DOCSLIB.ORG

A Dissertation Entitled JAK2 Tyrosine Kinase Phosphorylates and Is

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A Dissertation Entitled JAK2 Tyrosine Kinase Phosphorylates and Is A Dissertation Entitled JAK2 Tyrosine Kinase Phosphorylates and is Negatively Regulated by the Centrosomal Protein Ninein By Jennifer Jay Submitted to the Graduate Faculty as partial fulfillment of the requirements for the Doctor of Philosophy Degree in Biology _________________________________________ Dr. Maria Diakonova, Committee Chair _________________________________________ Dr. Patricia R. Komuniecki, Dean College of Graduate Studies The University of Toledo May 2015 Copyright 2015, Jennifer Jay This document is copyrighted material. Under copyright law, no parts of this document may be reproduced without the expressed permission of the author. An Abstract of JAK2 Tyrosine Kinase Phosphorylates and is Negatively Regulated by the Centrosomal Protein Ninein By Jennifer Jay Submitted to the Graduate Faculty as partial fulfillment of the requirements for the Doctor of Philosophy Degree in Biology The University of Toledo May 2015 Janus Kinase 2 (JAK2) is a non-receptor tyrosine kinase that is activated by two- thirds of the cytokine receptor superfamily including receptors to interferon-γ, growth hormone and prolactin. Upon ligand binding to its receptor, JAK2 becomes activated and can phosphorylate downstream targets that lead to diverse physiological responses. Even though JAK2 plays an important role in cytokine signaling, its subcellular localization is still under debate. We show that both inactive and active JAK2 (pJAK2) localizes around the mother centrioles where it partially colocalizes with ninein, a protein involved in microtubule (MT) nucleation and anchoring. We demonstrate that depletion of JAK2 or using JAK2-null cells, results in microtubule anchorage defects at the mother centriole and an increased number of cells with mitotic defects; however, MT nucleation is unaffected. Additionally, loss of JAK2 leads to an increase in separated centrosomes in interphase cells. We show that JAK2 directly phosphorylates the N-terminus of ninein while the C-terminus of ninein inhibits JAK2 kinase activity in vitro. Overexpression of either C-terminal or WT ninein decreases JAK2 activation in cells, causing a decrease in prolactin and interferon-γ induced tyrosyl phosphorylation of STAT1 and STAT5, iii downstream targets of JAK2. Down-regulation of endogenous ninein increased JAK2 activation and subsequently STAT1 and STAT5 tyrosyl phosphorylation. These results indicate that JAK2 is a novel member of the centrosome-associated complex and that this localization regulates both centrosomal function and JAK2 kinase activity, thus controlling cytokine-activated molecular pathways. iv Acknowledgements I would like to thank my advisor, Dr. Maria Diakonova, for allowing me to complete my Ph.D. under her supervision. Through her guidance and support I have thrived and I would not be the scientist I am today without her push. I would also like to thank my committee members for their support. I would like to thank all of the previous and current lab members, without them I would not be here today. Their support and friendship kept me going during some hard times. I would also like to thank previous and former members of the Biology Department at UT. I have made so many friends and have felt so at home here from the beginning. UT truly feels like a second home to me. I would like to also thank my family: my parents, Gary and Linda Jay, my brother and sister-in-law, Jeremy and Katie Jay, my niece, Samantha Jay, my in-laws, Barb and Bud, brother-in-laws, Andy and Matt, and sister-in-law, Tammy. Without the support of my entire family I would not be the person I am today, and I am truly grateful to have all of them in my life. Last but not least I want to thank my fiancée, Lori. Without her love, support, and faith in me, I would not be where I am today. I am so grateful for