DOCSLIB.ORG

Molecular Mechanisms Controlling Centriole Duplication

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Molecular Mechanisms Controlling Centriole Duplication Molecular Mechanisms Controlling Centriole Duplication Item Type text; Electronic Dissertation Authors Boese, Cody Citation Boese, Cody. (2020). Molecular Mechanisms Controlling Centriole Duplication (Doctoral dissertation, University of Arizona, Tucson, USA). Publisher The University of Arizona. Rights Copyright © is held by the author. Digital access to this material is made possible by the University Libraries, University of Arizona. Further transmission, reproduction, presentation (such as public display or performance) of protected items is prohibited except with permission of the author. Download date 05/10/2021 17:34:06 Link to Item http://hdl.handle.net/10150/648667 MOLECULAR MECHANISMS CONTROLLING CENTRIOLE DUPLICATION by Cody Boese ____________________________ Copyright © Cody Boese 2020 A Dissertation Submitted to the Faculty of the GRADUATE INTERDISCIPLINARY PROGRAM IN CANCER BIOLOGY In Partial Fulfillment of the Requirements For the Degree of DOCTOR OF PHILOSOPHY In the Graduate College THE UNIVERSITY OF ARIZONA 2020 THE UNIVERSITY OF ARIZONA GRADUATE COLLEGE As members of the Dissertation Committee, we certify that we have read the dissertation prepared by: Cody Boese titled: Molecular mechanisms controlling centriole assembly and recommend that it be accepted as fulfilling the dissertation requirement for the Degree of Doctor of Philosophy. Gregory C Rogers Date: Jul 21, 2020 Gregory C Rogers Date: Jul 21, 2020 Anne E Cress Date: Oct 22, 2020 Keith Maggert Date: Jul 21, 2020 Ghassan Mouneimne Date: Aug 3, 2020 Nathan Ellis Final approval and acceptance of this dissertation is contingent upon the candidate’s submission of the final copies of the dissertation to the Graduate College. I hereby certify that I have read this dissertation prepared under my direction and recommend that it be accepted as fulfilling the dissertation requirement. Gregory C Rogers Date: Jul 21, 2020 Gregory C Rogers Cellular and Molecular Medicine 2 ACKNOWLEDGEMENTS I would like to thank my P.I., Greg Rogers for mentoring me and teaching me, but mostly for being so supportive of all my ideas. I would like to thank my committee, Nathan Ellis, Keith Maggert, Gus Mouneimne, and Anne Cress for always being willing to meet with me and for helping me think critically about my research. I would like to thank all members of the Rogers lab for their ideas and help with technical aspects of my project, but mostly for being an all-around good group to be around. Lastly, a special thanks to my family and friends, especially my fiancé, Irene Moreno for her never ending, all-around support throughout these years. 3 TABLE OF CONTENTS LIST OF FIGURES………...……………………………………………………………………7 LIST OF TABLES………………………...…………………………………………….……….9 ABSTRACT…………………………………………………………………………….……….10 CHAPTER ONE: CENTROSOMES – AN OVERVIEW 1.1 Introduction…………………………………………………………………………………12 1.2 Centrosome Dysregulation and Cancer………………………….………………………..12 1.3 The Centriole – The Key to Centrosome Duplication……………………………………17 1.4 Molecular Regulation of Centrosome Duplication……………………………………….17 A. Forming the Spot of Centriole Assembly……………………………………………...17 B. From Procentriole Spot to Cartwheel Formation…………………………………….20 C. Centriole Growth………………………………………………………..……………...22 D. Centriole Disengagement and Licensing for Reduplication………..………………...23 1.5 Molecular Regulation of Centrosome Function…………………………………………..25 A. Pericentriolar Material Assembly……………………………………………………..25 B. Centrosome Separation………………………………………………………………...27 1.6 Figures……………………………………………………………………………………….29 1.7 Tables………………………………………………………………………………………..33 4 CHAPTER TWO: ASTERLESS IS A POLO-LIKE KINASE 4 SUBSTRATE THAT BOTH ACTIVATES AND INHIBITS KINASE ACTIVITY DEPENDING ON ITS PHOSPHORYLATION STATE 2.1 Abstract…………………………………………………………………………………...