DOCSLIB.ORG

Differential Proteomics of the Cerebral Cortex of Juvenile, Adult and Aged Rats

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Differential Proteomics of the Cerebral Cortex of Juvenile, Adult and Aged Rats ics om & B te i Wille et al., J Proteomics Bioinform 2017, 10:2 ro o P in f f o o DOI: 10.4172/jpb.1000424 r l m a Journal of a n t r i c u s o J ISSN: 0974-276X Proteomics & Bioinformatics Research Article Article Open Access Differential Proteomics of the Cerebral Cortex of Juvenile, Adult and Aged Rats: An Ontogenetic Study Michael Wille1, Antje Schümann, Michael Kreutzer2, Michael O Glocker2, Andreas Wree1, Grit Mutzbauer3 and Oliver Schmitt1* 1Department of Anatomy, Gertrudenstraße 9, 18055 Rostock, Germany 2Proteome Center Rostock, Schillingallee 69, 18055 Rostock, Germany 3Department of Pathology, Josef-Schneider-Straße 2, 97080 Würzburg, Germany Abstract The identification of up- and downregulated as well as absent proteins in the central nervous system is necessary to understand the interplay of migration, differentiation and integration of neuronal progenitor cells at different stages of development. In a first step, differentially expressed proteins of the cerebral cortex of the laboratory rat at three significant stages of development were identified. The cerebral cortex needs differential abundances of proteins during ontogenesis and uses its high plasticity postnatally to adapt to many types of intrinsic and extrinsic changes. This study focuses on the identification of specific proteins which are differentially expressed during postnatal development. Cerebral cortices of P7, P90 and P637 old wistar rats were dissected and analyzed by two- dimensional polyacrylamide gel electrophoresis (2DE) and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) analysis. The identified and differentially expressed proteins are subdivided into 13 different classes. Proteins of the functional classes of the carbohydrate metabolism, structural and regulatory proteins as well as proteins involved in the energy metabolism show the highest differential abundance within the analyzed stages of development. Cytoskeleton proteins like neurofilaments and β-actin are downregulated in early development. In contrast, some proteins which are necessary for migration and motility are upregulated in P7 versus P90 animals. Furthermore, proteins for vesicular trafficking like drebrin and Gdi2 are upregulated in P7. In aged animals oxidative stress sensors, proteins necessary for autophagy of dysfunctional mitochondria, growth control and hypoxia tolerance (Ppp1ca, Eno1) turned out to be upregulated. Overall, energy consumption and differentiation processes as well as specific regulatory mechanisms can be observed at least indirectly by differential abundances of proteins during the investigated stages of ageing. Keywords: Brain; Development; Cerebral Cortex; Proteomics; Rat of synapses, neurons and whole brain regions to adapt their properties depending on their biological task. Different types of neuroplasticity are: Abbreviations: A: Axon; CBB: Coomassie Blue; CpG: Cytoplasmic evolutionary, reactive, adaptive and reparative plasticity [5]. Synaptic Granule; CNS: Central Nervous System; Cts: Centrosome; Cr: plasticity is the most common form of neuroplasticity during aging and Chromosome; CSK: Cytoskeleton; CP: Chaperones; CPM: Cytoplasm; it describes the activity-dependent change of the synaptic transmission CPV: Cytoplasmic Vesicle; CTS: Cytosol; Cx: Cerebral Cortex; ECM: strength [6]. In addition, cortical plasticity follows the activity- Extracellular Matrix; ER: Endoplasmic Reticulum; Eds: Endosome; dependent change of the brain size, the connectivity or the activation ExR: Extracellular Region; GC: Growth Cone; GJ: Gap Junction; patterns of cortical networks [7]. Strength and length of stimuli lead to Golgi: Golgi Apparatus; HGC: Heterotrimeric G-protein Complex; specific interactions of parts of the nervous system which may change LA: Lipid Anchor; Lyso: Lysosome; M: Membrane; Micro: Microsome; the structure of neuronal tissue at the ultrastructural and microscopic MMT: Mitochondrial Matrix; MM: Mitochondrial Membrane; level. In terms of differences in the weight of rat brains as well as body MIM: Mitochondrion Inner Membrane; MIMS: Mitochondrion mass, changes of the abundance pattern of proteins can be determined. Intermembrane Space; MOM: Mitochondrion Outer Membrane; MEL: Especially in the first two postnatal months a strong increase in the rats’ Melanosome; Mito: Mitochondrion; MT: Microtubule; NC: Nucleus; brain mass occurs. Between postnatal day P2 and P25, the biggest mass NF: Neurofilament; NM: Nucleus matrix; NP: Nucleoplasm; P: Proteasome; PA: Proteins Antioxidants; PAAM: Proteins Amino Acid increase can be determined, whereas a further increase happens around