DOCSLIB.ORG

Transcriptomic Analysis of Cortical Versus Cancellous Bone in Response to Mechanical Loading and Estrogen Signaling

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

TRANSCRIPTOMIC ANALYSIS OF CORTICAL VERSUS CANCELLOUS BONE IN RESPONSE TO MECHANICAL LOADING AND ESTROGEN SIGNALING A Dissertation Presented to the Faculty of the Graduate School of Cornell University In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy by Natalie H Kelly January 2017 © 2017 Natalie H Kelly TRANSCRIPTOMIC ANALYSIS OF CORTICAL VERSUS CANCELLOUS BONE IN RESPONSE TO MECHANICAL LOADING AND ESTROGEN SIGNALING Natalie H Kelly, Ph. D. Cornell University 2017 Osteoporosis is a skeletal disease characterized by low bone mass that often results in fracture. Mechanical loading of the skeleton is a promising approach to maintain or recover bone mass. Mouse models of in vivo loading differentially increase bone mass in cortical and cancellous sites. The molecular mechanisms behind this anabolic response to mechanical loading need to be determined and compared between cortical and cancellous bone. This knowledge could enhance the development of drug therapies to increase bone formation in osteoporotic patients. After developing a method to isolate high-quality RNA from marrow- free mouse cortical and cancellous bone, differences in gene transcription were determined at baseline and at two time points following mechanical loading of wild-type mice. Cortical and cancellous bone exhibited different transcriptional profiles at baseline and in response to mechanical loading. Enhanced Wnt signaling dominated the response in cortical bone at both time points, but in cancellous bone only at the early time point. In cancellous bone at the later time point, many muscle-related genes were downregulated. Decreased bioavailable estrogen levels are a major cause of bone loss in postmenopausal women. Estrogen signaling through estrogen receptor alpha (ERa) has been found to be particularly important in regulating bone mass and the skeletal response to mechanical loading. We recently showed that mice lacking ERa in osteoblasts and osteocytes (pOC-ERaKO) had an increased adaptive response to mechanical loading, particularly in cancellous bone. The molecular mechanisms of functional adaptation to load in the context of decreased estrogen signaling are not fully elucidated, particularly in cortical versus cancellous sites. We examined transcription in cortical versus cancellous bone of tibiae from littermate control (LC) and pOC- ERaKO mice. pOC-ERaKO mice had a blunted transcriptional response to mechanical loading in cortical bone compared to littermate controls, but had an increased response in cancellous bone. This work demonstrates the importance of examining cortical and cancellous bone separately, and that next-generation sequencing is a powerful tool for discovering the complete transcriptional mechanisms responsible for mechanical loading-related bone anabolism. BIOGRAPHICAL SKETCH Natalie Hillhouse Kelly was born in Wadsworth, Illinois in 1983. She graduated from Zion Benton Township High School and attended Case Western Reserve University. In 2006 she completed her Bachelor of Science degree in Biomedical Engineering with a concentration in orthopaedic biomaterials, including a one-year cooperative education experience at DePuy Orthopaedics. While at CWRU, she was captain of the Fighting Gobies ultimate frisbee team for 4 years and competed regionally. Upon graduation, Natalie published 13 peer-reviewed journal articles as a research engineer at the Hospital for Special Surgery in the Department of Biomechanics. In 2010, she entered the Biomedical Engineering PhD program at Cornell University, earning her Master of Science in 2014. While in graduate school, Natalie began running competitively, qualified for the Boston marathon twice, and completed a total of four marathons. In August 2016, she received her Doctorate of Philosophy degree in Biomedical Engineering. While at Cornell, Natalie received a prestigious three-year NSF Graduate Research Fellowship and the Robert and Helen Appel Fellowship in Biomedical Engineering. She was also honored with the Harold M. Frost Young Investigator award from the American Society of Bone and Mineral Research. She served on the New Investigators Mentoring Committee and the Annual Meeting Committee of the Orthopaedic Research Society. v I dedicate this work to Bome and G’ampa Kelly vi ACKNOWLEDGMENTS I am extremely grateful to all of the individuals who assisted me both professionally and personally on my PhD journey. I want to thank my committee chair, Dr. Marjolein van der Meulen for her guidance throughout my career and her mentorship. My committee members Dr. John Schimenti and Dr. Jan Lammerding provided advice and encouragement. Furthermore, Dr. Schimenti graciously allowed me to conduct most of my research in his laboratory. Dr. F. Patrick Ross was practically my fourth