…35 2.2 Introduction…………………………………………………………………………………36 2.3 Results……………………………………………………………………………………….38 2.4 Discussion…………………………………………………………………………………...50 2.5 Materials and Methods……………………………………………………………………..54 2.6 Figures……………………………………………………………………………………….62 2.7 Tables………………………………………………………………………………………..83 CHAPTER THREE: ASTERLESS PHOSPHORYLATION PROMOTES SINGLE SITE OF CENTRIOLE ASSEMBLY 3.1 Abstract………………………………………………………………………….………..…85 3.2 Introduction……………………………………………………………………….……..….85 3.3 Results and Discussion…………………………………………………………………...…88 3.4 Materials and Methods…………………………………………………………………..…98 3.5 Figures……………………………………………………………………………………...103 5 CHAPTER 4: FUTURE DIRECTIONS AND CONCLUSIONS 4.1 Identification of a Cellular Plk4 Inhibitor………...………………………………..……119 4.2 Formation of the Procentriole Spot by Wdb……………………………...………..……121 4.3 Further Molecular Characterizations of the Asl-Plk4 Interaction …………….……...123 4.4 Figures…………………………………………………………………………………...…125 APPENDIX A: PUBLICATIONS …….……………….………………………………….…131 COMPLETE LIST OF REFERENCES…………………………..…………………….…...132 6 LIST OF FIGURES 1.1 The Centrosome: A Mother-Daughter Centriole Pair Surrounded my Pericentriolar Material…………………………………………..………………………………………….29 1.2 Two Centrosomes Facilitate Bipolar Mitotic Spindle Formation……………………….30 1.3 Centriole Duplication Cycle – An Overview……………………………………………...31 1.4 Centrioles Exhibit a Nine-Fold Radial Symmetry………………………………………..32 2.1 Plk4 Phosphorylates the N-terminal Domain of Asl….……………………………..……62 2.2 Asl-A Phosphomutants are Largely α-helical and Self-Oligomerize……………..……..64 2.3 The Phosphorylation State of Asl-A Controls Plk4 Activity……………………………..67 2.4 Nonphosphorylatable Asl-A (13A) Stimulates Plk4 Activity In Vitro……………….….69 2.5 Asl-A Phosphomutants Control Kinase Activity by Modulating Plk4 Inhibition……...71 2.6 Plk4 Phosphorylates Its Kinase domain and Asl-A, Generating a State that Inhibits Kinase Activity…..……………………………………………………………………………...73 S2.1 Full-length Asl Phosphomutants Induce Centriole Amplification……….…………….75 S2.2 The Phosphorylation State of Asl-A Does Not Influence Cellular Aggregate Formation and has Little Effect on Binding to Plk4 PB1-PB2………………….………………………..77 S2.3 Plk4 S228 Phosphomutants are Catalytically Active but do not Bind Asl-A When Lacking PB1-PB2…………………………………….………………………………………....80 3.1 Phosphorylation of T3 and S7 in Asterless-A is Necessary and Sufficient to Block Centriole Duplication………………………..……………………………………………...…103 7 3.2 Asl-A-Plk4 Interaction is Required for Asl-A-2PM to Block Centriole Duplication…106 3.3 Phospho-Asl Forms a Ring of Puncta at the Mother Centriole that may Prohibit Daughter Centriole Assembly.………………………………………………………………..108 3.4 Wdb Interacts with Asl and Promotes Active Site of Centriole Assembly…………….110 S3.1 Development of Plk4 and Asl Phospho-Specific Antibodies…..………………………113 S3.2 Wdb and Wrd Localize to Centrioles and Cause Centriole Amplification When Overexpressed…………………………...…………………………………………………….115 S3.3 Wdb Interacts with Ana2 and Forms a Complex with Plk4 and Asl-A.……………..117 4.1 Screen to Determine Co-Inhibitor of Plk4……………..………………………………...125 4.2 Utilization of a Proximity-Dependent Biotinylation Assay……………………………..126 4.3 Centriolar Localization of Wdb and Ana2………………………………………………128 4.4 Asl-A dimerization is Required for its Interaction with Plk4…………………………..129 8 LIST OF TABLES 1.1 A List of Centrosome Associated Proteins and Their Functions……….….…………….33 2.1 Phosphorylation Sites of Asl-A……………...………………………………………….