DOCSLIB.ORG

Continuously Active Transcriptional Programs Are Required to Build Expansive Serotonergic Axon Architectures

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Continuously Active Transcriptional Programs Are Required to Build Expansive Serotonergic Axon Architectures CONTINUOUSLY ACTIVE TRANSCRIPTIONAL PROGRAMS ARE REQUIRED TO BUILD EXPANSIVE SEROTONERGIC AXON ARCHITECTURES By LAUREN JANINE DONOVAN Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Dissertation Advisor: Evan S. Deneris Department of Neurosciences CASE WESTERN RESERVE UNIVERSITY January 2020 CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES We hereby approve the thesis/dissertation of Lauren Janine Donovan candidate for the degree of Doctor of Philosophy*. Committee Chair Jerry Silver, Ph.D. Committee Member Evan Deneris, Ph.D. Committee Member Heather Broihier, Ph.D. Committee Member Ron Conlon, Ph.D. Committee Member Pola Philippidou, Ph.D. Date of Defense August 29th, 2019 *We also certify that written approval has been obtained for any proprietary material contained therein. ii TABLE OF CONTENTS List of Figures……………………………………………………………………….….vii Abstract………………………………………….………………………………..….…1 CHAPTER 1. INTRODUCTION………………………………………………...……..3 GENERAL INTRODUCTION TO SEROTONIN………………………………….….4 Serotonin: Discovery and function………………………….……………...4 Serotonin Biosynthesis…………………………..…………………………..6 Manipulation of the serotonin system in humans……………………….6 Human mutations in 5-HT related genes………………………………….9 SEROTONIN NEURON NEUROGENESIS……………..………………………….11 5-HT neuron specification……………..………………………………...…11 Development of 5-HT neurons……………..………………………………13 NEUROANATOMY……………..……………………………………………………..13 Cytoarchitecture ……………..………………………………………………13 Adult Ascending 5-HT axon projection system ………………………..14 5-HT axon innervation patterns in the forebrain……………………14 Serotonergic axon tracing studies……………..…………………….16 Varicosities in ascending 5-HT axons……………………………….18 Adult Descending 5-HT axon projection system……………………….19 DEVELOPMENT OF SEROTONERGIC AXON PROJECTION SYSTEM……...20 Development of ascending projection system ………………………...20 Primary axon pathway formation…………………………………….21 Selective routing ………………………………………………………22 Terminal target arborization…………………………………………..24 iii Known molecules affecting 5-HT neuron ascending axon development…………………………………………………………………..26 Wnt planar cell polarity pathway……………………………………..26 Slit-Robo signaling…………………………………………………….28 EphrinA5………………………………………………………………..28 Gap43…………………………………………………………….….....29 STOP (Map6) ………………………………………………………….30 Pcdhac2………………………………………………………………...31 5-HT……………………………………………………………………..34 Development of descending projection system ……………………….37 PET-1…………………………………………………………………………………...38 Gene/protein expression……………………………………………………38 Protein structure………………………………………………………….…..39 Function………………………………………………………………………..39 LMX1B………………………………………………………………………………….40 Gene/protein structure………………………………………………………40 Lmx1b in peripheral tissues………………………………………………..41 Lmx1b in the CNS…………………………………………………………….42 Lmx1b in midbrain-hindbrain patterning…………………………….42 Lmx1b in midbrain Dopaminergic neurons………………………….43 Lmx1b in Noradrenergic neurons…………………………………….44 Lmx1b in Serotonergic neurons……………………………………...44 iv CHAPTER 2. PET-1 CONTROLS TETRAHYDROBIOPTERIN PATHWAY AND SLC22A3 TRANSPORTER GENES IN SEROTONIN NEURONS. Summary……………………………………………………………………………....60 Introduction…………………………………………………………………..……….61 Methods………………………………………………………………………………..65 Results and Discussion………………………………………………………….....68 CHAPTER 3. LMX1B IS REQUIRED AT MULTIPLE STAGES TO BUILD EXPANSIVE SEROTONERGIC AXON ARCHITECTURES Summary……………………………………………………………………………….90 Introduction……………………………………………………………………………91 Materials and Methods………………………………………………………………94 Results………………………………………………………………………………..104 Lmx1b controls formation of ascending 5-HT projection pathways…………….104 Lmx1b controls formation of descending 5-HT projection pathways…………...107 Delayed primary pathway formation and aborted selective pathway routing in Lmx1bcKO mice………………………………………………………………….......108 Lmx1b acts temporally to control 5-HT axon selective pathways…………..