her patience, encouragement, and humor over these last few years, and her willingness to stay with me. She makes me a better person and every day I am thankful that I found her. v Table of Contents Abstract .............................................................................................................................. iii Acknowledgements ..............................................................................................................v Table of Contents ............................................................................................................... vi List of Figures ................................................................................................................... vii List of Abbreviations ......................................................................................................... ix I. Introduction…………………… .....................................................................................1 II. Material and Methods....................................................................................................15 III. Results……………………………………………………………..…………………26 IV. Discussion……………….. ..........................................................................................61 References ..........................................................................................................................68 vi List of Figures Figure 1. JAK2 Structure.....................................................................................................1 Figure 2. Centrosome Structure ..........................................................................................6 Figure 3. Centrosome Duplication.......................................................................................9 Figure 4. Ninein Structure .................................................................................................11 Figure 5. Ninein Localization During the Cell Cycle…………………………………....13 Figure 6. Active JAK2 tyrosine kinase localizes to the centrosome .......................... 27-28 Figure 7. Synchronized HeLa Cells ..................................................................................30 Figure 8. Localization of JAK2 During the Cell Cycle ......................................... 31-32,34 Figure 9. JAK2 Regulates Aster Formation and Microtubule Release ..................37-38,40 Figure 10. Endogenous JAK2 Associates with Endogenous Ninein and WT and C-ninein .......................................................................................................... 41-42 Figure 11. Endogenous JAK2 copurified with Endogenous Ninein in the Same Centrosomal Fractions ..........................................................................................44 Figure 12. Recombinant JAK2 Tyrosyl Phosphorylates the N-terminus of Ninein While C-terminus of Ninein Inactivates JAK2 activity in vitro .......................... …..45-48 Figure 13. C-terminal Ninein Decreases JAK2 Tyrosyl Kinase Activity in vivo .......50,52 Figure 14. WT and C-terminal Ninein Decrease Endogenous JAK2 Autophosphorylation and Subsequently STAT1 and STAT5 Tyrosyl Phosphorylation ..............53-54,56 Figure 15. Loss of JAK2 Leads to Mitotic Errors ............................................................57 Figure 16. Loss of JAK2 causes centrosome splitting ......................................................60 Figure 17. Model of JAK2 and Ninein Interaction at the Centrosome..............................63 Figure 18. The Centrosome as the Center of Signal Transduction in the Cell..................66 vii List of Abbreviations ER ..............................Endoplasmic Reticulum FACS..........................Fluorescence-activated Cell Sorting FERM .........................band 4.1, erzin, radixin and moesin GFP ............................Green Fluorescent Protein GSK3β .......................Glycogen Synthase Kinase-3β GST ............................Glutathione S-transferase hNinein .......................Human Ninein IFNγ ...........................