committee member and was instrumental to the design and interpretation of this work. Many fellow scientists and colleagues provided technical advice and personal support. I would like to thank my undergraduate mentor Dr. Clare Rimnac for encouraging me to apply to the Hospital for Special Surgery, and to Dr. Timothy Wright for hiring me and inspiring me to pursue a PhD. I would also like to thank all of the members of the van der Meulen lab, past and present. In particular, Drs. Maureen Lynch, Katie Melville and Frank Ko taught me many technical skills and provided advice in the early years of graduate school. Thank you to Funmi Adebayo for being my main sounding board and allowing me to vent on our near weekly coffee dates. Dr. Adrian McNairn taught me molecular biology, and fed me cookies along the way. Many thanks to Judy Thoroughman, Marcia Sawyer, and Belinda Floyd for all of their administrative support. I am grateful for my classmates and friends who always offered a supportive ear, especially the POB crew: Drs. Liz Wayne, Sara Che, Young Hye Song, Karin Wang, and Stephanie Lindsey, and John Foo and Fredrik Thege. vii Several core facilities at Cornell University provided extensive assistance in my experiments. The Biotechnology Resource Center provided technical expertise, sequencing, and computational resources. Dr. Peter Schweitzer, and Jennifer Mosher assisted in experimental design, taught me technical skills, and performed sequencing. Dr. Jen Grenier of the RNA sequencing core provided invaluable technical expertise on RNA isolation. Dr. Qi Sun assisted me with bioinformatics techniques to analyze my data. I would like to thank the dedicated staff of the Cornell Center for Animal Resources and Education who make our animal work possible. My time in Ithaca would not have been the same without my running and polo communities. I appreciate the many miles covered with my Wednesday morning ladies, particularly Melissa Weiner, Lesley Middleton, Katie Stettler, and Ellie Pell. I am grateful to Cornell University polo for teaching me the sport of kings, and to the entire Wednesday night polo group. My family and loved ones shared in my triumphs and setbacks equally and were unwavering in their support. My sister, Dr. Felice Kelly, is not only my best friend and confidant, she is also an incredible scientist who contributed to my research. Finally, I owe everything to my parents Jack and Kathleen Kelly. They raised me with a curiosity of the world around me and the belief that anything is achievable if you’re willing to work for it. Funding for this work was provided by the National Institutes of Health grants R01-AG028664 and R21-AR064034. I was honored to receive a three-year Graduate Research Fellowship from the National Science Foundation, and the Robert and Helen Appel Fellowship in Biomedical Engineering from the Hospital for Special Surgery and Cornell University. viii TABLE OF CONTENTS Biographical Sketch .................................................................................................. v Dedication ................................................................................................................. vi Acknowledgments ................................................................................................... vii Table of Contents .................................................................................................... ix List of Figures .......................................................................................................... xii List of Tables .......................................................................................................... xiv Chapter 1: Introduction...........................................................................1 1.1 Cortical and Cancellous Bone ............................................................... 1 1.2 Osteoporosis ............................................................................................ 4 1.3 Bone Mechanosensitivity ....................................................................... 7 1.4 Signaling in Bone Response to Mechanical Loading ......................... 9 1.5 Differential Gene Expression Following in vivo Mechanical Loading .................................................................................................. 21 1.6 Aims ........................................................................................................ 25 1.7 References .............................................................................................. 29 Chapter 2: A Method For Isolating High Quality RNA From Mouse Cortical and Cancellous Bone ............................................................. 41 2.1 Introduction ..........................................................................................
Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
  • Pathogen Receptor Discovery with a Microfluidic Human Membrane Protein Array