…..110 Lmx1b switches function to control terminal arborization...…………………......112 Targeting of 5-HT synthesis does not impair formation of forebrain and spinal cord 5-HT arbors………………………………………………………………..…....113 Lmx1b controlled axon-related transcriptomes…………………………………...114 An ascending-specific axonal Lmx1Pet1 regulatory cascade………………...117 Lmx1b acts through Pet1 to temporally control postnatal stage-specific gene expression and forebrain arborization……………………………………………...120 Discussion…………………………………………………………………………...123 v CHAPTER 4. DISCUSSION AND FUTURE DIRECTIONS Serotonergic Heterogeneity………………………………………………………196 Lmx1b is continuously required for the formation of 5-HT axon architectures………………………………………………………………………...198 Lmx1b in intrinsic 5-HT axon growth or guidance?.....................................200 Short-range versus long-range 5-HT axon growth……………………….200 Lmx1b regulates axon growth and guidance genes …………………….202 Potential mechanisms of Lmx1bcKO axon failure to innervate…………206 From identity to axon development………………………………………….…..211 Transcription factor regulation of ascending vs descending 5-HT axon architectures…………………………………………………………………………212 Lmx1bPet1 regulatory cascade functions in 5-HT arborization…………214 Possible role for Lmx1b in regeneration?.....................................................217 Investigation of human mutations in the 5-HT GRN………………………….219 Conclusion…………………………………………………………………………...220 Bibliography………………………………………………………………………….228 vi LIST OF FIGURES CHAPTER 1 Figure 1. Enzymatic steps of 5-HT synthesis……………………………....47 Figure 2. Transcription factor regulatory network that defines serotonergic identity……………………………………………….…………..49 Figure 3. Cytoarchitecture of 5-HT neurons in the mouse brain………….51 Figure 4. 5-HT axon innervation patterns in the forebrain………………...53 Figure 5. Single labeled 5-HT neurons reveal a great diversity of 5-HT axon innervation……………………………………………………………….55 Figure 6. Embryonic time series of 5-HT axon selective routing in the mouse…………………………………………………………………………..57 CHAPTER 2 Figure 1. Schematic of BH4 de novo synthesis, salvage, and regeneration pathways and its role in 5-HT synthesis………………………………….…77 Figure 2. Isolation of ePet-EYFP and Pet-1-/-;ePet-EYFP 5-HT neurons.……79 Figure 3. Microarray analyses………………………………………………..81 Figure 4. Slc22a3 expression………………………………………………...83 Figure 5. Slc22a3 and Htr1a expression in the adult dorsal raphe……....85 Figure 6. Pet-1 control of the 5-HT neuron-type gene battery…………….87 CHAPTER 3 Figure 1. Lmx1b is required for the formation of ascending 5-HT axon projection pathways…………………………………………………………..130 Figure 1—figure supplement 1. Surrogate marking of 5-HT cell bodies and axons and Lmx1b conditional targeting……………………………….132 Figure 1—figure supplement 2. Lmx1b deficiency disrupts 5-HT axon patterns in the forebrain……………………………………………………...135 Figure 2. Lmx1b is required for the formation of descending 5-HT axon projection pathways…………………………………………………...……...137 Figure 2—figure supplement 1. Conditional targeting of Lmx1b in the descending 5-HT projection pathway……………………………………….139 vii Figure 2—figure supplement 2. Progressive deficits of 5-HT axon fibers in Lmx1b deficient spinal cord white and gray matter…………………....141 Figure 3. Initial axon outgrowth is delayed and selective pathway routing fails in Lmx1b deficient 5-HT neurons………………………….....143 Figure 4. Lmx1b is temporally required for 5-HT projection pathway formation……………………………………………………………………....145 Figure 4—figure supplement 1. Efficiency of postnatal tamoxifen inducible targeting of Lmx1b………………………………………………...147 Figure 5. Lmx1b temporally controls postnatal 5-HT terminal arborization…………………………………………………………………....149 Figure 5—figure supplement 1. P3 targeted Lmx1bicKO mice display normal 5-HT axon routing but decreased 5-HT terminal arbors………...151 Figure 6. Specific targeting of 5-HT synthesis does not alter 5-HT arborization patterns…………………………………………………….