γ-interferon JAK2 ..........................Janus Kinase 2 JH ...............................JAK Homology Domain MAPK ........................Mitogen-Activated Protein Kinase MT..............................Microtubules MTOC ........................Microtubule Organizing Center Nek2 ...........................NimA-related protein kinase 2 PBS ............................Phosphate Buffer Saline PCM ...........................Pericentriolar Material PI3K ...........................Phosphatidylinositol 3-Kinase pJAK2 ........................Autophosphorylated JAK2 PKA............................Protein Kinase A PRL ............................Prolactin PTP-BL ......................Protein Tyrosine Phosphatase-Basophil-like PY ..............................Phosphotyrosine SH2 ............................Src-homology-2 SOCS..........................Suppressor of Cytokine Signaling STAT..........................Signal Transducers and Activators of Transcription V617F JAK2 ..............Constitutively Active JAK2 VEGF .........................Vascular Endothelial Growth Factor WT .............................Wild-type γ-TURC .......................γ-Tubulin Ring Complex viii Chapter One Introduction JAK Janus kinase 2 (JAK2) is a non-receptor tyrosine kinase that belongs to the Janus family of cytoplasmic tyrosine kinases that also includes JAK1, JAK3 and TYK2. JAK2 is ubiquitously expressed and contains seven JAK homology domains (JH1-JH7, see Figure 1). At the C-terminus is the kinase domain (JH1) which contains an activation Figure 1. JAK2 Structure. JAK2 contains seven JAK2 homology (JH) domains. At the N-terminus, JH4-7 makes up the FERM domain, which
Load more

Recommended publications
  • Mutations in CDK5RAP2 Cause Seckel Syndrome Go¨ Khan Yigit1,2,3,A, Karen E
    ORIGINAL ARTICLE Mutations in CDK5RAP2 cause Seckel syndrome Go¨ khan Yigit1,2,3,a, Karen E. Brown4,a,Hu¨ lya Kayserili5, Esther Pohl1,2,3, Almuth Caliebe6, Diana Zahnleiter7, Elisabeth Rosser8, Nina Bo¨ gershausen1,2,3, Zehra Oya Uyguner5, Umut Altunoglu5, Gudrun Nu¨ rnberg2,3,9, Peter Nu¨ rnberg2,3,9, Anita Rauch10, Yun Li1,2,3, Christian Thomas Thiel7 & Bernd Wollnik1,2,3 1Institute of Human Genetics, University of Cologne, Cologne, Germany 2Center for Molecular Medicine Cologne (CMMC), University of Cologne, Cologne, Germany 3Cologne Excellence Cluster on Cellular Stress Responses in Aging-Associated Diseases (CECAD), University of Cologne, Cologne, Germany 4Chromosome Biology Group, MRC Clinical Sciences Centre, Imperial College School of Medicine, Hammersmith Hospital, London, W12 0NN, UK 5Department of Medical Genetics, Istanbul Medical Faculty, Istanbul University, Istanbul, Turkey 6Institute of Human Genetics, Christian-Albrechts-University of Kiel, Kiel, Germany 7Institute of Human Genetics, Friedrich-Alexander University Erlangen-Nuremberg, Erlangen, Germany 8Department of Clinical Genetics, Great Ormond Street Hospital for Children, London, WC1N 3EH, UK 9Cologne Center for Genomics, University of Cologne, Cologne, Germany 10Institute of Medical Genetics, University of Zurich, Schwerzenbach-Zurich, Switzerland Keywords Abstract CDK5RAP2, CEP215, microcephaly, primordial dwarfism, Seckel syndrome Seckel syndrome is a heterogeneous, autosomal recessive disorder marked by pre- natal proportionate short stature, severe microcephaly, intellectual disability, and Correspondence characteristic facial features. Here, we describe the novel homozygous splice-site Bernd Wollnik, Center for Molecular mutations c.383+1G>C and c.4005-9A>GinCDK5RAP2 in two consanguineous Medicine Cologne (CMMC) and Institute of families with Seckel syndrome. CDK5RAP2 (CEP215) encodes a centrosomal pro- Human Genetics, University of Cologne, tein which is known to be essential for centrosomal cohesion and proper spindle Kerpener Str.
    [Show full text]
  • Anatomy of the Axon