….83 9 ABSTRACT Centrioles are barrel shaped, non-membrane bound organelles that typically exist in pairs where the younger ‘daughter’ centriole emanates orthogonally off of the proximal end of the older ‘mother’ centriole. The mother-daughter centriole pair and their surrounding proteins constitute the centrosome, which is the primary regulator of chromosome separation and cell division in animal cells. The centrosome controls these processes by acting as the microtubule organizing center (MTOC) of the cell – it nucleates microtubules during mitosis to form the mitotic spindle required to promote chromosome segregation. In order for proper chromosome segregation to occur, each cell needs to contain only two centrosomes entering mitosis – one at each pole to achieve spindle bipolarity. To achieve this, each centrosome must duplicate itself throughout the cell cycle. This duplication event is orchestrated by the centrioles – a single daughter centriole is built off of each mother centriole as the cell cycle progresses. The formation of excess daughter centrioles around a mother is a mechanism of centriole amplification, which is a driver of aneuploidy and tumor formation. Because of this, the process of centriole duplication is tightly controlled on a molecular level. The process of centriole duplication is coordinated in part by two conserved proteins: the Ser/Thr kinase Plk4 and its multifunctional regulator, Asterless. Previous work has shown that an excess of Asl protein levels, Plk4 protein levels and Plk4 catalytic activity can contribute to centriole amplification. Thus, it is crucial to obtain a complete understanding of how Plk4 and Asl coordinate their functions to ensure centrioles duplicate properly. It is known that Asl can regulate Plk4 by targeting it to the centriole as well as control its stability in a cell-cycle dependent manner. However, we still have an incomplete understanding of exactly how these two proteins promote the formation of a single daughter centriole during each cell cycle. Here we 10 identify multiple new regulatory mechanisms that Plk4 and Asl utilize in order to control centriole assembly. First, we identify Asl as a multifunctional phosphorylation-dependent regulator
Load more

Recommended publications
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • A Genome-Wide Association Study Identifies New Susceptibility Loci for Esophageal Adenocarcinoma and Barrett's Esophagus
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by White Rose Research Online This is an author produced version of A genome-wide association study identifies new susceptibility loci for esophageal adenocarcinoma and Barrett's esophagus.. White Rose Research Online URL for this paper: http://eprints.whiterose.ac.uk/105073/ Article: Levine, D.M., Ek, W.E., Zhang, R. et al. (31 more authors) (2013) A genome-wide association study identifies new susceptibility loci for esophageal adenocarcinoma and Barrett's esophagus. Nature Genetics, 45 (12). pp. 1487-1493. ISSN 1061-4036 https://doi.org/10.1038/ng.2796 promoting access to White Rose research papers [email protected] http://eprints.whiterose.ac.uk/ HHS Public Access Author manuscript Author Manuscript Author ManuscriptNat Genet Author Manuscript. Author manuscript; Author Manuscript available in PMC 2014 June 01. Published in final edited form as: Nat Genet. 2013 December ; 45(12): 1487–1493. doi:10.1038/ng.2796. A Genome-Wide Association Study Identifies New Susceptibility Loci for Esophageal Adenocarcinoma and Barrett’ s Esophagus David M. Levine1, Weronica E. Ek2, Rui Zhang1, Xinxue Liu3, Lynn Onstad4, Cassandra Sather5, Pierre Lao-Sirieix3, Marilie D. Gammon6, Douglas A. Corley7, Nicholas J. Shaheen8, Nigel C. Bird9, Laura J. Hardie10, Liam J. Murray11, Brian J. Reid4,12, Wong-Ho Chow13, Harvey A. Risch14, Olof Nyrén15, Weimin Ye15, Geoffrey Liu16, Yvonne Romero17,18, Leslie Bernstein19, Anna H. Wu20, Alan G. Casson21, Stephen Chanock22, Patricia Harrington23,24,25, Isabel Caldas25, Irene Debiram-Beecham3, Carlos Caldas25,26, Nicholas K. Hayward27, Paul Pharoah23,24,25, Rebecca Fitzgerald3, Stuart MacGregor2, David C.