    Pathogen Receptor Discovery with a Microfluidic Human Membrane Protein Array

    Pathogen receptor discovery with a microfluidic human membrane protein array Yair Glicka,1,Ya’ara Ben-Aria,1, Nir Draymanb, Michal Pellacha, Gregory Neveuc,d, Jim Boonyaratanakornkitc,d, Dorit Avrahamia, Shirit Einavc,d, Ariella Oppenheimb, and Doron Gerbera,2 aMina and Everard Goodman Faculty of Life Sciences, Bar Ilan University, 5290002, Israel; bFaculty of Medicine, Hebrew University, Jerusalem, 9112001, Israel; cDepartment of Medicine, Division of Infectious Diseases and Geographic Medicine, Stanford University School of Medicine, Stanford, CA 94305; and dDepartment of Microbiology and Immunology, Stanford University School of Medicine, Stanford, CA 94305 Edited by Stephen R. Quake, Stanford University, Stanford, CA, and approved March 1, 2016 (received for review September 20, 2015) The discovery of how a pathogen invades a cell requires one to and translate into proteins in situ (10, 11). This approach has determine which host cell receptors are exploited. This determina- enabled the study of the Pseudomonas aeruginosa outer mem- tion is a challenging problem because the receptor is invariably a brane protein for immunity (12). membrane protein, which represents an Achilles heel in proteomics. Combining integrated microfluidics with microarrays and We have developed a universal platform for high-throughput ex- in vitro transcription and translation (TNT) systems may over- – pression and interaction studies of membrane proteins by creating a come all of the above mentioned difficulties (Fig. 1A) (13 16). microfluidic-based comprehensive human membrane protein array The integrated microfluidic device allows smart liquid manage- (MPA). The MPA is, to our knowledge, the first of its kind and offers ment in very low volumes, partitioning, and process integration a powerful alternative to conventional proteomics by enabling the (i.e., protein expression, immobilization, and interaction exper- simultaneous study of 2,100 membrane proteins.
  • MDR-1, Bcl-Xl, H. Pylori, and Wnt&Sol;Β-Catenin Signalling in the Adult Stomach

    MDR-1, Bcl-Xl, H. Pylori, and Wnt&Sol;Β-Catenin Signalling in the Adult Stomach

    Laboratory Investigation (2012) 92, 1670–1673 & 2012 USCAP, Inc All rights reserved 0023-6837/12 $32.00 EDITORIAL MDR-1, Bcl-xL, H. pylori, and Wnt/b-catenin signalling in the adult stomach: how much is too much? R John MacLeod Laboratory Investigation (2012) 92, 1670–1673; doi:10.1038/labinvest.2012.151 ultiple drug resistance (MDR) is a interaction between the antiapoptotic protein major cause of failure of che- Bcl-xL and MDR-1. Knockdown of MDR-1 motherapy in cancer treatment. increases the apoptotic index of these cells exposed The membrane transporter P-gly- to oxidative stress consistent with a role for MDR- coprotein (MDR-1, Pgp) encoded 1 in apoptosis. Several questions emerge from Mby the adenosine triphosphate-binding cassette, these findings. The first is why is MDR-1 increased subfamily B, member 1 is the main mechanism for in some HP-positive mucosa but in 100% of the decreased intracellular drug accumulation in MDR intestinal metaplasia samples? A likely causative cancer.1 Increases in Mdr-1 expression prevent effector of the increase in MDR-1 is the activation tumor cells from a variety of induced apoptosis, of canonical or Wnt/b-catenin signaling. It has but how this occurs is poorly understood. It is been known for a dozen years that the MDR-1 essential to understand how this occurs to be able gene may be stimulated by Tcf4.4 Yamada et al4 to design effective therapeutic interventions. The clearly demonstrated the presence of Tcf4 sites on study by Rocco et al2 (this issue) clearly shows that the MDR-1 promoter and showed that MDR-1 in the mitochondria of gastric cancer cell lines protein had substantially increased in adenomas MDR1 physically interacts with Bcl-xL, a well- and colon cancer.
  • Supplemental Figure 1. Vimentin