…....153 Figure 7. Ascending and descending Lmx1b regulated transcriptomes…………………………………………………………......….155 Figure 7--supplement table 1. Lmx1b-regulated axon-related genes in rostral and caudal 5-HT neurons at E17.5……………………………..….169 Figure 8. Distinct transcription factor requirements in the formation of ascending and descending 5-HT projection pathways………………..….158 Figure 8—figure supplement 1. Pet1cKO and Lmx1bcKO mice exhibit distinct axon defects in thalamus…………………………………………...160 Figure 8—figure supplement 2. DKO and Pet1-/- analyses………………162 Figure 9. An ascending specific Lmx1bPet1 cascade controls stage specific 5-HT gene expression and postnatal terminal arborization….…164 Figure 9—figure supplement 1. Lmx1bPet1 cascade acts postnatally to control 5-HT terminal arborization…………………...…………………..167 CHAPTER 4 Figure 1. Lmx1b regulates both growth and guidance genes in 5-HT neurons………………………………………………………………………...222 Figure 2. The glial sling is a transient barrier in the embryonic mouse brain........................................................................................................224 viii Figure 3. Gap43 is significantly upregulated in maturing 5-HT neurons into postnatal stages………………………………………………………………226 ix Continuously Active Transcriptional Programs are Required to Build Expansive Serotonergic Axon Architectures Abstract by LAUREN JANINE DONOVAN Neurons express unique neurotransmitters, extend axons either short or long distances, and distribute axon processes in specific patterns in order to functionally integrate into the complex network that is the brain. Neuronal diversity is ultimately shaped by gene expression diversity. Serotonin (5-HT)
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • 1 Evidence for Gliadin Antibodies As Causative Agents in Schizophrenia
    1 Evidence for gliadin antibodies as causative agents in schizophrenia. C.J.Carter PolygenicPathways, 20 Upper Maze Hill, Saint-Leonard’s on Sea, East Sussex, TN37 0LG [email protected] Tel: 0044 (0)1424 422201 I have no fax Abstract Antibodies to gliadin, a component of gluten, have frequently been reported in schizophrenia patients, and in some cases remission has been noted following the instigation of a gluten free diet. Gliadin is a highly immunogenic protein, and B cell epitopes along its entire immunogenic length are homologous to the products of numerous proteins relevant to schizophrenia (p = 0.012 to 3e-25). These include members of the DISC1 interactome, of glutamate, dopamine and neuregulin signalling networks, and of pathways involved in plasticity, dendritic growth or myelination. Antibodies to gliadin are likely to cross react with these key proteins, as has already been observed with synapsin 1 and calreticulin. Gliadin may thus be a causative agent in schizophrenia, under certain genetic and immunological conditions, producing its effects via antibody mediated knockdown of multiple proteins relevant to the disease process. Because of such homology, an autoimmune response may be sustained by the human antigens that resemble gliadin itself, a scenario supported by many reports of immune activation both in the brain and in lymphocytes in schizophrenia. Gluten free diets and removal of such antibodies may be of therapeutic benefit in certain cases of schizophrenia. 2 Introduction A number of studies from China, Norway, and the USA have reported the presence of gliadin antibodies in schizophrenia 1-5. Gliadin is a component of gluten, intolerance to which is implicated in coeliac disease 6.