    [Show full text]
  • An Extensive Program of Periodic Alternative Splicing Linked to Cell
    RESEARCH ARTICLE An extensive program of periodic alternative splicing linked to cell cycle progression Daniel Dominguez1,2, Yi-Hsuan Tsai1,3, Robert Weatheritt4, Yang Wang1,2, Benjamin J Blencowe4*, Zefeng Wang1,5* 1Department of Pharmacology, University of North Carolina at Chapel Hill, Chapel Hill, United States; 2Lineberger Comprehensive Cancer Center, University of North Carolina at Chapel Hill, Chapel Hill, United States; 3Program in Bioinformatics and Computational Biology, University of North Carolina at Chapel Hill, Chapel Hill, United States; 4Donnelly Centre and Department of Molecular Genetics, University of Toronto, Toronto, Canada; 5Key Lab of Computational Biology, CAS-MPG Partner Institute for Computational Biology, Chinese Academy of Science, Shanghai, China Abstract Progression through the mitotic cell cycle requires periodic regulation of gene function at the levels of transcription, translation, protein-protein interactions, post-translational modification and degradation. However, the role of alternative splicing (AS) in the temporal control of cell cycle is not well understood. By sequencing the human transcriptome through two continuous cell cycles, we identify ~ 1300 genes with cell cycle-dependent AS changes. These genes are significantly enriched in functions linked to cell cycle control, yet they do not significantly overlap genes subject to periodic changes in steady-state transcript levels. Many of the periodically spliced genes are controlled by the SR protein kinase CLK1, whose level undergoes cell cycle- dependent fluctuations via an auto-inhibitory circuit. Disruption of CLK1 causes pleiotropic cell cycle defects and loss of proliferation, whereas CLK1 over-expression is associated with various *For correspondence: cancers. These results thus reveal a large program of CLK1-regulated periodic AS intimately [email protected] (BJB); associated with cell cycle control.
    [Show full text]
  • Symplekin and Transforming Acidic Coiled-Coil Containing Protein 3 Support the Cancer Cell Mitotic Spindle
    SYMPLEKIN AND TRANSFORMING ACIDIC COILED-COIL CONTAINING PROTEIN 3 SUPPORT THE CANCER CELL MITOTIC SPINDLE Kathryn M. Cappell A dissertation submitted to the faculty of the University of North Carolina at Chapel Hill in partial fulfillment of the requirements for the degree of Doctorate of Philosophy in the Department of Pharmacology, School of Medicine. Chapel Hill 2011 Approved by: Advisor: Dr. Angelique Whitehurst Reader: Dr. David Siderovski Reader: Dr. Channing Der Reader: Dr. Pilar Blancafort Reader: Dr. Mohanish Deshmukh ABSTRACT KATHRYN CAPPELL: Symplekin and Transforming Acidic Coiled-Coil Containing Protein 3 Support the Cancer Cell Mitotic Spindle (Under the direction of Dr. Angelique Whitehurst) An increased rate of proliferation in cancer cells, combined with abnormalities in spindle architecture, places tumors under increased mitotic stress. Previously, our laboratory performed a genome-wide paclitaxel chemosensitizer screen to identify genes whose depletion sensitizes non- small cell lung cancer (NSCLC) cells to mitotic stress induced by paclitaxel treatment. This screen uncovered a cohort of genes that are required for viability only in the presence of paclitaxel. Two genes uncovered in this screen were the polyadenylation scaffold symplekin and the gametogenic protein transforming acidic coiled-coil containing protein 3 (TACC3). Herein, we examine the impact of polyadenylation and gametogenesis on the tumor cell mitotic spindle. First, we demonstrate that depletion of SYMPK and other polyadenylation components sensitizes many NSCLC cells, but not normal immortalized lines, to paclitaxel by inducing mitotic errors and leading to abnormal mitotic progression. Second, we demonstrate that multiple gametogenic genes are required for normal microtubule dynamics and mitotic spindle formation in the presence of paclitaxel.