    Supplemental Figure 1. Vimentin

    Double mutant specific genes Transcript gene_assignment Gene Symbol RefSeq FDR Fold- FDR Fold- FDR Fold- ID (single vs. Change (double Change (double Change wt) (single vs. wt) (double vs. single) (double vs. wt) vs. wt) vs. single) 10485013 BC085239 // 1110051M20Rik // RIKEN cDNA 1110051M20 gene // 2 E1 // 228356 /// NM 1110051M20Ri BC085239 0.164013 -1.38517 0.0345128 -2.24228 0.154535 -1.61877 k 10358717 NM_197990 // 1700025G04Rik // RIKEN cDNA 1700025G04 gene // 1 G2 // 69399 /// BC 1700025G04Rik NM_197990 0.142593 -1.37878 0.0212926 -3.13385 0.093068 -2.27291 10358713 NM_197990 // 1700025G04Rik // RIKEN cDNA 1700025G04 gene // 1 G2 // 69399 1700025G04Rik NM_197990 0.0655213 -1.71563 0.0222468 -2.32498 0.166843 -1.35517 10481312 NM_027283 // 1700026L06Rik // RIKEN cDNA 1700026L06 gene // 2 A3 // 69987 /// EN 1700026L06Rik NM_027283 0.0503754 -1.46385 0.0140999 -2.19537 0.0825609 -1.49972 10351465 BC150846 // 1700084C01Rik // RIKEN cDNA 1700084C01 gene // 1 H3 // 78465 /// NM_ 1700084C01Rik BC150846 0.107391 -1.5916 0.0385418 -2.05801 0.295457 -1.29305 10569654 AK007416 // 1810010D01Rik // RIKEN cDNA 1810010D01 gene // 7 F5 // 381935 /// XR 1810010D01Rik AK007416 0.145576 1.69432 0.0476957 2.51662 0.288571 1.48533 10508883 NM_001083916 // 1810019J16Rik // RIKEN cDNA 1810019J16 gene // 4 D2.3 // 69073 / 1810019J16Rik NM_001083916 0.0533206 1.57139 0.0145433 2.56417 0.0836674 1.63179 10585282 ENSMUST00000050829 // 2010007H06Rik // RIKEN cDNA 2010007H06 gene // --- // 6984 2010007H06Rik ENSMUST00000050829 0.129914 -1.71998 0.0434862 -2.51672
  • Propranolol-Mediated Attenuation of MMP-9 Excretion in Infants with Hemangiomas

    Propranolol-Mediated Attenuation of MMP-9 Excretion in Infants with Hemangiomas

    Supplementary Online Content Thaivalappil S, Bauman N, Saieg A, Movius E, Brown KJ, Preciado D. Propranolol-mediated attenuation of MMP-9 excretion in infants with hemangiomas. JAMA Otolaryngol Head Neck Surg. doi:10.1001/jamaoto.2013.4773 eTable. List of All of the Proteins Identified by Proteomics This supplementary material has been provided by the authors to give readers additional information about their work. © 2013 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 eTable. List of All of the Proteins Identified by Proteomics Protein Name Prop 12 mo/4 Pred 12 mo/4 Δ Prop to Pred mo mo Myeloperoxidase OS=Homo sapiens GN=MPO 26.00 143.00 ‐117.00 Lactotransferrin OS=Homo sapiens GN=LTF 114.00 205.50 ‐91.50 Matrix metalloproteinase‐9 OS=Homo sapiens GN=MMP9 5.00 36.00 ‐31.00 Neutrophil elastase OS=Homo sapiens GN=ELANE 24.00 48.00 ‐24.00 Bleomycin hydrolase OS=Homo sapiens GN=BLMH 3.00 25.00 ‐22.00 CAP7_HUMAN Azurocidin OS=Homo sapiens GN=AZU1 PE=1 SV=3 4.00 26.00 ‐22.00 S10A8_HUMAN Protein S100‐A8 OS=Homo sapiens GN=S100A8 PE=1 14.67 30.50 ‐15.83 SV=1 IL1F9_HUMAN Interleukin‐1 family member 9 OS=Homo sapiens 1.00 15.00 ‐14.00 GN=IL1F9 PE=1 SV=1 MUC5B_HUMAN Mucin‐5B OS=Homo sapiens GN=MUC5B PE=1 SV=3 2.00 14.00 ‐12.00 MUC4_HUMAN Mucin‐4 OS=Homo sapiens GN=MUC4 PE=1 SV=3 1.00 12.00 ‐11.00 HRG_HUMAN Histidine‐rich glycoprotein OS=Homo sapiens GN=HRG 1.00 12.00 ‐11.00 PE=1 SV=1 TKT_HUMAN Transketolase OS=Homo sapiens GN=TKT PE=1 SV=3 17.00 28.00 ‐11.00 CATG_HUMAN Cathepsin G OS=Homo
  • Table S1 the Four Gene Sets Derived from Gene Expression Profiles of Escs and Differentiated Cells

