Title Epithelial TRAF6 Drives IL-17-Mediated Psoriatic
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
Data Sheet Huil36g (152 A.A.)
Growth Factor Data Sheet GoldBio growth factors are manufactured for RESEARCH USE ONLY and cannot be sold for human consumption! Interleukin-36G (IL36G) is a pro-inflammatory cytokine that plays an important role in the pathophysiology of several diseases. IL36A, IL36B and IL36G (formerly IL1F6, IL1F8, and IL1F9) are IL1 family members that signal through the IL1 receptor family members IL1Rrp2 (IL1RL2) and IL1RAcP. IL36G is secreted when transfected into 293-T cells and could constitute part of an independent signaling system analogous to that of IL1A and IL1B receptor agonist and interleukin-1 receptor type I (IL1R1). Furthermore, IL36G also can function as an agonist of NFκB activation through the orphan IL1- receptor-related protein 2. Human IL36G (152 a.a.) shares 58%, 59%, 68% and 69% amino acid sequence identity with mouse, rat, bovine and equine IL36G, respectively, and 23-57% amino acid sequence identity with other family members. Catalog Number 1110-36F Product Name IL36G (IL-36 gamma), Human (152 a.a.) Recombinant Human Interleukin-36γ IL36G, IL36γ Interleukin 1 Homolog 1 (IL1H1) Interleukin 1-Related Protein 2 (IL1RP2) Interleukin 1 Family, Member 9 (IL1F9) Source Escherichia coli MW ~17.0 kDa (152 amino acids) Sequence SMCKPITGTI NDLNQQVWTL QGQNLVAVPR SDSVTPVTVA VITCKYPEAL EQGRGDPIYL GIQNPEMCLY CEKVGEQPTL QLKEQKIMDL YGQPEPVKPF LFYRAKTGRT STLESVAFPD WFIASSKRDQ PIILTSELGK SYNTAFELNI ND Accession Number Q9NZH8 Purity >95% by SDS-PAGE and HPLC analyses Biological Activity Fully biologically active when compared to standard. The ED50 as determined by its ability to induce IL-8 secretion by human preadipocytes is less than 10 ng/ml, corresponding to a specific activity of >1 × 105 IU/mg. -
Dog Coat Colour Genetics: a Review Date Published Online: 31/08/2020; 1,2 1 1 3 Rashid Saif *, Ali Iftekhar , Fatima Asif , Mohammad Suliman Alghanem
www.als-journal.com/ ISSN 2310-5380/ August 2020 Review Article Advancements in Life Sciences – International Quarterly Journal of Biological Sciences ARTICLE INFO Open Access Date Received: 02/05/2020; Date Revised: 20/08/2020; Dog Coat Colour Genetics: A Review Date Published Online: 31/08/2020; 1,2 1 1 3 Rashid Saif *, Ali Iftekhar , Fatima Asif , Mohammad Suliman Alghanem Authors’ Affiliation: 1. Institute of Abstract Biotechnology, Gulab Devi Educational anis lupus familiaris is one of the most beloved pet species with hundreds of world-wide recognized Complex, Lahore - Pakistan breeds, which can be differentiated from each other by specific morphological, behavioral and adoptive 2. Decode Genomics, traits. Morphological characteristics of dog breeds get more attention which can be defined mostly by 323-D, Town II, coat color and its texture, and considered to be incredibly lucrative traits in this valued species. Although Punjab University C Employees Housing the genetic foundation of coat color has been well stated in the literature, but still very little is known about the Scheme, Lahore - growth pattern, hair length and curly coat trait genes. Skin pigmentation is determined by eumelanin and Pakistan 3. Department of pheomelanin switching phenomenon which is under the control of Melanocortin 1 Receptor and Agouti Signaling Biology, Tabuk Protein genes. Genetic variations in the genes involved in pigmentation pathway provide basic understanding of University - Kingdom melanocortin physiology and evolutionary adaptation of this trait. So in this review, we highlighted, gathered and of Saudi Arabia comprehend the genetic mutations, associated and likely to be associated variants in the genes involved in the coat color and texture trait along with their phenotypes. -