    [Show full text]
  • Molecular Genetics of Microcephaly Primary Hereditary: an Overview
    brain sciences Review Molecular Genetics of Microcephaly Primary Hereditary: An Overview Nikistratos Siskos † , Electra Stylianopoulou †, Georgios Skavdis and Maria E. Grigoriou * Department of Molecular Biology & Genetics, Democritus University of Thrace, 68100 Alexandroupolis, Greece; [email protected] (N.S.); [email protected] (E.S.); [email protected] (G.S.) * Correspondence: [email protected] † Equal contribution. Abstract: MicroCephaly Primary Hereditary (MCPH) is a rare congenital neurodevelopmental disorder characterized by a significant reduction of the occipitofrontal head circumference and mild to moderate mental disability. Patients have small brains, though with overall normal architecture; therefore, studying MCPH can reveal not only the pathological mechanisms leading to this condition, but also the mechanisms operating during normal development. MCPH is genetically heterogeneous, with 27 genes listed so far in the Online Mendelian Inheritance in Man (OMIM) database. In this review, we discuss the role of MCPH proteins and delineate the molecular mechanisms and common pathways in which they participate. Keywords: microcephaly; MCPH; MCPH1–MCPH27; molecular genetics; cell cycle 1. Introduction Citation: Siskos, N.; Stylianopoulou, Microcephaly, from the Greek word µικρoκεϕαλi´α (mikrokephalia), meaning small E.; Skavdis, G.; Grigoriou, M.E. head, is a term used to describe a cranium with reduction of the occipitofrontal head circum- Molecular Genetics of Microcephaly ference equal, or more that teo standard deviations
    [Show full text]
  • Appendix 2. Significantly Differentially Regulated Genes in Term Compared with Second Trimester Amniotic Fluid Supernatant
    Appendix 2. Significantly Differentially Regulated Genes in Term Compared With Second Trimester Amniotic Fluid Supernatant Fold Change in term vs second trimester Amniotic Affymetrix Duplicate Fluid Probe ID probes Symbol Entrez Gene Name 1019.9 217059_at D MUC7 mucin 7, secreted 424.5 211735_x_at D SFTPC surfactant protein C 416.2 206835_at STATH statherin 363.4 214387_x_at D SFTPC surfactant protein C 295.5 205982_x_at D SFTPC surfactant protein C 288.7 1553454_at RPTN repetin solute carrier family 34 (sodium 251.3 204124_at SLC34A2 phosphate), member 2 238.9 206786_at HTN3 histatin 3 161.5 220191_at GKN1 gastrokine 1 152.7 223678_s_at D SFTPA2 surfactant protein A2 130.9 207430_s_at D MSMB microseminoprotein, beta- 99.0 214199_at SFTPD surfactant protein D major histocompatibility complex, class II, 96.5 210982_s_at D HLA-DRA DR alpha 96.5 221133_s_at D CLDN18 claudin 18 94.4 238222_at GKN2 gastrokine 2 93.7 1557961_s_at D LOC100127983 uncharacterized LOC100127983 93.1 229584_at LRRK2 leucine-rich repeat kinase 2 HOXD cluster antisense RNA 1 (non- 88.6 242042_s_at D HOXD-AS1 protein coding) 86.0 205569_at LAMP3 lysosomal-associated membrane protein 3 85.4 232698_at BPIFB2 BPI fold containing family B, member 2 84.4 205979_at SCGB2A1 secretoglobin, family 2A, member 1 84.3 230469_at RTKN2 rhotekin 2 82.2 204130_at HSD11B2 hydroxysteroid (11-beta) dehydrogenase 2 81.9 222242_s_at KLK5 kallikrein-related peptidase 5 77.0 237281_at AKAP14 A kinase (PRKA) anchor protein 14 76.7 1553602_at MUCL1 mucin-like 1 76.3 216359_at D MUC7 mucin 7,
    [Show full text]
  • S41467-019-10037-Y.Pdf
