Conservation Genet Resour (2011) 3:155–157 DOI 10.1007/s12686-010-9312-4

TECHNICAL NOTE

Anonymous nuclear markers for halfbeak fishes of the genus Hemirhamphodon

Mark de Bruyn • Wendy Grail • Gary R. Carvalho

Received: 13 August 2010 / Accepted: 26 August 2010 / Published online: 12 September 2010 Ó Springer Science+Business Media B.V. 2010

Abstract We developed ten single-copy anonymous have recently turned to molecular data to help investigate nuclear polymorphic loci (SCNPs) molecular markers from the biogeographical history of this region, and to assess to the Southeast Asian freshwater livebearing halfbeak fish what extent, if any, cryptic levels of variation exist. Hemirhamphodon pogonognathus. Ninety-six clones from Historically, mitochondrial DNA has been the workhorse a genomic library were examined, and 37 potential loci of phylogeographic and phylogenetic studies, however this were tested across several species of Hemirhamphodon, single, generally non-recombining and matrilinealy inher- and in the related halfbeak Dermogenys pusilla. All 10 loci ited locus may reveal a biased picture of the evolutionary reported here amplified successfully in four putative history of the taxon in question (Ballard and Whitlock 2004). species of Hemirhamphodon, but only one amplified in Researchers have recently begun utilising anonymous sin- D. pusilla. An average of 57 SNPs per kilobase were gle-copy nuclear polymorphic sequence (SCNPs) data in an identified (total of 4,462 bp sequenced per individual). The attempt to resolve questions regarding phylogeny, phylo- markers documented here provide a useful resource for geography and population genetics. Herein we describe the ongoing investigations into the biogeographical history of development of ten such markers (Table 1) for use in SouthEast Asia, and the population genetic structure and Hemirhamphodon Bleeker 1866, a livebearing freshwater phylogenetic relationships of Hemirhamphodon halfbeaks. fish genus from SouthEast Asia. We assembled a genomic library from a single Hemir- Keywords Anonymous nuclear loci Halfbeak hamphodon pogonognathus specimen sampled from near Hemirhamphidae Teleost Jambi, Sumatra, Indonesia. Total genomic DNA was extracted following the high-salt method (Aljanabi and Martinez 1997) from a large piece of tissue (±1cm3). This Within SouthEast Asia, four biodiversity hotspots have been extract was concentrated to *550 ng/lL (assayed on a identified: the Indo-Burma, Wallacea, Sundaland and Phil- NanoDrop ND-1000) using a vacufuge. Approximately ippine hotspots (Myers et al. 2000). These hotspots have 12 lg of DNA was randomly fragmented by restriction been mapped based on the distribution of terrestrial fauna digest using RsaI. The digest was visualised on a 1% and flora, however, a knowledge gap exists in our under- agarose gel, and products of approximately 0.5–1.5 kb standing of how freshwater biodiversity is distributed in this were excised and purified using a QIAGEN Gel Extraction region. Freshwater diversity levels in the region are also Kit, according to the manufacturer’s instructions (eluted in believed to be extremely high, with Indonesia probably 50 lL autoclaved DNAse and RNAse-free water). This accounting for some 15% of the global freshwater fauna size selected DNA was quantified initially at 17 ng/lL, alone (Braatz et al. 1992; Dudgeon et al. 2006). Researchers and subsequently vacufuged to a final concentration of 45 ng/lL, in order to provide the correct molar ratio ([10:1) of insert to vector for blunt-ended ligation. & M. de Bruyn ( ) W. Grail G. R. Carvalho Approximately 100 ng of DNA was ligated into 25 ng of School of Biological Sciences, Bangor University, Deiniol Road, Bangor LL57 2UW, UK PCR Zero Blunt vector (Invitrogen) and transformed into e-mail: [email protected] competent One Shot TOP10 E. coli cells (Invitrogen), 123 156 Conservation Genet Resour (2011) 3:155–157

Table 1 Primer sequences for 10 anonymous nuclear loci for the freshwater fish genus Hemirhamphodon, developed from a genomic library of Hemirhamphodon pogonognathus

0 0 Locus Genbank Primer sequence (5 –3 ) % div. bp S phW G ? C Indels accession (yes or no)