Universidade Estadual De Campinas Instituto De Biologia
UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA VERÔNICA APARECIDA MONTEIRO SAIA CEREDA O PROTEOMA DO CORPO CALOSO DA ESQUIZOFRENIA THE PROTEOME OF THE CORPUS CALLOSUM IN SCHIZOPHRENIA CAMPINAS 2016 1 VERÔNICA APARECIDA MONTEIRO SAIA CEREDA O PROTEOMA DO CORPO CALOSO DA ESQUIZOFRENIA THE PROTEOME OF THE CORPUS CALLOSUM IN SCHIZOPHRENIA Dissertação apresentada ao Instituto de Biologia da Universidade Estadual de Campinas como parte dos requisitos exigidos para a obtenção do Título de Mestra em Biologia Funcional e Molecular na área de concentração de Bioquímica. Dissertation presented to the Institute of Biology of the University of Campinas in partial fulfillment of the requirements for the degree of Master in Functional and Molecular Biology, in the area of Biochemistry. ESTE ARQUIVO DIGITAL CORRESPONDE À VERSÃO FINAL DA DISSERTAÇÃO DEFENDIDA PELA ALUNA VERÔNICA APARECIDA MONTEIRO SAIA CEREDA E ORIENTADA PELO DANIEL MARTINS-DE-SOUZA. Orientador: Daniel Martins-de-Souza CAMPINAS 2016 2 Agência(s) de fomento e nº(s) de processo(s): CNPq, 151787/2F2014-0 Ficha catalográfica Universidade Estadual de Campinas Biblioteca do Instituto de Biologia Mara Janaina de Oliveira - CRB 8/6972 Saia-Cereda, Verônica Aparecida Monteiro, 1988- Sa21p O proteoma do corpo caloso da esquizofrenia / Verônica Aparecida Monteiro Saia Cereda. – Campinas, SP : [s.n.], 2016. Orientador: Daniel Martins de Souza. Dissertação (mestrado) – Universidade Estadual de Campinas, Instituto de Biologia. 1. Esquizofrenia. 2. Espectrometria de massas. 3. Corpo caloso. -
From IL-15 to IL-33: the Never-Ending List of New Players in Inflammation
From IL-15 to IL-33: the never-ending list of new players in inflammation. Is it time to forget the humble Aspirin and move ahead? Fulvio d’Acquisto, Francesco Maione, Magali Pederzoli-Ribeil To cite this version: Fulvio d’Acquisto, Francesco Maione, Magali Pederzoli-Ribeil. From IL-15 to IL-33: the never-ending list of new players in inflammation. Is it time to forget the humble Aspirin and move ahead?. Bio- chemical Pharmacology, Elsevier, 2009, 79 (4), pp.525. 10.1016/j.bcp.2009.09.015. hal-00544816 HAL Id: hal-00544816 https://hal.archives-ouvertes.fr/hal-00544816 Submitted on 9 Dec 2010 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Accepted Manuscript Title: From IL-15 to IL-33: the never-ending list of new players in inflammation. Is it time to forget the humble Aspirin and move ahead? Authors: Fulvio D’Acquisto, Francesco Maione, Magali Pederzoli-Ribeil PII: S0006-2952(09)00769-2 DOI: doi:10.1016/j.bcp.2009.09.015 Reference: BCP 10329 To appear in: BCP Received date: 30-7-2009 Revised date: 9-9-2009 Accepted date: 10-9-2009 Please cite this article as: D’Acquisto F, Maione F, Pederzoli-Ribeil M, From IL- 15 to IL-33: the never-ending list of new players in inflammation. -
Huil36g 169 Data Sheet