    Anatomy of the Axon: Dissecting the role of microtubule plus-end tracking proteins in axons of hippocampal neurons ISBN: 978-90-393-7095-7 On the cover: Interpretation of Rembrandt van Rijn’s iconic oil painting The Anatomy Lesson of Dr. Nicolaes Tulp (1632). Instead of a human subject, a neuron is being dissected under the watchful eye of members of the Hoogenraad & Akhmanova labs circa 2018. The doctoral candidate takes on the role of Dr. Nicolaes Tulp. The year in which this thesis is published, 2019, marks the 350th anniversary of Rembrandt’s passing. It is therefore declared Year of Rembrandt. Cover photography: Jasper Landman (Bob & Fzbl Photography) Design and layout: Dieudonnée van de Willige © 2019; CC-BY-NC-ND. Printed in The Netherlands. Anatomy of the Axon: Dissecting the role of microtubule plus-end tracking proteins in axons of hippocampal neurons Anatomie van de Axon: Ontleding van de rol van microtubulus-plus-eind-bindende eiwitten in axonen van hippocampale neuronen (met een samenvatting in het Nederlands) Proefschrift ter verkrijging van de graad van doctor aan de Universiteit Utrecht op gezag van de rector magnificus, prof.dr. H.R.B.M. Kummeling, ingevolge het besluit van het college voor promoties in het openbaar te verdedigen op woensdag 22 mei 2019 des middags te 2.30 uur door Dieudonnée van de Willige geboren op 24 oktober 1990 te Antwerpen, België Promotoren: Prof. dr. C.C. Hoogenraad Prof. dr. A. Akhmanova Voor Hans & Miranda Index Preface 7 List of non-standard abbreviations 9 Microtubule plus-end tracking proteins
    [Show full text]
  • An Extensive Program of Periodic Alternative Splicing Linked to Cell
    RESEARCH ARTICLE An extensive program of periodic alternative splicing linked to cell cycle progression Daniel Dominguez1,2, Yi-Hsuan Tsai1,3, Robert Weatheritt4, Yang Wang1,2, Benjamin J Blencowe4*, Zefeng Wang1,5* 1Department of Pharmacology, University of North Carolina at Chapel Hill, Chapel Hill, United States; 2Lineberger Comprehensive Cancer Center, University of North Carolina at Chapel Hill, Chapel Hill, United States; 3Program in Bioinformatics and Computational Biology, University of North Carolina at Chapel Hill, Chapel Hill, United States; 4Donnelly Centre and Department of Molecular Genetics, University of Toronto, Toronto, Canada; 5Key Lab of Computational Biology, CAS-MPG Partner Institute for Computational Biology, Chinese Academy of Science, Shanghai, China Abstract Progression through the mitotic cell cycle requires periodic regulation of gene function at the levels of transcription, translation, protein-protein interactions, post-translational modification and degradation. However, the role of alternative splicing (AS) in the temporal control of cell cycle is not well understood. By sequencing the human transcriptome through two continuous cell cycles, we identify ~ 1300 genes with cell cycle-dependent AS changes. These genes are significantly enriched in functions linked to cell cycle control, yet they do not significantly overlap genes subject to periodic changes in steady-state transcript levels. Many of the periodically spliced genes are controlled by the SR protein kinase CLK1, whose level undergoes cell cycle- dependent fluctuations via an auto-inhibitory circuit. Disruption of CLK1 causes pleiotropic cell cycle defects and loss of proliferation, whereas CLK1 over-expression is associated with various *For correspondence: cancers. These results thus reveal a large program of CLK1-regulated periodic AS intimately [email protected] (BJB); associated with cell cycle control.
    [Show full text]
  • Molecular Genetics of Microcephaly Primary Hereditary: an Overview