    [Show full text]
  • Identification of a Novel CHN1 P.(Phe213val) Variant in a Large Han Chinese Family with Congenital Duane Retraction Syndrome
    www.nature.com/scientificreports OPEN Identifcation of a novel CHN1 p.(Phe213Val) variant in a large Han Chinese family with congenital Duane retraction syndrome Tai‑Cheng Zhou1,3, Wen‑Hua Duan1,3, Xiao‑Lin Fu2,3, Qin Zhu1, Li‑Yun Guo1, Yuan Zhou1, Zhi‑Juan Hua1, Xue‑Jiao Li1, Dong‑Mei Yang1, Jie‑Ying Zhang1, Jie Yin1, Xiao‑Fan Zhang1, Guang‑Long Zhou1 & Min Hu1* Duane retraction syndrome (DRS) is a neuromuscular dysfunction of the eyes. Although many causative genes of DRS have been identifed in Europe and the United States, few reports have been published in regard to Chinese DRS. The aim of the present study was to explore the genetic defect of DRS in a Chinese family. Exome sequencing was used to identify the disease‑causing gene for the two afected family members. Ophthalmic and physical examinations, as well as genetic screenings for variants in chimerin 1 (CHN1), were performed for all family members. Functional analyses of a CHN1 variant in 293T cells included a Rac‑GTP activation assay, α2‑chimaerin translocation assay, and co‑immunoprecipitation assay. Genetic analysis revealed a NM_001822.7: c.637T > G variant in the CHN1 gene, which resulted in the substitution of a highly conserved C1 domain with valine at codon 213 (NP_001813.1: p.(Phe213Val)) (ClinVar Accession Number: SCV001335305). In-silico analysis revealed that the p.(Phe213Val) substitution afected the protein stability and connections among the amino acids of CHN1 in terms of its tertiary protein structure. Functional studies indicated that the p.(Phe213Val) substitution reduced Rac‑GTP activity and enhanced membrane translocation in response to phorbol‑myristoyl acetate (PMA).
    [Show full text]
  • Downloaded from the National Database for Autism Research (NDAR)
    International Journal of Molecular Sciences Article Phenotypic Subtyping and Re-Analysis of Existing Methylation Data from Autistic Probands in Simplex Families Reveal ASD Subtype-Associated Differentially Methylated Genes and Biological Functions Elizabeth C. Lee y and Valerie W. Hu * Department of Biochemistry and Molecular Medicine, The George Washington University, School of Medicine and Health Sciences, Washington, DC 20037, USA; [email protected] * Correspondence: [email protected]; Tel.: +1-202-994-8431 Current address: W. Harry Feinstone Department of Molecular Microbiology and Immunology, y Johns Hopkins Bloomberg School of Public Health, Baltimore, MD 21205, USA. Received: 25 August 2020; Accepted: 17 September 2020; Published: 19 September 2020 Abstract: Autism spectrum disorder (ASD) describes a group of neurodevelopmental disorders with core deficits in social communication and manifestation of restricted, repetitive, and stereotyped behaviors. Despite the core symptomatology, ASD is extremely heterogeneous with respect to the severity of symptoms and behaviors. This heterogeneity presents an inherent challenge to all large-scale genome-wide omics analyses. In the present study, we address this heterogeneity by stratifying ASD probands from simplex families according to the severity of behavioral scores on the Autism Diagnostic Interview-Revised diagnostic instrument, followed by re-analysis of existing DNA methylation data from individuals in three ASD subphenotypes in comparison to that of their respective unaffected siblings. We demonstrate that subphenotyping of cases enables the identification of over 1.6 times the number of statistically significant differentially methylated regions (DMR) and DMR-associated genes (DAGs) between cases and controls, compared to that identified when all cases are combined. Our analyses also reveal ASD-related neurological functions and comorbidities that are enriched among DAGs in each phenotypic subgroup but not in the combined case group.