Growth Factor Data Sheet GoldBio growth factors are manufactured for RESEARCH USE ONLY and cannot be sold for human consumption! Interleukin-36G (IL36G) is a pro-inflammatory cytokine that plays an important role in the pathophysiology of several diseases. IL36A, IL36B and IL36G; (formerly IL1F6, IL1F8, and IL1F9) are IL1 family members that signal through the IL1 receptor family members IL1Rrp2 (IL1RL2) and IL1RAcP. IL36B is secreted when transfected into 293-T cells and could constitute part of an independent signaling system analogous to that of IL1A and IL1B receptor agonist and interleukin-1 receptor type I (IL1R1). Furthermore, IL36G also can function as an agonist of NFκB activation through the orphan IL1- receptor-related protein 2. Recombinant human IL36G is synthesized as a protein that contains no signal sequence, no prosegment and no potential N-linked glycosylation site.There is a 53% amino acid homology between human and mouse IL36G. IL36G also has a 25-55% amino acid homology with IL36G and IL1RN, IL1B, IL36RN, IL36A, IL37, IL36B and IL1F10. Catalog Number 1110-36E Product Name IL36G (IL-36 gamma), Human (169 a.a.) Recombinant Human Interleukin-36γ IL36G, IL36γ Interleukin 1 Homolog 1 (IL1H1) Interleukin 1-Related Protein 2 (IL1RP2) Interleukin 1 Family, Member 9 (IL1F9) Source Escherichia coli MW 18.7 kDa (169 amino acids) Sequence MRGTPGDADG GGRAVYQSMC KPITGTINDL NQQVWTLQGQ NLVAVPRSDS VTPVTVAVIT CKYPEALEQG RGDPIYLGIQ NPEMCLYCEK VGEQPTLQLK EQKIMDLYGQ PEPVKPFLFY RAKTGRTSTL ESVAFPDWFI ASSKRDQPII LTSELGKSYN TAFELNIND Accession Number Q9NZH8 Purity >95% by SDS-PAGE and HPLC analyses Biological Activity Fully biologically active when compared to standard. The specific activity is determined by its binding ability in a functional ELISA. -
The IL-1-Like Cytokine IL-33 Is Inactivated After Maturation by Caspase-1
The IL-1-like cytokine IL-33 is inactivated after maturation by caspase-1 Corinne Cayrola,b and Jean-Philippe Girarda,b,1 aCentre National de la Recherche Scientifique, Institut de Pharmacologie et de Biologie Structurale, F-31077 Toulouse, France; and bUniversite´de Toulouse, Universite´Paul Sabatier, Institut de Pharmacologie et de Biologie Structurale, F-31077 Toulouse, France Edited by Charles A. Dinarello, University of Colorado Health Sciences Center, Denver, CO, and approved April 10, 2009 (received for review December 13, 2008) IL-33 is a chromatin-associated cytokine of the IL-1 family that has that nuclear IL-33 possesses transcriptional regulatory proper- recently been linked to many diseases, including asthma, rheuma- ties and associates with chromatin in vivo (5). Recently, we found toid arthritis, atherosclerosis, and cardiovascular diseases. IL-33 that IL-33 mimics Kaposi sarcoma herpesvirus for attachment to signals through the IL-1 receptor-related protein ST2 and drives chromatin, and docks, through a short chromatin-binding pep- production of pro-inflammatory and T helper type 2-associated tide, into the acidic pocket formed by the histone H2A-H2B cytokines in mast cells, T helper type 2 lymphocytes, basophils, dimer at the surface of the nucleosome (22). Together, our eosinophils, invariant natural killer T cells, and natural killer cells. findings suggested IL-33 is a dual-function protein that may play It is currently believed that IL-33, like IL-1 and IL-18, requires important roles as both a cytokine and an intracellular nuclear processing by caspase-1 to a mature form (IL-33112–270) for biolog- factor (5, 22). -
Genetic Determinants of Circulating Interleukin-1 Receptor Antagonist Levels and Their Association with Glycemic Traits
