Order Number 9411942
The role of NADP+-malic enzyme in tomato fruit
Finger, Fernando Luiz, Ph.D.
The Ohio State University, 1993
Copyright ©1993 by Finger, Fernando Luiz. All rights reserved.
U M I 300 N. Zeeb Rd. Ann Arbor, M I 48106 THE ROLE OF NADP+-MALIC ENZYME
IN TOMATO FRUIT
DISSERTATION
Presented in Partial Fulfillment of the Requirements for
the Degree Doctor of Philosophy in the Graduate
School of The Ohio State University
By
Fernando Lufz Finger, B.S., M.S.
*****
The Ohio State University
1993
Dissertation Committee: Approved by
M. Knee
L. M. Lagrimini [HLi t L ____ Advisor M. S. Biggs Department of Horticulture
J. J. Finer Copyright by Fernando Lufz Finger 1993 To My Parents
ii ACKNOWLEDGMENTS
I would like to express my sincere appreciation to my advisor Dr.
Michael Knee for his guidance and interest in this research. I would also like to thank Dr. Mark Lagrimini for sharing his expertise in molecular biology techniques. Thanks go to Drs. Scott Biggs and John Finer for their comments and suggestions. I would like to thank the following Brazilian institutions,
Universidade Federal de Vigosa, CAPES and FAPEMIG for their financial support. Special thanks go to my colleague Dr. Raimundo Santos Barros for his friendship and encouragement. I am very grateful to Dr. Avtar Handa
(Purdue University) for providing the tomato fruit lambda ZAP If library and Dr.
Timothy Nelson (Yale University) for the corn malic enzyme cDNA clone. I would like to thank my fellow graduate students, in special, Joe Curran and
Karen Klotz for their friendship. This research was in part supported by a grant from The Ohio State Graduate Student Alumni Research Award. VITA
July 8, 1958 Born - Caxias do Sul, Brazil
1982 B.S., Universidade Federal de Pelotas, Brazil
1986 M.S., Universidade Federal de Vigosa, Brazil
1986-Present Assistent Professor of Universidade Federal de Vigosa, Brazil
PUBLICATIONS
Finger F. L. (1985). Effects of water loss on postharvest physiology of green pepper (Capsicum annuum L.) and (Musa acuminata Colla) fruits. M.S. Thesis, Universidade Federal de Vicosa, Brazil.
Knee M. and Finger F. L. (1992). NADP+-Malic enzyme and organic acid levels in developing tomato fruits. J. Amer. Soc. Hort. Sci. 117: 799-801.
FIELDS OF STUDY
Major Field: Horticulture
Postharvest physiology of fruits and vegetables TABLE OF CONTENTS
ACKNOWLEGMENTS ...... iii
VITA ...... iv
LIST OF TABLES ...... vii
LIST OF FIGURES...... viii
GENERAL INTRODUCTION...... 1
CHAPTER
I. NAD P+-MALIC ENZYME AND ORGANIC ACID METABOLISM IN DEVELOPING TOMATO FRUITS...... 14
Introduction ...... 14 Materials and M ethods ...... 17 Results and Discussion ...... 21 Conclusions ...... 40 List of References ...... 42
II. PURIFICATION AND INTRACELLULAR LOCATION OF TOMATO FRUIT NADP+-MALIC ENZYME ...... 44
Introduction ...... 44 Materials and M ethods ...... 47 Results and Discussion ...... 61 Conclusions ...... 88 List of References ...... 90
v III. ISOLATION AND CHARACTERIZATION OF A cDNA CLONE FOR NADP+-MALIC ENZYME FROM TOMATO FR U IT...... 94
Introduction ...... 94 Materials and M ethods ...... 97 Results and Discussion ...... 113 Conclusions ...... 135 List of References ...... 137
SUMMARY AND CONCLUSIONS...... 140
LIST OF REFERENCES...... 145
vi LIST OF TABLES
TABLE PAGE
1.1 NADP+-malic enzyme activity, malic and citric acid contents in various tissues of mature-green 'Ohio 7814’ tomato fruits 37
2.1. Purification of NADP+-malic enzyme from mature-green tomato fruit pericarp ...... 62
2.2. Activity of NADP+-glyceraldehyde-3-phosphate dehydrogenase in intact and 0.1% Triton X-100 lysed chloroplast fraction of immature-green tomato fruit pericarp, tomato leaves and corn leaves ...... 78
2.3. Total and specific activities of ribulose-1,5- bisphosphate carboxylcise in the Sephadex G-25 protein fraction of the supernatant and 0.1% Triton X-100 lysed chloroplast fraction from immature-green tomato fruit, tomato leaves and corn leaves ...... 79
2.4. Total and specific activities of NADP+-malic enzyme in the Sephadex G-25 protein fraction of the supernatant and 0.1% Triton X-100 lysed chloroplast fraction from immature-green tomato fruit, tomato leaves and corn leaves ...... 81
3.1. Comparison of nucleotide sequence between ME-4 cDNA and the sequence of malic enzyme cDNAs from other sources. ... 130 LIST OF FIGURES
FIGURE PAGE
1.1. Transverse section of a tomato fruit showing the various tissues ...... 18
1.2. Changes in specific activity of NADP+-malic enzyme in the outer pericarp of Cherry tomato fruits through ripening ...... 23
1.3. Changes in specific activity of NADP+-malic enzyme in the inner tissues of Cherry tomato fruits through ripening ...... 24
1.4. Changes in malic acid concentration during Cherry tomato fruit ripening ...... 27
1.5. Fruit growth in fresh weight and soluble protein changes in the outer pericarp and inner tissues of ’Ohio 7814’ tomatoes 29
1.6. Changes during fruit development for the outer pericarp of 'Ohio 7814' tomato in specific activity of NADP+-maiic enzyme 30
1.7. Changes during fruit development for inner tissues of 'Ohio 7814’ tomato specific activity of NADP+-malic enzyme ...... 31
1.8. Changes during fruit development for outer pericarp of ’Ohio 7814’ tomato, in specific activity of NADP+-ma!ic enzyme, malic acid and citric acid contents ...... 34
1.9. Changes during fruit development for inner tissues of 'Ohio 7814’ tomato, in specific activity of NADP+-malic enzyme, malic acid and citric acid contents ...... 35
2.1. Purification of NADP+-malic enzyme from tomato fruit on DEAE- Cellulose column ...... 63 2.2. Purification of NADP+-malic enzyme from tomato fruit on gel filtration column ...... 65
2.3. Estimation of the molecular weight of native NADP+-malic enzyme (ME) from tomato fruit by Sephacryl S-300 chromatography...... 66
2.4. Purification of tomato fruit NADP+-malic enzyme on pseudo affinity chromatography Cibacron Bluecolumn ...... 68
2.5. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (12% separating gel) of fractions eluted from Cibacron Blue 3GA Agarose column ...... 70
2.6. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (8% separating gel) of a fraction eluted from Cibacron Blue 3GA Agarose column ...... 72
2.7. Western blots following 8% sodium dodecyl sulfate- polyacrylamide gel electrophoresis ...... 74
2.8. Immunoinhibition of tomato fruit NADP+-malic enzyme activity in a Sephadex G-25 protein fraction ...... 76
2.9. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (8% separating gel) of total and chloroplastidic protein fraction from tomato fruit, tomato leaves and corn leaves ...... 83
2.10. Western blot following 8% sodium dodecyl sulfate-polyacrylamide gel electrophoresis of total and chloroplastidic protein fraction from tomato fruit, tomato leaves and corn leaves ...... 84
2.11. Western blot following 8% sodium dodecyl sulfate-polyacrylamide gel electrophoresis of total protein fraction from tomato stems and roots, and corn roots ...... 85
3.1. Northern hybridization analysis of NADP+-malic enzyme transcripts...... 114
3.2. Southern hybridization analysis of tomato fruit NADP+-malic enzyme cDNAs ...... 116
ix 3.3. Northern hybridization analysis of NADP+-malic enzyme transcripts...... 117
3.4. Southern hybridization analysis of tomato fruit NADP+-malic enzyme cDNAs ...... 120
3.5. Nucleotide sequence of ME-4 cDNA encoding tomato fruit NADP+-malic enzyme ...... 121
3.6. Diagrammatic representation of NADP+-ma!ic enzyme tomato cDNA clone ...... 129
3.7. Nucleotide sequence and amino acid composition of NADP+- malic enzyme amino terminus in C3 plants ...... 132
3.8. Genomic hybridization analysis of tomato NADP+-malic enzyme gene ...... 134
x GENERAL INTRODUCTION
Fleshy fruits are considered to be the product of determinate growth from ovaries or inflorescence. During growth, fruits are major sinks to the plant, accumulating organic acids, sugars, lipids, starch, and water. Soluble solutes and water are mainly accumulated in the cellular vacuoles, and apparently drive cell expansion and fruit growth (Coombe, 1976). Once the fruit reaches physiological maturity, ripening will eventually occur. Ripening is often characterized by transitions in texture, color, sweetness, astringency and acidity. In climacteric fruits, ripening is associated with a rise in respiration and autocatalytic production of ethylene; but in nonclimacteric fruits, ripening takes place with no apparent alteration in respiration and ethylene evolution (Biale and Young, 1981). Ripening and the rise of respiration are independent events in climacteric fruits; however, both are stimulated by the hormone ethylene.
The notion that ripening is mainly a degradative process is contradicted by the increase in synthetic activity such as transcription and translation, and preservation of membrane integrity (Biale and Young, 1981). Ripening is characterized by the expression of new proteins and messenger RNAs which have been absent or at a low level in immature fruits; however, the function of 2 the majority remain unknown. The expression of mRNAs that increase during ripening include those which encode some enzymes of pigment and ethylene biosynthesis, and cell wall degradation (Gray eta!., 1992). Only a few ripening- related enzymes have been identified, such as polygalacturonase which is involved in cell wall pectin degradation in tomato fruits (Schuch etaL, 1989).
In addition to its economic importance, tomato fruit has served as a model to study the physiological and biochemical changes that take place during ripening of climacteric fruits. Most studies have focused on enzymes involved in ethylene biosynthesis and cell wall degradation in fruit ripening.
Other works concern the factors responsible for the climacteric rise in respiration and the enzymology of cell wall degradation during ripening.
However, other aspects of fruit ripening of economic importance such as organic acid metabolism, remain to be better understood. Tomato fruits accumulate organic acids throughout growth, and a large proportion of these acids are degraded during ripening (Winsor et al., 1962). Citrate and malate are major components of taste in fresh fruits and an important part of processed tomato product quality (Hobson and Davies, 1971). Acidity of tomato fruits is influenced by genetic and environmental factors. The pH of juice from locular and pericarp tissues of tomato fruit shows a negative correlation with total content of organic acids; high levels of potassium in the soil increase the content of citrate and malate in fruits (Mahakun ef a/., 1979;
Davies, 1964). Moreover, tomato juice pH is highly dependent on variety and fruit ripeness; overripe tomatoes usually have a relatively high pH; tomato juice pH has to be below pH 4.6 to reduce the risk of microbial spoilage by
Clostridium botulinum after processing (Sapers ef al ., 1978; Wolf ef a/. ,1979).
In recent years, recombinant DNA technology has contributed to a better understanding of plant nucleic acid metabolism and molecular biology.
Because of molecular cloning and transformation techniques, the roles played by several proteins in plant metabolism are better established. In addition, the commercial applications of agricultural biotechnology in controlling the expression of specific genes in transgenic plants seems promising in the near future. The genetic manipulation of gene(s) encoding enzyme(s) involved in organic acid degradation may be the natural approach to control and manipulate the expression of enzyme(s) involved in acid metabolism.
NADP+-malic enzyme (EC 1.1.1.40) is present in both animal and plant tissues. In addition, the enzyme is also found in prokaryotic and eukaryotic microorganisms (Edwards and Andreo, 1992). Malic enzyme catalyzes the reversible reaction as follows:
Me2+ L-malate + NADP+ it Pyruvate + NADPH + C02
At physiological pH, the enzyme catalyzes the oxidative decarboxylation of malate in the presence of a divalent cation (Me2+) as cofactor, which can be either Mg2+ or Mn2+ depending on the enzyme source (Possner ef al., 1981;
Dubery and Schabort, 1981). In animals, malic enzyme is located in the cytosol and seems to be involved in the biosynthesis of long chain fatty acids (Bagchi ef a/., 1987). On the other hand, in plant tissues the enzyme can be located in the cytoplasm and/or chloroplast, and is involved in specific physiological roles, depending on the plant species or tissue and intracellular location.
Malic enzyme in some C4 and crassulacean acid metabolism (CAM) plants is involved in the release of C02 to the reductive pentose phosphate pathway. C4 plants fix COa in the leaf mesophyll cells, converting phosphoenolpyruvate into oxaloacetate by phosphoenolpyruvate (PEP) carboxylase (EC 1.1.31) activity. In the NADP+-malic enzyme type C4 pathway plants, oxaloacetate is converted to malate by NADP+-malate dehydrogenase
(EC 1.1.82) in the mesophyll chloroplasts (Nelson and Langdale, 1992). Finally, in the chloroplasts of bundle sheath cells, malic enzyme decarboxylates malate to pyruvate releasing C02 as substrate for ribulose 1,5-bisphosphate carboxylase/oxygenase (Rubisco; EC 4.1.1.39) (Edwards and Huber, 1981).
Although in CAM plants malic enzyme seems to be located in the cell cytoplasm, it plays a similar physiological role to that present in the chloroplast of the NADP+-malic enzyme C4 plants subgroup (Schnarrenberger ef a/., 1980;
Ting, 1985).
Crassulacean acid metabolism is a photosynthetic process present in the families Crassulaceae and Cactaceae in which malic acid is accumulated in the vacuole at night and decarboxylated in the next daylight period. The CAM plants take up the external C 02 at night when the stomata are open, and recycle the COz for incorporation into the Calvin cycle during daylight after stomatal closure {Osmond and Holtum, 1981). At night, PEP carboxylase incorporates COa into phosphoenolpyruvate to form oxaloacetate, which is converted into malic acid by NAD+-malate dehydrogenase activity. The malic acid accumulated in the vacuole is mobilized to the cytosol in the next daylight period, and then decarboxylated by NADP+-malic enzyme activity; the C 02 diffuses to the chloroplast to be incorporated into the Calvin cycle metabolism by Rubisco activity (Ting, 1985). This unique photosynthetic process is considered an important adaptation for the plant survival under constant water stress conditions.
The metabolism of malate by NADP+-malic enzyme may participate in a cytoplasmic ’pH stat’ in plant cells. The pH-activity curves of PEP carboxylase and malic enzyme suggest that an increase in pH leads to higher carboxylation activity by PEP carboxylase resulting in malate accumulation. On the other hand, a decrease in pH results in increase of the decarboxylation activity of malic enzyme, returning to a higher pH status (Davies, 1986). Thus, PEP carboxylase incorporates a carboxyl group into phosphoenolpyruvate generating oxaloacetate, which is converted into malic acid by malate dehydrogenase activity. Finally, malic enzyme decarboxylates malate to pyruvate which can be metabolized in the tricarboxylic (TCA) cycle.
Decarboxylation of malate by malic enzyme may be involved in the early cell response to hypoxia in maize roots; decarboxylation of malate could reverse
the drop in the cytoplasmic pH caused by oxygen deprivation (Roberts et al.,
1992).
NADP+-malic enzyme seems to be associated with degradation of
malate in some climacteric and nonclimacteric fruits. Fruits like tomato and
grape accumulate malic acid throughout their growth, but fruit ripening is
marked by a decrease in the malate content which may be related to an
increase in specific activity of malic enzyme (Ruffner and et at., 1976; Jeffery
et al., 1984). Malate and citrate are the two predominant organic acids in tomato fruits, and may be important sources of respiratory substrates during the climacteric rise of respiration. The respiratory quotient (R.Q.=COa
production/Oz absorption) is usually thought to indicate the nature of
respiratory substrates. The R.Q. approaches 1 when sugars are consumed and
1.33 when malic or citric acid is fully oxidized (Ulrich, 1970). Detached tomato fruits show an R.Q. between 1.10 to 1.20 during ripening (Pratt and Workman,
1961). This suggests that some of the organic acids may be used as sources
of respiratory substrates. Goodenough et al. (1985) suggest that malate
decarboxylation by malic enzyme activity may account for 60% of the total COa evolution at the mature-green/breaker stages of tomato fruits. They suggest that at the mature-green/breaker stages the TCA cycle may not be fully operative, since citrate synthase, malate dehydrogenase and NAD+
mitochondrial malic enzyme activities are declining (Jeffery et al., 1984; Goodenough ef al., 1905). They conclude that the decarboxylation of malate
by malic enzyme activity would account for the increase in fruit respiration during transition of mature-green to breaker stages in ripening. Therefore, the metabolism of malate could decouple the respiratory metabolism from glycolysis. Malic enzyme activity would provide pyruvate for malate and citrate oxidation by the TCA cycle; and NADPH could be oxidized by the NADPH dehydrogenase at the exterior of the inner mitochondrial membrane (Douce and Neuburger, 1989).
It is well known that controlled atmosphere storage (high COa and low
Oa concentrations) inhibits fruit ripening. Tomatoes stored in controlled atmosphere conditions show temporal separation of fruit color changes and breakdown of starch to monosaccharides, from changes in organic acid concentrations in tomatoes (Goodenough ef al., 1982). Jeffery ef al. (1984) found that controlled atmosphere storage of tomato fruits induced an initial increase in the specific activity of malic enzyme and a sharp decrease in malate content, which occurred before any change in lycopene, polygalacturonase, and ethylene biosynthesis. In addition, exogenous ethylene applied to mature-green fruits had no effect on malic enzyme activity, suggesting that malic enzyme is an "ethylene-independent" enzyme. This suggests that malic enzyme could be involved in other physiological events besides the climacteric rise of respiration in tomatoes. In addition, in some nonclimacteric fruits like grape, the high malic enzyme activity present during ripening argues against its potential involvement in the rise of respiratory metabolism.
In order to elucidate the role of malic enzyme in tomato fruit, purification of malic enzyme is the starting point to raise polyclonal antibodies, which can be used to locate the enzyme in subcellular preparations and probe the expression of isoforms in different tissues. Malic enzyme has been purified to homogeneity from both C3 and C4 plant tissues. Isoforms were purified from
Lupinus luteus, sugar cane and corn leaves (Tomaszewskaef al., 1983; Iglesias and Andreo, 1989; Pupillo and Bossi, 1979). Several reports claim the purification of fruit malic enzyme from tomato, mango and grape (Goodenough et al., 1985; Dubery and Schabort, 1981; Possner et al., 1981). The native molecular weight of malic enzyme ranges from 250- to 265-kDa; the enzyme is a tetramer with 62- to 65-kDa subunits (Edwards and Andreo, 1992).
However, the intracellular location of malic enzyme remains to be better studied, particularly in C3 plant tissues. A number of studies suggest that a cytoplasmic malic enzyme isoform is present in tomato, corn roots and corn leaves (Goodenough et al., 1985; Danner and Ting, 1967; Scagliarini et al.,
1988). El-Shora and ap Rees (1991) found that malic enzyme activity was mostly associated with the chloroplasts in cotyledons of germinating marrow seedlings and protoplasts of suspension cultures of soybean. They suggest that the enzyme is confined to the plastids in C3 plants and is involved in biosynthesis; they argue that malic enzyme activity in the soluble fraction is a consequence of chloroplast breakage during extraction. If the enzyme is confined to the plastids of C3 plants, as suggested by El-Shora and ap Rees
(1991) this would exclude any major role of malic enzyme in the climacteric rise of respiration in tomato fruits. However, Pupillo and Bossi (1979) working with partially purified malic enzyme from corn, found two isozymes with distinct isoelectric point and optimum pH activities. The isoform with optimum pH of
7 is assumed to be cytoplasmic, while the isoform with maximum activity at pH
8 is expected to be located in the chloroplast. The assumption seems to be consistent with the physiological pH conditions present in the cytoplasm and chloroplast. Furthermore, the nucleotide sequence of full length malic enzyme cDNAs of C4 plants show a transit peptide sequence to transport the protein into the chloroplast stroma, but the transit sequence is absent from the cDNAs of C3 plants (Rothermel and Nelson, 1989; Borsch and Westhoff, 1990; van
Doorsselaere et al., 1991). Sequence analysis of the chloroplastidic malic enzyme gene and the cytoplasmic isoform indicate the existence of two different nuclear genes coding for the enzyme in maize (Edwards and Andreo,
1992). The authors suggest that the gene encoding the chloroplast malic enzyme has arisen from the cytoplasmic isoform, probably by gene duplication.
