DOCSLIB.ORG

Distribution Agreement

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Distribution Agreement Distribution Agreement In presenting this thesis or dissertation as a partial fulfillment of the requirements for an advanced degree from Emory University, I hereby grant to Emory University and its agents the non-exclusive license to archive, make accessible, and display my thesis or dissertation in whole or in part in all forms of media, now or hereafter known, including display on the world wide web. I understand that I may select some access restrictions as part of the online submission of this thesis or dissertation. I retain all ownership rights to the copyright of the thesis or dissertation. I also retain the right to use in future works (such as articles or books) all or part of this thesis or dissertation. Signature: _____________________________ ______________ Ivan Ludlow Date MDMA’s Effect on Myocardial DNA Methylation and its Association with Dilated Cardiomyopathy By Ivan Ludlow Master of Public Health Environmental Health _________________________________________ William Michael Caudle, Ph.D. Committee Chair _________________________________________ Paige Tolbert, Ph.D. Committee Member _________________________________________ William Lewis, M.D. Committee Member MDMA’s Effect on Myocardial DNA Methylation and its Association with Dilated Cardiomyopathy By Ivan Ludlow B.S. Emory University 2014 Thesis Committee Chair: William Michael Caudle, Ph.D. An abstract of A thesis submitted to the Faculty of the Rollins School of Public Health of Emory University in partial fulfillment of the requirements for the degree of Master of Public Health in Environmental Health 2015 Abstract MDMA’s Effect on Myocardial DNA Methylation and its Association with Dilated Cardiomyopathy By Ivan Ludlow MDMA (“Ecstasy”) is an illicit psychoactive drug that has increased in popularity in the past two decades. However, the cardiovascular toxicological mechanism of MDMA has not been fully characterized. The present study utilized microarray analysis to determine gene expression and DNA methylation modifications after MDMA exposure in the murine heart. Alterations in gene expression and epigenetics may serve a critical function in the development of dilated cardiomyopathy (DCM) and heart failure. Three different drug administration timeframes were used to determine the permanence of MDMA-associated DNA methylation and gene expression changes. MDMA decreased the transcription of genes found in the circadian rhythm pathway, which was verified via quantitative RT-PCR. This pathway has been shown to have an important role in regulating mitochondrial metabolism and maintaining cardiac function. Differential expression of the myosin heavy chain (Myh7) gene was identified across all treatment groups, which has been associated with cardiac dysfunction and cardiomyopathy. Furthermore, MDMA treated mice displayed genome-wide hypermethylation compared to controls. Similar genome-wide DNA methylation changes have been reported in DCM patients. Collectively, these results suggest that MDMA may be toxic to the heart through its ability to change DNA methylation patterns and alter gene transcription leading to disease onset. MDMA’s Effect on Myocardial DNA Methylation and its Association with Dilated Cardiomyopathy By Ivan Ludlow B.S. Emory University 2014 Thesis Committee Chair: William Michael Caudle, Ph.D. A thesis submitted to the Faculty of the Rollins School of Public Health of Emory University in partial fulfillment of the requirements for the degree of Master of Public Health in Environmental Health 2015 Acknowledgements The author would like to thank William Lewis, Christopher Koczor, and W. Michael Caudle for their help with the creation and editing of this manuscript. Table of Contents Introduction ........................................................................................................................1 MDMA’s Short Term Effects ..........................................................................................1 MDMA’s Long Term Effects ..........................................................................................1 Gene Expression Association with Cardiac Function ......................................................2 DNA Methylation Association with Cardiac Function ....................................................3 MDMA’s Effect on DNA Methylation and Gene Expression .........................................4 Methods ...............................................................................................................................6 Reagents ...........................................................................................................................6 Mouse Protocols...............................................................................................................6 Gene Expression Analysis ...............................................................................................6 Quantitative RT-PCR .......................................................................................................7 DNA Methylation Analysis .............................................................................................7 Statistical Analysis ...........................................................................................................8 Results ...............................................................................................................................10 Cardiac