    ARTICLE https://doi.org/10.1038/s41467-019-10037-y OPEN Feedback inhibition of cAMP effector signaling by a chaperone-assisted ubiquitin system Laura Rinaldi1, Rossella Delle Donne1, Bruno Catalanotti 2, Omar Torres-Quesada3, Florian Enzler3, Federica Moraca 4, Robert Nisticò5, Francesco Chiuso1, Sonia Piccinin5, Verena Bachmann3, Herbert H Lindner6, Corrado Garbi1, Antonella Scorziello7, Nicola Antonino Russo8, Matthis Synofzik9, Ulrich Stelzl 10, Lucio Annunziato11, Eduard Stefan 3 & Antonio Feliciello1 1234567890():,; Activation of G-protein coupled receptors elevates cAMP levels promoting dissociation of protein kinase A (PKA) holoenzymes and release of catalytic subunits (PKAc). This results in PKAc-mediated phosphorylation of compartmentalized substrates that control central aspects of cell physiology. The mechanism of PKAc activation and signaling have been largely characterized. However, the modes of PKAc inactivation by regulated proteolysis were unknown. Here, we identify a regulatory mechanism that precisely tunes PKAc stability and downstream signaling. Following agonist stimulation, the recruitment of the chaperone- bound E3 ligase CHIP promotes ubiquitylation and proteolysis of PKAc, thus attenuating cAMP signaling. Genetic inactivation of CHIP or pharmacological inhibition of HSP70 enhances PKAc signaling and sustains hippocampal long-term potentiation. Interestingly, primary fibroblasts from autosomal recessive spinocerebellar ataxia 16 (SCAR16) patients carrying germline inactivating mutations of CHIP show a dramatic dysregulation of PKA signaling. This suggests the existence of a negative feedback mechanism for restricting hormonally controlled PKA activities. 1 Department of Molecular Medicine and Medical Biotechnologies, University Federico II, 80131 Naples, Italy. 2 Department of Pharmacy, University Federico II, 80131 Naples, Italy. 3 Institute of Biochemistry and Center for Molecular Biosciences, University of Innsbruck, A-6020 Innsbruck, Austria.
    [Show full text]
  • The Transformation of the Centrosome Into the Basal Body: Similarities and Dissimilarities Between Somatic and Male Germ Cells and Their Relevance for Male Fertility
    cells Review The Transformation of the Centrosome into the Basal Body: Similarities and Dissimilarities between Somatic and Male Germ Cells and Their Relevance for Male Fertility Constanza Tapia Contreras and Sigrid Hoyer-Fender * Göttingen Center of Molecular Biosciences, Johann-Friedrich-Blumenbach Institute for Zoology and Anthropology-Developmental Biology, Faculty of Biology and Psychology, Georg-August University of Göttingen, 37077 Göttingen, Germany; [email protected] * Correspondence: [email protected] Abstract: The sperm flagellum is essential for the transport of the genetic material toward the oocyte and thus the transmission of the genetic information to the next generation. During the haploid phase of spermatogenesis, i.e., spermiogenesis, a morphological and molecular restructuring of the male germ cell, the round spermatid, takes place that includes the silencing and compaction of the nucleus, the formation of the acrosomal vesicle from the Golgi apparatus, the formation of the sperm tail, and, finally, the shedding of excessive cytoplasm. Sperm tail formation starts in the round spermatid stage when the pair of centrioles moves toward the posterior pole of the nucleus. The sperm tail, eventually, becomes located opposed to the acrosomal vesicle, which develops at the anterior pole of the nucleus. The centriole pair tightly attaches to the nucleus, forming a nuclear membrane indentation. An Citation: Tapia Contreras, C.; articular structure is formed around the centriole pair known as the connecting piece, situated in the Hoyer-Fender, S. The Transformation neck region and linking the sperm head to the tail, also named the head-to-tail coupling apparatus or, of the Centrosome into the Basal in short, HTCA.