    brain sciences Review Molecular Genetics of Microcephaly Primary Hereditary: An Overview Nikistratos Siskos † , Electra Stylianopoulou †, Georgios Skavdis and Maria E. Grigoriou * Department of Molecular Biology & Genetics, Democritus University of Thrace, 68100 Alexandroupolis, Greece; [email protected] (N.S.); [email protected] (E.S.); [email protected] (G.S.) * Correspondence: [email protected] † Equal contribution. Abstract: MicroCephaly Primary Hereditary (MCPH) is a rare congenital neurodevelopmental disorder characterized by a significant reduction of the occipitofrontal head circumference and mild to moderate mental disability. Patients have small brains, though with overall normal architecture; therefore, studying MCPH can reveal not only the pathological mechanisms leading to this condition, but also the mechanisms operating during normal development. MCPH is genetically heterogeneous, with 27 genes listed so far in the Online Mendelian Inheritance in Man (OMIM) database. In this review, we discuss the role of MCPH proteins and delineate the molecular mechanisms and common pathways in which they participate. Keywords: microcephaly; MCPH; MCPH1–MCPH27; molecular genetics; cell cycle 1. Introduction Citation: Siskos, N.; Stylianopoulou, Microcephaly, from the Greek word µικρoκεϕαλi´α (mikrokephalia), meaning small E.; Skavdis, G.; Grigoriou, M.E. head, is a term used to describe a cranium with reduction of the occipitofrontal head circum- Molecular Genetics of Microcephaly ference equal, or more that teo standard deviations
    [Show full text]
  • S41467-019-10037-Y.Pdf
    ARTICLE https://doi.org/10.1038/s41467-019-10037-y OPEN Feedback inhibition of cAMP effector signaling by a chaperone-assisted ubiquitin system Laura Rinaldi1, Rossella Delle Donne1, Bruno Catalanotti 2, Omar Torres-Quesada3, Florian Enzler3, Federica Moraca 4, Robert Nisticò5, Francesco Chiuso1, Sonia Piccinin5, Verena Bachmann3, Herbert H Lindner6, Corrado Garbi1, Antonella Scorziello7, Nicola Antonino Russo8, Matthis Synofzik9, Ulrich Stelzl 10, Lucio Annunziato11, Eduard Stefan 3 & Antonio Feliciello1 1234567890():,; Activation of G-protein coupled receptors elevates cAMP levels promoting dissociation of protein kinase A (PKA) holoenzymes and release of catalytic subunits (PKAc). This results in PKAc-mediated phosphorylation of compartmentalized substrates that control central aspects of cell physiology. The mechanism of PKAc activation and signaling have been largely characterized. However, the modes of PKAc inactivation by regulated proteolysis were unknown. Here, we identify a regulatory mechanism that precisely tunes PKAc stability and downstream signaling. Following agonist stimulation, the recruitment of the chaperone- bound E3 ligase CHIP promotes ubiquitylation and proteolysis of PKAc, thus attenuating cAMP signaling. Genetic inactivation of CHIP or pharmacological inhibition of HSP70 enhances PKAc signaling and sustains hippocampal long-term potentiation. Interestingly, primary fibroblasts from autosomal recessive spinocerebellar ataxia 16 (SCAR16) patients carrying germline inactivating mutations of CHIP show a dramatic dysregulation of PKA signaling. This suggests the existence of a negative feedback mechanism for restricting hormonally controlled PKA activities. 1 Department of Molecular Medicine and Medical Biotechnologies, University Federico II, 80131 Naples, Italy. 2 Department of Pharmacy, University Federico II, 80131 Naples, Italy. 3 Institute of Biochemistry and Center for Molecular Biosciences, University of Innsbruck, A-6020 Innsbruck, Austria.
    [Show full text]
  • Suppl. Table 1
    Suppl. Table 1. SiRNA library used for centriole overduplication screen. Entrez Gene Id NCBI gene symbol siRNA Target Sequence 1070 CETN3 TTGCGACGTGTTGCTAGAGAA 1070 CETN3 AAGCAATAGATTATCATGAAT 55722 CEP72 AGAGCTATGTATGATAATTAA 55722 CEP72 CTGGATGATTTGAGACAACAT 80071 CCDC15 ACCGAGTAAATCAACAAATTA 80071 CCDC15 CAGCAGAGTTCAGAAAGTAAA 9702 CEP57 TAGACTTATCTTTGAAGATAA 9702 CEP57 TAGAGAAACAATTGAATATAA 282809 WDR51B AAGGACTAATTTAAATTACTA 282809 WDR51B AAGATCCTGGATACAAATTAA 55142 CEP27 CAGCAGATCACAAATATTCAA 55142 CEP27 AAGCTGTTTATCACAGATATA 85378 TUBGCP6 ACGAGACTACTTCCTTAACAA 85378 TUBGCP6 CACCCACGGACACGTATCCAA 54930 C14orf94 CAGCGGCTGCTTGTAACTGAA 54930 C14orf94 AAGGGAGTGTGGAAATGCTTA 5048 PAFAH1B1 CCCGGTAATATCACTCGTTAA 5048 PAFAH1B1 CTCATAGATATTGAACAATAA 2802 GOLGA3 CTGGCCGATTACAGAACTGAA 2802 GOLGA3 