Physiology ........................................................................................................10 Gene Expression ............................................................................................................10 Quantitative RT-PCR .....................................................................................................11 DNA Methylation ..........................................................................................................12 Discussion .........................................................................................................................14 Conclusion ........................................................................................................................20 References .........................................................................................................................21 Tables and Figures .............................................................................................................1 Figure 1 ............................................................................................................................1 Figure 2 ............................................................................................................................2 Figure 3 ............................................................................................................................3 Figure 4 ............................................................................................................................4 Figure 5 ............................................................................................................................5 Figure 6 ............................................................................................................................6 Figure 7 ............................................................................................................................8 Appendices ..........................................................................................................................1 Supplemental Table 1 ......................................................................................................1 Supplemental Table 2 ......................................................................................................2 Supplemental Table 3 ....................................................................................................42 Supplemental Table 4 ....................................................................................................84 1 Introduction MDMA (3,4-methylenedioxymethamphetamine, “ecstasy”) is an amphetamine derivative, with hallucinogenic and stimulant properties. (1) The popularity of MDMA has increased since the late 1980s, as its use became a feature of the underground dance scene. (2) According to the 2004 National Survey on Drug Use and Health (3), more than 17 million people 12 or older have tried MDMA at least once in their lifetime. MDMA’s Short Term Effects The onset of MDMA’s effects takes 20 to 60 minutes to occur, with peak effect 60 to 90 minutes after ingestion. (4) Effects can last for 3 to 5 hours. (4) MDMA produces a relaxed, euphoric state, including emotional openness, empathy, reduction of negative thoughts, and a decrease in inhibitions. (5-9) Pathophysiologically, acute administration of MDMA has been shown to increase heart rate, blood pressure and myocardial oxygen consumption in humans. (10, 11) Furthermore, a single administration of MDMA could produce significant cardiovascular toxicity in vivo. (12) Yet the immediate health risk of MDMA is minor. Emergency department and mortality data suggests that serious complications of MDMA use are less common than those associated with opioids, cocaine, or methamphetamine. (13-15) MDMA’s Long Term Effects The long-term health effects of MDMA pose a far greater risk than short-term outcomes. The cardiotoxicity of MDMA has been well documented. (1) MDMA increases the risk of tachycardia, arrhythmia, cardiac ischemia, myocardial infarction, and 2 cardiomyopathy. (11, 16-18)
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Table 2. Significant
    Table 2. Significant (Q < 0.05 and |d | > 0.5) transcripts from the meta-analysis Gene Chr Mb Gene Name Affy ProbeSet cDNA_IDs d HAP/LAP d HAP/LAP d d IS Average d Ztest P values Q-value Symbol ID (study #5) 1 2 STS B2m 2 122 beta-2 microglobulin 1452428_a_at AI848245 1.75334941 4 3.2 4 3.2316485 1.07398E-09 5.69E-08 Man2b1 8 84.4 mannosidase 2, alpha B1 1416340_a_at H4049B01 3.75722111 3.87309653 2.1 1.6 2.84852656 5.32443E-07 1.58E-05 1110032A03Rik 9 50.9 RIKEN cDNA 1110032A03 gene 1417211_a_at H4035E05 4 1.66015788 4 1.7 2.82772795 2.94266E-05 0.000527 NA 9 48.5 --- 1456111_at 3.43701477 1.85785922 4 2 2.8237185 9.97969E-08 3.48E-06 Scn4b 9 45.3 Sodium channel, type IV, beta 1434008_at AI844796 3.79536664 1.63774235 3.3 2.3 2.75319499 1.48057E-08 6.21E-07 polypeptide Gadd45gip1 8 84.1 RIKEN cDNA 2310040G17 gene 1417619_at 4 3.38875643 1.4 2 2.69163229 8.84279E-06 0.0001904 BC056474 15 12.1 Mus musculus cDNA clone 1424117_at H3030A06 3.95752801 2.42838452 1.9 2.2 2.62132809 1.3344E-08 5.66E-07 MGC:67360 IMAGE:6823629, complete cds NA 4 153 guanine nucleotide binding protein, 1454696_at -3.46081884 -4 -1.3 -1.6 -2.6026947 8.58458E-05 0.0012617 beta 1 Gnb1 4 153 guanine nucleotide binding protein, 1417432_a_at H3094D02 -3.13334396 -4 -1.6 -1.7 -2.5946297 1.04542E-05 0.0002202 beta 1 Gadd45gip1 8 84.1 RAD23a homolog (S.