    [Show full text]
  • Small Cell Ovarian Carcinoma: Genomic Stability and Responsiveness to Therapeutics
    Gamwell et al. Orphanet Journal of Rare Diseases 2013, 8:33 http://www.ojrd.com/content/8/1/33 RESEARCH Open Access Small cell ovarian carcinoma: genomic stability and responsiveness to therapeutics Lisa F Gamwell1,2, Karen Gambaro3, Maria Merziotis2, Colleen Crane2, Suzanna L Arcand4, Valerie Bourada1,2, Christopher Davis2, Jeremy A Squire6, David G Huntsman7,8, Patricia N Tonin3,4,5 and Barbara C Vanderhyden1,2* Abstract Background: The biology of small cell ovarian carcinoma of the hypercalcemic type (SCCOHT), which is a rare and aggressive form of ovarian cancer, is poorly understood. Tumourigenicity, in vitro growth characteristics, genetic and genomic anomalies, and sensitivity to standard and novel chemotherapeutic treatments were investigated in the unique SCCOHT cell line, BIN-67, to provide further insight in the biology of this rare type of ovarian cancer. Method: The tumourigenic potential of BIN-67 cells was determined and the tumours formed in a xenograft model was compared to human SCCOHT. DNA sequencing, spectral karyotyping and high density SNP array analysis was performed. The sensitivity of the BIN-67 cells to standard chemotherapeutic agents and to vesicular stomatitis virus (VSV) and the JX-594 vaccinia virus was tested. Results: BIN-67 cells were capable of forming spheroids in hanging drop cultures. When xenografted into immunodeficient mice, BIN-67 cells developed into tumours that reflected the hypercalcemia and histology of human SCCOHT, notably intense expression of WT-1 and vimentin, and lack of expression of inhibin. Somatic mutations in TP53 and the most common activating mutations in KRAS and BRAF were not found in BIN-67 cells by DNA sequencing.
    [Show full text]
  • Viewed Under 23 (B) Or 203 (C) fi M M Male Cko Mice, and Largely Unaffected Magni Cation; Scale Bars, 500 M (B) and 50 M (C)
    BRIEF COMMUNICATION www.jasn.org Renal Fanconi Syndrome and Hypophosphatemic Rickets in the Absence of Xenotropic and Polytropic Retroviral Receptor in the Nephron Camille Ansermet,* Matthias B. Moor,* Gabriel Centeno,* Muriel Auberson,* † † ‡ Dorothy Zhang Hu, Roland Baron, Svetlana Nikolaeva,* Barbara Haenzi,* | Natalya Katanaeva,* Ivan Gautschi,* Vladimir Katanaev,*§ Samuel Rotman, Robert Koesters,¶ †† Laurent Schild,* Sylvain Pradervand,** Olivier Bonny,* and Dmitri Firsov* BRIEF COMMUNICATION *Department of Pharmacology and Toxicology and **Genomic Technologies Facility, University of Lausanne, Lausanne, Switzerland; †Department of Oral Medicine, Infection, and Immunity, Harvard School of Dental Medicine, Boston, Massachusetts; ‡Institute of Evolutionary Physiology and Biochemistry, St. Petersburg, Russia; §School of Biomedicine, Far Eastern Federal University, Vladivostok, Russia; |Services of Pathology and ††Nephrology, Department of Medicine, University Hospital of Lausanne, Lausanne, Switzerland; and ¶Université Pierre et Marie Curie, Paris, France ABSTRACT Tight control of extracellular and intracellular inorganic phosphate (Pi) levels is crit- leaves.4 Most recently, Legati et al. have ical to most biochemical and physiologic processes. Urinary Pi is freely filtered at the shown an association between genetic kidney glomerulus and is reabsorbed in the renal tubule by the action of the apical polymorphisms in Xpr1 and primary fa- sodium-dependent phosphate transporters, NaPi-IIa/NaPi-IIc/Pit2. However, the milial brain calcification disorder.5 How- molecular identity of the protein(s) participating in the basolateral Pi efflux remains ever, the role of XPR1 in the maintenance unknown. Evidence has suggested that xenotropic and polytropic retroviral recep- of Pi homeostasis remains unknown. Here, tor 1 (XPR1) might be involved in this process. Here, we show that conditional in- we addressed this issue in mice deficient for activation of Xpr1 in the renal tubule in mice resulted in impaired renal Pi Xpr1 in the nephron.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Transcriptomic Analysis of Native Versus Cultured Human and Mouse Dorsal Root Ganglia Focused on Pharmacological Targets Short