Modern techniques for isolating and cloning genes have made it possible to introduce foreign genes into plant cells. Transformation of plants with genes is able to change specific aspects of the physiology and biochemistry of the resulting transgenic plants. Furthermore, the role of a particular enzyme in metabolism can be directly demonstrated by controlling the expression of its gene in transformed plants. The bacterium Agrobacterium tumefaciens is known for its ability to transfer DNA (T-DNA) into several dicot plant cells. The Ti-plasmid of A. tumefaciens has been successfully used as a vector to incorporate foreign cDNA genes into the plant nuclear DNA (Klee et al., 1987). The presence of a suitable promoter in the transferred cDNA can lead to constitutive expression of the gene product or expression in a specific tissue or stage of development in the transgenic plants. In the case of tomatoes, cotyledons or leaf discs are inoculated with A. tumefaciens containing the modified Ti-plasmid, which also carries a gene for antibiotic resistance. Plant tissue containing the transformed cells is selected by growth on a medium incorporating kanamycin; shoot and plant regeneration are obtained by transferring the explants to appropriate hormone balanced culture medium (Horsch et al., 1985; Smith et al., 1988).
The molecular biology of fruit ripening has been extensively studied in tomatoes, due to their commercial importance and the availability of mutants, transformation and regeneration systems, and chromosome maps. There are many genes involved in the changes that occur in fruits during ripening, and the functions of most genes are still unknown. However, the importance of some fruit ripening related enzymes has been extensively studied by manipulation of their expression in transformed plants. The expression of a gene can be reduced or turned off by introducing a gene construct which results in transcription of the antisense RNA. This reduces the accumulation of the sense RNA and synthesis of the corresponding protein (Gray et al., 1992).
Tomato plants transformed with an antisense DNA construct of a polygalacturonase gene show polygalacturonase expression reduced by 99% and inhibition of pectin depolymerization during fruit ripening (Smith ef al.,
1990). Transformation with an antisense gene for the key enzyme of ethylene biosynthesis, 1-aminocyclopropane-1-carboxylic acid (ACC) synthase, inhibits ethylene synthesis, ripening and the climacteric rise in respiration of tomato fruits (Oellerefa/., 1991), Transgenic tomato plants expressing antisense RNA for phytoene synthase show less synthesis of the carotenoid lycopene, during fruit ripening (Bird et al., 1991; Bartley et al., 1992).
Over-expression of certain genes under control of a constitutive promoter frequently has been used as a way to study the physiological effects of protein over-synthesis, as well as to generate new plant phenotypes.
Transformed plants over-expressing chitinase or pathogen related protein genes showed an increased level of these proteins in their tissues; however, no increase in plant disease resistance was observed (Dixon and Harrison,
1990). Tobacco plants over-expressing an anionic peroxidase show wilting once the plant reaches sexual maturity (Lagrimini, 1992). Plants overproducing the tryptophan monooxygenase of auxin biosynthesis show that auxin is involved in apical dominance, and overproduction of ACC-deaminase inhibits 12 ethylene synthesis, resulting in greater stem elongation in transgenic plants
(Romano et al., 1993).
The manipulation of any gene product requires isolation of its coding
sequence most conveniently as a cDNA. Malic enzyme cDNAs from several C3
and C4 plants have been isolated from expression libraries using antibodies or
even heterologous DNA probes. Complete nucleotide sequence of NADP+-
malic enzyme cDNAs from Flaveria trinervia, Zea mays, Populus and Phaseolus
vulgaris, and the partial sequence of Flaveria linearis, show homology ranging
from 70% to 92% (Rajeevan ef al., 1991; van Dorsselaere ef al., 1991).
Furthermore, the malic enzyme cDNA sequences contain a highly conserved
region which codes for a 10 amino acid long peptide segment identified as the
potential NADP+-binding site. This high nucleotide homology among the malic
enzyme cDNAs suggests that any one of these DNAs could be used as a
probe to screen and isolate a malic enzyme cDNA clone from a tomato library.
The main goals of this project were to obtain correlative evidence for the
role of NADP+-malic enzyme in malic acid metabolism during tomato fruit
development; to investigate the intracellular location of the enzyme in tomato
cells; to isolate and sequence a malic enzyme cDNA clone; and to study the
enzyme expression in different tomato tissues. This work will allow the future
manipulation of the malic enzyme expression in tomato plants by antisense or
over-expression DNA constructs. The phenotypic effects of such transformations should yield new evidence of the role of NADP+-maIic enzyme in fruit ripening and in C3 plants in general. It could also be beneficial for commercial handling of tomato fruit if better control of postharvest acid metabolism could be achieved. CHAPTER I
NADP+-MALIC ENZYME AND ORGANIC ACID METABOLISM IN
DEVELOPING TOMATO FRUITS.
INTRODUCTION
Several fruits, including tomato, accumulate organic acids during fruit growth which can be used as major respiratory substrates during ripening. The two major nonvolatile organic acids in tomato fruit are citric and malic acids.
They are responsible for 98% of nonvolatile organic acids in the fruit tissues
(Buescher, 1975). Little information is available on changes in the concentration of these two acids throughout tomato fruit development. Most of the studies related to fruit acid metabolism focus on later stages of fruit development or changes related to specific environmental conditions, such as storage in chilling temperatures or controlled atmospheres.
Detached tomato fruits stored at 19°C showed a drastic decrease in malic acid content during the first stages of ripening, while citric acid presents a less sharp decrease (Thorne and Efiuvwevwere, 1988). On the other hand,
14 15
chilled fruits showed an increase in citric acid content while malic acid
concentration decreases (Thorne and Efiuvwevwere, 1988). Mature-green
tomatoes stored in 6% COz and 6% 0 2 showed a decrease in malic acid,
however citric acid showed a transient increase and then fell to a lower
concentration than that observed at the beginning of the experiment (Jeffery
etal., 1984).
Dalai etal. (1965) reported that malic and citric acids content increased
continuously during fruit growth, reaching maximum concentration at the red-
ripe stage. However, the total titrable acidity showed a slight decrease after the
breaker stage. On the other hand, in another similar study, Davis (1966)
observed that attached tomato fruits showed a decrease in malic acid content from mature-green to ripe stage, while citric acid concentration increased up to the breaker stage and exhibited a slow decrease in the later stages. In addition, the locular contents of the tomato fruit showed higher malic and citric acid contents than those in the outer pericarp walls (Davis, 1966).
In nonclimacteric fruits such as grapes, citric and malic acids accumulate during growth and development of the berry. Just after the onset of fruit softening the concentration of malic and citric acids decreases sharply; however, the berry continues to increase in volume throughout ripening. Acid content on a per berry basis showed a decrease in malic acid concentration.
On the other hand, citric acid exhibited a plateau followed by an increase
(Ruffner and Hawker, 1977). The results suggest that malic acid is degraded 16 selectively during ripening, while citric acid accumulates.
The decrease in malic acid during tomato ripening coincides with an
increase of cytoplasmic NADP+-malic enzyme (EC 1.1.1.40) specific activity as
observed in fruits stored in 6% C 02 and 6% Oa atmospheric conditions (Jeffery
etal. 1984). In addition, malate consumption during grape ripening seems also to be due to NADP+-dependent malic enzyme activity (Lasko and Kliewer,
1975; Ruffnerefa/., 1976). Jeffery etat. (1984) distinguished between "ethylene
dependent" and "independent" events occurring in tomato fruits stored in
controlled atmospheres. Alterations in acid metabolism occurred before an
increase in ethylene and therefore appeared to be "ethylene independent".
Goodenough ef al. (1985) observed a slight increase in specific activity of
NADP+-malic enzyme at the first stages of tomato fruit ripening. The authors suggested that TCA cycle is suppressed during ripening and that malic enzyme could be responsible for 60% of COz released in the respiratory climacteric at the mature-green and breaker stages.
The experiments conducted attempted to relate the activity of NADP+- malic enzyme activity to changes in malic and citric acid metabolism during tomato fruit development. In addition, malic enzyme activities were also measured in vegetative tomato tissues to determine if the enzyme is specifically expressed in fruit. 17
MATERIALS AND METHODS
Materials
In preliminary experiments, malic enzyme assays were conducted with
’Large Cherry Red' tomatoes obtained from the greenhouse. Mature-green cherry tomatoes were harvested and left to ripen at room temperature; malic enzyme activity and malate content were determined at mature-green, breaker and ripe stages.
For more extensive studies, tomato plants of cv. ’Ohio 7814’ (Berry and
Gould, 1983) were grown at The Ohio State University Horticulture Farm,
Columbus. Tomato seedlings were produced in the green-house and transplanted to the field when 35-40 days old. Flowers trusses were tagged as flowers opened every two days so that fruits of known age could be harvested each week. After harvest, fruits were washed and weighed in the laboratory. In addition, mature leaves, stems and roots were collected from the field plants for analysis of malic enzyme activity and malate content.
Extraction of the enzyme
Tomato fruits were divided into outer pericarp (walls) and ’inner’ tissues
(inner pericarp, placenta/columella, and jelly) except the seeds. Mature-green tomatoes were separated more extensively into outer pericarp, inner pericarp, placenta/columella, jelly and seeds as described by Brecht (1987), and as 18 shown in Figure 1.1:
Placenta Radial Pericarp
-O; Locular Gel
Outer Pericarp
Skin Seeds
Figure 1.1. Transverse section of a tomato fruit showing the various tissues.
The activity of malic enzyme, malate and citrate concentrations were determined in each part of the separated fruit tissues.
Two replicate 20 g samples of outer pericarp or inner tissues were homogenized at 0°C in 2 volumes of 0.1 M MOPS, 0.1 M Bicine (pH 8.2), 3 mM
EDTA, 5 mM /?-mercaptoethanol with 1% (w/v) polyvinylpyrrolidone (PVP-40T), using a Polytron (Brinkmann Instruments, Westbury, NY 11590) for 15 sec. The homogenate was filtered through 4 layers of muslin and the filtrate was centrifuged at 20,000 x g at 0°C for 20 minutes. The centrifuged supernatant fraction was divided into two portions; one sample (200 pi) was used in the
NADP+-malic enzyme assay, and the other 5.0 ml sample was applied to a 18 19 x 1.5 cm column of Sephadex G-25 equilibrated with 10 mM Bicine, 10 mM
MOPS (pH 7.0), 1 mM /?-mercaptoethanol and 0.5 mM MnS04. Elution was
continued with the same buffer at 2.0 ml min1 and 2°C. Elution of the protein
fraction from Sephadex G-25 was monitored at 280 nm. The excluded peak
was collected and its protein content was estimated by the Bradford (1976)
method.
Enzyme assay
The centrifuged supernatant crude extract and the protein fraction collected from the Sephadex G-25 column were assayed for NADP+-malic enzyme activity in a 3.0 ml reaction mixture. The reaction buffer contained 0.1
M Bicine, 0.1 M MOPS (pH 7.0), 10 mM malic acid (pH 7.0), 0.5 mM NADP+ sodium salt and 5 mM MnS04. The malic enzyme activity was followed in a
Shimadzu UV 160U spectrophotometer by reduction of NADP+ to NADPH at
340 nm and a temperature of 25±1°C as described by Goodenough ef at. (1985). Control assays were conduced by substituting malate or NADP+ with double distilled water. The reaction was started by addition of 200 ^l of crude extract or protein fraction , and the reaction rates were calculated from the increase in absorbance at 340 nm over 3 minutes, using the extinction coefficient for NADPH of 6.22 cm2 /*mole1. 20
Protein estimation
Protein content in the centrifuged supernatant crude extracts or protein fraction from Sephadex G-25 was estimated by the method described by
Bradford (1976). The Bradford reagent was obtained by mixing 100 mg of
Coomassie brilliant blue G-250 with 50 ml 95% ethanol with agitation and then addition of 100 ml 85% phosphoric acid. The mixture was diluted to one liter with double distilled water, followed by filtration with Watman #1 filter paper.
Protein was assayed in a 0.1 ml sample with 1.0 ml of Bradford reagent using bovine serum albumin (BSA) as standard. The absorbance was recorded in a
Shimadzu UV 160U spectrophotometer at 595 nm after 10 minutes reaction of the protein extract with the Bradford reagent.
Malate content
Malate in crude extracts was estimated by enzymatic procedure
(Bergmeyer, 1983). A sample (50 jil) of buffer extract sample from the fruits or vegetative tissues was added to the reaction mixture containing 76 mM Tris-
NaOH (pH 10), 50 mM L-glutamic acid (pH 10), 2 mM NAD+ sodium salt, and
200 U of L-aspartate: 2-oxoglutarate aminotransferase (EC 2.6.1.1) in a total volume of 1.0 ml. The reaction was started by addition of 16 U of L-malate:
NAD+ oxireductase (EC 1.1.1.37). The increase of absorbance at 339 nm was recorded in a Shimadzu UV 160U spectrophotometer. The malate content was determined based on the total reduction of NAD+ to NADH at absorbance 339 21
nm over 5 min. The total moles of NADH produced by the reaction was
estimated using the extinction coefficient of 6.22 cm2 jim ole1.
Citrate content
Citric acid in centrifuged crude extracts were determined by the
enzymatic assay described by Moellering and Gruber (1966). A 10 (il sample from fruit or vegetative tissues was mixed with 67 mM Tris-HCI (pH 7.6), 0.1
mM ZnS041 0.2 mM NADH, 2 U of lactate dehydrogenase (EC 1.1.1.27), 5 U
malate dehydrogenase (EC 1.1.1.37). The reaction was initiated by addition of
5 U citrate lyase (EC 4.1.3.6) in a total volume of 1.0 ml. The citric acid content was estimated based on the total oxidation of NADH to NAD+ in a Shimadzu
UV 160U spectrophotometer at 340 nm over 3 min. Total moles of NADH
oxidated by the reaction assay was determined based on the extinction
coefficient of 6.22 cm2 jimole'1.
RESULTS AND DISCUSSION
Preliminary studies
Initial analysis of NADP+-malic enzyme activity was conducted in 'Large
Cherry Red’ tomato fruits. Mature-green fruits were stored at room temperature; malic enzyme activity and malate content were determined at mature-green, breaker and red stages. 22
Figures 1.2 and 1.3 show the specific activity of NADP+-malic enzyme in outer pericarp and inner tissues during fruit ageing. Specific activity presented a continuous decline during ripening in both fruit tissues analyzed
(Fig. 1.2 and 1.3). Goodenough etal. (1985) in studying the NADP+-malic enzyme activity during tomato fruit ripening, found a slight increase in the specific activity at the onset of fruit ripening (breaker stage); however, they observed a similar decline in malic enzyme activity later in fruit ripening. The authors did not mention from which fruit tissues they extracted the enzyme. As observed in Figures 1.2 and 1.3, malic enzyme activity in the outer pericarp was 23% lower at mature-green, 32% at breaker, and 49% at ripe stages compared to those activities observed in the inner tissues. Thus the relative amount of outer pericarp and inner tissues which composed the experimental samples could be responsible for some of the variations observed by
Goodenough et al. (1985) in the malic enzyme activity.
The supernatant of centrifuged crude extracts showed the highest specific activity in both outer pericarp and inner fruit tissues at the three stages analyzed, while the protein fraction from gel filtration presented a 45% lower activity in the outer pericarp and 22% in the inner tissues compared to those in the equivalent supernatants from crude extracts (Fig. 1.2 and 1.3). This may reflect the removal of an activator of malic enzyme when the crude extract was passed through the Sephadex G-25. NADP+-Malic enzyme shows allosteric properties based on kinetic studies of the enzyme isolated from potato tuber 23
M B 0.7
0.6 c *0J4*^ o 0.5 \ x O) E 0.4
X D_ Q 0.3
O E 0.2
0.1
1 4 6 8 10 Days after harvest
Figure 1.2. Changes in specific activity of NADP+-malic enzyme in the outer pericarp of ’Large Cherry Red’ tomato fruits throughout ripening. Reaction assays contained the supernatant of the centrifuged crude extract plus malate (-&-), same extract less malate (-£ -), and gel filtration protein fraction (—B—). M = mature-green, B = breaker and R = ripe. 24
c 0.8 a> 2 a. O) ^ 0.6 ' c
'E X CL Q < 0.4 o E 3.
0.2
0 2 4 6 8 10 Days after harvest
Figure 1.3. Changes in specific activity of NADP+-malic enzyme in the inner tissues of ’Large Cherry Red’ tomato fruits throughout ripening. Reaction assays contained the centrifuged crude extract plus malate (^r), same extract less malate (—^-), and gel filtration protein fraction ( - B - ) . M - mature-green, B = breaker and R = ripe. (Davies and Patil, 1974), pear (Drouet and Hartmann, 1977), grapes (Possner
et a!., 1981) and mango (Dubery et a/., 1984). Activity of malic enzyme was
stimulated by dicarboxylic acids such as succinate and fumarate (Drouet and
Hartmann, 1977; Davies and Patil, 1974). In addition, the presence of Mn2+ or
Mg2+ as a cofactor may affect the enzyme V ^ . Substitution of Mn2+ for Mg2+
increased the maximal activity of malic enzyme in grape fruits (Possner et al.,
1981); while it had a negative effect in tomato fruit malic enzyme (Goodenough etal. 1985).
When malate was omitted from the reaction assays of the supernatant of centrifuged crude extracts, some reduction of NADP+ to NADPH was observed. However, the activity was 70% lower in the outer pericarp tissues and 78% lower in the inner tissues compared to those activities observed in the same reaction assays containing malate (Fig. 1.2 and 1.3). This fact suggests that endogenous malic acid is present in enough amount to promote reduction of NADP+ to NADPH. However, when NADP+ was omitted from the reaction assay, there was no change of absorbance at 340 nm (data not shown), thus exogenous NADP+ is required for malic enzyme activity. Gel permeation of centrifuged supernatant crude extracts removed the endogenous malate from the preparations since no reduction of NADP+ was observed when malate was absent from the reaction assay. When NAD+ was substituted for NADP+ in the enzyme assay after gel permeation, there was an increase of absorbance at 340 nm. The specific activity was 13% of that occurring with NADP+ over the 3 min of assay. The reduction of NAD+ stopped after 2 min; this is consistent with the presence of malate dehydrogenase (MDH, EC 1.1.1.37), since the equilibrium reaction for this enzyme strongly favors malate formation. The reduction of NAD+ may also have been caused by NAD+-malic enzyme (EC 3.1.1.39). As a mitochondrial enzyme, NAD+-malic enzyme could leak from the mitochondrion, since no sucrose was added to maintain their integrity. The reduction of NAD+ (for 2 min) would stop through accumulation of NADH, which is a known inhibitor of
NAD+-malic enzyme (Wedding, 1989).
Malate content in Cherry tomato fruits showed its highest concentration at the mature-green stage (Fig. 1.4). The inner tissues had a higher content at the mature-green and breaker stage than those observed in the outer pericarp tissues. However at the ripe stage the concentration of malate was similar in both tissues (Fig. 1.4). It is quite possible that malic enzyme activity was able to decarboxylate malate even though its specific activity was declining during the fruit ripening (Fig. 1.2 and 1.3). A similar trend of decrease in malate was observed by Thorne and Efiuvwevwere (1988), who were studying acid metabolism during normal ripening of tomato fruits. 27
M B R
O) -g 'o o £
0 2 4 6 8 10 Days after harvest
Figure 1.4. Changes in malic acid concentration during ‘Large Cherry Red’ tomato fruit ripening. Malic acid content in the outer pericarp (^*—) and inner tissues (—s—). M = mature-green, B = breaker and R = ripe. 28 NADP+-Malic enzyme and organic acid metabolism in developing fruits of
’Ohio 7814’
The fresh weight of tomato fruits showed a sigmoidal curve of growth, reaching a stable weight at 42 days after anthesis (Fig. 1.5). The protein content of gel permeation fractions of outer pericarp and inner tissues showed a sharp decrease 15 day after anthesis, followed by a somewhat stable phase from 42 to 63 days after anthesis (Fig. 1.5). The decrease in protein content can be attributed to the dilution caused by the exponential phase of increase in fresh weight of fruit.
The specific activity of NADP+-malic enzyme increased throughout fruit growth in both outer pericarp and inner tissues, reaching maximum activity at mature-green/breaker stages followed by a sharp decrease (Fig. 1.6 and 1.7).
However, the total malic enzyme activity based on a fresh weight basis showed a continuous decline during fruit development (data not shown). The data indicate that malic enzyme activity increased relative to the total protein content of the fruit tissues. Ruffner et al. (1976) found similar results studying malate metabolism during grape fruit growth. Malic enzyme increased in specific activity throughout grape growth under two temperature regimes, with highest activities at the onset of grape ripening. Although malic enzyme activity declined during ripening, the authors suggested that malic acid was decarboxylated via malic enzyme action. h ue eiap n inrtsus - ) f'ho71' tomatoes. 7814' 'Ohio of -) {-& tissues inner and ) - * - ( pericarp outer the Figure 1.5. Fruit growth in fresh weight (-A -) and soluble protein changes in changes protein soluble and -) (-A weight fresh in growth Fruit 1.5. Figure Fruit weight (g FW) 20 30 10 40 50 60 0 10 030 20 Days after anthesis after Days 40 B R B M 50 60 70 CL £ 2 c O) o> 29 30 M B R
0.4 I i i
c
k.o 0.3 Q. b> E 'c E X 0.2 CL D < z o E a. 0.1
10 20 30 40 50 60 70 Days after anthesis
Figure 1.6. Changes during fruit development for the outer pericarp of 'Ohio 7814’ tomato in specific activity of NADP+-malic enzyme. Reaction assays of supernatant centrifuged crude extract plus malate (-£ *-), same extract less malate (-5K-), and gel filtration protein fraction ( - B - ) . M = mature green, B = breaker and R = ripe. 31
M B R
0.8 c q3 Q. e 0.6 i c E x Q. Q 0.4 < Z o E a. 0.2
0 10 20 30 40 50 60 7 0 Days after anthesis
Figure 1.7. Changes during fruit devepopment for inner tissues of 'Ohio 7814' tomato in specific activity of NADP+-malic enzyme. Reaction assays of centrifuged crude extract plus malate (-A-), same extract less malate ( - * - ) , and gel filtration protein fraction ( - B - ) . M = mature-green, B = breaker and R = ripe. 32 Similar trends of increase and decline in malic enzyme activity throughout fruit development were observed in the all of the three assays: supernatant of centrifuged crude extracts with malate, same extracts in absence of malate, and gel permeation protein fraction in presence of malate; lower specific activities were observed in the assays without malate (Fig. 1.6 and 1.7), confirming the preliminary results with ’Large Cherry Red’ fruits (Fig.