    [Show full text]
  • Role of Active Contraction and Tropomodulins in Regulating Actin Filament Length and Sarcomere Structure in Developing Zebrafish Skeletal Muscle
    ORIGINAL RESEARCH published: 31 March 2016 doi: 10.3389/fphys.2016.00091 Role of Active Contraction and Tropomodulins in Regulating Actin Filament Length and Sarcomere Structure in Developing Zebrafish Skeletal Muscle Lise Mazelet 1, Matthew O. Parker 2, Mei Li 3, Anders Arner 3 and Rachel Ashworth 4* 1 School of Biological and Chemical Sciences, Queen Mary, University of London, London, UK, 2 School of Health Sciences and Social Work, University of Portsmouth, Portsmouth, UK, 3 Department of Physiology and Pharmacology, Karolinska Institutet, Stockholm, Sweden, 4 The Blizard Institute/Institute of Health Sciences Education, Barts and The London School of Medicine and Dentistry, London, UK Whilst it is recognized that contraction plays an important part in maintaining the structure and function of mature skeletal muscle, its role during development remains undefined. In this study the role of movement in skeletal muscle maturation was investigated in intact zebrafish embryos using a combination of genetic and pharmacological approaches. An immotile mutant line (cacnb1ts25) which lacks functional voltage-gated calcium channels (dihydropyridine receptors) in the muscle and pharmacological immobilization of embryos Edited by: with a reversible anesthetic (Tricaine), allowed the study of paralysis (in mutants and Catherine Coirault, anesthetized fish) and recovery of movement (reversal of anesthetic treatment). The Institut National de la Santé et de la Recherche Médicale, France effect of paralysis in early embryos (aged between 17 and 24 hours post-fertilization, hpf) Reviewed by: on skeletal muscle structure at both myofibrillar and myofilament level was determined Corrado Poggesi, using both immunostaining with confocal microscopy and small angle X-ray diffraction.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Lineage-Specific Programming Target Genes Defines Potential for Th1 Temporal Induction Pattern of STAT4
    Downloaded from http://www.jimmunol.org/ by guest on October 1, 2021 is online at: average * The Journal of Immunology published online 26 August 2009 from submission to initial decision 4 weeks from acceptance to publication J Immunol http://www.jimmunol.org/content/early/2009/08/26/jimmuno l.0901411 Temporal Induction Pattern of STAT4 Target Genes Defines Potential for Th1 Lineage-Specific Programming Seth R. Good, Vivian T. Thieu, Anubhav N. Mathur, Qing Yu, Gretta L. Stritesky, Norman Yeh, John T. O'Malley, Narayanan B. Perumal and Mark H. Kaplan Submit online. Every submission reviewed by practicing scientists ? is published twice each month by http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://www.jimmunol.org/content/suppl/2009/08/26/jimmunol.090141 1.DC1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* • Why • • Material Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2009 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of October 1, 2021. Published August 26, 2009, doi:10.4049/jimmunol.0901411 The Journal of Immunology Temporal Induction Pattern of STAT4 Target Genes Defines Potential for Th1 Lineage-Specific Programming1 Seth R. Good,2* Vivian T. Thieu,2† Anubhav N. Mathur,† Qing Yu,† Gretta L.
    [Show full text]
  • The Effects of Betaine Treatment on Rats Fed an Acute Bolus of Ethanol at 3 and 12 H Post Bolus: a Microarray Analysis
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by PubMed Central Genes Nutr (2010) 5:321–329 DOI 10.1007/s12263-010-0173-y RESEARCH PAPER The effects of betaine treatment on rats fed an acute bolus of ethanol at 3 and 12 h post bolus: a microarray analysis J. Li • F. Bardag-Gorce • J. Oliva • B. A. French • J. Dedes • S. W. French Received: 24 November 2009 / Accepted: 19 February 2010 / Published online: 19 March 2010 Ó The Author(s) 2010. This article is published with open access at Springerlink.com Abstract Betaine, a methyl donor active in methionine Introduction metabolism, is effective in preventing and reversing experimental alcohol liver disease. The metabolic and Ethanol, given as a bolus of 6 g/kg body weight, increases molecular biologic mechanisms involved in this prevention the blood and urinary alcohol to a high level at 3 h post are only partially known. To further investigate how betaine bolus. At 12 h, the blood and urinary alcohol levels return modifies the effects of ethanol on the liver, rats were given to low a level [2]. At these 2 time points, there are major an acute ethanol bolus with or without betaine and the changes in gene expression in the liver but only minimal results were compared to isocaloric dextrose-fed controls. evidence of epigenetic changes [2]. Only at 12 h is there a Livers were subjected to microarray analysis, and functional decrease in global DNA methylation [2]. pathways and individual gene expression changes were Previously, in using this model, S-adenosylmethionine analyzed.