    bioRxiv preprint doi: https://doi.org/10.1101/766865; this version posted September 12, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Transcriptomic analysis of native versus cultured human and mouse dorsal root ganglia focused on pharmacological targets Short title: Comparative transcriptomics of acutely dissected versus cultured DRGs Andi Wangzhou1, Lisa A. McIlvried2, Candler Paige1, Paulino Barragan-Iglesias1, Carolyn A. Guzman1, Gregory Dussor1, Pradipta R. Ray1,#, Robert W. Gereau IV2, # and Theodore J. Price1, # 1The University of Texas at Dallas, School of Behavioral and Brain Sciences and Center for Advanced Pain Studies, 800 W Campbell Rd. Richardson, TX, 75080, USA 2Washington University Pain Center and Department of Anesthesiology, Washington University School of Medicine # corresponding authors [email protected], [email protected] and [email protected] Funding: NIH grants T32DA007261 (LM); NS065926 and NS102161 (TJP); NS106953 and NS042595 (RWG). The authors declare no conflicts of interest Author Contributions Conceived of the Project: PRR, RWG IV and TJP Performed Experiments: AW, LAM, CP, PB-I Supervised Experiments: GD, RWG IV, TJP Analyzed Data: AW, LAM, CP, CAG, PRR Supervised Bioinformatics Analysis: PRR Drew Figures: AW, PRR Wrote and Edited Manuscript: AW, LAM, CP, GD, PRR, RWG IV, TJP All authors approved the final version of the manuscript. 1 bioRxiv preprint doi: https://doi.org/10.1101/766865; this version posted September 12, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • Sodium Pumps Mediate Activity-Dependent Changes in Mammalian Motor Networks
    906 • The Journal of Neuroscience, January 25, 2017 • 37(4):906–921 Systems/Circuits Sodium Pumps Mediate Activity-Dependent Changes in Mammalian Motor Networks X Laurence D. Picton, XFilipe Nascimento, XMatthew J. Broadhead, XKeith T. Sillar, and XGareth B. Miles School of Psychology and Neuroscience, University of St Andrews, St Andrews KY16 9JP, United Kingdom Ubiquitously expressed sodium pumps are best known for maintaining the ionic gradients and resting membrane potential required for generating action potentials. However, activity- and state-dependent changes in pump activity can also influence neuronal firing and regulate rhythmic network output. Here we demonstrate that changes in sodium pump activity regulate locomotor networks in the spinal cord of neonatal mice. The sodium pump inhibitor, ouabain, increased the frequency and decreased the amplitude of drug-induced locomotor bursting, effects that were dependent on the presence of the neuromodulator dopamine. Conversely, activating the pump with the sodium ionophore monensin decreased burst frequency. When more “natural” locomotor output was evoked using dorsal-root stimulation, ouabain increased burst frequency and extended locomotor episode duration, whereas monensin slowed and shortened episodes. Decreasing the time between dorsal-root stimulation, and therefore interepisode interval, also shortened and slowed activity, suggesting that pump activity encodes information about past network output and contributes to feedforward control of subsequent locomotor bouts. Using whole-cell patch-clamp recordings from spinal motoneurons and interneurons, we describe a long-duration (ϳ60 s), activity-dependent, TTX- and ouabain-sensitive, hyperpolarization (ϳ5 mV), which is mediated by spike-dependent increases in pump activity. The duration of this dynamic pump potential is enhanced by dopamine.