Metabolism; PB: Proteins Biosynthesis; PCM: Proteins Carbohydrate P60 [8]. Also until P275 an additional mass increase occurs, but on the Metabolism; PD: Proteins Degradation; Per: Peroxisome; PEM: Proteins whole in a decreased and slower pattern [9]. Energy Metabolism; PEMA: Proteinaceous Extracellular Matrix; PFM: In the first postnatal weeks a considerable number of migratory Proteins Fat Metabolism; PMP: Peripheral Membrane Protein; PR: Proteins Regulation; PST: Proteins Signal Transduction; PTM: Proteins Transmitter Metabolism; RS: Ribosome; S: Synapse; Sc: Secreted; *Corresponding author: Oliver Schmitt, Department of Anatomy, SCc: Spliceosomal Complex; SER: Smooth Endoplasmic Reticulum; Gertrudenstraße 9, 18055 Rostock, Germany, Tel: +49-(0)381-494-8408; SP: Structural Proteins; SV: Synaptic Vesicle; Ss: Synaptosome; SR: E-mail: [email protected] Sarcoplasmic Reticulum; TP: Transport Proteins; ULC: Ubiquitin Received December 22, 2016; Accepted February 24, 2017; Published February Ligase Complex 28, 2017 Citation: Wille M, Schumann A, Kreutzer M, Glocker MO, Wree A, et al. (2017) Introduction Differential Proteomics of the Cerebral Cortex of Juvenile, Adult and Aged Rats: An Ontogenetic Study. J Proteomics Bioinform 10: 41-59. doi: 10.4172/jpb.1000424 Within the intrauterine development from embryonal days (E1- E22) the neurulation occurs during E7 [1,2]. The CNS develops mainly Copyright: © 2017 Wille M, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted between E14 and E22 [3]. Neuroplasticity is a fundamental process for use, distribution, and reproduction in any medium, provided the original author and brain development and neuro-ontogenesis [4]. It describes the property source are credited. J Proteomics Bioinform, an open access journal ISSN: 0974-276X Volume 10(2) 41-59 (2017) - 41 Citation: Wille M, Schumann A, Kreutzer M, Glocker MO, Wree A, et al. (2017) Differential Proteomics of the Cerebral Cortex of Juvenile, Adult and Aged Rats: An Ontogenetic Study. J Proteomics Bioinform 10: 41-59. doi: 10.4172/jpb.1000424 processes (e.g. of the glial progenitor cells) are necessary for the development of the Cx is subdivided into different phases. Originating development of the CNS. This neuronal migration stops at the time of from a three-layer structure, the ventricular, the intermediary and the birth; however, exceptions for different types of cells occur. For example, early marginal zone (preplate) build a new layer (cortical layer), located the migration of neuroblasts in the rostal migratory stream (Figure 1) between preplate and intermediary zone. From here the migration of from the subventricular zone to the olfactory bulb is a physiological postmitotic neurons (cortical plate) begins where densely packed and process in the adult rat. In addition, neuronal progenitors at the border radiating arranged cell extensions are visible. The ventricular zone can of the granular cell layer and the hilus show neurogenesis and migrate be divided into an inner and an outer zone. The inner zone shows a into the granular layer [10]. The synaptogenesis proceeds in two higher cell density than the outer zone [13-16]. An immigration of different phases: early stage (P1-P5) and later stage (P15-P20) [11]. As neurons occurs at the base of the cortical plate [17-18]. Differentiation regards the number of neural and non-neural cells, differences during and synaptogenesis are associative, partly overlapping processes [19]. the development have been observed. While the number of non-neural Within the cortical plate, neuronal cell layering can be divided into cells is limited to 4 million cells (ca. 6% of the total cell number) after the upper marginal zone and the underlying subplate [20]. The cells birth, the number increases up to 140 million cells in the adult rat brain of the subplate show the characteristics of differentiated neurons and, (ca. 50% of the total cell number). A large portion of these non-neural therefore, can process synaptic information from afferent nerve fibers cells originate from the cerebellum (90%). On the whole, the growth of [21]. Additionally, a projection of the neurons themselves into the the non-neural cells (except for the cerebellum) is finished by the end cortical plate, the thalamus and the colliculus superior is observed [22]. of the third postnatal week [8]. The Cx shows the largest increase of mass during the first postnatal The Cx develops from the prosencephalon (Figure 1) [12]. The week. In the following weeks of the first postnatal month, the brain Figure 1: Overview of the rat brain at the level of the Cx. In (a-c) three-dimensional reconstructions of the rat brain from dorsal (a), ventral (b) and lateral (c) are shown. Reconstruction has been build using the neuroVIISAS framework (http://neuroviisas.med.uni-rostock.de/neuroviisas.shtml).