    [Show full text]
  • The Role of Asic1a in the Regulation of Synaptic Release Probability
    The Role of ASIC1a in the Regulation of Synaptic Release Probability THESIS Presented in Partial Fulfillment of the Requirements for the Degree Master of Science in the Graduate School of The Ohio State University By Soluman Culver Graduate Program in Pathology The Ohio State University 2013 Master's Examination Committee: W. James Waldman, Adviser Candice Askwith John Enyeart Copyright by Soluman Culver 2013 Abstract Extracellular pH plays an important role in neuronal signaling. As primary receptors of pH signals, acid-sensing ion channels (ASICs) are able to translate fluctuations in the extracellular pH into membrane potentials and calcium signals. ASICs and pH signaling are thought to play important roles in anxiety, affect, and pain, although the mechanism by which they are able to influence these processes remains poorly understood. During conditions of dysregulated pH aberrant ASIC activity is known to result in cellular dysfunction and death, making a mechanistic explanation of ASIC function of broad importance to our understanding of downstream consequences during pathophysiological circumstances. One significant role of ASIC is in its ability to modulate synaptic vesicle release, a property which may contribute to neuronal dysfunction secondary to disruptions in pH signaling. This study demonstrates that the mechanism of ASIC-dependent regulation of synaptic vesicle does not rely upon rapid local signaling, but rather requires several hours of ASIC block to be interrupted, suggesting that it may take place through the induction of gene regulation and cause global changes in cellular physiology. Similarly, our results suggest that ASIC1a may be responding to endogenous proton flux to accomplish this regulation, refining our understanding of the cause and context of ASIC1a activation in health and disease.
    [Show full text]
  • Table SII. Significantly Differentially Expressed Mrnas of GSE23558 Data Series with the Criteria of Adjusted P<0.05 And
    Table SII. Significantly differentially expressed mRNAs of GSE23558 data series with the criteria of adjusted P<0.05 and logFC>1.5. Probe ID Adjusted P-value logFC Gene symbol Gene title A_23_P157793 1.52x10-5 6.91 CA9 carbonic anhydrase 9 A_23_P161698 1.14x10-4 5.86 MMP3 matrix metallopeptidase 3 A_23_P25150 1.49x10-9 5.67 HOXC9 homeobox C9 A_23_P13094 3.26x10-4 5.56 MMP10 matrix metallopeptidase 10 A_23_P48570 2.36x10-5 5.48 DHRS2 dehydrogenase A_23_P125278 3.03x10-3 5.40 CXCL11 C-X-C motif chemokine ligand 11 A_23_P321501 1.63x10-5 5.38 DHRS2 dehydrogenase A_23_P431388 2.27x10-6 5.33 SPOCD1 SPOC domain containing 1 A_24_P20607 5.13x10-4 5.32 CXCL11 C-X-C motif chemokine ligand 11 A_24_P11061 3.70x10-3 5.30 CSAG1 chondrosarcoma associated gene 1 A_23_P87700 1.03x10-4 5.25 MFAP5 microfibrillar associated protein 5 A_23_P150979 1.81x10-2 5.25 MUCL1 mucin like 1 A_23_P1691 2.71x10-8 5.12 MMP1 matrix metallopeptidase 1 A_23_P350005 2.53x10-4 5.12 TRIML2 tripartite motif family like 2 A_24_P303091 1.23x10-3 4.99 CXCL10 C-X-C motif chemokine ligand 10 A_24_P923612 1.60x10-5 4.95 PTHLH parathyroid hormone like hormone A_23_P7313 6.03x10-5 4.94 SPP1 secreted phosphoprotein 1 A_23_P122924 2.45x10-8 4.93 INHBA inhibin A subunit A_32_P155460 6.56x10-3 4.91 PICSAR P38 inhibited cutaneous squamous cell carcinoma associated lincRNA A_24_P686965 8.75x10-7 4.82 SH2D5 SH2 domain containing 5 A_23_P105475 7.74x10-3 4.70 SLCO1B3 solute carrier organic anion transporter family member 1B3 A_24_P85099 4.82x10-5 4.67 HMGA2 high mobility group AT-hook 2 A_24_P101651