CAGAGTTACTTCAGTGCATAA 9662 CEP135 AAGAATTTCATTCTCACTTAA 9662 CEP135 CAGCAGAAAGAGATAAACTAA 153241 CCDC100 ATGCAAGAAGATATATTTGAA 153241 CCDC100 CTGCGGTAATTTCCAGTTCTA 80184 CEP290 CCGGAAGAAATGAAGAATTAA 80184 CEP290 AAGGAAATCAATAAACTTGAA 22852 ANKRD26 CAGAAGTATGTTGATCCTTTA 22852 ANKRD26 ATGGATGATGTTGATGACTTA 10540 DCTN2 CACCAGCTATATGAAACTATA 10540 DCTN2 AACGAGATTGCCAAGCATAAA 25886 WDR51A AAGTGATGGTTTGGAAGAGTA 25886 WDR51A CCAGTGATGACAAGACTGTTA 55835 CENPJ CTCAAGTTAAACATAAGTCAA 55835 CENPJ CACAGTCAGATAAATCTGAAA 84902 CCDC123 AAGGATGGAGTGCTTAATAAA 84902 CCDC123 ACCCTGGTTGTTGGATATAAA 79598 LRRIQ2 CACAAGAGAATTCTAAATTAA 79598 LRRIQ2 AAGGATAATATCGTTTAACAA 51143 DYNC1LI1 TTGGATTTGTCTATACATATA 51143 DYNC1LI1 TAGACTTAGTATATAAATACA 2302 FOXJ1 CAGGACAGACAGACTAATGTA
    [Show full text]
  • Association of Cnvs with Methylation Variation
    www.nature.com/npjgenmed ARTICLE OPEN Association of CNVs with methylation variation Xinghua Shi1,8, Saranya Radhakrishnan2, Jia Wen1, Jin Yun Chen2, Junjie Chen1,8, Brianna Ashlyn Lam1, Ryan E. Mills 3, ✉ ✉ Barbara E. Stranger4, Charles Lee5,6,7 and Sunita R. Setlur 2 Germline copy number variants (CNVs) and single-nucleotide polymorphisms (SNPs) form the basis of inter-individual genetic variation. Although the phenotypic effects of SNPs have been extensively investigated, the effects of CNVs is relatively less understood. To better characterize mechanisms by which CNVs affect cellular phenotype, we tested their association with variable CpG methylation in a genome-wide manner. Using paired CNV and methylation data from the 1000 genomes and HapMap projects, we identified genome-wide associations by methylation quantitative trait locus (mQTL) analysis. We found individual CNVs being associated with methylation of multiple CpGs and vice versa. CNV-associated methylation changes were correlated with gene expression. CNV-mQTLs were enriched for regulatory regions, transcription factor-binding sites (TFBSs), and were involved in long- range physical interactions with associated CpGs. Some CNV-mQTLs were associated with methylation of imprinted genes. Several CNV-mQTLs and/or associated genes were among those previously reported by genome-wide association studies (GWASs). We demonstrate that germline CNVs in the genome are associated with CpG methylation. Our findings suggest that structural variation together with methylation may affect cellular phenotype. npj Genomic Medicine (2020) 5:41 ; https://doi.org/10.1038/s41525-020-00145-w 1234567890():,; INTRODUCTION influence transcript regulation is DNA methylation, which involves The extent of genetic variation that exists in the human addition of a methyl group to cytosine residues within a CpG population is continually being characterized in efforts to identify dinucleotide.
    [Show full text]
  • An Exome-Wide Sequencing Study of Lipid Response to High-Fat Meal and Fenofibrate in Caucasians from the GOLDN Cohort
    Washington University School of Medicine Digital Commons@Becker Open Access Publications 2018 An exome-wide sequencing study of lipid response to high-fat meal and fenofibrate in Caucasians from the GOLDN cohort Xin Geng Ping An Mary F. Feitosa Michael A. Province et al. Follow this and additional works at: https://digitalcommons.wustl.edu/open_access_pubs Supplemental Material can be found at: http://www.jlr.org/content/suppl/2018/02/20/jlr.P080333.DC1 .html patient-oriented and epidemiological research An exome-wide sequencing study of lipid response to high-fat meal and fenofibrate in Caucasians from the GOLDN cohort Xin Geng,* Marguerite R. Irvin,† Bertha Hidalgo,† Stella Aslibekyan,† Vinodh Srinivasasainagendra,§ Ping An,‡ Alexis C. Frazier-Wood,|| Hemant K. Tiwari,§ Tushar Dave,# Kathleen Ryan,# Jose M. Ordovas,$,**,†† Robert J. Straka,§§ Mary F. Feitosa,‡ Paul N. Hopkins,‡‡ Ingrid Borecki,|| || Michael A. Province,‡ Braxton D. Mitchell,# Donna K. Arnett,1,## and Degui Zhi1,*,$$ School of Biomedical Informatics* and School of Public Health,$$ The University of Texas Health Downloaded from Science Center at Houston, Houston, TX 77030; Departments of Epidemiology† and Biostatistics,§ University of Alabama at Birmingham, Birmingham, AL 35233; Division of Statistical Genomics, Department of Genetics,‡ Washington University School of Medicine, St. Louis, MO 63110; US Department of Agriculture/Agricultural Research Service Children’s Nutrition Research Center,|| Baylor College of Medicine, Houston, TX 77030; Department of Medicine, Division