1.2 and 1.3). At the mature-green/breaker stages of 'Ohio 7814’ the protein fractions reaction from gel filtration had higher specific activities than those observed in supernatant of centrifuged crude extracts in both outer pericarp and inner tissues (Fig. 1.6 and 1.7), while in the Cherry tomatoes the opposite effect was observed (Fig. 1.2 and 1.3). It seems possible that gel permeation removed an inhibitor from the crude extracts of ’Ohio 7814’ fruit tissues, while in the Cherry tomatoes gel permeation removed an activator. As mentioned previously, dicarboxylic acids act as positive modulators on malic enzyme
(Davies and Patil, 1974). On the other hand, products of the TCA cycle such as oxaloacetate, citrate, isocitrate and a-ketoglutarate inhibited malic enzyme from pear fruits (Drouet and Hartmann, 1977). In addition, Davies and Patil
(1974) found that potato malic enzyme was inhibited by phosphate, sulfate and
AMP.
A similar trend of decline in malic enzyme activity was observed in the
’Ohio 7814' and Cherry tomatoes during fruit ripening (Fig. 1.2, 1.3, 1,6 and
1.7). This fact suggests that fruit ripening on or off the vine shows the same 33 pattern of decline in malic enzyme activity.
Malate and citrate accumulated in outer pericarp and inner fruit tissues analyzed during growth. At the onset of fruit ripening the acid content started to decline (Fig. 1.8 and 1.9). Citrate accumulated to a higher concentration in relation to malate in both outer pericarp and inner tissues. Except at the ripe stage where malate appeared in similar amount in both inner tissues and outer pericarp, the inner tissues showed higher malate and citrate content than those found in the outer pericarp (Fig. 1.8 and 1.9). Davies (1966) found that citrate was the major acid present in tomato fruit tissues, followed by malate; in addition, citrate concentrations were higher in the inner tissues throughout tomato ripening compared to those found in the outer fruit walls (Davies, 1966).
Together, malic and citric acids account for 98% of the nonvolatile organic acids in tomato fruits (Buescher, 1975). The rapid decline in the acid concentrations throughout fruit ripening was not simultaneous, since the decline in malate content was followed by the decline in citrate (Fig. 1.8 and
1.9). Probably, this temporal difference in citrate decrease was caused by the high malic enzyme activity associated with low TCA cycle activity, which allowed a transient accumulation of citrate.
The decline of malic enzyme specific activity observed during fruit ripening suggests that the enzyme is not involved in the metabolism of malate
(Fig. 1.8 and 1.9). However, the total malic enzyme activity at red-ripe fruit was
0.11 /*mol NADPH m in1 g 1 FW for the outer pericarp and 0.16 /*mol NADPH tomato, in specific activity of NADP+-malic enzyme ( - ^ ) , malic acid (3+e-) (3+e-) acid malic , ) ^ - ( enzyme NADP+-malic of activity specific in tomato, n ircai (3) otns M mtr-re, = rae n R ripe. = R and breaker = B mature-green, = M contents. (-3^) acid citric and Figure 1.8. Changes during fruit development for outer pericarp of ’Ohio 7814’ ’Ohio of pericarp outer for development fruit during 1.8.Changes Figure pmol NADPH min'1 mg'1 protein 0.2 0.3 0.4 0 10 20 Days after anthesis after Days 30 40 B R B M 50 60 70
\
20 6 je |owrf pjoe .6 34 35
M B R
50
0.8 I 40
CL
i 30 T CD
< 0.4
0.2
0 10 20 30 40 50 60 70 Days after anthesis
Figure 1.9. Changes during fruit development for inner tissues of ’Ohio 7814’ tomato, in specific activity of NADP+-malic enzyme ), malic acid ) and citric acid (~e-) contents. B = breaker, M = mature-green and R = ripe. 36 m in1 g 1 FW for the inner tissues; the activities are high enough to metabolize
the maximal malate concentration at the mature-green stage of 5.7 /*mol acid g 1 FW and 18.3 ^mol acid g 1 FW present in the outer pericarp and inner
tissues, respectively. Thus malic enzyme could be directly involved in malate
metabolism during fruit ripening as suggested earlier.
Mature-green fruits were separated into outer pericarp, radial pericarp,
placenta/columella, jelly and seeds (Fig. 1.1). Malic enzyme activity was
present at a similar activity in both the outer and radial pericarp (Table 1.1).
However, the activity was 138% higher in the placenta/columella and 334%
higher in jelly tissues than in the outer pericarp (Table 1.1). In addition, the seeds showed some malic enzyme activity; this activity could have resulted from contamination of the seeds by locular tissues adhering to the seeds; malic acid was not detected and only traces of citric acid were detected in the seeds
(Table 1.1).
The jelly portion showed the highest content of acids, while the outer pericarp showed the lowest concentration of acids, not including seeds (Table
1.1). The data for the different fruit tissues suggest that malic enzyme has higher activity where malic acid is present in higher concentration. Statistical analysis of the possible correlation between malate content and malic enzyme activity shows r = 0.99 for n = 4 in the mature-green fruits. Kinetic studies show that malic acid is a positive effector of malic enzyme activity (Drouet and
Hartmann, 1977; Possner et al., 1981). In addition, Possner et al. (1981) Table 1.1. NADP+-malic enzyme activity, malic and citric acid contents in various tissues of mature-green 'Ohio 7814' tomato fruits.
Soluble protein Malic enzyme Malic acid Citric acid Fruit tissue (mg g'1 FW) (umol NADPH min1 (umol g'* FW) (umol g‘1 FW) mg'* protein)
Outer pericarp 1.08 0.26 4.2 17
Radial pericarp 0.99 0.28 6.2 26
Placenta/columella 0.94 0.36 7.8 28
Jelly 0.70 0.87 18.0 50
Seeds 29.0 0.11 0.0 6.2
(CV%) (11.3) (9.8) (10.2) (3.6)
Coefficients of variation (CV) were calculated from the error term in an analysis of variance on log-transformed data which were obtained from two independent series of extracts.
co -si 38 suggest that a minimum concentration of malic acid should be available to the enzyme for maximum activity. Ruffner ef al. (1976) observed that the decrease in grape malic acid content throughout ripening is concomitant with a similar decrease in malic enzyme activity.
Malic enzyme was also present in tomato vegetative tissues; leaves (0.18
^umol NADPH m in1 m g1 protein), stems (0.18/imol NADPH min'1 mg'1 protein) and roots (0.35 /*mol NADPH m in1 m g 1 protein). The root malic enzyme activity approached the specific activities found in the outer pericarp of tomato fruits (0.39 /imol NADPH min'1 mg'1 protein at mature-green stage), however, they were low compared to the higher activities found in the inner tissues (0.9
|/mol NADPH min'1 mg'1 protein at breaker stage). Malic acid was found in the leaves (5.7 /*mol acid g'1 FW), stems (11.5 ,umol acid g 1 FW) and roots (7.4
^wmol acid g'1 FW). These concentrations are similar to those found in the outer pericarp (5.8 ^mol acid g'1 FW at mature-green stage), but lower than in the inner tissues (18.5 /imol acid g"1 FW at mature-green stage). Malic enzyme activity is not specific to tomato fruits, but different molecular forms of the enzyme may be tissue specific.
Several authors have suggested that malic enzyme is involved in the metabolism of malate accumulated during fruit growth. The high activities of malic enzyme observed at the first stages of ripening not only in tomato fruits
(Goodenough et al., 1985)), but also in grapes (Ruffner ef al., 1976) and mango (Krishnamurthy, etal., 1971) are correlative evidence that malic enzyme plays a major role in acid metabolism throughout fruit ripening. Goodenough ef al. (1985) suggested that malic enzyme activity associated with the first stages of tomato ripening could maintain the flow of reducing power (NADPH) to the electron transport chain, since they suggest that the TCA cycle is inoperative. However, it seems logical that malic enzyme provides pyruvate, which could sustain the TCA cycle. Based on this supposition, malic enzyme could decouple the TCA operation from glycolysis and account for the climacteric rise in respiration.
The presence of malic enzyme in vegetative tissues suggests other physiological roles played by the enzyme. Davies (1986) suggested that malic enzyme is involved in cytoplasmic pH regulation of plant cells. Roberts et al.
(1992) studying the effects of hypoxia in maize root tips using nuclear magnetic resonance spectroscopy, provide data that cytoplasmic malate is partially decarboxylated to pyruvate and partially converted to succinate; thus it appears that activation of malic enzyme in the early stages of hypoxia could prevent acidification of the cytoplasm. This could be related to the two-fold higher specific activity of malic enzyme in roots compared to leaves and stems, since roots are more commonly exposed to low oxygen supply than leaves and stems. However, El-Shora and ap Rees (1991) found strong evidence that in
C3 plants malic enzyme is located in the chloroplast and that the occurrence of enzyme activity in the soluble fraction of plant tissues results from plastid breakdown. The conflicting results of malic enzyme cellular location could be 40 further investigated using antibodies against the enzyme, this may help to elucidate the role played by malic enzyme in cell metabolism.
CONCLUSIONS
Tomato (Lycopersicon esculentum Mill.) NADP+-malic enzyme (E.C.
1.1.1.40) activity has been investigated in inner and outer fruit tissues during ripening of harvested ’Large Cherry Red’ fruits, and throughout fruit development of ’Ohio 7814’. Malic enzyme activity was also estimated in mature leaves, stems and roots of 'Ohio 7814’. Concentration of malic and citric acids was analyzed in the fruit tissues as well.
Total malic enzyme activity decreased throughout tomato fruit development. However, the specific activity increased, reaching the highest level at the mature-green/breaker stages, followed by a sharp decrease during fruit ripening. A similar trend of decline in malic enzyme activity was found during ripening of detached Cherry tomato fruits.
Malate and citrate accumulated during fruit growth; malate content declined at the onset of ripening, whereas citrate concentration decreased later in ripening. At the mature-green stage, tomato fruit jelly showed the highest content of malate, citrate and malic enzyme activity when compared with the other fruit tissues. 41 Malic enzyme was also present in vegetative tomato tissues. The specific
activities present in leaves, stems and roots are comparable to those present
in the outer pericarp of fruit, but lower than malic enzyme in inner tissues.
Although malic enzyme specific activity declines during ripening, the total activity was high enough to account for malate consumption in the fruit tissues. Malic enzyme seems to be involved in malate metabolism in tomato fruits; thus malic enzyme activity could decouple the fruit respiratory metabolism from glycolysis during ripening. However, the presence of malic enzyme in vegetative tissues suggests other physiological roles, such as cytosolic pH regulation.
The intracellular location of malic enzyme remains to be better studied.
If the enzyme is located in the cytoplasm, its roles in fruit respiration and pH cell regulation seem feasible; however, if malic enzyme is confined to the chloroplast, a role in biosynthesis seems more likely. 42
LIST OF REFERENCES
Bergmeyer M. V. (1983). Methods of enzymatic analysis. 3rd ed. Vol. VII. VCH Publishers. Weinheim. p 39-47.
Berry S. Z. and Gould W. A. (1983). ‘Ohio 7814’ tomato. HortScience 18: 494-496.
Bradford M. M. (1976). A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72: 248-254.
Buescher R. W. (1975). Organic acid and sugar levels in tomato pericarp as influenced by storage at low temperature. HortScience 10: 158-159.
Brecht J. K. (1987). Locular gel formation in developing tomato fruit and the initiation of ethylene production. HortScience 22: 476-479.
Dalai K. B., Salunkhe D. K., Boe A. A. and Olson L. E. (1965). Certain physiological and biochemical changes in the developing tomato fruit (Lycopersicon escuientum Mill.). J. Fd. Sci. 30: 504-508.
Davies J. N. (1966). Changes in the non-volatile organic acids of tomato fruit during ripening. J. Sci. Fd. Agric. 17: 396-400.
Davies D. D. (1986). The fine control of cytosolic pH. Physiol. Plant. 67: 702- 706.
Davies D. D. and Patil K. D. (1974). Regulation of ’malic’ enzyme of Solanum tuberosum by metabolites. Biochem. J. 137: 45-53.
Dubery I. A., Schabort C. and Cloete F. (1984). Some properties of the NADP- malic enzyme from mango fruit, Mang'riera indica. Int. J. Biochem. 16: 417- 422.
Drouet A. G. and Hartmann C. J. R. (1977). Activity of pear fruit malic enzyme; its regulation by metabolites. Phytochemistry 16: 505-508. 43 El-Shora H. M. and ap Rees T. (1991). Intracellular location of NADP+-linked malic enzyme in C3 plants. Planta 185: 362-367.
Goodenough P. W., Prosser I. M. and Young K. (1985). NADP-linked malic enzyme and malate metabolism in ageing tomato fruit. Phytochemistry 24: 1157-1162.
Jeffery D., Smith C.t Goodenough P., Prosser I. and Grierson D. (1984). Ethylene-independent and ethylene-dependent biochemical changes in ripening tomatoes. Plant Physiol. 74: 32-38.
Krishnamurthy S., Patwardhan M. V. and Subramanyam H. (1971). Biochemical changes during ripening of the mango fruit. Phytochemistry 10: 2277-2281.
Lasko A. N. and Kliewer M. W. (1975). The influence of temperature on malic acid metabolism in grape berries. Plant Physiol. 56: 370-372.
Moellering H. and Gruber W. (1966). Determination of citrate with citrate lyase. Anal. Biochem. 17: 369-376.
Possner D., Ruffner H. P. and Rast D. M. (1981). Isolation and biochemical characterization of grape malic enzyme. Planta 151: 549-554.
Roberts J. K. M., Hooks M. A., Miaullis A. P., Edwards J. and Webster C. (1992). Contribution of malate and amino acid metabolism to cytoplasmic pH regulation in hypoxic maize root tips studied using nuclear resonance spectroscopy. Plant Physiol. 98: 480-487.
Ruffner H. P. and Hawker J. S. (1977). Control of glycolysis in ripening berries of Vitis vinifera. Phytochemistry 16: 1171-1175.
Ruffner H. P., Hawker J. S. and Hale C. R. (1976). Temperature and enzymic control of malate metabolism in berries of Vitis vinifera. Phytochemistry 15: 1877-1880.
Thorne S. N. and Efiuvwevwere J. O. (1988). Changes in organic acids in chilled tomato fruit ( Lycopersicon esculentum Mill). J. Sci. Fd.Agric. 44: 309- 319.
Wedding R. T. (1989). Malic enzymes of higher plants. Plant Physiol. 90: 367- 371. CHAPTER II
PURIFICATION AND INTRACELLULAR LOCATION OF TOMATO FRUIT
NADP+-MALIC ENZYME
INTRODUCTION
NADP+-Malic enzyme (EC 1.1.1.40) is widely found in plant tissues, such as plants with the C4 pathway of photosynthesis, plants with crassulacean acid metabolism (CAM) and C3 plants in general. In the NADP+-malic enzyme subgroup of C4 plants, malic enzyme is involved in the C4 pathway of photosynthesis, providing COs as substrate for fixation by Rubisco (Edwards and Huber, 1981). However, in C3 plants, malic enzyme seems to play other physiological roles. In both climacteric and nonclimacteric fruits, including tomatoes (Jeffery efa/., 1984), mango (Krishnamurthy etal. 1971), pear (Drouet and Hartmann, 1977) and grapes (Ruffner ef a/., 1976), the enzyme participates in the metabolism of malic acid which the fruits accumulate. The decarboxylation of malic acid seems to be an alternative to glycolysis as a source of pyruvate for the TCA cycle, and reducing power (NADPH) to the
44 electron transport chain (Goodenough ef al., 1985). Furthermore, malicenzyme
may contribute to cytoplasmic pH regulation by carboxylating or
decarboxylating malate (Davies, 1986); the enzyme seems to play a major role
in compensating for the decrease in cytoplasmic pH which is an initial
response to hypoxia in maize root tips (Roberts ef al., 1992). However, El-
Shora and ap Rees (1991) found a close correlation between NADP+-malic
enzyme activity and the activity of the chloroplast marker enzymes via
differential centrifugation and density-gradient fractionation of extracts from
germinating Cucurbita pepo cotyledons. They suggest that in C3 plants, malic
enzyme is confined to the plastids and provides pyruvate for synthesis of
pyruvate-based amino acids and acetyl-CoA for synthesis of fatty acids. On the
other hand, the nucleotide sequence of cDNAs encoding NADP*-malic enzyme
of Populus and Phaseolus vulgaris (C3 plants) did not contain an obvious transit
sequence for transport to the chloroplast (van Doorsselaere ef al., 1991).
Edward and Andreo (1992) suggest the presence of more than one isoform of
malic enzyme in addition to the chloroplastidic form. They suggest that the
chloroplastidic enzyme evolved from a pre-existing cytoplasmic isoform.
Malic enzyme has been purified to homogeneity from several plant tissues, such as sugar cane leaves (Iglesias and Andreo, 1989), grapes
(Possner etal., 1981), mango (Dubery and Schabort, 1981) and tomato fruits
(Goodenough ef al,, 1985). The purified enzyme is a tetramer with molecular weight of 250- to 265-kDa depending on the plant source used. Iglesias and 46
Andreo (1989) isolated malic enzyme with a native molecular weight of 250-kDa from the leaves of sugar cane. Purified mango fruit malic enzyme appears to be a 258-kDa tetramer (Dubery and Schabort, 1981), and tomato fruit malic enzyme has a native molecular weight of 260- to 265-kDa with four subunits each of 64- to 65-kDa (Goodenough ef al., 1985).
The role of malic enzyme in the acid metabolism of fruits as well as other possible physiological roles can be further investigated at the molecular level. The manipulation of gene expression provides a direct approach to understand the role and tissue specificity of proteins. Manipulation of genes expressed during fruit ripening provided new information about the role of enzymes like polygalacturonase in cell wall degradation (Smith et al., 1988;
Giovannini ef al., 1989), ACC oxidase and ACC synthase in ethylene synthesis
(Hamilton ef al., 1990; Oeller ef al., 1991), and phytoene synthase in fruit carotenoid accumulation (Bird et al., 1991; Bartley ef al., 1992).
The genetic manipulation of malic enzyme expression requires isolation of its cDNA from a library. This cDNA could be isolated by using a heterologous DNA probe for malic enzyme or by screening an expression cDNA tomato library with antibodies. Antibodies have been successfully used to isolate cDNA clones for tomato fruit polygalacturonase and zucchini fruit
ACC synthase from expression libraries (DellaPenna ef al., 1986; Sato and
Theologis, 1989). Langdale et al. (1988), using polyclonal antibodies as a probe, were able to isolate a cDNA malic enzyme clone from a lambda 47 expression library of maize leaves.
The objectives of this work were to purify the NADP+-malic enzyme from tomato fruits and raise polyclonal antibodies for further use as a probe to determine the intracellular location of the enzyme. It was also anticipated that the antibodies could be used in the isolation of a malic enzyme cDNA clone from a tomato fruit expression library.
MATERIALS AND METHODS
Material
Tomato plants (Lycopersicon esculentum ’Ohio 7814') (Berry and Gould,
1983) were grown at The Ohio State University Horticulture Farm, Columbus.
Tomato seedlings were produced in the greenhouse and transplanted to the field when 35-40 days old. Plants were examined every two days and flower trusses were tagged at anthesis. Mature-green fruits (40 to 45 days old) were harvested and the pericarp was used for NADP+-malic enzyme purification.
Extraction of malic enzyme
A 250 g FW sample of fruit pericarp was homogenized at 0°C in 2x volumes of 0.1 M MOPS, 0.1 M Bicine (pH 8.2), 3 mM EDTA, 5 mM (i- mercaptoethanol with 1% (w/v) polyvinylpyrrolidone (PVP-40T), using a Waring blender for 15 sec. The homogenate was filtrated through four layers of muslin 48
and the filtrate was centrifuged at 20,000 x g at 0°C for 20 min.