    Table S1 the Four Gene Sets Derived from Gene Expression Profiles of Escs and Differentiated Cells

    Table S1 The four gene sets derived from gene expression profiles of ESCs and differentiated cells Uniform High Uniform Low ES Up ES Down EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol 269261 Rpl12 11354 Abpa 68239 Krt42 15132 Hbb-bh1 67891 Rpl4 11537 Cfd 26380 Esrrb 15126 Hba-x 55949 Eef1b2 11698 Ambn 73703 Dppa2 15111 Hand2 18148 Npm1 11730 Ang3 67374 Jam2 65255 Asb4 67427 Rps20 11731 Ang2 22702 Zfp42 17292 Mesp1 15481 Hspa8 11807 Apoa2 58865 Tdh 19737 Rgs5 100041686 LOC100041686 11814 Apoc3 26388 Ifi202b 225518 Prdm6 11983 Atpif1 11945 Atp4b 11614 Nr0b1 20378 Frzb 19241 Tmsb4x 12007 Azgp1 76815 Calcoco2 12767 Cxcr4 20116 Rps8 12044 Bcl2a1a 219132 D14Ertd668e 103889 Hoxb2 20103 Rps5 12047 Bcl2a1d 381411 Gm1967 17701 Msx1 14694 Gnb2l1 12049 Bcl2l10 20899 Stra8 23796 Aplnr 19941 Rpl26 12096 Bglap1 78625 1700061G19Rik 12627 Cfc1 12070 Ngfrap1 12097 Bglap2 21816 Tgm1 12622 Cer1 19989 Rpl7 12267 C3ar1 67405 Nts 21385 Tbx2 19896 Rpl10a 12279 C9 435337 EG435337 56720 Tdo2 20044 Rps14 12391 Cav3 545913 Zscan4d 16869 Lhx1 19175 Psmb6 12409 Cbr2 244448 Triml1 22253 Unc5c 22627 Ywhae 12477 Ctla4 69134 2200001I15Rik 14174 Fgf3 19951 Rpl32 12523 Cd84 66065 Hsd17b14 16542 Kdr 66152 1110020P15Rik 12524 Cd86 81879 Tcfcp2l1 15122 Hba-a1 66489 Rpl35 12640 Cga 17907 Mylpf 15414 Hoxb6 15519 Hsp90aa1 12642 Ch25h 26424 Nr5a2 210530 Leprel1 66483 Rpl36al 12655 Chi3l3 83560 Tex14 12338 Capn6 27370 Rps26 12796 Camp 17450 Morc1 20671 Sox17 66576 Uqcrh 12869 Cox8b 79455 Pdcl2 20613 Snai1 22154 Tubb5 12959 Cryba4 231821 Centa1 17897
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • Targeting the Tryptophan Hydroxylase 2 Gene for Functional Analysis in Mice and Serotonergic Differentiation of Embryonic Stem Cells

    Targeting the Tryptophan Hydroxylase 2 Gene for Functional Analysis in Mice and Serotonergic Differentiation of Embryonic Stem Cells

    TARGETING THE TRYPTOPHAN HYDROXYLASE 2 GENE FOR FUNCTIONAL ANALYSIS IN MICE AND SEROTONERGIC DIFFERENTIATION OF EMBRYONIC STEM CELLS Inaugural-Dissertation to obtain the academic degree Doctor rerum naturalium (Dr. rer. nat.) submitted to the Department of Biology, Chemistry and Pharmacy of Freie Universität Berlin by Dana Kikic, M.Sc. in Molecular biology and Physiology from Nis June, 2009 The doctorate studies were performed in the research group of Prof. Michael Bader Molecular Biology of Peptide Hormones at Max-Delbrück-Center for Molecular Medicine in Berlin, Buch Mai 2005 - September 2008. 1st Reviewer: Prof. Michael Bader 2nd Reviewer: Prof. Udo Heinemann date of defence: 13. August 2009 ACKNOWLEDGMENTS Herewith, I would like to acknowledge the persons who made this thesis possible and without whom my initiation in the world of basic science research would not have the spin it has now, neither would my scientific illiteracy get the chance to eradicate. I am expressing my very personal gratitude and recognition to: Prof. Michael Bader, for an inexhaustible guidance in all the matters arising during the course of scientific work, for an instinct in defining and following the intellectual challenge and for letting me following my own, for necessary financial support, for defining the borders of reasonable and unreasonable, for an invaluable time and patience, and an amazing efficiency in supporting, motivating, reading, correcting and shaping my scientific language during the last four years. Prof. Harald Saumweber and Prof. Udo Heinemann, for taking over the academic supervision of the thesis, and for breathing in it a life outside the laboratory walls and their personal signature.
  • Pin1 Inhibitors: Towards Understanding the Enzymatic