Load more

Recommended publications
  • Cyclin D1/Cyclin-Dependent Kinase 4 Interacts with Filamin a and Affects the Migration and Invasion Potential of Breast Cancer Cells
    Published OnlineFirst February 28, 2010; DOI: 10.1158/0008-5472.CAN-08-1108 Tumor and Stem Cell Biology Cancer Research Cyclin D1/Cyclin-Dependent Kinase 4 Interacts with Filamin A and Affects the Migration and Invasion Potential of Breast Cancer Cells Zhijiu Zhong, Wen-Shuz Yeow, Chunhua Zou, Richard Wassell, Chenguang Wang, Richard G. Pestell, Judy N. Quong, and Andrew A. Quong Abstract Cyclin D1 belongs to a family of proteins that regulate progression through the G1-S phase of the cell cycle by binding to cyclin-dependent kinase (cdk)-4 to phosphorylate the retinoblastoma protein and release E2F transcription factors for progression through cell cycle. Several cancers, including breast, colon, and prostate, overexpress the cyclin D1 gene. However, the correlation of cyclin D1 overexpression with E2F target gene regulation or of cdk-dependent cyclin D1 activity with tumor development has not been identified. This suggests that the role of cyclin D1 in oncogenesis may be independent of its function as a cell cycle regulator. One such function is the role of cyclin D1 in cell adhesion and motility. Filamin A (FLNa), a member of the actin-binding filamin protein family, regulates signaling events involved in cell motility and invasion. FLNa has also been associated with a variety of cancers including lung cancer, prostate cancer, melanoma, human bladder cancer, and neuroblastoma. We hypothesized that elevated cyclin D1 facilitates motility in the invasive MDA-MB-231 breast cancer cell line. We show that MDA-MB-231 motility is affected by disturbing cyclin D1 levels or cyclin D1-cdk4/6 kinase activity.
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • 1 1 Alpha-Smooth Muscle Actin (ACTA2) Is Required for Metastatic Potential of Human 1 Lung Adenocarcinoma 2 3 Hye Won Lee*1,2,3
    Author Manuscript Published OnlineFirst on August 30, 2013; DOI: 10.1158/1078-0432.CCR-13-1181 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. 1 1 Alpha-smooth muscle actin (ACTA2) is required for metastatic potential of human 2 lung adenocarcinoma 3 4 Hye Won Lee*1,2,3, Young Mi Park*3,4, Se Jeong Lee1,4,5, Hyun Jung Cho1,2, Duk-Hwan Kim6,7, 5 Jung-Il Lee2, Myung-Soo Kang3, Ho Jun Seol2, Young Mog Shim8, Do-Hyun Nam1,2,3, Hyeon 6 Ho Kim3,4, Kyeung Min Joo1,3,4,5 7 8 Authors’ Affiliations: 9 1Cancer Stem Cell Research Center, 2Department of Neurosurgery, 3Department of Health 10 Sciences and Technology, Samsung Advanced Institute for Health Sciences and 11 Technology (SAIHST), 4Samsung Biomedical Research Institute, 5Department of Anatomy 12 and Cell Biology, 6Department of Molecular Cell Biology, 7Center for Genome Research, 13 8Department of Thoracic Surgery, Samsung Medical Center, Sungkyunkwan University 14 School of Medicine, Seoul, Korea 15 16 *These authors contributed equally to this work. 17 18 Running title: ACTA2 confers metastatic potential on lung adenocarcinoma 19 Keywords: Non-small cell lung adenocarcinoma, alpha-smooth muscle actin, migration, 20 invasion, metastasis 1 Downloaded from clincancerres.aacrjournals.org on September 26, 2021. © 2013 American Association for Cancer Research. Author Manuscript Published OnlineFirst on August 30, 2013; DOI: 10.1158/1078-0432.CCR-13-1181 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. 2 1 Financial support: This study was supported by a grant from the Korea Healthcare 2 Technology R&D Project, Ministry for Health & Welfare Affairs, Republic of Korea (A092255), 3 and the Basic Science Research Program, National Research Foundation of Korea by the 4 Ministry of Education, Science, and Technology (2011-009329 to H.