Enzyme purification
The supernatant from the first centrifugation was stirred at 2°C for 15 min
with solid (NH4)2S04 added to a final concentration of 30% saturation. The
mixture was centrifuged for 30 min at 0°C and 20,000 x g. The resulting pellet was discarded; the supernatant was brought to 55% saturation with solid
(NH4)2S04 and stirred at 2°C for 15 min. Then the saturated solution was
centrifuged at 20,000 x g for 30 min at 0°C (Goodenough ef al., 1985). The collected precipitate was resuspended in 20 ml of 25 mM Tris-HCI (pH 7.2) and
1 mM /9-mercaptoethanoi at 0°C. In order to eliminate residual traces of
(NH4)2S0 4, the solution was dialyzed against 2.5 mM Tris-HCI (pH 7.2) and 0.1 mM ^-mercaptoethanol for 4 hours at 2°C with one change in the dialysis buffer after 2 hours.
DEAE-Cellulose was titrated with 1.0 N HCI to pH 7.2, and packed into a column (18 x 1.5 cm) which was pre-equilibrated with 10x the total column volume of 25 mM Tris-HCI (pH 7.2) and 1 mM /f-mercaptoethanol at 2°C; the flow rate was 2.5 ml min'1. After applying the dialyzed protein solution, the column was washed with the equilibration buffer (25 mM Tris-HCI pH 7.2, and
1 mM /3-mercaptoethanol) until all unbound protein was eluted. Elution of the bound protein was achieved with 160 ml linear gradient of 0-200 mM NaCI in
25 mM Tris-HCI (pH 7.2) and 1 mM/?-mercaptoethanol. The salt concentration 49 of each fraction was determined by comparing the conductivity, in micromhos,
of the equilibration buffer and the 200 mM NaCI solution with the conductivity
of each fraction measured by a Selectro Mark Analyzer 4505 (MARKSON
Science INC., Del Mar, CA 92014). Elution of bound proteins was monitored
by absorbance at 280 nm and the total protein content of each 4.0 ml fraction collected was estimated by the Bradford (1976) method.
The protein fractions containing malic enzyme with at least half of maximum specific activity were pooled, and then concentrated to 3.0 ml final volume in a Stirred Cell concentrator using an Omega™ (MW cut off 10-kDa) membrane from Pharmacia and following the specifications from the company.
The concentrated protein solution was applied to the top of a 45 x 2.5 cm gel permeation column of Sephacryl S-300 previously equilibrated with 10x the total column volume of 25 mM Tris-HCI (pH 7.2) and 1 mM /?- mercaptoethanol at 2°C. The column was calibrated with different molecular weight markers; the column void volume (VD) was estimated by running a solution of Blue dextran, and the total column volume (Vt) was estimated with a solution of sodium chloride. The elution of Blue dextran was followed at absorbance 450 nm in a Shimadzu UV 160U spectrophotometer, and the elution of sodium chloride solution was followed by the changes in conductivity using a Selectro Mark Analyzer 4505 (MARKSON Science INC., Del Mar, CA
92014) in each of the 3.0 ml fractions collected. Cytochrome C (MW 12,384
Da), carbonic anhydrase (MW 29,000 Da), bovine serum albumin (MW dimmer 50 132,000 Da), /J-amylase (MW 200,000 Da) and apoferritin (MW 443,000 Da) were used for column calibration. Elution volume (V.) of each of the above proteins was estimated by following the total protein content in 3.0 ml fractions by the Bradford (1976) method. The elution position of each protein used as a marker in the column calibration was determined by the K„v (1) index:
v.-v0 K .v = ------(1) Vv t - V v o
The eluted protein fractions containing malic enzyme with at least half of maximum specific activity were pooled and concentrated to 2.0 ml volume in a Stirred Cell concentrator equipped with an Omega™ membrane from
Pharmacia according to the company specifications. Then the protein solution was applied to the top of a 2 x 0.5 cm Cibacron Blue 3GA Agarose (from
Sigma Co.) column previously equilibrated with 10x the total column volume of equilibration buffer (25 mM Tris-HCI, pH 7.2, 1 mM /?-mercaptoethanol and
1 mM MnSOJ at 2°C and flow rate of 0.15 ml min V The protein solution was applied on the top of the column and washed with the equilibration buffer until all unbound protein was eluted from the column. The elution of the bound protein was achieved with 5.0 ml of equilibrium buffer containing 10 mM
NADP+ sodium salt, followed by 10 ml of equilibration buffer. The remaining bound proteins were eluted by applying 10 ml of 200 mM NaCI in equilibration buffer. The protein elution was followed at absorbance 280 nm and the total 51 protein concentration of each 1.0 ml fraction was determined by the Bradford
(1976) method.
The fractions containing NADP+-malic enzyme activity were pooled,
diluted to 10x volume with 5 mM Tris-HCI (pH 7.2) and 200 //M /}-
mercaptoethanol, and then concentrated to 500 til in the stirred cell concentrator.
Enzyme assays
NADP+-Malic enzyme activity was measured in all steps of purification in a 3.0 ml reaction mixture as described in the materials and methods of
Chapter I.
NAD+-Malic enzyme (EC 1.1.1.39) was assayed as described by Dittrich
(1979) in a mixture containing 0.1 M Bicine, 0.1 M MOPS (pH 7.0), 5 mM malate, 5 mM MnS04, 2 mM NAD+ sodium salt and 5 ,uM CoA. The enzyme assay was done in a total volume of 3.0 ml, recorded at 340 nm for 3 min at
25±1°C in a Shimadzu UV 160U spectrophotometer. The reaction rate was calculated from the increase in absorbance over 3 min, using the extinction coefficient for NADH equal to 6.22 cm2 pmole'1.
Chloroplast isolation
Samples containing 10 g FW of young tomato leaves or corn leaves (20-
30 days old) were diced and homogenized in 10 ml g 1 FW of grinding buffer 52 (0.33 M D-Sorbitol, 50 mM Tricine-KOH pH 7.9, 2 mM EDTA, 1 mM MgCI2 and
1 % PVP); or a 50 g FW sample of immature-green tomato fruit pericarp was homogenized in 5 ml g 1 FW of grinding buffer at 4°C for 4 sec in a Polytron
(Brinkmann Instruments, Westbury, NY 11590), and then filtered through 8 layers of muslin. The filtered solution was centrifuged for 3 min in a swing-out rotor at 1,500 x g and 4°C. Next the pellet was gently resuspended in 3.0 ml of resuspension buffer (0.33 M D-Sorbitol, 50 mM Tricine-KOH pH 7.9, 2 mM
EDTA and 1 mM MgCI2).
The tomato leaves or fruit chloroplast solutions were applied to the top of a 10 ml centrifuge tube with 5.0 ml of 30% (v/v) and 3.0 ml of 80% (v/v)
Percoll step gradient in resuspension buffer (Price ef al., 1987), and centrifuged for 30 min at 26,000 x g in a swing-out rotor at 4°C. The chloroplast band at the 30%/80% interface was removed with a wide bore pipet tip and diluted with
5 x volumes of resuspension buffer. The chloroplasts were spun down at 1,500 x g for 3 min at 4°C, followed by gentle resuspension in minimum volume of resuspension buffer.
The corn chloroplast preparation was applied to the top of 5.0 ml of 20%
(v/v) Percoll layer, and spun down at 700 x g for 5 min in a swing-out rotor at
4°C. The pellet containing most of the intact chloroplasts (Jenkins and Boag,
1985) was washed with 5.0 ml of resuspension buffer and centrifuged at 1,500 x g for 2 min at 4°C. Finally, the chloroplasts were resuspended in a minimum volume of resuspension buffer. 53 The supernatants from the first centrifugation of all chloroplast preparations were spun down at 20,000 x g at 4°C for 20 min. Next the supernatants were desalted in a Sephadex G-25 column (18 x 1.5 cm) at flow of 2.0 ml min'1 in 10 mM MOPS, 10 mM (pH 7.0), 0.5 mM MnS04 with 1 mM
/J-mercaptoethanol at 2°C. The protein was collected following absorbance at
280 nm and estimated by the Bradford (1976) method. The protein fraction was used to estimate the NADP+-malic enzyme, alcohol dehydrogenase and rubisco enzyme activities.
All chloroplast preparations were done in three independent replicates.
Chloroplast intactness
NADP+-glyceraldehyde-3-phosphate dehydrogenase (GAPDH; EC
1.1.1.8) activity was used to estimate the intactness of the chloroplast preparations as described by Bathgate ef al. (1985). A 100 (t\ sample of chloroplast was incubated with 0.33 M D-sorbitol, 32.5 mM Tris-HCI pH 7.2, 3.3 mM ATP, 10 mM MgCI2, 4 mM EDTA, 0.13 mM NADPH, 3pg phosphoglycerate kinase and 1 mM dithiothreitol; the reaction was initiated by addition of 1 mM
3-phosphoglycerate, in a 1.0 ml final reaction mixture. GAPDH activity was followed by decrease in absorbance at 340 nm over 3 min in a Shimadzu UV
160U spectrophotometer at 25±1°C. The extinction coefficient for NADPH equal to 6.22 cm2 /^mole1 was used to estimate the enzyme activity.
Chloroplasts were lysed with 0.1% Triton X-100, and then re-assayed for 54
GADPH activity. The increase in GAPDH activity in the presence of Triton X-100 was used as an indicator of chloroplast intactness.
Malic enzyme activity in the chloroplasts was assayed in a 1.0 ml reaction mixture as described in the materials and methods of Chapter I. The reaction was started by addition of 100 /il of chloroplast preparation previously lysed with 0.1% Triton X-100.
Cytoplasmic marker
Alcohol dehydrogenase (EC 1.1.1.1) activity was used as cytoplasmic marker in the Sephadex G-25 protein extract and in the chloroplast preparations. Alcohol dehydrogenase activity was assayed as described by
Smith and ap Rees (1979) in a mixture containing 0.33 M D-sorbitol, 50 mM glycylglycine (pH 8.6), 2 mM NAD+ and 100 mM ethanol. The reaction was started by addition of 300 ju\ of Sephadex G-25 protein extract or 50 of chloroplast preparation previously lysed with 0.1% Triton X-100 in a total volume of 1.0 ml. The activity was followed for 3 min at 25±1°C by the reduction of NAD+ at 340 nm in a Shimadzu UV 160U spectrophotometer. The total activity was measured using the extinction coefficient for NADH equal to
6.22 cm2 /*mole‘1. 55 Chloroplast marker
Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco; EC
4.1.1.39) was used as marker for chloroplast preparations. The assay was done as described by Lilley and Walker (1974): samples of 0.1% Triton X-100 lysed chloroplasts were stored at -20°C and then thawed; 50^1 samples were mixed with 0.33 M sorbitol, 50 mM Hepes (pH 7.8), 10 mM KCI, 1 mM EDTA, 15 mM
MgCI2, 5 mM dithiothreitol, 5 mM ATP, 0.03 mM NADH, 10 mM NaHC03, 5 mM phosphocreatine, 2.5 units glyceraldehyde-3-phosphate dehydrogenase, 3.8 units 3-phosphoglycerate kinase, 1.0 unit phosphocreatine kinase and 1.0 unit ribulose-5-phosphate isomerase. The mixture was preincubated for 5 min at
25±1°C, and the reaction was started by addition of 0.5 mM D-ribose-5- phosphate in a 1.0 ml final volume. Rubisco activity was recorded for 10 min by oxidation of NADH as measured by absorbance at 340 nm in a spectrophotometer. The total activity was estimated using the extinction coefficient for NAD+ equal to 6.22 cm2jumole'1.
Once it was determined that the preparations contained intact chloroplasts, samples for SDS-PAGE were stored at -20°C, then thawed and dialyzed against 10 mM Tris-HCI (pH 6.8) at 4°C for 24 hours. The dialyzed chloroplast proteins were applied to an 8% gel for SDS-PAGE and then transferred to nitrocellulose for Western blot analysis. 56 Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE)
A protein sample containing 2.5 jig of pure malic enzyme was lyophilized and resuspended in 50 ^1 of SDS-PAGE sample buffer (62.5 mM Tris-HCI pH 6.8, 2% SDS, 10% glycerol, 5% /Tmercaptoethanol and 0.0005% bromophenol blue); then the sample was incubated at 70°C in water bath for
10 min and applied to a 6% stacking gel with 8% or 12% polyacrylamide separating slab gel carried out according to Laemmli (1970). The gel buffers were: 250 mM Tris-HCI (pH 6.8) and 0.1% SDS in the stacking gel; 375 mM
Tris-HCI (pH 8.8) and 0.1% SDS in the separating gel; the running buffer was
25 mM Tris-HCI (pH 8.3), 190 mM glycine and 0.1% SDS.
Samples of 5 g FW of mature-green tomato fruit pericarp, or 1 g FW of tomato leaves, stems, roots, corn leaves or roots were mixed with 5 x volumes of pure acetone at -20°C and ground in a Polytron (Brinkmann Instruments,
Westbury, NY 11590) for 15 sec. The resulting suspensions were passed through a Miracloth filter and the particulate matter was washed with 50 ml of
80% acetone at -20°C. The cell material retained by the Miracloth filter was resuspended in 1.0 ml of SDS-PAGE sample buffer or 62.5 mM Tris-HCI (pH
6.8), and then incubated at 70°C in a water bath for 10 min. Solutions were centrifuged at 14,000 rpm for 5 min in a microfuge and the supernatants were saved. The total protein content of the supernatant in the 62.5 mM Tris-HCI (pH
6.8) buffer was estimated by the Bradford (1976) method. An aliquot containing
50 (*.g of total protein in SDS-PAGE buffer was applied to the gel. A protein solution in SDS-PAGE sample buffer containing 2.5 of egg albumin (MW 45,000 Da) and phosphorylase b (MW 97,400 Da) or bovine serum albumin
(MW 66,000 Da marker grade from Sigma Co.) were used as molecular weight markers. Electrophoresis was conducted at 10 mA until samples had migrated through the stacking gel and then 20 mA until the dye had moved through the separating gel. Proteins were fixed by soaking the gel in 200 ml of 10% sulfosalicylic acid for 1 hour with agitation and stained in 500 ml of 0.05%
Coomassie brilliant blue R-250 in 25% methanol and 10% acetic acid for 4 hours with agitation. The gel was destained washing 3 times with 1 I of 30% methanol and 10% acetic acid for 10 hours under agitation.
Antibody production
Antibodies to malic enzyme were produced in the University Immunology
Laboratory in a male New Zealand White rabbit by subcutaneous injection. The rabbit was immunized twice at 3-week intervals with 50 /ug of purified protein in Freund's complete adjuvant, followed 3 weeks later by 100 jug of purified protein in 50% Freund’s incomplete adjuvant. The final bleed out was done by cardiac puncture and the collected blood was allowed to clot for 24 hours at
4°C. Serum was drained from the clot and centrifuged at 3,000 rpm for 10 min. 58 Affinity purification of NADP*-malic enzyme antibodies
The polyclonal antibodies were purified as described by Johnson ef al.
(1985) with modifications. A 10 jig sample of pure malic enzyme preparation was lyophilized, resuspended in 1.0 ml of SDS-sample buffer and incubated at
70°C for 10 min in a water bath. The resulting protein solution was incubated with a 2.0 cm diameter circle of nitrocellulose filter at room temperature for 2 hours with agitation, and then the filter was rinsed with TBST (10 mM Tris-HCI pH 8.0, 150 mM NaCI and 0.05% Tween 20). The nonspecific sites on the filter were blocked with 1% BSA in TBST for 1 hour with agitation and then the filter was rinsed with TBST. The filter was next treated with 2.5 ml of rabbit antiserum diluted 1:50 in TBST for 2 hours with agitation; then washed with
TBST buffer for 1 hour with at least one change of the TBST buffer. Next, the antibodies were eluted from the filter with 3.5 ml of 0.2 M glycine-HCI (pH 2.5) for 2 min with agitation; the filter was removed and the glycine solution was neutralized by adding 1.75 ml of 1.0 M of potassium phosphate buffer (pH 9.0) and 1 % BSA. The purified antibody solution was stored at -20°C until further use.
Immunoinhibition of NADP+-malic emzyme
Malic enzyme was extracted from 15 g FW samples of tomato fruit pericarp at mature-green stage, homogenized and desalted in a Sephadex G-
25 column as described in the materials and methods of Chapter I. Two 59 independent replicates were used for the malic enzyme immunoinhibition
assay. Samples of 300 pi\ from Sephadex G-25 protein fraction were mixed with 0, 0.5, 1.0, 1.5, 2.0, 2.5 and 3.0//I of preimmune serum, immune antiserum or affinity purified antibodies for 12 hours at 2°C, and then centrifuged at 14,000
rpm in a microfuge at 2°C for 20 min. Then a 250 fi\ aliquot of the supernatant
was used for the malic enzyme assay as described in materials and methods
of Chapter I.
Western blotting
Potential antigens were transferred from a 8% SDS-polyacrylamide gel
to a nitrocellulose membrane by electrophoresis as follows. The stacking gel
was removed and the separating gel was soaked in 100 ml of transfer buffer
(20 mM Tris, 150 mM Glycine and 20% methanol) for 15 min. Proteins were
transferred to a nitrocellulose filter in a TE 70 SemiPhor™ Semi-Dry Transfer
Unit (Hoefer Scientific Instruments, San Francisco, CA 94107) at 100 mA for 45
min as recommended by the company. Then the nitrocellulose membrane was floated on TBST until evenly wet and rinsed in the same buffer. The nonspecific
protein binding sites were blocked by incubating the membrane in 1% BSA in
TBST at room temperature for at least 4 hours with agitation. Next, the membrane was rinsed with TBST and incubated with 10 ml of 1:500 dilution of immune antiserum or purified malic enzyme antibody at room temperature for
1 hour with agitation. The filter was washed three times with TBST for 5 min each to remove the unbound primary antibody and then the filter was
incubated with goat-anti-rabbit IgG-alkaline phosphatase conjugate in TBST
{1:7500 dilution as recommended by Promega) at room temperature with
agitation. After 1 hour the filter was washed three times with TBST for 5 min
each to remove the secondary unbound antibody and the filter was dried on
Whatman #1 filter paper. The nitrocellulose membrane was transferred to 10
ml of fresh alkaline phosphatase buffer (100 mM Tris-HCI pH 9.5,100 mM NaCI
and 5 mM MgCI2) containing 66 ill of nitro blue tetrazolium (NBT) and 33 til of
5-bromo-4-chloro-3-indolyl phosphate (BCIP) as recommended by Promega
(Madison, Wl 53711). This color development solution was protected from
strong light and the reactive purple areas appeared after 15 min of incubation.
The color reaction was stopped by rinsing the membrane with double distilled
water for 10 min changing the water at least once, followed by air drying on
filter paper.
Protein estimation
Protein contents in all steps of NADP+-malic enzyme purification and chloroplast isolation were estimated by the Bradford (1976) method as described in the materials and methods of Chapter I. 61 RESULTS AND DISCUSSION
Table 2.1 summarizes the results of the several steps of NADP+-malic
enzyme purification from the pericarp of mature-green tomato fruits.
Fractionation with 30% - 55% saturated (NHJzSO« precipitated 41.9% of total
malic enzyme and increased the specific activity two-fold (Table 2.1). At the
same interval of ammonium sulfate fractionation, Goodenough ef al. (1985)
report a 81.3% recovery and purification factor of 2.3 for tomato fruit malic
enzyme under similar conditions. However, the authors did not specify from
which fruit tissue and developmental stage the enzyme was extracted. The
lower yield of malic enzyme recovered in the pellet of 30% - 55% ammonium
sulfate fractionation compared to that found by Goodenough etal. (1985) may
be attributed to losses during resuspension, since the pellet was spread all
over the walls of the centrifuge tube.
Figure 2.1 shows the elution of total protein and purification of malic
enzyme from a DEAE-Cellulose chromatographic column. The peak of malic
enzyme activity was eluted starting at approximately 80 mM NaCI in the linear
concentration gradient from 0 to 200 mM NaCI (Fig. 2.1). Ion exchange
chromatography increased the specific activity 3.2-fold and recovered 52.0%
of total malic enzyme activity applied to the column (Table 2.1). The protein fractions containing malic enzyme with less than half of maximum specific activity were discarded, representing a reduction of 15% in the total activity Table 2.1. Purification of NADP+-malic enzyme from mature-green tomato fruit pericarp.
Step Protein Total Activity Yield Specific Activity Purification (mg) if*mol NADPH min'1) (%) (umol NADPH min1 mg'1 protein)
Crude Extract 194.60 102.96 100 0.53 1.0
30% - 55% 40.04 43.09 41.9 1.08 2.0 (NH,)2S04
DEAE-Cellulose 6.54 22.26 21.6 3.40 6.4
Sephacryl S-300 4.54 18.94 16.4 4.17 7.9
Cibacron Blue 0.13 5.53 5.4 42.54 80.3 63
7 2 5 0
6 200
5
4
3 mM NaCI
CL 2
50 1
0 0 0 10 20 30 40 50 60 Fraction number
Figure 2.1. Purification of NADP^maJic enzyme from tomato fruit on DEAE- Celtulose column. Malic enzyme activity (-*- ), protein concentration ( — ) and NaCI gradient ( — ). 64 from the peak (Fig. 2.1). Iglesias and Andreo (1989) report that malic enzyme
from sugar cane leaves was eluted at similar ionic strength in the DEAE-
cellulose chromatography purification step.