    Pin1 Inhibitors: Towards Understanding the Enzymatic

    Pin1 Inhibitors: Towards Understanding the Enzymatic Mechanism Guoyan Xu Dissertation submitted to the faculty of the Virginia Polytechnic Institute and State University In the partial fulfillment of the requirement for the degree of Doctor of Philosophy In Chemistry Felicia A Etzkorn, Chair David G. I. Kingston Neal Castagnoli Paul R. Carlier Brian E. Hanson May 6, 2010 Blacksburg, Virginia Keywords: Pin1, anti-cancer drug target, transition-state analogues, ketoamides, ketones, reduced amides, PPIase assay, inhibition Pin1 Inhibitors: Towards Understanding the Enzymatic Mechanism Guoyan Xu Abstract An important role of Pin1 is to catalyze the cis-trans isomerization of pSer/Thr- Pro bonds; as such, it plays an important role in many cellular events through the effects of conformational change on the function of its biological substrates, including Cdc25, c- Jun, and p53. The expression of Pin1 correlates with cyclin D1 levels, which contributes to cancer cell transformation. Overexpression of Pin1 promotes tumor growth, while its inhibition causes tumor cell apoptosis. Because Pin1 is overexpressed in many human cancer tissues, including breast, prostate, and lung cancer tissues, it plays an important role in oncogenesis, making its study vital for the development of anti-cancer agents. Many inhibitors have been discovered for Pin1, including 1) several classes of designed inhibitors such as alkene isosteres, non-peptidic, small molecular Pin1 inhibitors, and indanyl ketones, and 2) several natural products such as juglone, pepticinnamin E analogues, PiB and its derivatives obtained from a library screen. These Pin1 inhibitors show promise in the development of novel diagnostic and therapeutic anticancer drugs due to their ability to block cell cycle progression.
  • FAM210A Is a Novel Determinant of Bone and Muscle Structure And

    FAM210A Is a Novel Determinant of Bone and Muscle Structure And

    FAM210A is a novel determinant of bone and muscle PNAS PLUS structure and strength Ken-ichiro Tanakaa, Yingben Xuea, Loan Nguyen-Yamamotoa, John A. Morrisb,c,d, Ippei Kanazawae, Toshitsugu Sugimotoe, Simon S. Winga,f, J. Brent Richardsb,c,d, and David Goltzmana,f,1 aCalcium Research Laboratory, Metabolic Disorders and Complications Program, Research Institute of the McGill University Health Centre, Montreal, QC, Canada H4A 3J1; bDepartment of Medicine, McGill University, Montreal, QC, Canada H3T 1E2; cDepartment of Human Genetics, Jewish General Hospital, McGill University, Montreal, QC, Canada H3T 1E2; dDepartment of Epidemiology and Biostatistics, Jewish General Hospital, McGill University, Montreal, QC, Canada H3T 1E2; eInternal Medicine 1, Faculty of Medicine, Shimane University, 693-8501 Shimane, Japan; and fDivision of Endocrinology, Department of Medicine, McGill University, Montreal, QC, Canada H4A 3J1 Edited by John T. Potts, Massachusetts General Hospital, Charlestown, MA, and approved March 14, 2018 (received for review November 1, 2017) Osteoporosis and sarcopenia are common comorbid diseases, yet TOM1L2/SREBF1 locus were found to exert opposing effects on their shared mechanisms are largely unknown. We found that total body lean mass and total body less head BMD (13). SREBP- genetic variation near FAM210A was associated, through large 1, and the product of the SREBF1 gene, is known to exert op- genome-wide association studies, with fracture, bone mineral posing effects on osteoblast and myoblast differentiation (14, 15). density (BMD), and appendicular and whole body lean mass, in However, more commonly, bone loss coincides with a decrease in humans. In mice, Fam210a was expressed in muscle mitochondria muscle mass and function, suggesting that there are shared bio- and cytoplasm, as well as in heart and brain, but not in bone.
  • Anti-Inflammatory Role of Curcumin in LPS Treated A549 Cells at Global Proteome Level and on Mycobacterial Infection