    [Show full text]
  • Figure S1. DMD Module Network. the Network Is Formed by 260 Genes from Disgenet and 1101 Interactions from STRING. Red Nodes Are the Five Seed Candidate Genes
    Figure S1. DMD module network. The network is formed by 260 genes from DisGeNET and 1101 interactions from STRING. Red nodes are the five seed candidate genes. Figure S2. DMD module network is more connected than a random module of the same size. It is shown the distribution of the largest connected component of 10.000 random modules of the same size of the DMD module network. The green line (x=260) represents the DMD largest connected component, obtaining a z-score=8.9. Figure S3. Shared genes between BMD and DMD signature. A) A meta-analysis of three microarray datasets (GSE3307, GSE13608 and GSE109178) was performed for the identification of differentially expressed genes (DEGs) in BMD muscle biopsies as compared to normal muscle biopsies. Briefly, the GSE13608 dataset included 6 samples of skeletal muscle biopsy from healthy people and 5 samples from BMD patients. Biopsies were taken from either biceps brachii, triceps brachii or deltoid. The GSE3307 dataset included 17 samples of skeletal muscle biopsy from healthy people and 10 samples from BMD patients. The GSE109178 dataset included 14 samples of controls and 11 samples from BMD patients. For both GSE3307 and GSE10917 datasets, biopsies were taken at the time of diagnosis and from the vastus lateralis. For the meta-analysis of GSE13608, GSE3307 and GSE109178, a random effects model of effect size measure was used to integrate gene expression patterns from the two datasets. Genes with an adjusted p value (FDR) < 0.05 and an │effect size│>2 were identified as DEGs and selected for further analysis. A significant number of DEGs (p<0.001) were in common with the DMD signature genes (blue nodes), as determined by a hypergeometric test assessing the significance of the overlap between the BMD DEGs and the number of DMD signature genes B) MCODE analysis of the overlapping genes between BMD DEGs and DMD signature genes.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Tropomodulin Isoform-Specific Regulation of Dendrite Development and Synapse Formation
    This Accepted Manuscript has not been copyedited and formatted. The final version may differ from this version. Research Articles: Cellular/Molecular Tropomodulin Isoform-Specific Regulation of Dendrite Development and Synapse Formation Omotola F. Omotade1,3, Yanfang Rui1,3, Wenliang Lei1,3, Kuai Yu1, H. Criss Hartzell1, Velia M. Fowler4 and James Q. Zheng1,2,3 1Department of Cell Biology, Emory University School of Medicine, Atlanta, GA 30322. 2Department of Neurology 3Center for Neurodegenerative Diseases, Emory University School of Medicine, Atlanta, GA 30322. 4Department of Molecular Medicine, Scripps Research Institute, La Jolla, CA 92037 DOI: 10.1523/JNEUROSCI.3325-17.2018 Received: 22 November 2017 Revised: 25 September 2018 Accepted: 2 October 2018 Published: 9 October 2018 Author contributions: O.F.O. and J.Q.Z. designed research; O.F.O., Y.R., W.L., and K.Y. performed research; O.F.O. and J.Q.Z. analyzed data; O.F.O. and J.Q.Z. wrote the paper; Y.R., H.C.H., V.M.F., and J.Q.Z. edited the paper; V.M.F. contributed unpublished reagents/analytic tools. Conflict of Interest: The authors declare no competing financial interests. This research project was supported in part by research grants from National Institutes of Health to JQZ (GM083889, MH104632, and MH108025), OFO (5F31NS092437-03), VMF (EY017724) and HCH (EY014852, AR067786), as well as by the Emory University Integrated Cellular Imaging Microscopy Core of the Emory Neuroscience NINDS Core Facilities grant (5P30NS055077). We would like to thank Dr. Kenneth Myers for his technical expertise and help throughout the project. We also thank Drs.