Molecular exclusion chromatography on the Sephacryl S-300 column
recovered 85.1% of total malic enzyme activity applied to the column and
increased the specific activity 1.2-fold (Table 2.1). The elution profile of malic
enzyme from the Sephacryl S-300 column is shown in Figure 2.2. The enzyme
peak activity was not symmetrical; it shows a shoulder around 116.0 ml of
elution volume, beyond the maximum malic enzyme activity at 109.8 ml of
elution volume (Fig. 2.2). The shoulder could be the result of partial
dissociation of malic enzyme into its subunits through the purification
procedure.
Figure 2.3 shows the correlation between log MW and the of protein
markers used to calibrate the gel permeation column. Based on the K*, of
malic enzyme compared to those of the protein markers, gel permeation
chromatography indicated a native molecular weight of about 260-KDa (Fig.
2.3). However, the malic enzyme activity at the 116.0 ml shoulder, indicated a
molecular weight of 180-kDa. The molecular weights were estimated from the
average of three independent runs with 4% coefficient of variation.
Goodenough etai. (1985) report a 260- to 265-kDa native molecular weight for tomato fruit malic enzyme using gel permeation (S-300 Sephracyl) and non- denaturating PAGE. Mango fruit malic enzyme shows equivalent native 65
2.5
’c o t5 as *♦—k— '1 c 'E X CL 1.5 0.4 a < z mg mg protein fraction
0.2
0.5
5 0 70 90 110 130 150 Volume (ml)
Figure 2.2. Purification of NADP+-malic enzyme from tomato fruit on gel filtration (Sephacryl S-300) column. Malic enzyme activity (-* -) and protein concentration (—•—). 66
0.7
0.6 □
0.5 □
0.4 ME 0.3
0.2
0.1
4.5 5 5.5 Log MW
Figure 2.3. Estimation of the molecular weight of native NADP+-malic enzyme (ME) from tomato fruit by Sephacryl S-300 chromatography. The column was calibrated with the following proteins markers: cytochrome c (12,384 Da), carbonic anhydrase (29,000 Da), bovine serum albumin (132,000 Da), /3- amylase (200,000 Da) and apoferritin (433,000 Da). molecular weight in Sephadex G-200 gel permeation chromatography (Dubery
and Schabort, 1981). Pupillo and Bossi (1979) found that the cytoplasmic corn
malic enzyme appeared to partially dissociate during purification. They
obtained two malic enzyme fractions from a Sepharose 6B column, the first
contained an enzyme with MW of 280-kDa and the second 150-kDa. It seems
possible that the shoulder observed in the peak of malic enzyme elution from
the Sephacryl S-300 column represents a partially dissociated form of the
enzyme (Fig. 2.2). The fractions containing at least half of the maximum
specific activity of malic enzyme from the Sephacryl S-300 column were pooled
(Fig. 2.2). Thus the peak tails fractions, representing 15% of the total malic
enzyme activity were discarded, as in the previous purification step.
Passage through the Sephacryl S-300 column also removed salt from
the protein preparation after DEAE-cellulose chromatography; this was
important for binding of malic enzyme to the subsequent Cibacron blue matrix.
The pattern of malic enzyme elution from the Cibacron blue chromatographic column is shown in Figure 2.4. Based on the enzyme activity, malic enzyme seems to ligate to the matrix column with high affinity, since no activity was detected in the unbound protein eluted during loading and washing (Fig. 2.4). During elution there were three protein peaks with malic enzyme activity; the malic enzyme eluted with 10 mM NADP+ sodium salt had two-fold higher specific activity compared to those peaks eluted with the equilibration buffer (25 mM Tris-HCI, pH 7.2, 1 mM /3-mercaptoethanol and 1 68
3.5 ^ 0.2
c 2.5 c o ts (0 **—k_ c '53*-» u.o Q. cn £
0 .0 5
0.5
0 10 20 30 4 0 50 Fraction number
Figure 2.4. Purification of tomato fruit NADP*-malic enzyme on pseudo-affinity chromatophy Cibacron Blue 3GA Agarose column. Malic enzyme activity (~*~) and protein concentration (—-). A = 10 mM NADP+; B = equilibration buffer and C = 200 mM NaCI. 69
mM MnSOJ and 200 mM NaCI (Fig. 2.4). Preliminary column runs showed that
the presence of MnS04 in the equilibration buffer was vital to ligate malic
enzyme to the column matrix, otherwise the enzyme was eluted with the
unbound protein. Therefore Mn2+ is required as cofactor for binding of malic
enzyme onto the nucleotide-binding protein matrix.
SDS-PAGE with a 12% separating gel showed a single band for the
malic enzyme eluted with 10 mM NADP+ sodium salt and two bands for the
peaks eluted with equilibration buffer and 200 mM NaCI (Fig. 2.5a and 2.5b).
The presence of two bands suggests that some other protein binds to the
Cibacron blue matrix. The total enzyme activity of the NADP+ eluate gave a yield of 29.2% from the previous step, with a 10.2-fold increase in the specific activity (Table 2.1). Thompson et at. (1975) show that proteins with the
"dinucleotide fold" super-secondary structure bind with high affinity to Blue-
Dextran Sepharose, NAD+- and NADP+-dependent enzymes, such as dehydrogenases are particularly strongly bound; in addition adequate elution conditions from Blue Dextran columns may provide high purification for these proteins.
The purification scheme used for tomato malic enzyme was able to recover 5.4% of total enzyme activity and increased its specific activity 80.3-fold
(Table 2.1). A previous report of malic enzyme purification from tomato fruit shows a final yield of 0.8% and specific activity of 2.6 jumol NADPH min'1 m g 1 protein (Goodenough ef a/., 1985). The purification scheme used in this 70 1 2 3
Figure 2.5. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (12% separating gel) of fractions eluted from Cibacron Blue column, a) Lane 1, equilibration buffer after NADP+; Lane 2, 200 mM NaCI fraction; Lane 3, bovine serum albumin (66,000 Da), b) Lane 1, bovine serum albumin (66,000 Da); Lane 2, 10 mM NADP+ fraction. 71 experiment was able to recover 6.8-fold more malic enzyme, and the specific activity of 42.5 //mol NADPH min'1 m g 1 protein (Table 2.1) is 16.4-fold higher than the final activity found by Goodenough et al. (1985). Tomaszewzka et al.
(1983) report an increase of 122-fold in the specific activity of malic enzyme from Lupinus luteus leaves. However, the enzyme specific activity was only
4.86//mol NADPH min'1 m g1 protein. Davies and Patil (1974) found 30//mol
NADPH min -1 mg'1 protein in a pure malic enzyme preparation from potato tuber.
The purified NADP+-malic enzyme was assayed for NAD+-malic enzyme activity; however no reduction of NAD+ was observed during the assay. Based on the data, the isolated enzyme is specific for NADP+ as substrate, and there is no presence of NAD+-dependent enzymes in the pure preparation.
Figure 2.6 shows an 8% SDS-PAGE stained with Coomassie blue. Malic enzyme eluted with 10 mM NADP+ sodium salt from the Cibacron Blue column
(Fig. 2.4) appears as a 65-KDa polypeptide when compared with the migration of egg albumin and phosphorylase b on the SDS-PAGE (Fig. 2.6); a similar molecular weight was found in a 12% SDS-PAGE using BSA as a protein marker (Fig. 2.5b). Based on the molecular weight obtained from the gel permeation chromatography (Fig. 2.3) and that found in the SDS-PAGE (Fig.
2.5b and 2.6), the native tomato malic enzyme is apparently a tetramer with identical subunits. Other authors found similar results for malic enzyme extracted from fruits like mango (Dubery and Schabort, 1981) and tomato 72
Figure 2.6. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (8% separating gel) with Coomassie blue stain. Lane 1, egg albumin (45,000 Da) and phosphorylase b (97,400 Da); Lane 2, acetone powder protein fraction of mature-green tomato fruit pericarp; Lane 3, purified tomato fruit NADP+-malic enzyme. 73 (Goodenough et al., 1985), and leaves of sugar cane (Iglesias and Andreo,
1989).
Crude polyclonal antibodies (immune antiserum) raised against the 80- fold purified NADP+-malic enzyme showed some cross reaction with other tomato fruit peptides transferred from an 8% SDS-PAGE onto a nitrocellulose membrane (Fig. 2.7a).
The reaction of affinity purified antibodies with total tomato fruit proteins and pure NADP+-malic enzyme is shown in Figure 2.7b. Pure malic enzyme was recognized by the affinity purified polyclonal antibodies at a 500-fold dilution in a Western blot from an 8% SDS-PAGE (Fig. 2.7b). In addition, the affinity purified antibodies showed higher reaction color intensity when the amount of purified enzyme applied to the gel was increased from 0.25, 0.5 to
1.0 ^g per lane (Fig. 2.7b). The blot in Fig. 2.7b shows that the antibodies recognized a similar molecular weight peptide to the pure malic enzyme in the acetone powder protein fraction extracted from mature-green tomato fruit pericarp. Furthermore, the affinity purification of antibodies was able to eliminate most of the antibodies which react with proteins other than malic enzyme (Fig. 2.7a). However, the purified antibodies showed a weak reaction with another peptide with estimated molecular weight of 74-KDa (Fig. 2.7b).
Therefore, the crude protein extract from mature-green tomato fruit contains at least one peptide with a similar epitope to malic enzyme. 74
a) ! !
1 2 3 4
b)
Figure 2.7. Western blots following 8% sodium dodecyl sulfate-polyacrylamide gel electrophoresis, a) Blot of acetone powder protein fraction of mature-green tomato fruit pericarp with crude immune antiserum, b) Blot of acetone powder protein fraction of mature-green tomato fruit pericarp (Lane 1) and 1.0 fig (Lane 2), 0.5 jug (Lane 3) and 0.25 jug (Lane 4) of pure NADP+-malic enzyme probed with affinity purified antibodies. The immune antiserum inhibited malic enzyme activity of a Sephadex G-
25 protein fraction of pericarp from mature-green tomato fruits (Fig. 2.8). The immune antiserum precipitated about 50% of the enzyme activity at a concentration of 0.5 //I antiserum/300 /i\ of a Sephadex G-25 protein fraction (Fig. 2.8). This represents a 600-fold dilution of the original immune antiserum; a 300-fold (1 nI antiserum/300 ^ I extract) dilution reduced malic enzyme activity by 83% (Fig. 2.8). On the other hand, the preimmune antiserum or affinity purified antibody did not precipitate malic enzyme from 600- to 100-fold dilution, since no reduction of enzyme activity was observed (Fig. 2.8). The affinity purified antibody seems not recognize any epitope essential for malic enzyme activity, although it was able to react with the denatured malic enzyme polypeptide on Western blots (Fig. 2.7b). The affinity purification method may have selected antibodies that recognize malic enzyme polypeptides in a denatured form; this would explain the absence of malic enzyme inhibition of activity in the immunotitration assay.
Intracellular location of tomato NADP*-malic enzyme
El-Shora and ap Rees (1991), studying the intracellular location of
NADP+-malic enzyme in cotyledons of marrow seedlings and soybean protoplasts, found enzyme activity associated with the chloroplast fraction.
They conclude that the appearance of malic enzyme activity in soluble fractions of both C3 and C4 plant extracts (Goodenough et al., 1985; Danner and Ting, 76
0.35
0.3
0.25 c E T. CL 0.2 O < z
0.1
0 .0 5
0 0.5 1 1.5 2 2.5 3 3.5 Volume (/ul)
Figure 2.8. Immunoinhibition of tomato fruit NADP+-malic enzyme activity in Sephadex G-25 protein fraction. The residual activity was determined after addition of various amounts of preimmune antiserum or affinity purified antibodies and immune antiserum (-B-). 77
1967) may result from chloroplast breakage. In an attempt to localize malic enzyme in tomato tissues, chloroplasts from leaves and fruits were isolated and the activities of specific cytosolic and chloroplastidic protein markers were used to test the purity of preparations. Corn leaf extracts were used as a positive control, since a chloroplastidic isoform of NADP+-malic enzyme is known to be present in this tissue.
The total activity of the chloroplast enzyme GAPDH in tomato fruit, tomato leaves, and corn leaves is shown in Table 2.2. Comparing GAPDH activities in intact chloroplasts and those lysed with 0.1% Triton X-100, the chloroplast preparations from tomato fruit, tomato leaves, and corn leaves showed 65, 63 and 67% intactness respectively, based on the increase in
GAPDH activity of Triton X-100 treated chloroplasts.
Rubisco is an enzyme exclusively present in the chloroplast stroma of plant cells; the total and specific activities of rubisco in the tomato and corn are shown in Table 2.3. The rubisco activity recovered in the chloroplast was 3.3% for tomato fruit, 9.7% for tomato leaves and 7.4% for corn leaves, compared to the total activity found in their corresponding supernatants (Table 2.3); however the specific activity of rubisco in the chloroplast was 3.8-, 5.5- and 3.3-fold higher than that present in the supernatant, respectively (Table 2.3). The higher activities found in the chloroplast fractions compared to those present in the supernatants, suggest that the chloroplastidic proteins are represented in higher proportion in the chloroplast preparations. 70
Table 2.2. Activity of NADP+-glyceraldehyde-3-phosphate dehydrogenase in intact and 0.1% Triton X-100 lysed chloroplast fraction of immature-green tomato fruit pericarp, tomato and corn leaves.
Total activity
(nmol NADP+ min'1 g'1 FW) Chloroplasts
Intact Lysed
Tomato Fruit 0.6 ±0.1 1.0 ±0.2
Tomato Leaves 6.3 ±0.2 10.3 ±0.3
Corn Leaves 6 6 ± 0 -4 11 0 ± 0 -5
±SE of three independent replicates Table 2.3. Total and specific activities of ribulose-1,5-bisphosphate carboxylase in the Sephadex G-25 protein fraction of the supernatant and 0.1% Triton X-100 lysed chloroplast fraction of immature-green tomato fruit, tomato leaves and corn leaves.
Total Activity Specific Activity
Tissue (nmol NAD+ min' g'1 FW) (nmol NAD* min'1 mg'1 protein)
Supernatant Chloroplast Supernatant Chloroplast
Tomato Fruit 0.9 ±0.1 0.03 ±0.01 1.1 ±0.2 4.2 ±1.4
Tomato Leaves 37.0 ±7.4 3.6 ±1.0 4.9 ±1.0 27.0 ±7.5
Com Leaves 14.8 ±3.0 1.1 ±0.3 4.2 ±0.9 13.9 ±3.8
±SE from three independent samples 80 Alcohol dehydrogenase was used as a cytosolic marker enzyme.
Tomato fruit supernatant showed a total alcohol dehydrogenase activity of 177
nmol NADH m in1 g'1 FW, but no activity was detected in the fruit chloroplast.
Furthermore, no alcohol dehydrogenase activity was present in either supernatant or chloroplast fraction of tomato and corn leaves. Based on alcohol dehydrogenase activity, the tomato fruit chloroplast preparation seems not to be contaminated with cytosolic proteins.
Table 2.4 shows the total NADP+-malic enzyme activity in the supernatant and chloroplast fractions. Enzyme activity was not detected in tomato leaf chloroplasts; however, the immature-green fruit chloroplast contained 0.15% of the total activity present in the supernatant. In corn, relatively high malic enzyme activities were present in both supernatant and chloroplast fractions (Table 2.4). Total enzyme activity in the corn chloroplast represents 11.5% of the malic enzyme in the supernatant; which is similar to the partition ratio found for rubisco activity (Tables 2.3 and 2.4). On the other hand, the tomato fruit chloroplast fraction showed 0.15% of total malic enzyme activity present in the supernatant, whereas 3.3% of rubisco activity was recovered in the chloroplast fraction (Tables 2.3 and 2.4). This suggests that malic enzyme and rubisco are not associated with the same organelle in tomato fruit. In addition, the specific activity of malic enzyme in the tomato fruit chloroplast was 9.2-fold lower than the activity found in the supernatant (Table
2.4). However, in the corn leaf chloroplast fraction, specific activity of the Table 2.4. Total and specific activities of NADP+-malic enzyme in the Sephadex G-25 protein fraction of the supernatant and 0.1% Triton X-100 lysed chloroplast fraction of immature-green tomato fruit, tomato leaves and corn leaves.
Total Activity Specific Activity
Tissue (nmol NADPH min'1 g'1 FW) (nmol NADPH min'1 mg'1 protan)
Supernatant Chloroplast Supernatant Chloroplast
Tomato Fruit 130.5 ±16.0 0.2 ±0.1 156.2 ±31.0 16.9 ±5.6
Tomato Leaves 132.0 ±14.0 ND 17.5 ±3.0 ND
82.5 ±12.0 9.5 ±1.0 Com Leaves 23.5 ±4.5 120.0 ±37.0
±SE from three independent samples 82 enzyme was 5-fold higher than that present in the supernatant (Table 2.3).
Therefore, unlike the corn malic enzyme, the tomato fruit and leaf enzymes seem not to be associated with the chloroplast. The small activity present in the fruit chloroplast preparations might be attributed to enzyme adsorbed to the chloroplast membranes or due to contamination with mitochondrial NAD-malic enzyme (EC 1.1.1.39) which reduces either NAD+ or NADP+ in the presence of malic acid (Wedding, 1989).
A Coomassie brilliant blue-stained SDS-PAGE 8% gel of the total and chloroplastidic proteins from the above tissues is shown in Fig 2.9. The corresponding Western blot shows that the purified polyclonal antibodies raised against the pure tomato fruit malic enzyme recognize a 65-kDa polypeptide in the total protein extracts of tomato fruit and leaves, and corn leaves (Fig. 2.10). The polypeptide size is similar to the pure malic enzyme isolated from tomato fruit (Fig 2.7b and 2.10). The antibodies also recognized the 65-kDa polypeptide in the total protein extracts of tomato stems and roots, and corn roots (Fig. 2.11). This suggests that a similar malic enzyme is expressed in tomato fruits, leaves, stems and roots. Furthermore, a malic enzyme in corn leaves and roots seems to be similar to that found in tomato fruits. The occurrence of antibody reaction with a 65-kDa polypeptide in the total tomato protein fractions, but not with the tomato chloroplast protein fractions, suggests that malic enzyme is located in the cytoplasm of tomato cells. 83
Figure 2.9. Sodium dodecyl sulfate-potyacrylamide gel electrophoresis (8% separating gel). Lane 1, egg albumin (45,000 Da); acetone powder protein fractions of immature-green tomato fruit pericarp (Lane 2), tomato leaves Lane 3) and corn leaves (Lane 4). Chloroplastidic proteins of immature-green tomato fruit pericarp (Lane 5), tomato leaves (Lane 6) and corn leaves (Lane 7). 84
1 2 3 4 5 6
65 KDa —►
Figure 2.10. Western blot following 8% sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Acetone powder protein fraction of immature-green tomato fruit pericarp (Lane 1), tomato leaves (Lane 2) and corn leaves (Lane 3). Chloroplastidic proteins of immature-green tomato fruit pericarp (Lane 4), tomato leaves (Lane 5) and corn leaves (Lane 6). 85
1 2 3
65 KDa —♦ —
Figure 2.11. Western blot following 8% sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Acetone powder protein fraction of tomato stems (Lane 1), tomato roots (Lane 2) and corn roots (Lane 3). In addition to the 65-kDa polypeptide, the antibodies recognized a 74-
kDa polypeptide in both chloroplast and total tomato immature-green fruit
proteins (Fig. 2.10). The reaction signal was more intense with the
chloroplastidic protein fraction than with the total proteins of tomato fruit (Fig.
2.10); this suggests that the 74-kDa polypeptide is located primarily in the fruit
chloroplast. However, this polypeptide was not present in the total protein
fraction from tomato leaves, stems and roots (Fig. 2.10 and 2.11). Therefore,
the 74-kDa polypeptide seems to be present only in the fruit plastid, and its
function remains to be studied.
Pupillo and Bossi (1979) report the existence of two NADP+-malic
enzymes in corn, chloroplastidic and cytoplasmic isozymes with distinct kinetic
properties and isoelectric points. The two enzymes are present in the leaves,
however the chloroplastidic form develops high specific activities during
photosynthetic differentiation. In another report, Danner and Ting (1967) found that malic enzyme present in corn root tips seems not be associated with any
organelle in the cell, suggesting that it is a soluble, cytoplasmic enzyme.
Although antibodies to tomato NADP+-malic enzyme did not react with any chloroplastidic enzyme in corn leaves (Fig. 2.10), they recognized a 65-kDa
polypeptide in the total protein extract of leaves and roots (Fig. 2.10 and 2.11); this might correspond to the corn cytoplasmic malic isozyme. Fathi and
Schnarrenberger (1990) found that antibodies raised against purified NADP+- malic enzyme from corn leaves showed a high percent of cross-reactivity in immunotritation tests with sugar cane malic enzyme, However, the antibodies had a much lower degree of reactivity with malic enzyme in the C3 plants spinach and wheat, and the crassulacean acid metabolism (CAM) plant
Bryophyllum daigremontianum. This suggests that the polypeptide secondary structure of chloroplastidic malic enzyme of C4 plants may differ from the cytosolic isoform in C3 and CAM plants (Edwards and Andreo, 1992).
