Conservation Genet Resour (2010) 2:325–327 DOI 10.1007/s12686-010-9228-z

TECHNICAL NOTE

Anonymous nuclear markers for SouthEast Asian halfbeak fishes (Dermogenys)

Mark de Bruyn • Wendy Grail • Axel Barlow • Gary R. Carvalho

Received: 25 March 2010 / Accepted: 4 April 2010 / Published online: 27 April 2010 Ó Springer Science+Business Media B.V. 2010

Abstract We report the development of nine single-copy Historically, mitochondrial DNA has been the workhorse anonymous nuclear polymorphic loci (SCNPs) developed of phylogeographic and phylogenetic studies, however, from the SouthEast Asian freshwater livebearing halfbeak this single, generally non-recombining and matrilinealy fish Dermogenys pusilla. Ninety-six clones from a geno- inherited locus may reveal a biased picture of the evo- mic library were examined, and 43 potential loci were lutionary history of the taxon in question (Ballard tested across several species of Dermogenys, and in the and Whitlock 2004). Researchers have recently begun related halfbeak Hemirhamphodon pogonognathus. All loci utilising anonymous single-copy nuclear polymorphic reported here amplified successfully in six putative species sequence (SCNPs) data in an attempt to resolve questions of Dermogenys, but not in Hemirhamphodon. An average regarding phylogeny, phylogeography and population of 50 SNPs per kilobase were identified (total of 5,850 bp genetics. Herein we describe the development of nine sequenced per individual). These markers should provide a such markers (Table 1) for use in Dermogenys van useful resource for species delineation, and other phylo- Hasselt 1823, a livebearing freshwater fish genus from genetic, phylogeographic and population genetic studies of SouthEast Asia. Dermogenys halfbeaks. We assembled a genomic library from a single Der- mogenys pusilla specimen sampled from near Surabaya, Keywords Anonymous nuclear loci Halfbeak Java Island, Indonesia. Total genomic DNA was extracted Hemirhamphidae Teleost following the high-salt method (Aljanabi and Martinez 1997) from a large piece of tissue (±1cm3). This extract was concentrated to *550 ng/lL (assayed on a Nano- The SouthEast Asian region has intrigued biologists for Drop ND-1000) using a vacufuge. Approximately 12 lg more than a century (Wallace 1859). Four biodiversity of DNA was randomly fragmented by restriction digest hotspots overlap within this region (Myers et al. 2000), yet using RsaI. The digest was visualised on a 1% agarose its fauna and flora are under considerable threat from gel, and products of approximately 0.5–1.5 kb were anthropogenic-related activities (Dudgeon et al. 2006). excised and purified using a QIAGEN Gel Extraction Kit, Understanding the mechanisms that have generated such according to the manufacturer’s instructions (eluted in high levels of biodiversity in this region is paramount to 50 lL autoclaved DNAse and RNAse-free water). This establishing credible conservation programs. Researchers size selected DNA was quantified initially at 17 ng/lL, have recently turned to molecular data to better understand and subsequently vacufuged to a final concentration of these mechanisms and their influence on evolutionary 45 ng/lL, in order to provide the correct molar ratio diversification in this region. ([10:1) of insert to vector for blunt-ended ligation. Approximately 100 ng of DNA was ligated into 25 ng of PCR Zero Blunt vector (Invitrogen) and transformed into & M. de Bruyn ( ) W. Grail A. Barlow G. R. Carvalho competent One Shot TOP10 E. coli cells (Invitrogen), School of Biological Sciences, Bangor University, Deiniol Road, Bangor LL57 2UW, UK plated onto agar plates containing kanamycin (50 lg/mL), e-mail: [email protected] and grown overnight at 37°C. 123 326 Conservation Genet Resour (2010) 2:325–327

Table 1 Primer sequences for nine anonymous nuclear loci for the freshwater fish genus Dermogenys, developed from a genomic library of Dermogenys pusilla

0 0 Locus Genbank Accession Primer sequence (5 –3 ) % div. bp S phW G–C

Dp1 GS926396 F: TCTTTTATTCACCAATATGTTGTTTTT 0.014–0.018 513 10 0.0156 0.0156 0.438 R: ACTGAACGTCCTAGCGGATG Dp5 GS926402 F: ATGTGGATGGATTCGAGAGG 0.012–0.040 332 20 0.0259 0.0297 0.383 R: TGCAGTGTTGAATTGACCAAA Dp6 GS926403 F: GAAAATGTGTGCAACACTGAAAA 0.002–0.014 421 8 0.0091 0.0092 0.429 R: TTTGCAGGCTCAAAAAGACC Dp8 GS926404 F: TCACAGATCCAGATCAGAGGATT 0.020–0.046 369 24 0.0300 0.0326 0.340 R: CTCTCATCGGGTCCTTTCAG Dp14 GS926397 F: AGCCATTCTCCCCTCTGTCT 0.000–0.056 320 21 0.0184 0.0254 0.414 R: GTCCGCCTGTGTTTGAAAAG Dp21 GS926398 F: CCAACATCTTGACGGAATCG 0.000–0.025 637 22 0.0102 0.0134 0.474 R: TTACAGTTTCCCAGCTGCAT Dp35 GS926399 F: GAAGACCCACAACACCCTGT 0.006–0.069 367 32 0.0263 0.0361 0.409 R: CGAGTTTGCACTCCTCAGGT Dp37 GS926400 F: CATGCTCTGGTTTACTGACTGAA 0.009–0.060 240 19 0.0349 0.0388 0.353 R: GGTAGCGGTGGCAGTTGTAT Dp39 GS926401 F: TGTGAAAACAAAGGAAGTTGGA 0.025–0.042 405 25 0.0330 0.0338 0.351 R: GGGTCAGCAAAGTCAAAACAA Minimum and maximum percent pairwise sequence divergence (% div.); size of alignable sequence in base pairs (bp); number of variable sites (S); nucleotide diversity per site (p); Watterson’s estimate of theta per site (hW); and GC content (G–C) are shown