    [Show full text]
  • Wnt/Β-Catenin Signaling Regulates Regeneration in Diverse Tissues of the Zebrafish
    Wnt/β-catenin Signaling Regulates Regeneration in Diverse Tissues of the Zebrafish Nicholas Stockton Strand A dissertation Submitted in partial fulfillment of the Requirements for the degree of Doctor of Philosophy University of Washington 2016 Reading Committee: Randall Moon, Chair Neil Nathanson Ronald Kwon Program Authorized to Offer Degree: Pharmacology ©Copyright 2016 Nicholas Stockton Strand University of Washington Abstract Wnt/β-catenin Signaling Regulates Regeneration in Diverse Tissues of the Zebrafish Nicholas Stockton Strand Chair of the Supervisory Committee: Professor Randall T Moon Department of Pharmacology The ability to regenerate tissue after injury is limited by species, tissue type, and age of the organism. Understanding the mechanisms of endogenous regeneration provides greater insight into this remarkable biological process while also offering up potential therapeutic targets for promoting regeneration in humans. The Wnt/β-catenin signaling pathway has been implicated in zebrafish regeneration, including the fin and nervous system. The body of work presented here expands upon the role of Wnt/β-catenin signaling in regeneration, characterizing roles for Wnt/β-catenin signaling in multiple tissues. We show that cholinergic signaling is required for blastema formation and Wnt/β-catenin signaling initiation in the caudal fin, and that overexpression of Wnt/β-catenin ligand is sufficient to rescue blastema formation in fins lacking cholinergic activity. Next, we characterized the glial response to Wnt/β-catenin signaling after spinal cord injury, demonstrating that Wnt/β-catenin signaling is necessary for recovery of motor function and the formation of bipolar glia after spinal cord injury. Lastly, we defined a role for Wnt/β-catenin signaling in heart regeneration, showing that cardiomyocyte proliferation is regulated by Wnt/β-catenin signaling.
    [Show full text]
  • Effect of Exercise Training on Tropomodulin-2 Gene Expression in Cerebellum of Diabetic Rats
    ORGINAL ARTICLE Effect of Exercise Training on Tropomodulin-2 Gene Expression in Cerebellum of Diabetic Rats Seyed Jalal Taherabadi 1, Masoud Rahmati 1*, Rahim Mirnasuri 1, Abdolreza Kazemi 2 Abstract 1. Department of Sport Sciences, Lorestan Objective: It is well documented that exercise training (ET) University, Khoram Abad, Iran. imposes beneficial effects on diabetes mellitus and its complication 2. Department of Sport Sciences, Vali-E-Asr University of Rafsanjan, Kerman, Iran. such as diabetic peripheral neuropathy (DPN). Regarding the importance of tropomodulin-2 (TMOD2) in nervous system plasticity, this protein may be recognized as a candidate mechanism for ET-induced neuroplasticity. The aim of this study was to *Correspondence: investigate the effects of ET on cerebellar gene expression of Masoud Rahmati, PhD, Department of TMOD2 in rats with DPN. Sport Sciences, Lorestan University, Materials and Methods: Animals were randomly divided into Khoram Abad, Iran. three groups: healthy control (C), diabetic control (DC) and diabetic Tel: (98) 912 452 5538 trained (DT). Diabetes was induced by a single intraperitoneal Email: [email protected] injection of streptozotocin. Behavioral nociception assessment was carried out by Von Frey Filaments and tail-flick tests. TMOD2 gene expression was assessed by real time-PCR . Received: 17 February 2019 Results: The mRNA levels of TMOD2 increased to 0.50-fold ( P- value: 0.005) in comparison of the sedentary controls after 6 weeks Accepted: 21 June 2019 of DPN. Also, TMOD2 gene expression in DT group was decreased Published in August 2019 to -0.68-fold changes in comparison of the C group ( P-value: 0.001).