    [Show full text]
  • 2014-Platform-Abstracts.Pdf
    American Society of Human Genetics 64th Annual Meeting October 18–22, 2014 San Diego, CA PLATFORM ABSTRACTS Abstract Abstract Numbers Numbers Saturday 41 Statistical Methods for Population 5:30pm–6:50pm: Session 2: Plenary Abstracts Based Studies Room 20A #198–#205 Featured Presentation I (4 abstracts) Hall B1 #1–#4 42 Genome Variation and its Impact on Autism and Brain Development Room 20BC #206–#213 Sunday 43 ELSI Issues in Genetics Room 20D #214–#221 1:30pm–3:30pm: Concurrent Platform Session A (12–21): 44 Prenatal, Perinatal, and Reproductive 12 Patterns and Determinants of Genetic Genetics Room 28 #222–#229 Variation: Recombination, Mutation, 45 Advances in Defining the Molecular and Selection Hall B1 Mechanisms of Mendelian Disorders Room 29 #230–#237 #5-#12 13 Genomic Studies of Autism Room 6AB #13–#20 46 Epigenomics of Normal Populations 14 Statistical Methods for Pedigree- and Disease States Room 30 #238–#245 Based Studies Room 6CF #21–#28 15 Prostate Cancer: Expression Tuesday Informing Risk Room 6DE #29–#36 8:00pm–8:25am: 16 Variant Calling: What Makes the 47 Plenary Abstracts Featured Difference? Room 20A #37–#44 Presentation III Hall BI #246 17 New Genes, Incidental Findings and 10:30am–12:30pm:Concurrent Platform Session D (49 – 58): Unexpected Observations Revealed 49 Detailing the Parts List Using by Exome Sequencing Room 20BC #45–#52 Genomic Studies Hall B1 #247–#254 18 Type 2 Diabetes Genetics Room 20D #53–#60 50 Statistical Methods for Multigene, 19 Genomic Methods in Clinical Practice Room 28 #61–#68 Gene Interaction
    [Show full text]
  • Downregulation of Carnitine Acyl-Carnitine Translocase by Mirnas
    Page 1 of 288 Diabetes 1 Downregulation of Carnitine acyl-carnitine translocase by miRNAs 132 and 212 amplifies glucose-stimulated insulin secretion Mufaddal S. Soni1, Mary E. Rabaglia1, Sushant Bhatnagar1, Jin Shang2, Olga Ilkayeva3, Randall Mynatt4, Yun-Ping Zhou2, Eric E. Schadt6, Nancy A.Thornberry2, Deborah M. Muoio5, Mark P. Keller1 and Alan D. Attie1 From the 1Department of Biochemistry, University of Wisconsin, Madison, Wisconsin; 2Department of Metabolic Disorders-Diabetes, Merck Research Laboratories, Rahway, New Jersey; 3Sarah W. Stedman Nutrition and Metabolism Center, Duke Institute of Molecular Physiology, 5Departments of Medicine and Pharmacology and Cancer Biology, Durham, North Carolina. 4Pennington Biomedical Research Center, Louisiana State University system, Baton Rouge, Louisiana; 6Institute for Genomics and Multiscale Biology, Mount Sinai School of Medicine, New York, New York. Corresponding author Alan D. Attie, 543A Biochemistry Addition, 433 Babcock Drive, Department of Biochemistry, University of Wisconsin-Madison, Madison, Wisconsin, (608) 262-1372 (Ph), (608) 263-9608 (fax), [email protected]. Running Title: Fatty acyl-carnitines enhance insulin secretion Abstract word count: 163 Main text Word count: 3960 Number of tables: 0 Number of figures: 5 Diabetes Publish Ahead of Print, published online June 26, 2014 Diabetes Page 2 of 288 2 ABSTRACT We previously demonstrated that micro-RNAs 132 and 212 are differentially upregulated in response to obesity in two mouse strains that differ in their susceptibility to obesity-induced diabetes. Here we show the overexpression of micro-RNAs 132 and 212 enhances insulin secretion (IS) in response to glucose and other secretagogues including non-fuel stimuli. We determined that carnitine acyl-carnitine translocase (CACT, Slc25a20) is a direct target of these miRNAs.