View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Trepo - Institutional Repository of Tampere University GENETIC DETERMINANTS OF CIRCULATING INTERLEUKIN-1 RECEPTOR ANTAGONIST LEVELS AND THEIR ASSOCIATION WITH GLYCEMIC TRAITS Marja-Liisa Nuotio Syventävien opintojen kirjallinen työ Tampereen yliopisto Lääketieteen yksikkö Tammikuu 2015 Tampereen yliopisto Lääketieteen yksikkö NUOTIO MARJA-LIISA: GENETIC DETERMINANTS OF CIRCULATING INTERLEUKIN-1 RECEPTOR ANTAGONIST LEVELS AND THEIR ASSOCIATION WITH GLYCEMIC TRAITS Kirjallinen työ, 57 s. Ohjaaja: professori Mika Kähönen Tammikuu 2015 Avainsanat: sytokiinit, insuliiniresistenssi, tyypin 2 diabetes, tulehdus, glukoosimetabolia, genominlaajuinen assosiaatioanalyysi (GWAS) Tulehdusta välittäviin sytokiineihin kuuluvan interleukiini 1β (IL-1β):n kohonneen systeemisen pitoisuuden on arveltu edesauttavan insuliiniresistenssin kehittymistä ja johtavan haiman β-solujen toimintahäiriöihin. IL-1β:n sisäsyntyisellä vastavaikuttajalla, interleukiini 1 reseptoriantagonistilla (IL-1RA), on puolestaan esitetty olevan suojaava rooli mainittujen fenotyyppien kehittymisessä päinvastaisten vaikutustensa ansiosta. IL-1RA:n suojaavan roolin havainnollistamiseksi työssä Genetic determinants of circulating interleukin-1 receptor antagonist levels and their association with glycemic traits tunnistettiin veren IL-1RA- pitoisuuteen assosioituvia geneettisiä variantteja, minkä jälkeen selvitettiin näiden yhteyttä glukoosi- ja insuliinimetaboliaan liittyvien muuttujien-, sekä -
Interleukin-33 Signaling Exacerbates Experimental Infectious Colitis by Enhancing Gut Permeability and Inhibiting Protective Th17 Immunity
www.nature.com/mi ARTICLE OPEN Interleukin-33 signaling exacerbates experimental infectious colitis by enhancing gut permeability and inhibiting protective Th17 immunity Vittoria Palmieri1, Jana-Fabienne Ebel1, Nhi Ngo Thi Phuong1, Robert Klopfleisch2, Vivian Pham Vu3,4, Alexandra Adamczyk1, Julia Zöller1, Christian Riedel5, Jan Buer1, Philippe Krebs3, Wiebke Hansen1, Eva Pastille1 and Astrid M. Westendorf 1 A wide range of microbial pathogens is capable of entering the gastrointestinal tract, causing infectious diarrhea and colitis. A finely tuned balance between different cytokines is necessary to eradicate the microbial threat and to avoid infection complications. The current study identified IL-33 as a critical regulator of the immune response to the enteric pathogen Citrobacter rodentium.We observed that deficiency of the IL-33 signaling pathway attenuates bacterial-induced colitis. Conversely, boosting this pathway strongly aggravates the inflammatory response and makes the mice prone to systemic infection. Mechanistically, IL-33 mediates its detrimental effect by enhancing gut permeability and by limiting the induction of protective T helper 17 cells at the site of infection, thus impairing host defense mechanisms against the enteric pathogen. Importantly, IL-33-treated infected mice supplemented with IL-17A are able to resist the otherwise strong systemic spreading of the pathogen. These findings reveal a novel IL-33/IL-17A crosstalk that controls the pathogenesis of Citrobacter rodentium-driven infectious colitis. Manipulating the dynamics of cytokines may offer new therapeutic strategies to treat specific intestinal infections. 1234567890();,: Mucosal Immunology (2021) 14:923–936; https://doi.org/10.1038/s41385-021-00386-7 INTRODUCTION epithelial cells, and endothelial cells in response to injury6. -
Cellular and Molecular Signatures in the Disease Tissue of Early
Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of -
Role of Active Contraction and Tropomodulins in Regulating Actin Filament Length and Sarcomere Structure in Developing Zebrafish Skeletal Muscle