Moreover, Edwards and Andreo (1992) discuss the existence of two genes that code for malic isozymes in corn. The cytosolic isoform is highly expressed in roots while the chloroplastidic isoform is expressed in the bundle sheath cells in a light-dependent way. Both genes contain very similar coding regions with many silent substitutions. Amino acid sequences predicted from NADP+-malic enzyme nucleotide sequences of Populus and Phaseolus vulgaris (C3 plants) cDNAs do not contain the apparent transit sequence for translocation to the chloroplasts, which was found in the chloroplastidic corn enzyme (van
Doorsselaere eta/., 1991; Rothermel and Nelson, 1989). The existence of a chloroplastidic enzyme in C3 plants is not excluded, however the enzyme activities and antibody reactions found in the tomato tissues do not support the existence of a chloroplastidic malic enzyme in tomato. 88 CONCLUSIONS
NADP+-malic enzyme from pericarp of mature-green tomato fruit was
purified to homogeneity by sequential precipitation with ammonium sulfate, ion
exchange chromatography, gel permeation and pseudo-affinity
chromatography. The purified malic enzyme preparation showed a single 65-
KDa band in either 8% or 12% denaturating SDS-polyacrylamide gel
electrophoresis. The purification scheme increased the specific activity 80-fold with a yield of 5.4%, when compared to the activities in the crude extract. Gel
permeation chromatography of partially purified malic enzyme indicated a
native molecular weight of 260-KDa, which is consistent with four subunits of
65-KDa. The pure malic enzyme was a specific NADP+-dependent dehydrogenase, having no activity with NAD+ as substrate.
Polyclonal antibodies raised against purified malic enzyme precipitated the enzyme, but cross reacted with other polypeptides of tomato fruit besides malic enzyme in Western blots after SDS-polyacrylamide gel electrophoresis.
Affinity-purified antibodies recognized a specific 65-KDa polypeptide in the total protein extract of tomato fruit. Intracellular location of malic enzyme was studied in tomato fruit and tomato leaf; corn leaves provided a positive control for chloroplastidic location. Based on enzyme activity and Western blots, malic enzyme is located in the cytoplasm of tomato cells. However, the presence of an isoform in the chloroplast of tomato is not excluded. Immunobloting showed 89 that a similar malic enzyme isoform is present in corn roots and leaves, and in tomato fruits, roots and stems. 90
LIST OF REFERENCES
Bartley G. E., Viitanen P. V., Bacot K. O. and Scolnik P. A. (1992). A tomato gene expressed during fruit ripening encodes an enzyme of the carotenoid biosynthesis pathway. J. Biol. Chem. 267: 5036-5039.
Bathgate B., Purton M. E., Grierson D., and Goodenough P. W. (1985). Plastid changes during the conversion of chloroplasts to chromoplasts in ripening tomatoes. Planta 165: 197-204.
Berry S. Z. and Gould W. A. (1983). ’Ohio 7814’ tomato. HortScience 18: 494-496.
Bird C. R., Ray J. A., Fletcher J. D., Boniwell J. M., Bird A. S., Teulieres C., Blain I., Bramley P. M. and Schuch W. (1991). Using antisense RNA to study gene function of carotenoid biosynthesis in transgenic tomatoes. Bio/Technology 9: 635-639.
Bradford M. M. (1976). A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72: 248-254.
Danner J. and Ting I. P. (1967). COa Metabolism in corn roots. II. Intracellular distribution of enzymes. Plant Physiol. 42: 719-724.
Davies D. D. and Patil K. D. (1974). Regulation of ’malic’ enzyme of Solanum tuberosum by metabolites. Biochem. J. 137: 45-53.
Davies D. D. (1986). The fine control of cytosolic pH. Physiol. Plant. 67: 702- 706.
DellaPenna D., Alexander D. C. and Bennett A. B. (1986). Molecular cloning of tomato fruit polygalacturonase: analysis of polygalacturonase mRNA levels during ripening. Proc. Natl. Acad. Sci. USA 83: 6420-6424. 91 Dittrich P. (1976). Nicotinamide adenine dinucleotide-specific "malic" enzyme in Kalanchoe daigremontiana and other plants exhibiting crassulacean acid metabolism. Plant Physiol. 57: 310-314.
Drouet A. G. and Hartmann C. J. R. (1977). Activity of pear malic enzyme; its regulation by metabolites. Phytochemistry 16: 505-508.
Dubery I. A. and Schabort J. C. (1981). Purification and characterization of the NADP-linked malate dehydrogenase (decarboxylating) from Mangifera indica. Biochim. Biophys. Acta 662: 102-110.
Edwards G. E. and Andreo C. S. (1992). NADP-Malic enzyme from plants. Phytochemistry 31: 1845-1857.
El-Shora H. M. and ap Rees T. (1991). Intracellular location of NADP+-linked malic enzyme in C3 plants. Planta 185: 362-367.
Fathi M. and Schnarrenberger C. (1990). Purification by immunoadsortion and immunochemical properties of NADP-dependent malic enzymes from leaves of C3, C4, and crassulacean acid metabolism plants. Plant Physiol. 92: 710- 717.
Giovannoni J. J., DellaPenna D., Bennett A. B. and Fischer R. L. (1989). Expression of a chimeric polygalacturonase gene in transgenic rin (ripening inhibitor) tomato fruit results in polyuronide degradation but notfruit softening. The Plant Cell 1: 53-63.
Goodenough P. W., Prosser I. M. and Young K. (1985). NADP-linked malic enzyme and malate metabolism in ageing tomato fruit. Phytochemistry 24: 1157-1162.
Hamilton A. J., Lycett G. W. and Grierson D. (1990). Antisense gene that inhibits synthesis of the hormone ethylene in transgenic plants. Nature 346: 284-287.
Iglesias A. A. and Andreo C. S. (1989). Purification of NADP-malic enzyme and phosphoenolpyruvate carboxylase from sugar cane leaves. Plant Cell Physiol. 30: 399-405.
Jeffery D., Smith C., Goodenough P., Prosser I. and Grierson D. (1984). Ethylene-independent and ethylene-dependent biochemical changes in ripening tomatoes. Plant Physiol. 74: 32-38. 92 Jenkins C. L. D. and Boag S. (1985). Isolation of bundle sheath cell chloroplasts from the NADP-ME type C4 plant Zea mays. Plant Physiol. 79: 84- 89.
Johnson L. M., Snyder M., Chang L. M. S., Davis R. W. and Campbell J. L. (1985). Isolation of the gene encoding yeast DNA polymerase I. Cell 43: 369- 377.
Krishnamurthy S., Patwardhan M. V. and Subramanyam H. (1971). Biochemical changes during ripening of the mango fruit. Phytochemistry 10: 2277-2281.
Laemmli U. R. (1970). Cleavage of structural proteins during assembly of the head of bacteriophage T4. Nature 227: 680-685.
Langdale J. A., Rothermel B. A. and Nelson T. (1988). Cellular pattern of photosynthetic gene expression in developing maize leaves. Genes & Development 2: 106-115.
Lilley R. McC. and Walker D. A. (1974). An improved spectrophotometric assay for ribulosebis-phosphate carboxylase. Biochim. Biophys. Acta 358: 226-229.
Oeller P. W., Min-Wong L., Taylor L. P., Pike D. A. and Theologis A. 1991. Reversible inhibition of tomato fruit senescence by antisense RNA. Science 254: 437-439.
Pupillo P. and Bossi P. (1979). Two forms of NADP-dependent malic enzyme in expanding maize leaves. Planta 144: 283-289.
Possner D., Ruffner H. P. and Rast D. M. (1981). Isolation and biochemical characterization of grape malic enzyme. Planta 151: 549*554.
Price C. A., Cushman J. C., Mendiola-Morgenthaler L. R. and Reardon E. M. (1987). Isolation of plastids in density gradients of percoll and other silica sols. In Methods in enzymology: plant cells membranes, Packer L. and Douce R. Eds., Vol. 148, pp 157-179. Academic Press, New York/London.
Roberts J. K. M., Hooks M. A., Miaullis A. P., Edwards J. and Webster C. (1992). Contribution of malate and amino acid metabolism to cytoplasmic pH regulation in hypoxic maize root tips studied using nuclear resonance spectroscopy. Plant Physiol. 98: 480-487. 93 Rothermel B. A. and Nelson T. (1989). Primary structure of the maize NADP- dependent malic enzyme. J. Biol. Chem. 264: 19587-19592.
Ruffner H. P., Hawker J. S and Hale C. R. (1976). Temperature and enzymic control of malate metabolism in berries of Vitis vinifera. Phytochemistry 15: 1877-1880.
Sato T. and Theologis A. (1989). Cloning the mRNA encoding 1- aminocyclopropane-1-carboxyiate synthase, the key enzyme for ethylene biosynthesis in plants. Proc. Natl. Acad. Sci. USA 86: 6621-6625.
Smith A. M. and ap Rees T. (1979). Effects of anaerobiosis on carbohydrate oxidation by roots of Pisum sativum. Phytochemistry 18: 1453-1458.
Smith C. J. S., Watson C. F., Ray J., Bird C. R., Morris P. C., Schuch W. and Grierson D. (1988). Antisense RNA inhibition of polygalacturonase gene expression in transgenic tomatoes. Science 334: 724-726.
Thompson S. T.t Cass K. H. and Stellwagen E. (1975). Blue dextran- sepharose: an affinity column for the dinucleotide fold proteins. Proc. Natl. Acad. Sci. USA 72: 669-672.
Tomaszewska B., Schramm R. W., Kokot A. and Mazurowa H. (1983). Isolation and characterization of cytoplasmic NADP+-malic enzyme from Lupinus luteus leaves. Physiol. Plant. 59: 641-646. van Doorsselaere J., Villerroel R., van Montagu M. and Inze D. (1991). Nucleotide sequence of a cDNA encoding malic enzyme from poplar. Plant Physiol. 96: 1385-1386.
Wedding R. T. (1989). Malic enzymes of higher plants. Plant Physiol. 90: 367- 371. CHAPTER III
ISOLATION AND CHARACTERIZATION OF A cDNA CLONE FOR NADP+-
MALIC ENZYME FROM TOMATO FRUIT.
INTRODUCTION
NADP+-dependent malic enzyme (EC 1.1.1.40) is present in a wide range of plant tissues. Under physiological conditions, the enzyme catalyzes the oxidative decarboxylation of malate to pyruvate, producing NADPH and
COz. In plants, malic enzyme plays distinct roles depending on the tissue and intracellular location. The enzyme seems to be associated with degradation of malic acid in some climacteric and nonclimacteric fruits which accumulate large amounts of organic acids throughout growth (Goodenough etal., 1985; Ruffner et a i, 1976). On the other hand, in plants showing crassulacean acid metabolism (CAM) and in some C4 plants like maize, malic enzyme provides
C 0 2 for photosynthetic fixation (Ting, 1985; Edwards and Huber, 1981). In addition, the enzyme may be involved in intracellular pH regulation in conjunction with phosphoenolpyruvate carboxylase (Davies, 1986).
94 95 Within the cell malic enzyme has been found in the cytoplasm and
chloroplasts. In C3 plants the enzyme is considered to be located in the
cytoplasm, but it occurs in the chloroplast of C4 plants. However, the presence
of a cytoplasmic isoform of the enzyme in the cytoplasm of maize cells has
been reported (Pupillo and Bossi, 1979; Scagliarini etal., 1988). These reports
suggest that the chloroplastidic isozyme is probably derived from a
predecessor cytoplasmic form. Rothermel and Nelson (1989) suggest that
the two isoforms may originate from gene duplication or through alternative
final products of the same single gene.
Malic enzyme cDNAs have been isolated and sequenced in several
plants and animals (Edwards and Andreo, 1992; Magnusun et at., 1986;
Bagchiefa/., 1987). In plants, NADP+-dependent malic enzyme cDNA was first
isolated in maize by Langdale etal. (1988) by screening an expression library
with antibodies. The nucleotide sequence of the maize cDNA malic enzyme
presents high amino acid homology with the cytoplasmic enzyme of rat and
mouse (Rothermel and Nelson, 1989). The nucleotide sequence of a "cinnamyl-
alcohol dehydrogenase" (CAD) cDNA isolated from a bean expression library
presents 77% similarity with maize malic enzyme amino acid sequence, suggesting that the cDNA does not encode CAD but rather a bean malic
enzyme (Walter et at., 1990).
The use of heterologous DNA probes enable isolation of malic enzyme cDNAs from plants like Flaveria (Borsch and Westhoff, 1990; Rajeevan et at., 1991) and Populus (van Doorsselaer eetal., 1991); the similarity among maize,
Flaveria, Populus and Phaseolus vulgaris cDNAs nucleotide coding sequences
exceeds 70% (Edwards and Andreo, 1992). In C4 plants, such as maize and
Flaveria trinervia, the malic enzyme cDNAs coding sequences show a region
coding for a putative transit peptide to import the protein into the chloroplast
(Rothermel and Nelson, 1989; Borsch and Westhoff, 1990). However, the transit
peptide nucleotide sequence is not present in the cDNAs of the C3 plants
Populus and Phaseolus vulgaris, suggesting that the enzymes are located in the cell cytoplasm (van Doorsnnelaereef a/., 1991). Current results reported by
Edwards and Andreo (1992) provide data which support the hypothesis that two genes encode for malic enzyme in maize; one gene codes for a cytosolic form expressed mainly in the roots, and another gene encodes the chloroplastidic enzyme. The results suggest that the chloroplastidic form is derived from the gene encoding the cytoplasmic malic enzyme, since both genes contain very similar coding regions (Edwards and Andreo, 1992).
The objectives of this work were to screen a tomato fruit cDNA library for malic enzyme using a maize cDNA malic enzyme as probe (Rothermel and
Nelson, 1989), followed by sequencing of the cDNA clone to obtain the complete coding region. 97 MATERIALS AND METHODS
Amplification of NADP*>malic enzyme cDNA probe
A 0.5 ml aliquot of overnight grown E. coli strain JM 109 was inoculated
in 50 ml of LB media and grown to O .D .^ of 0.3 - 0.4 at 37°C under shaking.
Cells were pelleted at 1,000 x g for 10 min at 4°C, resuspended in 5.0 ml of ice cold TSS (10% PEG 8000, 5% DMSO and 25 mM MgCI2 in LB, pH 6.5) and stored on ice until cell transformation, as described by Chung et al. (1989). A sample with 100 ng of pBS{+) AmpR plasmid containing a 1.3 Kbp Eco Rl cDNA insert from corn NADP+-malic enzyme (Rothermel and Nelson, 1989; gift from Timothy Nelson, Yale University) it was added to 100 fi\ of cold E. coli cells and placed on ice for 40 min, followed by heat shock at 42°C for 2 min.
To the cells was added 800 nI of LB media containing 20 mM glucose and they were grown for 40 min at 37°C with shaking. The cells were plated in solidified
YT 1.5% agar media containing lOO^ug ml'1 of ampicillin. The E. coli strain JM
109 untransformed cells were used as a control. After amplification, the 1.3 kb
Eco Rl cDNA fragment from corn NADP+-malic enzyme was used as a probe to screen a tomato fruit cDNA library.
Alkaline plasmid preparation
Plasmid isolation was done as described by Sambrook etal. (1989) with modifications: a 50 ml sample of overnight grown E. coli strain JM 109 containing the pBS(+) -1,3 kb corn Eco Rl malic enzyme cDNA fragment was
spun down at 7,000 x g for 10 min. The cells were resuspended in 2.0 ml of
50 mM glucose, 25 mM Tris-HCI (pH 8.0) and 10 mM EDTA (pH 8.0), and then
transferred to a 15 ml polypropylene tube; followed by addition of 4.0 ml of
fresh 0.2 M NaOH and 1 % SDS with sharp inversion of the tube several times,
and then incubated for 5 min at room temperature. Next, 3.0 ml of ice cold 3
M potassium acetate-glacial acetic acid (pH 4.8) was added, followed by sharp
inversion of the polypropylene tube several times, and incubation for 10 min
on ice. The digested cells were centrifuged at 25,400 x g in a swing-out rotor
for 20 min at 4°C; 8.0 ml of the supernatant was warmed up to room
temperature, mixed with 4.8 ml of isopropanol, and then incubated for 15 min
to precipitate nucleic acids. The DNA was pelleted by centrifugation at 13,200
x g in a swing-out rotor for 20 min at room temperature. The pellet was
washed with 70% ethanol and dried under vacuum; finally the pellet was
resuspended in 1.5 ml of TE buffer. The DNA was extracted twice with equal
volumes of 0.1 M Tris-HCI (pH 8.0) saturated phenol, and then twice with an
equal volume of chloroform. To the remaining aqueous phase was added 1.5
ml of ice cold 7.5 M NH4OAc (pH 5.7) and the mixture was incubated on ice
for 10 min. Contaminating RNA was precipitated by centrifugation at 25,400 x g in a swing-out rotor for 20 min at 4°C and the supernatant was transferred to a 15 ml Corex tube. Next the DNA was precipitated with 7.5 ml of 95% ethanol at -20°C, followed by incubation on ice for 10 min. The DNA was pelleted by centrifugation at 13,200 x g in a swing-out rotor for 20 min at 4°C.
The pellet was air dried and resuspended in 2.0 ml of TE buffer, followed by addition of 2 f iI cocktail of 1 mg ml'1 RNase A and 20,000 U ml'1 RNase T1.
After incubating for 30 min at 37°C, the plasmid was precipitated by addition of 350 fi\ of 5 M NaCI and 940 fi\ of 30% PEG 8000 and incubating overnight on ice. Next the plasmid DNA was pelleted by centrifugation at 13,200 x g in a swing-out rotor for 30 min at 4°C, followed by washing with 2.0 ml of 70% ethanol at -20°C; finally the pellet was resuspended in 200 ju\ of TE buffer. The absorbance of the DNA was measured at 280 and 260 nm in a Shimadzu UV
160U spectrophotometer. A satisfactory preparation showed a ratio -
1.7. DNA quantification was done by the following spectrophotometric conversion: lA ^ = 50 fig DNA m l1.
Probe labeling
A 20 fig sample of 1.3 kb Eco Rl corn malic enzyme cDNA in pBS(+) plasmid was digested with 50 U of Eco Rl for 2 hours at 37°C. The digested product was loaded in a 0.8% low melt agarose TAE buffer containing 0.25 fig ml'1 of ethidium bromide and electrophoresed for 2 hours at 50 V. The 1.3 kb
DNA fragment was visualized in UV light and the band was removed from the whole gel. The DNA fragment was removed from the agarose following the specifications suggested by the Geneclean II® Kit (Bio 101 Inc. La Jolla, CA
92038). The purified cDNA fragment was resuspended in 20^1 of TE buffer (10 100 mM Tris-HCI pH 8.0 and 1 mM EDTA). A 9 aliquot with 25 ng of 1.3 kb Eco
Rl corn malic enzyme cDNA fragment was denatured for 10 min at 95°C,
immediately placed on ice, and then mixed with 1 ^ I dATP, 1 fi I dGTP, 1 ft\ dTTP, 2fi\ reaction mix, 5 fi\ a^P-dCTP (3,000 Ci //I1) and 1/*l Klenow DNA
polymerase as recommended by the Boehringer - Mannheim Kit for random
primer labeling of DNA. The reaction mixture was incubated at 37°C for 30 min,
followed by inactivation of DNA polymerase at 65°C for 10 min. The labeled
probe was purified by using the Geneclean II® Kit and then resuspended in 100
fi\ of TE buffer. A 1 fi\ aliquot was used to determine the specific activity in cpm fiV of labeled DNA solution for “ P in a scintillation counter.
Isolation of tomato and corn total RNA
Total RNA was isolated according to the procedure published by Biggs
etal. (1986). Samples containing 100 g FW of tomato ’Ohio 7814’ fruit pericarp
at immature-green, mature-green, breaker, and ripe stages, and tomato and
corn leaves were ground to a powder under liquid nitrogen in a metal blender.