    [Show full text]
  • PPP1R35 Is a Novel Centrosomal Protein That Regulates
    RESEARCH ARTICLE PPP1R35 is a novel centrosomal protein that regulates centriole length in concert with the microcephaly protein RTTN Andrew Michael Sydor1, Etienne Coyaud2, Cristina Rovelli1, Estelle Laurent2, Helen Liu1, Brian Raught2,3, Vito Mennella1,4* 1Cell Biology Program, The Hospital for Sick Children, Toronto, Canada; 2Princess Margaret Cancer Centre, University Health Network, Toronto, Canada; 3Department of Medical Biophysics, University of Toronto, Ontario, Canada; 4Department of Biochemistry, University of Toronto, Ontario, Canada Abstract Centrosome structure, function, and number are finely regulated at the cellular level to ensure normal mammalian development. Here, we characterize PPP1R35 as a novel bona fide centrosomal protein and demonstrate that it is critical for centriole elongation. Using quantitative super-resolution microscopy mapping and live-cell imaging we show that PPP1R35 is a resident centrosomal protein located in the proximal lumen above the cartwheel, a region of the centriole that has eluded detailed characterization. Loss of PPP1R35 function results in decreased centrosome number and shortened centrioles that lack centriolar distal and microtubule wall associated proteins required for centriole elongation. We further demonstrate that PPP1R35 acts downstream of, and forms a complex with, RTTN, a microcephaly protein required for distal centriole elongation. Altogether, our study identifies a novel step in the centriole elongation pathway centered on PPP1R35 and elucidates downstream partners of the microcephaly protein RTTN. DOI: https://doi.org/10.7554/eLife.37846.001 *For correspondence: [email protected] Introduction Competing interests: The The centrosome is a membrane-less organelle whose major role is to organize, orient, and regulate authors declare that no competing interests exist. the site of microtubule formation.
    [Show full text]
  • Plk4-Induced Centriole Biogenesis in Human Cells
    Plk4-induced Centriole Biogenesis in Human Cells Dissertation zur Erlangung des Doktorgrades der Naturwissenschaften der Fakultät für Biologie der Ludwig-Maximilians Universität München Vorgelegt von Julia Kleylein-Sohn München, 2007 Dissertation eingereicht am: 27.11.2007 Tag der mündlichen Prüfung: 18.04.2008 Erstgutachter: Prof. E. A. Nigg Zweitgutachter: PD Dr. Angelika Böttger 2 Hiermit erkläre ich, dass ich die vorliegende Dissertation selbständig und ohne unerlaubte Hilfe angefertigt habe. Sämtliche Experimente wurden von mir selbst durchgeführt, soweit nicht explizit auf Dritte verwiesen wird. Ich habe weder an anderer Stelle versucht, eine Dissertation oder Teile einer solchen einzureichen bzw. einer Prüfungskommission vorzulegen, noch eine Doktorprüfung zu absolvieren. München, den 22.11.2007 3 TABLE OF CONTENTS SUMMARY…………………………………………………………………………..………. 6 INTRODUCTION……………………………………………………………………………. 7 Structure of the centrosome…………………………………………………………….. 7 The centrosome cycle…………………………………………………………………..10 Kinases involved in the regulation of centriole duplication………………………….12 Maintenance of centrosome numbers………………………………………………...13 Licensing of centriole duplication……………………………………………………... 15 ‘De novo ’ centriole assembly pathways in mammalian cells…………………..…...15 Templated centriole biogenesis in mammalian cells……………………………….. 18 The role of centrins and Sfi1p in centrosome duplication ……………………...…..19 Centriole biogenesis in C. elegans …………………………………………………… 21 Centriole biogenesis in human cells………………………………………………….. 23 Centrosome
    [Show full text]