    [Show full text]
  • Serum Albumin OS=Homo Sapiens
    Protein Name Cluster of Glial fibrillary acidic protein OS=Homo sapiens GN=GFAP PE=1 SV=1 (P14136) Serum albumin OS=Homo sapiens GN=ALB PE=1 SV=2 Cluster of Isoform 3 of Plectin OS=Homo sapiens GN=PLEC (Q15149-3) Cluster of Hemoglobin subunit beta OS=Homo sapiens GN=HBB PE=1 SV=2 (P68871) Vimentin OS=Homo sapiens GN=VIM PE=1 SV=4 Cluster of Tubulin beta-3 chain OS=Homo sapiens GN=TUBB3 PE=1 SV=2 (Q13509) Cluster of Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 (P60709) Cluster of Tubulin alpha-1B chain OS=Homo sapiens GN=TUBA1B PE=1 SV=1 (P68363) Cluster of Isoform 2 of Spectrin alpha chain, non-erythrocytic 1 OS=Homo sapiens GN=SPTAN1 (Q13813-2) Hemoglobin subunit alpha OS=Homo sapiens GN=HBA1 PE=1 SV=2 Cluster of Spectrin beta chain, non-erythrocytic 1 OS=Homo sapiens GN=SPTBN1 PE=1 SV=2 (Q01082) Cluster of Pyruvate kinase isozymes M1/M2 OS=Homo sapiens GN=PKM PE=1 SV=4 (P14618) Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 Clathrin heavy chain 1 OS=Homo sapiens GN=CLTC PE=1 SV=5 Filamin-A OS=Homo sapiens GN=FLNA PE=1 SV=4 Cytoplasmic dynein 1 heavy chain 1 OS=Homo sapiens GN=DYNC1H1 PE=1 SV=5 Cluster of ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide OS=Homo sapiens GN=ATP1A2 PE=3 SV=1 (B1AKY9) Fibrinogen beta chain OS=Homo sapiens GN=FGB PE=1 SV=2 Fibrinogen alpha chain OS=Homo sapiens GN=FGA PE=1 SV=2 Dihydropyrimidinase-related protein 2 OS=Homo sapiens GN=DPYSL2 PE=1 SV=1 Cluster of Alpha-actinin-1 OS=Homo sapiens GN=ACTN1 PE=1 SV=2 (P12814) 60 kDa heat shock protein, mitochondrial OS=Homo
    [Show full text]
  • Anti-Inflammatory Role of Curcumin in LPS Treated A549 Cells at Global Proteome Level and on Mycobacterial Infection
    Anti-inflammatory Role of Curcumin in LPS Treated A549 cells at Global Proteome level and on Mycobacterial infection. Suchita Singh1,+, Rakesh Arya2,3,+, Rhishikesh R Bargaje1, Mrinal Kumar Das2,4, Subia Akram2, Hossain Md. Faruquee2,5, Rajendra Kumar Behera3, Ranjan Kumar Nanda2,*, Anurag Agrawal1 1Center of Excellence for Translational Research in Asthma and Lung Disease, CSIR- Institute of Genomics and Integrative Biology, New Delhi, 110025, India. 2Translational Health Group, International Centre for Genetic Engineering and Biotechnology, New Delhi, 110067, India. 3School of Life Sciences, Sambalpur University, Jyoti Vihar, Sambalpur, Orissa, 768019, India. 4Department of Respiratory Sciences, #211, Maurice Shock Building, University of Leicester, LE1 9HN 5Department of Biotechnology and Genetic Engineering, Islamic University, Kushtia- 7003, Bangladesh. +Contributed equally for this work. S-1 70 G1 S 60 G2/M 50 40 30 % of cells 20 10 0 CURI LPSI LPSCUR Figure S1: Effect of curcumin and/or LPS treatment on A549 cell viability A549 cells were treated with curcumin (10 µM) and/or LPS or 1 µg/ml for the indicated times and after fixation were stained with propidium iodide and Annexin V-FITC. The DNA contents were determined by flow cytometry to calculate percentage of cells present in each phase of the cell cycle (G1, S and G2/M) using Flowing analysis software. S-2 Figure S2: Total proteins identified in all the three experiments and their distribution betwee curcumin and/or LPS treated conditions. The proteins showing differential expressions (log2 fold change≥2) in these experiments were presented in the venn diagram and certain number of proteins are common in all three experiments.