Hp5 HN153645 F: CCCCATGATTGATTAGCTTG 0.004–0.058 271 19 0.033 0.037 0.372 Y R: CACGATTGTTGCAACTCACTCT Hp8 HN153651 F: CAGACATTTTAATAACCTGGCAAA 0.003–0.074 408 32 0.033 0.044 0.382 Y R: TGTGTCGTACATGGCTGTGA Hp13 HN153643 F: TTGGCCCAATGATTTATTTGT 0.006–0.043 325 24 0.026 0.032 0.361 N R: TTGGTGGTGTAGTTCCTCCTC Hp42 HN153644 F: GTGTTAGTGAGCCGCTTCG 0.000–0.039 289 13 0.020 0.020 0.399 N R: GTTTCCTGCAGGCGAAGTT Hp54 HN153646 F: ATTGGCCAAAACCATAGCAG 0.000–0.029 177 6 0.013 0.015 0.342 N R: GCCACACCTTTTTCCCTTTT Hp56 HN153647 F: AAAAACCGTAGACAGACTTAAAGC 0.008–0.068 299 24 0.039 0.041 0.347 Y R: TGTCCTGTCAAACCCAGAAA Hp59 HN153648 F: CAAGAGTGTGGATAAAGGCAGTT 0.000–0.113 306 29 0.048 0.061 0.235 Y R: AAAACAAGAAACAGTTATGGTTTACCT Hp63 HN153649 F: TGACCGATACAGGGATGAGA 0.000–0.026 280 8 0.010 0.013 0.393 Y R: TCCAACTTTACTGCCGGAAT Hp75 HN153650 F: CTTCCCTCCTTCTCCTCCAC 0.009–0.035 447 19 0.021 0.021 0.417 Y R: CGAAGCAGTTAACGGTCACA Hp84 HN153652 F: GACCGTGAGTCTGAGCCTGT 0.004–0.021 543 18 0.011 0.015 0.605 N R: CCGGACTTATGCCCACAAT Minimum and maximum percent pairwise sequence divergence (% div.); size of alignable sequence in base pairs (bp); number of variable sites (S); nucleotide diversity per site (p); Watterson’s estimate of theta per site (hW); GC content (G ? C); presence or absence of insertions/deletions (indels) are shown plated onto agar plates containing kanamycin (50 lg/mL), primers were tested on four putative Hemirhamphodon and grown overnight at 37°C. species (Hemirhamphodon pogonognathus, H. tengah, H. Ninety-six colonies were picked individually into 2 mL kuekenthali, H. chrysopunctatus), and the related halfbeak LB-kanamycin (50 lg/mL) liquid medium using auto- Dermogenys pusilla (Meisner 2001). claved toothpicks, and grown overnight at 37°C with gentle Due to the large number of primer sets available we shaking. PCR reactions were set up using 23.5 lL Abgene chose not to optimize each primer set individually (as per 1.1 9 ReddyMixTM, 0.5 lL each primer (M13F&R pro- Noonan and Yoder 2009), and used a standard touchdown vided with the Invitrogen kit), and 0.5 lL template directly program: 95°C—2 min; 109 [95°C—35 s, 63°C—35 s pipetted from each individual overnight culture. These 96 (-0.5°C/cycle), 72°C—1 min]; 109 (95°C—35 s,58°C— PCR products were subsequently visualised on a 1% aga- 35 s, 72°C—1 min); 159 (95°C—35 s, 52°C—35 s, rose gel to determine product size. Sixty-three of these 72°C—1 min); 72°C—10 min; and standard reaction con- products, ranging in size from 200 to 1,300 bp, were ditions [2.0 mM MgCl2, 0.3 mM each dNTP, 0.5 U Taq purified (ExoSAP) and sequenced, using the forward and polymerase (Promega), 10 lL final volume]. Ten of the 36 reverse M13 primers used in PCR. Sequences were trans- loci tested reliably amplified a single product in four geo- lated into amino acid sequences to ensure they were non- graphically disparate putative species (Meisner 2001)of coding, BLAST searched to check for anonymity, and Hemirhamphodon, while one (locus Hp 75) amplified aligned against one another to ensure they were unique. successfully in the related halfbeak Dermogenys pusilla. Four sequences returned positive BLAST hits, aligning to Levels of pairwise sequence divergence in Hemirhamph- known fish (Oryzias latipes 9 1, Epinephelus itajara 9 1, odon ranged from 0% (Hp 42, 54, 59 & 63) to 11.3% (Hp Danio rerio 9 1, Gasterosteus aculeatus 9 1) genes, and 59) (Table 1), with an average of 57 single nucleotide were thus discarded. Primers were designed for 36 of the polymorphisms (SNPs) per kilobase. These loci, alongside remaining 59 sequences using Primer 3 (Rozen and Ska- mitochondrial markers, will form the basis of our future letsky 2000), after rejecting 23 sequences for small size, or phylogeographic and biogeographic investigations of the failure of Primer 3 to design suitable primers. These Hemirhamphodon.

123 Conservation Genet Resour (2011) 3:155–157 157

Acknowledgments We thank Bryan Carstens and Brice Noonan for Dudgeon D, Arthington AH, Gessner MO et al (2006) Freshwater helpful advice and protocols. This research was funded by a European biodiversity: importance, threats, status and conservation chal- Community Marie Curie Incoming International Fellowship (FP6 lenges. Biol Rev 81:163–182 MIIF-CT-2006-39798), and a National Geographic Society Research Meisner AD (2001) Phylogenetic systematics of the viviparous Grant (8541-08) to MdB. halfbeak genera Dermogenys and Nomorhamphus (Teleostei: Hemirhaphidae: Zenarchopterinae). Zool J Linn Soc 133: 199–283 References Myers N, Mittermeier RA, Mittermeier CG et al (2000) Biodiversity hotspots for conservation priorities. Nature 403:853–858 Noonan BP, Yoder AD (2009) Anonymous nuclear markers for Aljanabi SM, Martinez I (1997) Universal and rapid salt-extraction of Malagasy plated lizards (Zonosaurus). Mol Ecol Resour 9: high quality genomic DNA for PCR-based techniques. Nucleic 402–404 Acids Res 25:4692–4693 Rozen S, Skaletsky HJ (2000) Primer 3 on the WWW for general Ballard JWO, Whitlock MC (2004) The incomplete natural history of users and biologist programmers. In: Krawetz S, Misener S (eds) mitochondria. Mol Ecol 13:729–744 Bioinformatics methods and protocols: methods in molecular Braatz S, Davis G, Shen S et al (1992) Conserving biological diversity. biology. Humana Press, Totowa, pp 365–386 A strategy for protected areas in the Asia-Pacific Region. World Bank Tech Paper 193:1–66

123