The cold powder was mixed with 200 ml of Covey's extraction buffer and 1 %
/S-mercaptoethanol, followed by stirring for 30 min at room temperature. To the slurry was slowly added 100 ml of fresh Kirby’s phenol: chloroform: isopentyl
alcohol (PCIA, 50:48:2. v:v:v); this was stirred for 30 min and then centrifuged
at 16,300 x g for 5 min at 4°C. The upper phase was removed, slowly mixed with 100 ml of PCIA, stirred for 30 min, and centrifuged at 16,300 x g at 4°C for 5 min. To the upper phase was added 1/20 volumes of 4 M NaOAc (pH 6.0) and 2.5 volumes of 95% ethanol, and the mixture was incubated for at least 3 hours at -20°C to precipitate the nucleic acids. Next, the nucleic acids were pelleted at 16,300 x g for 15 min at 4°C. The pellet was resuspended in 40 ml of cold ddH20 and homogenized with a Dounce homogenizer, followed by centrifugation at 12,100 x g for 5 min at 4°C. The supernatant was mixed with
3 volumes of 4 M NaOAc (pH 6.0) and kept on melting ice for 1.5 hours. The
RNA was pelleted by centrifugation at 25,300 x g for 20 min at 4°C. The pellet was resuspended in 6.0 ml of cold RNase free ddHzO, mixed with 3 volumes of 4 M NaOAc (pH 6.0) and incubated on melting ice for 1.5 hours. Next, the
RNA was pelleted by centrifugation as above. The RNA was resuspended in 5.0 ml of cold RNase free ddHaO, mixed with 1 /20 volumes of 4 M NaOAc (pH 6.0) and 2.5 volumes of 95% ethanol, followed by incubation at -20°C overnight and centrifugation at 12,100 x g for 10 min at 4°C. Then the pellet was air dried and finally resuspended in 2.0 ml of RNase free ddH20. The absorbance of total RNA was scanned from 320 to 220 nm in a Shimadzu UV 160U spectrophotometer to check the quality and recovery. A good RNA preparation was consider to have A ^ /A ^ > 1.8. The quantification of total RNA was done by the following spectrophotometric conversion: lA ^ = 40 ^g RNA ml'1. 102 Northern hybridization analysis
Samples containing 20 of total RNA from tomato fruit, tomato leaves and corn leaves were resuspended in 4 //I of RNase free ddHaO, 10^/1 of
deionized formamide, 3.6 ju\ of 37% formaldehyde, 2 ju\ of 10x gel buffer (200
mM MOPS pH 7.0, 50 mM sodium acetate and 10 mM EDTA) and 2.2 fi\ of 10x dye buffer (0.5% xylene cyanole). The samples were heated to 55°C for
15 min, loaded in a 1.4% agarose, 0.33 M formaldehyde gel, and then run in
1 x gel buffer at 100 V for 3 hours. The gel was then rinsed with ddHaO for 5
min with several changes, soaked in fresh 50 mM NaOH and 10 mM NaCI for
45 min, and then in 0.1 M Tris-HCI (pH 7.5) for 45 min. Finally the gel was
soaked in 20 x SSC for one hour. The RNA was transferred to a Hybond-nylon filter overnight in a 20x SSC transfer buffer system. Then the filter was rinsed with 2x SSC to remove the excess agarose, air dried for one hour, and then exposed to UV-light for 1 min. Next, the blot filter was pre-hybridized at 60°C for 30 min in 50 mM sodium phosphate (pH 6.5), 1 mM EDTA, 5 x SSC and 5% SDS as described by Virca etal. (1990). The filter was hybridized overnight with DNA probe containing 1x 10® cpm m l1 in hybridization buffer (50 mM sodium phosphate pH 6.5, 5x SSC, 1mM EDTA, 5% SDS, 10% dextran sulfate and 50% formamide). Before hybridization, the probe was denatured at 95°C in water bath for 5 min. The temperature for hybridization was 38°C for the heterologous probe or 50°C for the homologous probe. The filter was washed for 15 min in 1 x SSC and 5% SDS at room temperature with at least two changes. Next, the filter was washed for 30 min in 500 ml of 0.1 x SSC and 5% 103 SDS at room temperature for the filter hybridized with the heterologous probe
or 50°C for the homologous probe. Finally the filter was briefly dried on
Whatman 3MM and exposed to X-ray film (X-OMAT AR5, Kodak) for 24 hours
at -70°C.
Library screening
A lambda gt 11 cDNA library of tomato (cv. VF N8) fruit at mature-green
stage (Clontech Laboratories Inc., Palo Alto, CA 94303) containing 3.3 x 1011
independent clones ml'1 was screened for NADP+-malic enzyme as follows: a
sample with 50,000 recombinant phages was mixed with 500 //I of overnight grown E. coli strain Y1090r' (cDNA library host) in LB medium and incubated at 37°C for 20 min to adsorb the phage. Then the E. coli - phage solution was
mixed to 9.0 ml of 0.8% YT melted top agarose (50°C) and plated in a 150 mm petri dish containing YT solidified with 1.5% agar. A total of 12 individual plates were prepared to be screened. The plates were incubated until plaque lysis occurred (12 hours) at 37°C, and then placed at 4°C for 1 hour minimum. A
Hybond nylon filter (from Amersham) was laid on the plate surface until evenly wet and keyed with ink; a second filter was then laid on the same plate for 1 min. The filters were soaked for 1 min in 0.5 M NaOH and 1.5 M NaCI to denature the proteins, followed by incubation in 0.5 M Tris-HCI (pH 8.0) and
1.5 NaCI for 2 min to neutralize the phage protein and DNA. Finally the filters were washed in 2x SSC for 1 min. The filters were air dried on Whatman 3MM 104 paper for 2 hours, and then exposed to UV-light for 1 min.
The dried filters were incubated in pre-hybridization solution (5x SSC,
5 x Denhardt’s solution and 0.5% SDS) at 65°C for 2 hours. Each filter was incubated overnight at 50°C in 4.0 ml of hybridization solution as follows: 1 x
10® cpm (cr^P-dCTP), 100 ^ g ml'1 of salmon sperm DNA, 5 x SSC, 5 x
Denhardt’s solution, 0.5% SDS, 10% dextran sulfate and 10 m l1 of Poly A acid to the hybridization solution. The probe and the salmon sperm DNA were denatured for 10 min at 95°C in water bath, placed immediately on ice, mixed with pre-warmed hybridization solution (50°C), and then applied to the filters in sealed plastic bags. After hybridization overnight filters were washed three times for 5 min with washing solution (2x SSC and 1% SDS) at room temperature, soaked in pre-warmed washing solution (50°C) for 30 min at50°C, and dried on Whatman 3MM paper. Finally the filters were exposed to X-ray film (X-OMAT AR5, Kodak) for at least 2 days at -70°C.
The filters which showed hybridization signals in both replicates were used to locate the recombinant phages in the agar plates. Around 15 agar plugs containing recombinant phages were punched out from the plates using the large end of a Pasteur pipet, and then placed into 500 ju\ of lambda diluent
(50 mM Tris-HCI pH 7.5, 100 mM NaCI, 8 mM MgSO* and 0.01% gelatin) and
50 of chloroform. The phages were allowed to diffuse from the agar plugs for at least 4 hours at 4°C. Phage samples containing 30 to 60 recombinants were plated in 150
mm petri dishes following the same procedure used in the first screening. A
total of 10 single recombinant phages showed positive hybridization signal with
the corn cDNA probe. Each of the single recombinant phage plaque was
removed from the agar plate by extracting the agar plug with the narrow end
of a Pasteur pipet, and placed into 50 /i\ of lambda diluent and 5 fi I of chloroform at 4°C for at least 4 hours. Each of the recombinants was amplified
on four 150 mm petri dishes with 1.5% agar in 9.0 ml of 0.8% TY top agarose
as follows: the top agar containing phage lysis was scraped off, mixed with 12
ml of lambda diluent, 500 ft\ of chloroform and shaken for 2 hours at room temperature. The supernatant was poured in a 15 ml polypropylene tube and centrifuged at 8,000 x g in a swing-out rotor for 20 min to remove the cell debris. To the supernatant was added 1 fig m l1 of RNase A and DNase I and this was incubated for 30 min at 37°C in a 30 ml Corex tube. Next the phage was precipitated with an equal volume of 20% PEG (MW 8,000) and 2 M NaCI
in lambda diluent, and incubated at 0°C for 1 hour, followed by centrifugation at 10,000 x g for 20 min at 4°C. The supernatant was aspirated off and the tube was drained for 5 min to remove the PEG solution. The pellet was gently resuspended in 2.0 ml of lambda diluent, centrifuged at 14,000 rpm in a microfuge for 2 min to remove the cell debris, and stored at 4°C until further A lambda ZAP II cDNA library from ripe tomato (cv. Rutgers) fruit ( gift
from Avtar K. Handa, Purdue University) containing 3.9 x 1010 phage particles
m l1 was screened for NADP+-malic enzyme cDNA as follows: samples with
60,000 recombinant phages were mixed with 500 / strain XL-1, incubated and plated as described elsewhere. A total of 6 plates were prepared to be probed as described in the lambda gt 11 screening, but using a 1.5 Kbp malic enzyme cDNA clone isolated from the lambda gt 11 cDNA library as probe. The pre-hybridization and hybridization were done as described in the lambda gt 11 screening, except that the hybridization was done at 65°C and the filter washing was done in 0.1 x SSC at 55°C for 30 min. A total of 8 lambda ZAP II recombinants were isolated after two sequential screenings. The excision of the recombinant cDNA was done as follows: 200 ^l of lambda ZAP II recombinant phage containing 1.0 x 105 particles was mixed with 200 /u\ of E. coli strain XL-1 (O.D.600=1 .0) and 1 p\ of VCS M13 helper phage with 1x10® particles ml'1. The mixture was incubated at 37°C for 15 min, mixed with 3.0 ml of 2 x YT media and incubated for 2.5 hours at 37°C with shaking. Next, the mixture was heated at 70°C for 20 min, and then the cell debris was spun down at 4,000 x g for 5 min. A portion (50 ^l) of supernatant containing the pBluescript phagemig packaged as filamentous phage particle was mixed with 200 of E. coli strain XL-1 cells (O.D.coo=1.0) and incubated at 37°C for 15 min. Then a 100 //I sample was plated on LB media with 100 /ig m l1 of ampicillin and incubated overnight at 37°C. Colonies 107 on the plate which contained the pBluescript double stranded phagemig with the cloned cDNA were transferred to 2.0 ml of TB media with 100 fig ml'1 of ampicillin and grown overnight at 37°C with shaking. Next the plasmids were isolated, digested with restriction enzymes and submitted to Southern hybridization analysis as described elsewhere. Lambda DNA purification The recombinant lambda phage gt 11 was purified as described by Sambrook et at. (1989). A 2.0 ml recombinant lambda phage solution was layered on the top of a CsCI step gradient in 10 ml centrifuge tubes as follows: at the tube bottom, 1.0 ml of 62.5% CsCI (// = 1.3996) in lambda diluent; next 2.0 ml of 41.67% CsCI; 2.0 ml of 31.25% CsCI and finally a 2.0 ml top layer of 20.83% CsCI. The phage solution was centrifuged at 82,400 x g in a swing-out rotor Sorvall TH-641 for 2 hours at 20°C. The purified phage was removed from the 41.67%/31.25% CsCI interface with a Pasteur pipet, and then the final volume was made to 2.0 ml with ddHaO. To the phage solution was added 40 fit of 0.5 M EDTA (pH 8.0), 50 fi\ of 20% SDS and 20 fi I of 5 mg m l1 Proteinase K, followed by incubation at 65°C for 15 min. The phage DNA was then sequentially extracted with an equal volume of 0.1 M Tris-HCI (pH 8.0) saturated phenol, phenol/chloroform and chloroform. The aqueous phase was transferred to a 15 ml Corex tube, mixed with 200 fi\ of 7.5 M NH4OAc (pH 5.7) and 5.0 ml of -20°C 95% ethanol and incubated at -20°C for 30 min to 108 precipitate the DNA; the mixture was centrifuged at 13,200 x g in a swing out rotor for 30 min. The pellet was washed with 1.0 ml of -20°C 70% ethanol, air dried and resuspended in 200 of TE buffer. Southern hybridization analysis Recombinant lambda DNA phage (20 ^g) was digested with 50 U of Eco Rl at 37°C for 2 hours to release the tomato fruit cDNA insert. The digestion product was loaded in a 0.8% agarose TBE buffer gel and electrophoresed at 50 V. Next, the gel was soaked in 500 ml of 0.25 M HCI for 15 min, rinsed with dH20, soaked twice for 15 min with 500 ml of 0.4 N NaOH and 0.6 M NaCI, and rinsed again with dHaO; finally the gel was soaked in 0.5 M Tris-HCI (pH 7.5) and 1.5 M NaCI for 30 min. The DNA fragments were transferred from the gel to a Hybond filter by the Southern method for 20 hours with 10x SSC as described by Southern (1975). Then the filter was rinsed with 2 x SSC to remove the excess of agarose, dried at room temperature for 2 hours on Whatman 3MM paper, and then exposed to UV light for 1 min. The filter was pre-hybridized in 5x SSC, 10x Denhardt’s solution and 0.5% SDS at 65°C for 6 hours. For the heterologous probe the filter was hybridized with 1.0 x 10® cpm m l1 of DNA probe and 50 /ug m l1 of salmon sperm DNA in 5x SSC, 10x Denhart’s solution, 0.5% SDS and 10% dextran sulfate at 50°C for overnight. Before hybridization the probe and the salmon sperm DNA mixture were denatured at 95°C for 10 min. The filter was washed 3 times with 2 x SSC at 109 room temperature for 5 min, followed by washing with pre-warmed 2x SSC and 1% SDS at 50°C for 30 min. For the homologous probe the filter hybridization was done as described above, but the temperature of hybridization was 65°C, filters were washed 3 times with 2x SSC for 5 min at room temperature and then 1 hour in pre-warmed 2x SSC and 1% SDS at 65°C; finally the filter was washed for 1 hour in pre-warmed 0.1 x SSC at 50°C. All filters were briefly dried on Whatman 3MM paper, followed by exposure to X-ray film (X-OMAT AR5, Kodak) for 2 hours at -70°C. Subcloning of lambda gt 11 cDNA inserts A total of five tomato fruit cDNAs cloned in lambda phage were Eco Rl digested to release the insert and subcloned in Bluescript(-t-) plasmid as follows: 20 ^g of lambda DNA and Bluescript(+) plasmid were treated with 50 U of Eco Rl for 2 hours at 37°C. The digested products were loaded on a 0.8% low melt agarose TAE buffer and run at 50 V for 2 hours. The agarose containing the lambda cDNA clones and the linear Bluescript(+) plasmid were removed from the whole gel with a razor blade, followed by purification with Geneclean II® Kit, finally the purified products were resuspended in 20jt\ of TE buffer. A 100 ng sample of tomato fruit cDNAs and linear Bluescript{+) were ligated with 2 U of T4 DNA Ligase in a 20 /il reaction mixture for 12 hours at 14°C. Next the E. coli strain JM 109 was PEG transformed with the ligated 110 plasmid product, as described by Chung etal. (1989). Transformed cells were plated on X-Gal plates containing 100 pg m l1 of ampicillin and incubated for 15 hours at 37°C. The white colonies were selected with a toothpick and grown for 12 hours at 37°C in liquid TB buffer with 100 fig ml’1 of ampicillin. The plasmid was isolated as described by Sambrook et al. (1989) for further restriction enzyme analysis. Isolation of tomato leaf DNA A 1.0 g sample of fresh leaf tissue was ground into a powder in liquid nitrogen in a chilled mortar and pestle. The powder was added to 7.5 ml of pre-heated isolation buffer: 2% (w/v) cetyltrimethylammonium bromide, 1.4 M NaCI, 0.2% (v/v) 2-mercaptoethanol, 20 mM EDTA and 100 mM Tris-HCI (pH 8.0) in a 30 ml Corex centrifuge tube at 60°C, as described by Doyle and Doyle (1990). The slurry was incubated for 30 min at 60°C in a water bath with occasional gentle swirling. The DNA was extracted twice with chloroform- isoamyl alcohol (24:1; v/v) and centrifuged at 1,600 x g in a swinging bucket rotor at room temperature for 5 min. The aqueous phase was transferred to a clean Corex tube and gently mixed with 2/3 volumes of cold isopropanol to precipitate the nucleic acids. After 10 min of incubation at room temperature, the DNA was collected by centrifugation at 500 x g for 2 min at 4°C. The pellet was washed with 5.0 ml of cold washing buffer (76%, v/v ethanol and 10 mM ammonium acetate, pH 7.7), and then centrifuged at 1,600 x g for 10 min. The 111 pellet was air dried, followed by resuspension in 1.0 ml of TE buffer. The RNA was digested by addition of 10 ml'1 of RNase A for 30 min at 37°C. The sample was diluted with one volume of TE buffer, and the DNA was extracted once with an equal volume of 0.1 M Tris-HCI (pH 8.0) saturated phenol, once with phenol:chloroform and twice with chloroform. DNA was precipitated by addition of 1/3 volume of 7.5 M ammonium acetate (pH 7.7) and 2.5 volumes of cold 95% ethanol. After incubation on ice for 15 min, the DNA was pelleted by centrifugation at 10,000 x g for 10 min at 4°C in a swing-out rotor. The pellet was washed with 1.0 ml of cold 70% ethanol, air dried and finally resuspended in 500 p\ of TE buffer. The absorbance of the DNA was measured at 280 and 260 nm in a Shimadzu UV 160U spectrophotometer. A good preparation showed A2 DNA sequencing Isolated cDNAs were sequenced by the dideoxy chain termination method described by Sanger etal. (1977). The dideoxy sequencing was done using the Sequenase 2.0 Kit (United States Biochemical Corp., Cleveland, OH 44122) or by the AmpliTaq® DNA polymerase Kit (Perkin Elmer Cetus Corp., Norwalk, CT 06859). The template preparation for DNA sequencing using the AmpliTaq® DNA polymerase Kit was performed as follows: a 200 ng DNA sample of Bluescript (+) plasmid - malic enzyme cDNA clone was used as a template for the 112 sequencing reactions, The sequencing reactions were done in a thermal cycler as recommended by the company, using two dye primers, the -21 M13 and the M13 reverse which hybridize with the vector arms. The DNA products were loaded in a 6% polyacrylamide gel in a Applied Biosystem Model 370A/373A DNA Sequencing System at the University Biochemical Instrument Center for separation of DNA fragments and sequence reading. Template DNA preparation for sequencing with the Sequenase 2.0 Kit was done as described by Kraft et at. (1988). A 12 /i\ sample containing 10//g of Bluescript(+) plasmid - DNA template was mixed with 2 pi of fresh 2 N NaOH and 2 mM EDTA, vortexed and kept at room temperature for 5 min. Next 8 n\ of cold 1 N Tris-HCI (pH 4.5) was added and mixed by vortex, and followed by addition of 3 fi I of cold 3 M NaOAc which was again vortexed. The DNA was precipitated by addition of 2.5 volumes of 95% ethanol at -20°C, incubated at -20°C for 20 min and centrifuged at 14,000 rpm for 10 min in a microfuge. The supernatant was removed and the pellet washed with 500 fi\ of 70% ethanol at -20°C. After centrifugation at 14,000 rpm for 2 min in a microfuge, the supernatant was aspirated, the pellet was vacuum dried, and finally resuspended in 14 /*l of ddHaO. A 7 pi\ aliquot was used for the DNA sequencing reaction. The DNA was primed by addition of 0.5 pmole of sense or anti-sense 17 base pair primers, synthesized by Operon (Operon Technologies Inc., Alameda, CA 94501). The primer sequence was based on the already known sequence of the DNA fragment. The DNA was labeled with 113 “ S-dATP added to the reaction mixture following the recommendations of the Sequenase 2.0 Kit. The reaction products were denatured at 95°C for 5 min, and then applied to a 35 x 43 cm slab of 6% acrylamide, 0.3% bis-acrylamide, 6 M urea and 0.9 x TBE buffer for denaturating polyacrylamide gel. Before applying the DNA samples, the gel was pre-run for 1 hour at 40 W at constant power. The denatured DNA samples were loaded twice with 4 hour run intervals. After electrophoresis, the gel was soaked in 10% HOAc and 10% methanol for 30 min to fix the DNA. Then, the gel was transferred to a Watman 3MM filter and dried at 80°C for 4 hours under vacuum. Finally the gel was exposed to X-ray film (X-OMAT AR5, Kodak) for 2 days at room temperature. RESULTS AND DISCUSSION Figure 3.1 presents a Northern hybridization of the total RNA isolated from tomato fruit pericarp, tomato leaves, and corn leaves. At low stringency, as described elsewhere, the 1.3 kb com malic enzyme cDNA probe showed positive hybridization signal with RNA with a size of = 2.1 Kb when compared with the migration of the tomato ribosomal RNAs. The = 2.1 Kb mRNA which may code for malic enzyme, was expressed at all stages of tomato fruit development analyzed, as well as in tomato leaves (Fig. 3.1). The results indicate that there is a significant degree of homology between the corn and tomato malic enzyme open reading frame base sequence. This is consistent 114 12 3 4 5 6 Figure 3.1. Northern hybridization analysis of NADP+-malic enzyme transcripts from total RNA of breaker (Lane 1), mature-green (Lane 2), ripe (Lane 3), immature-green tomato fruit (Lane 4), tomato leaves (Lane 5) and corn leaves (Lane 6). Probe: 1.3 Kbp corn cDNA NADP+-malic enzyme. 