    [Show full text]
  • Supplemental Information
    Supplemental information Dissection of the genomic structure of the miR-183/96/182 gene. Previously, we showed that the miR-183/96/182 cluster is an intergenic miRNA cluster, located in a ~60-kb interval between the genes encoding nuclear respiratory factor-1 (Nrf1) and ubiquitin-conjugating enzyme E2H (Ube2h) on mouse chr6qA3.3 (1). To start to uncover the genomic structure of the miR- 183/96/182 gene, we first studied genomic features around miR-183/96/182 in the UCSC genome browser (http://genome.UCSC.edu/), and identified two CpG islands 3.4-6.5 kb 5’ of pre-miR-183, the most 5’ miRNA of the cluster (Fig. 1A; Fig. S1 and Seq. S1). A cDNA clone, AK044220, located at 3.2-4.6 kb 5’ to pre-miR-183, encompasses the second CpG island (Fig. 1A; Fig. S1). We hypothesized that this cDNA clone was derived from 5’ exon(s) of the primary transcript of the miR-183/96/182 gene, as CpG islands are often associated with promoters (2). Supporting this hypothesis, multiple expressed sequences detected by gene-trap clones, including clone D016D06 (3, 4), were co-localized with the cDNA clone AK044220 (Fig. 1A; Fig. S1). Clone D016D06, deposited by the German GeneTrap Consortium (GGTC) (http://tikus.gsf.de) (3, 4), was derived from insertion of a retroviral construct, rFlpROSAβgeo in 129S2 ES cells (Fig. 1A and C). The rFlpROSAβgeo construct carries a promoterless reporter gene, the β−geo cassette - an in-frame fusion of the β-galactosidase and neomycin resistance (Neor) gene (5), with a splicing acceptor (SA) immediately upstream, and a polyA signal downstream of the β−geo cassette (Fig.
    [Show full text]
  • Cyclophilin B Facilitates the Replication of Orf Virus Kui Zhao1, Jida Li2, Wenqi He1, Deguang Song1, Ximu Zhang3, Di Zhang1, Yanlong Zhou1 and Feng Gao1,4*
    Zhao et al. Virology Journal (2017) 14:114 DOI 10.1186/s12985-017-0781-x RESEARCH Open Access Cyclophilin B facilitates the replication of Orf virus Kui Zhao1, Jida Li2, Wenqi He1, Deguang Song1, Ximu Zhang3, Di Zhang1, Yanlong Zhou1 and Feng Gao1,4* Abstract Background: Viruses interact with host cellular factors to construct a more favourable environment for their efficient replication. Expression of cyclophilin B (CypB), a cellular peptidyl-prolyl cis-trans isomerase (PPIase), was found to be significantly up-regulated. Recently, a number of studies have shown that CypB is important in the replication of several viruses, including Japanese encephalitis virus (JEV), hepatitis C virus (HCV) and human papillomavirus type 16 (HPV 16). However, the function of cellular CypB in ORFV replication has not yet been explored. Methods: Suppression subtractive hybridization (SSH) technique was applied to identify genes differentially expressed in the ORFV-infected MDBK cells at an early phase of infection. Cellular CypB was confirmed to be significantly up- regulated by quantitative reverse transcription-PCR (qRT-PCR) analysis and Western blotting. The role of CypB in ORFV infection was further determined using Cyclosporin A (CsA) and RNA interference (RNAi). Effect of CypB gene silencing on ORFV replication by 50% tissue culture infectious dose (TCID50) assay and qRT-PCR detection. Results: In the present study, CypB was found to be significantly up-regulated in the ORFV-infected MDBK cells at an early phase of infection. Cyclosporin A (CsA) exhibited suppressive effects on ORFV replication through the inhibition of CypB. Silencing of CypB gene inhibited the replication of ORFV in MDBK cells.
    [Show full text]