    [Show full text]
  • Supplementary Table 1
    Supplementary Table 1. 492 genes are unique to 0 h post-heat timepoint. The name, p-value, fold change, location and family of each gene are indicated. Genes were filtered for an absolute value log2 ration 1.5 and a significance value of p ≤ 0.05. Symbol p-value Log Gene Name Location Family Ratio ABCA13 1.87E-02 3.292 ATP-binding cassette, sub-family unknown transporter A (ABC1), member 13 ABCB1 1.93E-02 −1.819 ATP-binding cassette, sub-family Plasma transporter B (MDR/TAP), member 1 Membrane ABCC3 2.83E-02 2.016 ATP-binding cassette, sub-family Plasma transporter C (CFTR/MRP), member 3 Membrane ABHD6 7.79E-03 −2.717 abhydrolase domain containing 6 Cytoplasm enzyme ACAT1 4.10E-02 3.009 acetyl-CoA acetyltransferase 1 Cytoplasm enzyme ACBD4 2.66E-03 1.722 acyl-CoA binding domain unknown other containing 4 ACSL5 1.86E-02 −2.876 acyl-CoA synthetase long-chain Cytoplasm enzyme family member 5 ADAM23 3.33E-02 −3.008 ADAM metallopeptidase domain Plasma peptidase 23 Membrane ADAM29 5.58E-03 3.463 ADAM metallopeptidase domain Plasma peptidase 29 Membrane ADAMTS17 2.67E-04 3.051 ADAM metallopeptidase with Extracellular other thrombospondin type 1 motif, 17 Space ADCYAP1R1 1.20E-02 1.848 adenylate cyclase activating Plasma G-protein polypeptide 1 (pituitary) receptor Membrane coupled type I receptor ADH6 (includes 4.02E-02 −1.845 alcohol dehydrogenase 6 (class Cytoplasm enzyme EG:130) V) AHSA2 1.54E-04 −1.6 AHA1, activator of heat shock unknown other 90kDa protein ATPase homolog 2 (yeast) AK5 3.32E-02 1.658 adenylate kinase 5 Cytoplasm kinase AK7
    [Show full text]
  • 1471-2164-2-7.Pdf
    BMC Genomics BioMed Central BMC Genomics :7 Research2 2001, article Genomic organization of Tropomodulins 2 and 4 and unusual intergenic and intraexonic splicing of YL-1 and Tropomodulin 4 Patrick R Cox1, Teepu Siddique5 and Huda Y Zoghbi*1,2,3,4 Address: 1Division of Neuroscience, Baylor College of Medicine, Houston, Texas, USA, 2Departments of Pediatrics, Baylor College of Medicine, Houston, Texas, USA, 3Molecular and Human Genetics, Baylor College of Medicine, Houston, Texas, USA, 4Howard Hughes Medical Institute, Baylor College of Medicine, Houston, Texas, USA and 5Baylor College of Medicine, Houston, Northwestern University Medical School, Chicago, Illinois, USA E-mail: Patrick R Cox - [email protected]; Teepu Siddique - [email protected]; Huda Y Zoghbi* - [email protected] *Corresponding author Published: 17 October 2001 Received: 13 July 2001 Accepted: 17 October 2001 BMC Genomics 2001, 2:7 This article is available from: http://www.biomedcentral.com/1471-2164/2/7 © 2001 Cox et al; licensee BioMed Central Ltd. Verbatim copying and redistribution of this article are permitted in any medium for any non-commercial purpose, provided this notice is preserved along with the article's original URL. For commercial use, contact [email protected] Abstract Background: The tropomodulins (TMODs) are a family of proteins that cap the pointed ends of actin filaments. Four TMODs have been identified in humans, with orthologs in mice. Mutations in actin or actin-binding proteins have been found to cause several human diseases, ranging from hypertrophic cardiomyopathy to immunodefiencies such as Wiskott-Aldrich syndrome. We had previously mapped Tropomodulin 2 (TMOD2) to the genomic region containing the gene for amyotrophic lateral sclerosis 5 (ALS5).