    [Show full text]
  • A Benchmarking Study on Virtual Ligand Screening Against Homology Models of Human Gpcrs
    bioRxiv preprint doi: https://doi.org/10.1101/284075; this version posted March 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. A benchmarking study on virtual ligand screening against homology models of human GPCRs Victor Jun Yu Lima,b, Weina Dua, Yu Zong Chenc, Hao Fana,d aBioinformatics Institute (BII), Agency for Science, Technology and Research (A*STAR), 30 Biopolis Street, Matrix No. 07-01, 138671, Singapore; bSaw Swee Hock School of Public Health, National University of Singapore, 12 Science Drive 2, 117549, Singapore; cDepartment of Pharmacy, National University of Singapore, 18 Science Drive 4, 117543, Singapore; dDepartment of Biological Sciences, National University of Singapore, 16 Science Drive 4, Singapore 117558 To whom correspondence should be addressed: Dr. Hao Fan, Bioinformatics Institute (BII), Agency for Science, Technology and Research (A*STAR), 30 Biopolis Street, Matrix No. 07-01, 138671, Singapore; Telephone: +65 64788500; Email: [email protected] Keywords: G-protein-coupled receptor, GPCR, X-ray crystallography, virtual screening, homology modelling, consensus enrichment 1 bioRxiv preprint doi: https://doi.org/10.1101/284075; this version posted March 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract G-protein-coupled receptor (GPCR) is an important target class of proteins for drug discovery, with over 27% of FDA-approved drugs targeting GPCRs. However, being a membrane protein, it is difficult to obtain the 3D crystal structures of GPCRs for virtual screening of ligands by molecular docking.
    [Show full text]
  • Celsr1-3 Cadherins in PCP and Brain Development
    CHAPTER SEVEN Celsr1–3 Cadherins in PCP and Brain Development Camille Boutin, André M. Goffinet1, Fadel Tissir1 Institute of Neuroscience, Developmental Neurobiology, Universite´ Catholique de Louvain, Brussels, Belgium 1Corresponding authors: Equal contribution. e-mail address: [email protected]; andre. [email protected] Contents 1. Celsr1–3 Expression Patterns 164 2. Celsr1: A Major Player in Vertebrate PCP 165 3. Celsr2 and 3 in Ciliogenesis 169 4. Celsr1–3 in Neuronal Migration 171 5. Celsr2 and Celsr3 in Brain Wiring 174 5.1 Motifs of Celsr important for their functions 176 References 179 Abstract Cadherin EGF LAG seven-pass G-type receptors 1, 2, and 3 (Celsr1–3) form a family of three atypical cadherins with multiple functions in epithelia and in the nervous system. During the past decade, evidence has accumulated for important and distinct roles of Celsr1–3 in planar cell polarity (PCP) and brain development and maintenance. Although the role of Celsr in PCP is conserved from flies to mammals, other functions may be more distantly related, with Celsr working only with one or a subset of the classical PCP partners. Here, we review the literature on Celsr in PCP and neural devel- opment, point to several remaining questions, and consider future challenges and possible research trends. Celsr1–3 genes encode atypical cadherins of more than 3000 amino acids ( Fig. 7.1). Their large ectodomain is composed of nine N-terminal cadherin repeats (typical cadherins have five repeats), six epidermal growth factor (EGF)-like domains, two laminin G repeats, one hormone receptor motif (HRM), and a G-protein-coupled receptor proteolytic site (GPS).
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]