Ninety six colonies were picked individually into 2 ml Noonan and Yoder 2009), and used a standard touchdown LB-kanamycin (50 lg/ml) liquid medium using autoclaved program: 95°C—2 min; 109 [95°C—35 s, 63°C—35 s toothpicks, and grown overnight at 37°C with gentle (-0.5°C/cycle), 72°C—1 min]; 109 (95°C—35 s, 58°C— shaking. PCR reactions were set up using 23.5 ll Abgene 35 s, 72°C—1 min); 159 (95°C—35 s, 52°C—35 s, TM 1.19 ReddyMix , 0.5 ll each primer (M13F & R pro- 72°C—1 min); 72°C—10 min; and standard reaction con- vided with the Invitrogen kit), and 0.5 ll template directly ditions [2.0 mM MgCl2, 0.3 mM each dNTP, 0.5 U Taq pipetted from each individual overnight culture. These 96 polymerase (Promega), 10 ll final volume]. Nine of the 32 PCR products were subsequently visualised on a 1% aga- loci tested reliably amplified a single product in six geo- rose gel to determine product size. Forty-three of these graphically disparate putative species (Meisner 2001)of products, ranging in size from 300–1,500 bp, were purified Dermogenys, while none amplified successfully in the (ExoSAP) and sequenced, using the forward and reverse related halfbeak Hemirhamphodon pogonognathus. Levels M13 primers used in PCR. Sequences were translated into of pairwise sequence divergence in Dermogenys ranged amino acid sequences to ensure they were non-coding, from 0 (Dp 14 & 21) to 6.9% (Dp 35) (Table 1), with an BLAST searched to check for anonymity, and aligned average of 50 single nucleotide polymorphisms (SNPs) per against one another to ensure they were unique. Three kilobase. These loci, alongside mitochondrial markers, will sequences returned positive BLAST hits, aligning to form the basis of our future phylogeographic investigations known fish (Oryzias latipes 9 2, and Hippoglossus hip- of Dermogenys. poglossus 9 1) genes, and were thus discarded. Primers were designed for 32 of the remaining 40 sequences using Acknowledgments We thank Bryan Carstens and Bryce Noonan Primer 3 (Rozen and Skaletsky 2000), after rejecting 8 for helpful advice and protocols. This research was funded by a European Community Marie Curie Incoming International Fellowship sequences for small size, or the failure of Primer 3 to (FP6 MIIF-CT-2006-39798) to MdB. design suitable primers. These primers were tested on six putative Dermogenys species (D. pusilla, D. collettei, D. siamensis, D. sumatrana, D. bispina, D. burmanica), References and the related halfbeak Hemirhamphodon pogonognathus (Meisner 2001). Aljanabi SM, Martinez I (1997) Universal and rapid salt-extraction of Due to the large number of primer sets available we high quality genomic DNA for PCR-based techniques. Nucleic chose not to optimize each primer set individually (as per Acids Res 25:4692–4693

123 Conservation Genet Resour (2010) 2:325–327 327

Ballard JWO, Whitlock MC (2004) The incomplete natural history of Noonan BP, Yoder AD (2009) Anonymous nuclear markers for mitochondria. Mol Ecol 13:729–744 Malagasy plated lizards (Zonosaurus). Mol Ecol Resour 9:402– Dudgeon D, Arthington AH, Gessner MO et al (2006) Freshwater 404 biodiversity: importance, threats, status and conservation chal- Rozen S, Skaletsky HJ (2000) Primer 3 on the WWW for general lenges. Biol Rev 81:163–182 users and biologist programmers. In: Krawetz S, Misener S (eds) Meisner AD (2001) Phylogenetic systematics of the viviparous Bioinformatics, methods and protocols: methods in molecular halfbeak genera Dermogenys and Nomorhamphus (Teleostei: biology. Humana Press, Totowa, pp 365–386 Hemirhaphidae: Zenarchopterinae). Zool J Linn Soc 133:199– Wallace AR (1859) Letter from Mr Wallace concerning the 283 geographical distribution of birds. Ibis 1:449–454 Myers N, Mittermeier RA, Mittermeier CG et al (2000) Biodiversity hotspots for conservation priorities. Nature 403:853–858

123