    [Show full text]
  • Strand Breaks for P53 Exon 6 and 8 Among Different Time Course of Folate Depletion Or Repletion in the Rectosigmoid Mucosa
    SUPPLEMENTAL FIGURE COLON p53 EXONIC STRAND BREAKS DURING FOLATE DEPLETION-REPLETION INTERVENTION Supplemental Figure Legend Strand breaks for p53 exon 6 and 8 among different time course of folate depletion or repletion in the rectosigmoid mucosa. The input of DNA was controlled by GAPDH. The data is shown as ΔCt after normalized to GAPDH. The higher ΔCt the more strand breaks. The P value is shown in the figure. SUPPLEMENT S1 Genes that were significantly UPREGULATED after folate intervention (by unadjusted paired t-test), list is sorted by P value Gene Symbol Nucleotide P VALUE Description OLFM4 NM_006418 0.0000 Homo sapiens differentially expressed in hematopoietic lineages (GW112) mRNA. FMR1NB NM_152578 0.0000 Homo sapiens hypothetical protein FLJ25736 (FLJ25736) mRNA. IFI6 NM_002038 0.0001 Homo sapiens interferon alpha-inducible protein (clone IFI-6-16) (G1P3) transcript variant 1 mRNA. Homo sapiens UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15 GALNTL5 NM_145292 0.0001 (GALNT15) mRNA. STIM2 NM_020860 0.0001 Homo sapiens stromal interaction molecule 2 (STIM2) mRNA. ZNF645 NM_152577 0.0002 Homo sapiens hypothetical protein FLJ25735 (FLJ25735) mRNA. ATP12A NM_001676 0.0002 Homo sapiens ATPase H+/K+ transporting nongastric alpha polypeptide (ATP12A) mRNA. U1SNRNPBP NM_007020 0.0003 Homo sapiens U1-snRNP binding protein homolog (U1SNRNPBP) transcript variant 1 mRNA. RNF125 NM_017831 0.0004 Homo sapiens ring finger protein 125 (RNF125) mRNA. FMNL1 NM_005892 0.0004 Homo sapiens formin-like (FMNL) mRNA. ISG15 NM_005101 0.0005 Homo sapiens interferon alpha-inducible protein (clone IFI-15K) (G1P2) mRNA. SLC6A14 NM_007231 0.0005 Homo sapiens solute carrier family 6 (neurotransmitter transporter) member 14 (SLC6A14) mRNA.
    [Show full text]
  • Supporting Information for Proteomics DOI 10.1002/Pmic.200600056
    Supporting Information for Proteomics DOI 10.1002/pmic.200600056 Barbara Celegato, Daniele Capitanio, Mario Pescatori, Chiara Romualdi, Beniamina Pacchioni, Stefano Cagnin, Agnese Vigan, Luca Colantoni, Shajna Begum, Enzo Ricci, Robin Wait, Gerolamo Lanfranchi and Cecilia Gelfi Parallel protein and transcript profiles of FSHD patient muscles correlate to the D4Z4 arrangement and reveal a common impairment of slow to fast fibre differentiation and a general deregulation of MyoD-dependent genes ª 2006 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.com Table A. List of genes discriminating among the two classes of patients with the same range of size deletion (EcoRI fragment > 21Kb), but differing by age at biopsy. NA: not available value. Table B. Mass spectrometry data of up and down regulated proteins of unclusterised patients, as shown in Figure 3. Table C. Mass spectrometry data of up and down regulated proteins of patients after gene transcripts cluster analysis. Table D. Common altered genes in FSHD muscle compared to a deltoideous control muscle are listed according to their biological process. Table E. Functionally classified transcripts with an increasing profile according to KpnI repeats number at D4Z4 locus. Single patient ratios and intra-class averaged ratios are reported. Table F. Functionally classified transcripts with a decreasing profile according to KpnI repeats number at D4Z4 locus. Single patient ratios and intra-class averaged ratios are reported. Table G. Ratios values of selected transcripts altered in FSHD muscle, suggesting an enrichment in slow-oxidative fibers in the most severely affected patients. Table H. MyoD target genes with an altered expression in FSHD muscle.
    [Show full text]