ORIGINAL RESEARCH published: 31 March 2016 doi: 10.3389/fphys.2016.00091 Role of Active Contraction and Tropomodulins in Regulating Actin Filament Length and Sarcomere Structure in Developing Zebrafish Skeletal Muscle Lise Mazelet 1, Matthew O. Parker 2, Mei Li 3, Anders Arner 3 and Rachel Ashworth 4* 1 School of Biological and Chemical Sciences, Queen Mary, University of London, London, UK, 2 School of Health Sciences and Social Work, University of Portsmouth, Portsmouth, UK, 3 Department of Physiology and Pharmacology, Karolinska Institutet, Stockholm, Sweden, 4 The Blizard Institute/Institute of Health Sciences Education, Barts and The London School of Medicine and Dentistry, London, UK Whilst it is recognized that contraction plays an important part in maintaining the structure and function of mature skeletal muscle, its role during development remains undefined. In this study the role of movement in skeletal muscle maturation was investigated in intact zebrafish embryos using a combination of genetic and pharmacological approaches. An immotile mutant line (cacnb1ts25) which lacks functional voltage-gated calcium channels (dihydropyridine receptors) in the muscle and pharmacological immobilization of embryos Edited by: with a reversible anesthetic (Tricaine), allowed the study of paralysis (in mutants and Catherine Coirault, anesthetized fish) and recovery of movement (reversal of anesthetic treatment). The Institut National de la Santé et de la Recherche Médicale, France effect of paralysis in early embryos (aged between 17 and 24 hours post-fertilization, hpf) Reviewed by: on skeletal muscle structure at both myofibrillar and myofilament level was determined Corrado Poggesi, using both immunostaining with confocal microscopy and small angle X-ray diffraction. -
IL-1Β Induces the Rapid Secretion of the Antimicrobial Protein IL-26 From
Published June 24, 2019, doi:10.4049/jimmunol.1900318 The Journal of Immunology IL-1b Induces the Rapid Secretion of the Antimicrobial Protein IL-26 from Th17 Cells David I. Weiss,*,† Feiyang Ma,†,‡ Alexander A. Merleev,x Emanual Maverakis,x Michel Gilliet,{ Samuel J. Balin,* Bryan D. Bryson,‖ Maria Teresa Ochoa,# Matteo Pellegrini,*,‡ Barry R. Bloom,** and Robert L. Modlin*,†† Th17 cells play a critical role in the adaptive immune response against extracellular bacteria, and the possible mechanisms by which they can protect against infection are of particular interest. In this study, we describe, to our knowledge, a novel IL-1b dependent pathway for secretion of the antimicrobial peptide IL-26 from human Th17 cells that is independent of and more rapid than classical TCR activation. We find that IL-26 is secreted 3 hours after treating PBMCs with Mycobacterium leprae as compared with 48 hours for IFN-g and IL-17A. IL-1b was required for microbial ligand induction of IL-26 and was sufficient to stimulate IL-26 release from Th17 cells. Only IL-1RI+ Th17 cells responded to IL-1b, inducing an NF-kB–regulated transcriptome. Finally, supernatants from IL-1b–treated memory T cells killed Escherichia coli in an IL-26–dependent manner. These results identify a mechanism by which human IL-1RI+ “antimicrobial Th17 cells” can be rapidly activated by IL-1b as part of the innate immune response to produce IL-26 to kill extracellular bacteria. The Journal of Immunology, 2019, 203: 000–000. cells are crucial for effective host defense against a wide and neutrophils.