    [Show full text]
  • Suppl. Table 1
    Suppl. Table 1. SiRNA library used for centriole overduplication screen. Entrez Gene Id NCBI gene symbol siRNA Target Sequence 1070 CETN3 TTGCGACGTGTTGCTAGAGAA 1070 CETN3 AAGCAATAGATTATCATGAAT 55722 CEP72 AGAGCTATGTATGATAATTAA 55722 CEP72 CTGGATGATTTGAGACAACAT 80071 CCDC15 ACCGAGTAAATCAACAAATTA 80071 CCDC15 CAGCAGAGTTCAGAAAGTAAA 9702 CEP57 TAGACTTATCTTTGAAGATAA 9702 CEP57 TAGAGAAACAATTGAATATAA 282809 WDR51B AAGGACTAATTTAAATTACTA 282809 WDR51B AAGATCCTGGATACAAATTAA 55142 CEP27 CAGCAGATCACAAATATTCAA 55142 CEP27 AAGCTGTTTATCACAGATATA 85378 TUBGCP6 ACGAGACTACTTCCTTAACAA 85378 TUBGCP6 CACCCACGGACACGTATCCAA 54930 C14orf94 CAGCGGCTGCTTGTAACTGAA 54930 C14orf94 AAGGGAGTGTGGAAATGCTTA 5048 PAFAH1B1 CCCGGTAATATCACTCGTTAA 5048 PAFAH1B1 CTCATAGATATTGAACAATAA 2802 GOLGA3 CTGGCCGATTACAGAACTGAA 2802 GOLGA3 CAGAGTTACTTCAGTGCATAA 9662 CEP135 AAGAATTTCATTCTCACTTAA 9662 CEP135 CAGCAGAAAGAGATAAACTAA 153241 CCDC100 ATGCAAGAAGATATATTTGAA 153241 CCDC100 CTGCGGTAATTTCCAGTTCTA 80184 CEP290 CCGGAAGAAATGAAGAATTAA 80184 CEP290 AAGGAAATCAATAAACTTGAA 22852 ANKRD26 CAGAAGTATGTTGATCCTTTA 22852 ANKRD26 ATGGATGATGTTGATGACTTA 10540 DCTN2 CACCAGCTATATGAAACTATA 10540 DCTN2 AACGAGATTGCCAAGCATAAA 25886 WDR51A AAGTGATGGTTTGGAAGAGTA 25886 WDR51A CCAGTGATGACAAGACTGTTA 55835 CENPJ CTCAAGTTAAACATAAGTCAA 55835 CENPJ CACAGTCAGATAAATCTGAAA 84902 CCDC123 AAGGATGGAGTGCTTAATAAA 84902 CCDC123 ACCCTGGTTGTTGGATATAAA 79598 LRRIQ2 CACAAGAGAATTCTAAATTAA 79598 LRRIQ2 AAGGATAATATCGTTTAACAA 51143 DYNC1LI1 TTGGATTTGTCTATACATATA 51143 DYNC1LI1 TAGACTTAGTATATAAATACA 2302 FOXJ1 CAGGACAGACAGACTAATGTA
    [Show full text]
  • Association of Cnvs with Methylation Variation
    www.nature.com/npjgenmed ARTICLE OPEN Association of CNVs with methylation variation Xinghua Shi1,8, Saranya Radhakrishnan2, Jia Wen1, Jin Yun Chen2, Junjie Chen1,8, Brianna Ashlyn Lam1, Ryan E. Mills 3, ✉ ✉ Barbara E. Stranger4, Charles Lee5,6,7 and Sunita R. Setlur 2 Germline copy number variants (CNVs) and single-nucleotide polymorphisms (SNPs) form the basis of inter-individual genetic variation. Although the phenotypic effects of SNPs have been extensively investigated, the effects of CNVs is relatively less understood. To better characterize mechanisms by which CNVs affect cellular phenotype, we tested their association with variable CpG methylation in a genome-wide manner. Using paired CNV and methylation data from the 1000 genomes and HapMap projects, we identified genome-wide associations by methylation quantitative trait locus (mQTL) analysis. We found individual CNVs being associated with methylation of multiple CpGs and vice versa. CNV-associated methylation changes were correlated with gene expression. CNV-mQTLs were enriched for regulatory regions, transcription factor-binding sites (TFBSs), and were involved in long- range physical interactions with associated CpGs. Some CNV-mQTLs were associated with methylation of imprinted genes. Several CNV-mQTLs and/or associated genes were among those previously reported by genome-wide association studies (GWASs). We demonstrate that germline CNVs in the genome are associated with CpG methylation. Our findings suggest that structural variation together with methylation may affect cellular phenotype. npj Genomic Medicine (2020) 5:41 ; https://doi.org/10.1038/s41525-020-00145-w 1234567890():,; INTRODUCTION influence transcript regulation is DNA methylation, which involves The extent of genetic variation that exists in the human addition of a methyl group to cytosine residues within a CpG population is continually being characterized in efforts to identify dinucleotide.