    Anti-Inflammatory Role of Curcumin in LPS Treated A549 Cells at Global Proteome Level and on Mycobacterial Infection

    Anti-inflammatory Role of Curcumin in LPS Treated A549 cells at Global Proteome level and on Mycobacterial infection. Suchita Singh1,+, Rakesh Arya2,3,+, Rhishikesh R Bargaje1, Mrinal Kumar Das2,4, Subia Akram2, Hossain Md. Faruquee2,5, Rajendra Kumar Behera3, Ranjan Kumar Nanda2,*, Anurag Agrawal1 1Center of Excellence for Translational Research in Asthma and Lung Disease, CSIR- Institute of Genomics and Integrative Biology, New Delhi, 110025, India. 2Translational Health Group, International Centre for Genetic Engineering and Biotechnology, New Delhi, 110067, India. 3School of Life Sciences, Sambalpur University, Jyoti Vihar, Sambalpur, Orissa, 768019, India. 4Department of Respiratory Sciences, #211, Maurice Shock Building, University of Leicester, LE1 9HN 5Department of Biotechnology and Genetic Engineering, Islamic University, Kushtia- 7003, Bangladesh. +Contributed equally for this work. S-1 70 G1 S 60 G2/M 50 40 30 % of cells 20 10 0 CURI LPSI LPSCUR Figure S1: Effect of curcumin and/or LPS treatment on A549 cell viability A549 cells were treated with curcumin (10 µM) and/or LPS or 1 µg/ml for the indicated times and after fixation were stained with propidium iodide and Annexin V-FITC. The DNA contents were determined by flow cytometry to calculate percentage of cells present in each phase of the cell cycle (G1, S and G2/M) using Flowing analysis software. S-2 Figure S2: Total proteins identified in all the three experiments and their distribution betwee curcumin and/or LPS treated conditions. The proteins showing differential expressions (log2 fold change≥2) in these experiments were presented in the venn diagram and certain number of proteins are common in all three experiments.
  • Role of Active Contraction and Tropomodulins in Regulating Actin Filament Length and Sarcomere Structure in Developing Zebrafish Skeletal Muscle

    Role of Active Contraction and Tropomodulins in Regulating Actin Filament Length and Sarcomere Structure in Developing Zebrafish Skeletal Muscle

    ORIGINAL RESEARCH published: 31 March 2016 doi: 10.3389/fphys.2016.00091 Role of Active Contraction and Tropomodulins in Regulating Actin Filament Length and Sarcomere Structure in Developing Zebrafish Skeletal Muscle Lise Mazelet 1, Matthew O. Parker 2, Mei Li 3, Anders Arner 3 and Rachel Ashworth 4* 1 School of Biological and Chemical Sciences, Queen Mary, University of London, London, UK, 2 School of Health Sciences and Social Work, University of Portsmouth, Portsmouth, UK, 3 Department of Physiology and Pharmacology, Karolinska Institutet, Stockholm, Sweden, 4 The Blizard Institute/Institute of Health Sciences Education, Barts and The London School of Medicine and Dentistry, London, UK Whilst it is recognized that contraction plays an important part in maintaining the structure and function of mature skeletal muscle, its role during development remains undefined. In this study the role of movement in skeletal muscle maturation was investigated in intact zebrafish embryos using a combination of genetic and pharmacological approaches. An immotile mutant line (cacnb1ts25) which lacks functional voltage-gated calcium channels (dihydropyridine receptors) in the muscle and pharmacological immobilization of embryos Edited by: with a reversible anesthetic (Tricaine), allowed the study of paralysis (in mutants and Catherine Coirault, anesthetized fish) and recovery of movement (reversal of anesthetic treatment). The Institut National de la Santé et de la Recherche Médicale, France effect of paralysis in early embryos (aged between 17 and 24 hours post-fertilization, hpf) Reviewed by: on skeletal muscle structure at both myofibrillar and myofilament level was determined Corrado Poggesi, using both immunostaining with confocal microscopy and small angle X-ray diffraction.