    [Show full text]
  • An Exome-Wide Sequencing Study of Lipid Response to High-Fat Meal and Fenofibrate in Caucasians from the GOLDN Cohort
    Washington University School of Medicine Digital Commons@Becker Open Access Publications 2018 An exome-wide sequencing study of lipid response to high-fat meal and fenofibrate in Caucasians from the GOLDN cohort Xin Geng Ping An Mary F. Feitosa Michael A. Province et al. Follow this and additional works at: https://digitalcommons.wustl.edu/open_access_pubs Supplemental Material can be found at: http://www.jlr.org/content/suppl/2018/02/20/jlr.P080333.DC1 .html patient-oriented and epidemiological research An exome-wide sequencing study of lipid response to high-fat meal and fenofibrate in Caucasians from the GOLDN cohort Xin Geng,* Marguerite R. Irvin,† Bertha Hidalgo,† Stella Aslibekyan,† Vinodh Srinivasasainagendra,§ Ping An,‡ Alexis C. Frazier-Wood,|| Hemant K. Tiwari,§ Tushar Dave,# Kathleen Ryan,# Jose M. Ordovas,$,**,†† Robert J. Straka,§§ Mary F. Feitosa,‡ Paul N. Hopkins,‡‡ Ingrid Borecki,|| || Michael A. Province,‡ Braxton D. Mitchell,# Donna K. Arnett,1,## and Degui Zhi1,*,$$ School of Biomedical Informatics* and School of Public Health,$$ The University of Texas Health Downloaded from Science Center at Houston, Houston, TX 77030; Departments of Epidemiology† and Biostatistics,§ University of Alabama at Birmingham, Birmingham, AL 35233; Division of Statistical Genomics, Department of Genetics,‡ Washington University School of Medicine, St. Louis, MO 63110; US Department of Agriculture/Agricultural Research Service Children’s Nutrition Research Center,|| Baylor College of Medicine, Houston, TX 77030; Department of Medicine, Division
    [Show full text]
  • A High-Throughput Approach to Uncover Novel Roles of APOBEC2, a Functional Orphan of the AID/APOBEC Family
    Rockefeller University Digital Commons @ RU Student Theses and Dissertations 2018 A High-Throughput Approach to Uncover Novel Roles of APOBEC2, a Functional Orphan of the AID/APOBEC Family Linda Molla Follow this and additional works at: https://digitalcommons.rockefeller.edu/ student_theses_and_dissertations Part of the Life Sciences Commons A HIGH-THROUGHPUT APPROACH TO UNCOVER NOVEL ROLES OF APOBEC2, A FUNCTIONAL ORPHAN OF THE AID/APOBEC FAMILY A Thesis Presented to the Faculty of The Rockefeller University in Partial Fulfillment of the Requirements for the degree of Doctor of Philosophy by Linda Molla June 2018 © Copyright by Linda Molla 2018 A HIGH-THROUGHPUT APPROACH TO UNCOVER NOVEL ROLES OF APOBEC2, A FUNCTIONAL ORPHAN OF THE AID/APOBEC FAMILY Linda Molla, Ph.D. The Rockefeller University 2018 APOBEC2 is a member of the AID/APOBEC cytidine deaminase family of proteins. Unlike most of AID/APOBEC, however, APOBEC2’s function remains elusive. Previous research has implicated APOBEC2 in diverse organisms and cellular processes such as muscle biology (in Mus musculus), regeneration (in Danio rerio), and development (in Xenopus laevis). APOBEC2 has also been implicated in cancer. However the enzymatic activity, substrate or physiological target(s) of APOBEC2 are unknown. For this thesis, I have combined Next Generation Sequencing (NGS) techniques with state-of-the-art molecular biology to determine the physiological targets of APOBEC2. Using a cell culture muscle differentiation system, and RNA sequencing (RNA-Seq) by polyA capture, I demonstrated that unlike the AID/APOBEC family member APOBEC1, APOBEC2 is not an RNA editor. Using the same system combined with enhanced Reduced Representation Bisulfite Sequencing (eRRBS) analyses I showed that, unlike the AID/APOBEC family member AID, APOBEC2 does not act as a 5-methyl-C deaminase.
    [Show full text]