115 with the existence of highly conserved regions for genes for tomato and corn malic enzyme. Based on Northern hybridization analysis, Rajeevan etal. (1989) suggested that the malic enzyme DNA coding region from monocots and dicots have highly conserved regions. The results of Figure 3.1 suggest that the corn cDNA clone could be used as a probe to screen a tomato fruit library for isolation of a malic enzyme cDNA clone. Southern hybridization analysis of five lambda gt 11 recombinant cDNA clones isolated in a primary screen from a tomato fruit library showed that four clones hybridized with the corn cDNA probe (Fig. 3.2). Two clones exhibited a size o f« 1.2 Kbp (ME-1) and two = 1.5 Kbp (ME-2); however, another clone with a size of ~ 2.0 Kbp did not show any hybridization signal in the blot (Fig. 3.2). Restriction endonuclease analysis of the four clones showed that ME-1 was a partial cDNA from the ME-2 (data not shown). The clone ME-2 was used for further analysis, such as restriction enzyme sites, base pair sequence and Northern hybridization analysis. It is well known that fruit ripening is characterized by the expression of new messenger RNAs. The expression of ripening-related mRNAs include those which are absent or at a low level in immature fruits, such as mRNAs that code for some enzymes involved in pigment and ethylene biosynthesis, and cell wall degradation (Gray et al., 1992). Several authors have shown that polygalacturonase mRNA begins to accumulate at the onset of tomato fruit ripening (Biggs and Handa, 1989; DellaPenna ef a/., 1986). Figure 3.3 shows 116 1 2 3 4 5 6 1.3 Kbp—•> Figure 3.2. Southern hybridization analysis of tomato fruit NADP+-malic enzyme cDNAs isolated from lambda gt 11 recombinant phages (Lanes 2, 3, 4, 5 and 6). Probe: 1.3 Kbp corn NADP+-malic enzyme cDNA (Lane 1). 117 1 2 3 4 5 6 2.1 Kb— W W + W Figure 3.3. Northern hybridization analysis of NADP+-malic enzyme transcripts from total RNA of immature-green {Lane 1), mature-green (Lane 2), breaker (Lane 3), ripe tomato fruit (Lane 4), tomato leaves (Lane 5) and corn leaves (Lane 6). Probe: ME-2 (1.5 Kbp) tomato fruit NADP+-malioc enzyme cDNA. a Northern hybridization analysis of the total RNA isolated from tomato fruit pericarp, tomato and corn leaves using the ME-2 DNA as probe. At high stringency there is no hybridization signal with any mRNA from corn leaves (Fig. 3.3). This result indicates that the homology of base pairs between the two open reading frames is not complete, although it was high enough to isolate a NADP+-malic enzyme cDNA clone from the lambda gt 11 tomato library. The ME-2 cDNA probe hybridized with a » 2.1 Kb mRNA in tomato fruit and tomato leaves. Hybridization to RNA at a similar molecular weight was found when the corn DNA was used as a probe (Fig. 3.1 and 3.3). The « 2.1 Kb mRNA was present in all stages of tomato fruit development with a more intense hybridization signal at the mature-green and breaker stages (Fig 3.3), indicating that malic enzyme gene expression was higher at these stages of fruit development. These results are consistent with the specific activity of malic enzyme observed in the outer pericarp and inner tissues of tomato fruit (Chapter I). The data imply that malic enzyme gene expression in tomato fruit is not ripening-related and that regulation could be mainly at the transcriptional level. Preliminary sequencing of the ME-2 clone showed that the cDNA was incomplete. The 1.3 Kbp corn malic enzyme probe contains = 2/3 of the full length cDNA, from a internal Eco Rl site to the 3’ end of the full length cDNA clone (Rothermel and Nelson, 1989). The 5’ end of the ~ 1.5 Kbp ME-2 cDNA clone starts at an Eco Rl site, which might correspond to the restriction site 119 used to clone the cDNA or to an internal Eco Rl site. Comparing the nucleotide sequence of the 5’ end of ME-2 cDNA clone with the nucleotide sequence of maize, Flaveria trinervia, F. linearis, Phaseolus vulgaris and mouse (Rajeevan etal., 1991), ME-2 is an incomplete form of the full length malic enzyme cDNA gene. It seems to be missing « 700 bp from the 5’ end of the open reading frame. The ME-2 tomato fruit malic enzyme cDNA was used as a probe to screen a lambda ZAP II cDNA library from ripe tomato fruit. Five cDNA clones were isolated from the lambda ZAP II library. Restriction enzyme analysis showed that at least three of the five clones were not identical (data not shown). Figure 3.4 shows a Southern hybridization analysis of the isolated cDNAs. When the isolated cDNAs were digested with the restriction endonucleases Kpn I and Ssf I (located at the multiple cloning site of pBluescript), there was a strong hybridization signal with cDNAs at a size » 2.0 Kbp (Fig. 3.4 - Lanes 1,2,8 and 9). A complete base pair sequence of ME-3 (Fig. 3.4 - Lanes 1 and 2) and ME-4 (Fig. 3.4 -Lanes 8 and 9) showed that ME- 3 was an incomplete form of ME-4. The nucleotide sequence and deduced amino acid composition of ME-4 cDNA, encoding tomato fruit malic enzyme, is shown in Figure 3.5. Comparing the open reading frame base sequence of ME-4 with already published full length malic enzyme cDNA sequences, ME-4 has an open reading frame of 1707 base pairs. The 5' end of the ME-4 cDNA open reading frame seems to start with the codon ACG for Ser and ends (3’ 120 12345678910 — 1.5 Kbp Figure 3.4. Southern hybridization analysis of tomato fruit NADP+-malic enzyme cDNAs isolated from lambda ZAP II recombinant phages (Lanes 1, 2, 3, 4, 5, 6, 7, 8 and 9). Probe: ME-2 (1.5 Kpb) tomato fruit NADP+-malic enzyme cDNA (Lane 10). 121 Ser Thr Val 1 GAATTCGGCACGAGTCTACTGTT Thr Gly Gly Val Gin Asp Val Tyr Gly Glu 24 ACTGGTGGAGTTCAAGACGTTTATGGTGAG Asp Ser Ala Thr Glu Asp Gin Ser lie Thr 54 G ATAGTGCC ACAGAAG ATCAATCCATC AC A Pro Trp Thr Leu Ser Val Ala Ser Gly Phe 94 CCTTGGACCTTATCTGTTGCTAGTGGTTTC Ser Leu Leu Arg Asn Pro His Tyr Asn Lys 124 TCATTGTTGCGTAACCCACACTACAATAAG Gly Leu Ala Phe Ser Glu Arg Glu Arg Asp 154 GGCCTTGCTTTCTCTGAGAGAGAGAGAGAC Thr His Tyr Leu Arg Gly Leu Leu Pro Pro 184 ACCCACTATTTGCGTGGTCTTCTTCCTCCA Val Val lie SerHis Asp Leu Gin Val Lys 214 GTCGTAATTAGTCATGACCTTCAGGTCAAG Lys Met Met Asn Ser lie Arg Lys Tyr Asp 244 AAAATGATGAACAGCATCCGTAAGTATGAT Val Pro Leu Gin Arg Tyr Met Ala Met Met 274 GTACCACTTCAAAGATACATGGCCATGATG Asp Leu Gin Glu Met Asn Glu Arg Leu Phe 304 GATCTTC AGGAAATGAATG AGCGGCTATTC Tyr Lys Leu Leu lie Asp Asn Val Glu Glu 334 TAC AAGCTTCTTATTGACAATGTTGAGGAG Leu Leu Pro lie Val Tyr Thr Pro Thr Val 364 CTTCTTCCG AT AGTTT AC ACTCC AACTGTT Gly Glu Ala Cys Gin Lys Tyr Gly Trp lie 394 GGTGAAGCATGCCAGAAATATGGTTGGATC Figure 3.5. Nucleotide sequence of ME-4 cDNA encoding tomato fruit NADP+-maJic enzyme. The amino acid sequence was deduced from a single open reading frame. Figure 3.5. (continued) Phe Lys Arg Pro Gin Gly Leu Phe Phe Ser 424 TTTAAGCGTCCTCAAGGTCTTTTTTTCAGC Leu Lys Glu Lys Gly Lys lie His Glu Val 454 TTG AAAGAAAAAGGCAAAATTCACG AGGTG Leu Lys Asn Trp Pro Glu Lys Lys lie Gin 484 TTAAAAAATTGGCCCG AG AAG AAAATTCAA Val lie Val Val Thr Asp Gly Glu Arg lie 514 GTTATTGTTGTTACTGATGGAGAACGAATT Leu Gly Leu Gly Asp Leu Gly Cys Gin Gly 544 CTGGGCCTTGGGGACCTTGGTTGCCAGGGA Met Gly lie Pro Val Gly Lys Leu Ser Leu 574 ATGGGGATACCAGTGGGCAAGCTCTCTTTA Tyr Ser Ala Leu Gly Gly lie Arg Pro Ser 604 TACTCTGCTCTGGGAGGCATTCGTCCTTCA Ala Cys Leu Pro Val Thr lie Asp Val Gly 634 GCTTGTTTGCCCGTTACCATTGATGTGGGA Gin Thr Met Lys Phe Val Asp Asp Glu Phe 664 CAAAC AATG AAATTTGTTGACG ATGAATTC Tyr lie Gly Leu Arg Gin Arg Arg Ala Thr 694 TACATTGGACTCAGGCAAAGAAGAGCTACC Gly Gin Glu Tyr Ser Glu Leu Leu Asp Glu 724 GGACAGGAATATTCTGAACTTTTAGATGAA Phe Met Tyr Ala Val Lys Gin Asn Tyr Gly 754 TTTATGTATGCCGTCAAGCAGAATTATGGG Glu Lys Val Leu lie Gin Phe Glu Asp Phe 784 GAGAAAGTGCTCATTCAGTTTGAAGACTTT Ala Asn His Asn Ala Phe Asn Leu Leu Ala 814 GCAAATCATAATGCATTTAACCTCCTTGCA Lys Tyr Gly ThrSer His Leu Val Phe Asn 844 AAGTATGGAACTAGCC ACCTTGTTTTC AAT Asp Asp lie Gin Gly ThrAla Ser Val Val 874 GATGACATACAGGGGACAGCATCCGTGGTC Figure 3.5. (continued) Leu Ala Gly Leu Met Ala Ala Leu Asn Leu 904 CTTGCTGGGCTG ATGGCCGCATTAAACTTG Val Gly Gly Ser Leu Ser Glu His Thr Phe 934 GTTGGAGGAAGCTTGTCTGAACATACATTC Leu Phe Leu Gly Ala Gly Glu Ala Gly Thr 964 TTATTCCTTGGAGC AGGAGAGGCTGGC ACA Gly He Ala Glu Leu He Ala Leu Glu Met 994 GGTATAGCTGAACTCATAGCTCTTGAGATG Ser Lys Gin Thr Gly lie Pro Leu Glu Glu 1024 TCAAAGCAGACTGGAATCCCTCTAGAAGAG Thr Arg Lys Lys lie Trp Met Val Asp Ser 1054 ACTCGCAAGAAAATTTGGATGGTGGATTCT Lys Gly Leu lie Val Lys Ser Arg Met Glu 1084 AAGGGGCTAATTGTTAAGTCTCGCATGGAG Met Leu Gin His Phe Lys Arg Pro Trp Ala 1114 ATGCTTCAACATTTCAAGAGGCCCTGGGCA His Asp His Glu Pro Val Gin Glu Leu Val 1144 CATGACCACGAACCAGTACAAGAACTAGTG Asn Ala Val Lys Ser He Lys Pro Thr Val 1174 AATGCCGTGAAGTCAATTAAGCCTACGGTC Leu lie Gly Ser Ser Gly Ala Gly Arg Thr 1204 TTGATTGGTTCTTCTGGAGCTGGGAGAACG Phe Thr Lys Glu Val Val Gin Ala Met Ala 1234 TTTACTAAAGAAGTTGTACAAGCTATGGCA Thr Phe Asn GluLys Pro He He Phe Ala 1264 ACCTTCAATGAGAAACCAATTATTTTTGCC Leu Ser Asn Pro Thr Ser Gin Ser Glu Cys 1294 CTCTCCAATCCAACATCACAGTCTGAATGT Thr Ala Glu Glu Ala Tyr Ser Trp Ser Glu 1324 ACTGCTGAGGAGGCTTATAGCTGGAGTGAG Gly Arg Ala He Phe Ala Ser Gly Ser Pro 1354 GGGCGAGCCATTTTTGCTAGTGGGAGTCCA Figure 3.5. (continued) Phe Ala Pro Val Glu Tyr Asn Gly Lys Val 1364 TTTGCTCCAGTTGAGTACAATGGGAAGGTC Tyr Ala Ser Gly Gin Ala Asn Asn Ala Tyr 1414 TATGCGTCTGGCCAGGCAAATAATGCATAT lie Phe Pro Gly Phe Gly Leu Gly Leu lie 1444 ATTTTCCCTGGGTTTGGTCTAGGACTGATA lie Ser Gly Ala lie Arg Val His Asp Asp 1474 ATCTCTGGTGCAATTCGTGTCCACGATGAC Met Leu Leu Val Ala Ser Glu Ala Leu Ala 1504 ATGCTCCTGGTAGCCTCGGAAGCTTTAGCG Asp Glu Val Ser Gin Glu Asn Phe Glu Lys 1534 GACGAAGTTTCTCAAGAGAACTTTGAAAAA Gly Thr His lie Pro Pro Phe Ser Asn lie 1564 GGGACTCATATCCCGCCATTTTCCAACATA Arg Lys lie Ser Ala His lie Ala Lys Val 1594 AGAAAGATTTCAGCGCATATTGCAAAGGTG Ala Ala Lys Ala Tyr Glu Leu Gly Leu Ala 1624 GCAGCTAAAGCATATGAATTAGGTTTGGCC Thr Arg Leu Pro Gin Pro Lys Asp Leu Val 1654 ACTCGTCTACCGCAGCCCAAGGACCTAGTC Ala Tyr Ala Glu Ser Cys Met Tyr Ser Pro 1684 GCATATGCAGAGAGCTGCATGTACAGCCCA Ala Tyr Arg Ser Tyr Arg *** 1714 GCATACCGCAGCTATCGTTGAGTCAGAGAA 1744 GATATTGTTGCTTCAAAATTAGTCACTGTT 1774 CCTTCCAGTGTTAGTTAGTTATTGATGTCA 1804 TTCCTTTCTCCTTTTAGTTGGTTTGCTCTT 1834 AAAATTT AAGAAAAT ACGGT AGCTTGCAGA 1864 TATGGTGTACTCGTGAAATATTTGATTATG 1894 TTAAGAGTTAAATGTAGGGAACTTTGCAGC 125 Figure 3.5. (continued) 1924 ATCAAAAAAAAAAAAAAAAAACTCGAG 1950 end) with the stop codon TGA (Fig. 3.5). The open reading frame of the ME-4 cDNA codes for 569 amino acids and the 3’ end is an 18 base pair poly A tail, adjacent to the cloning site (Fig. 3.5). NADP+-Malic enzyme cDNA has been isolated from several plant species either in the C3, C4 or C3-C4 photosynthetic types. Full length malic enzyme cDNAs have been isolated from maize (Rothermel and Nelson, 1989), Flaveria trinervia (Borsch and Westhoff, 1990), Phaseolus vulgaris (Walter eta!., 1988; Walter ef a/., 1990) and Populus (van Doorsselaere ef at., 1991). The open reading frame of the maize (C4 plant) and Flaveria trinervia (C4 plant) cDNAs is over 1908 bp, giving a protein with molecular weight over 69-KDa (Rothermel and Nelson, 1989; Borsch and Westhoff, 1990). However, the precursor malic enzyme polypeptide contains a transit peptide that is removed into the chloroplast stroma, giving a final product of molecular weight of ~ 61-KDa. On the other hand, in the C3 plants Phaseolus vulgaris and Populus, the open reading frame of malic enzyme cDNA has 1767 bp, coding for a protein with molecular weight of 65-KDa (Walter ef a i, 1988; Walter ef a/., 1990; van Doorsselaere ef a/., 1991). In addition, the malic enzyme polypeptides in C3 plants do not have an apparent transit sequence for translocation into the chloroplasts, suggesting that malic enzyme in those plants is located in the cytosol (van Doorsselaere ef a/., 1991). Partial cDNA malic enzyme clones were isolated from Flaveria linearis (C3-C4 plant) and tomato (C3 plant) (Rajeevan eta!., 1991; Franke and Adams, 1993). In both cases, it seems to be missing between 600 to 700 bp from the 5’ end 127 of the open reading frame. The ME-4 malic enzyme tomato cDNA was 1950 bp long; comparing the nucleotide sequence and the amino acid identity of ME-4 with the sequence of other C3 plants Phaseolus vulgaris and Populus, it seems that it is lacking « 60 bp from the 5' end of the ME-4 open reading frame (Fig. 3.5). Reverse transcriptase is the enzyme used for conversion of mRNA into cDNA for the purpose of constructing libraries. The enzyme has two functions in vitro, a polymerase activity and an associated ribonuclease (RNase H) activity. During the synthesis of the first-strand cDNA by the polymerase activity of reverse transcriptase, the RNase H activity acts as exonuclease that degrades RNA, producing oligomers of 2 to 30 bases in size; this RNase H activity reduces the chances to obtain full length cDNAs (Krug and Berger, 1987). Thus it seems plausible to speculate that both the lambda gt 11 and the lambda ZAP II libraries may not contain a full length malic enzyme cDNA because of early termination of the polymerase activity of reverse transcriptase during library construction. Despite the fact that the ME-4 clone does not code for the 20 first amino acids from the protein amino terminus, it would be suitable for construction of an antisense gene to under-express malic enzyme in transgenic tomato plants. A DNA fragment with 200 to 400 base pairs from the 5' end of ME-4 could be used to make an antisense construct. 128 Figure 3.6 is a diagrammatic representation of the ME-4 cDNA clone and nucleotide sequencing strategy; showing the Eco Rl and Sst I cloning sites, the internal Eco Rl and Hind III restriction sites, stop codon of the open reading frame, poly A tail, and the NADP+ binding site. The ME-2 cDNA clone starts (5’ end) at the internal Eco Rl restriction site (base pair #688) and ends in a 11 bp poly A tail (not shown). The cDNA clones ME-2 and ME-4 showed 100% nucleotide homology at the open reading frame (not shown). The dinucleotide binding site of tomato malic enzyme cDNA is a 30 bp long DNA fragment that starts at base 973 and ends at base 1002 (Fig. 3.5 and 3.6); this fragment codes for the amino acids 5’-Gly-Ala-Gly-Glu-Ala-Gly-Thr- Gly-lle-Ala-3’. The NADP+ binding site showed 100% amino acid identity with maize, Flaveria linearis, F. trinervia, Phaseolus vulgaris and Populus NADP+- malic enzyme dinucleotide sites (Rajeevan ef a/., 1991; van Doorsselaere ef al., 1991). However, the homology of the nucleotide sequence for the NADP+ binding site ranged from 78% for maize and Populus to 83% for Flaveria linearis and F. trinervia. Comparison of the nucleotide sequence of the NADP+ binding sites among tomato and the above mentioned species showed that the codons are very similar with silent substitutions, usually at the third base of the codon. A comparison of sequences of cDNAs encoding NADP+-malic enzyme from different sources and ME-4 from tomato fruit is shown in Table 3.1. Considerable homology exists between the ME-4 clone and the cDNAs coding for malic enzyme in other plants: the nucleotide homology ranged from 72% NADP binding stop codon site ORF Poly A TJ o o o .c lii £ UJ 1 h 5* 3* 539 688 1523 1950 h P5 ► P3 P2 P6 P4 P1 Oligonucleotide primers used for sequencing: P1 5’-GGAGAGAGGAATGACATC P2 5’-GGAGGCTTATAGCTGGAG P3 S’-TTCCTGTCCGGTAGCTC P4 5’-GAGGACGGCTGAAGATGC P6 5'-CCAACTGTTGGTGAAGC P6 5’-GGAGGAAGAAGACCACGC Primers -21 M13 and M13 of pBluescript arms Figure 3.6. Diagrammatic representation of the ME-4 tomato fruit cDNA clone, showing the restriction cloning sites, internal Eco Rl and Hind III sites, and sequence strategy. The horizontal arrows indicate the direction of dideoxy sequencing and length sequenced. t Table 3.1. Comparison of nucleotide sequences between ME-4 (cDNA encoding tomato fruit NADP+-malic enzyme) and the sequences of malic enzyme cDNAs from other sources. Sources Nucleotide Amino acid (% similarity) (% identity) Tomato vs.Populus * 79 83 Tomato vs.Flaveria Irinerviab 79 84 Tomato vs.Flaveria linearisc 78 84 Tomato vs. maize*1 77 80 Tomato vs.Phaseolus vulgaris* 72 75 Tomato vs. mouse1 64 40 Van Doorsselaere efal. (1991) bBorsch and Westhoff (1990) cRajeevan ef af. (1991) dRothermal and Nelson (1989) Walter efaf. (1988); Walter efal. (1990) 'Bagchi efaf. (1987) 130 131 for Phaseolus vulgaris to 79% for Populus and Flaveria trinervia (Table 3.1). In addition, the corresponding amino acid similarities showed a high identity ranging from 75% for Phaseolus vulgaris to 84% for Flaveria trinervia and F. linearis (Table 3.1). Thus the tomato malic enzyme cDNA coding sequence showed high nucleotide homology and amino acid identity with malic enzyme cDNAs from C3 plants (Populus and Phaseolus vulgaris), a C3-C4 plant (Flaveria linearis) and C4 plants (corn and Flaveria trinervia). Figure 3.7 shows the nucleotide and amino acid sequence of the 5' end for NADP+-malic enzyme open reading frames from the C3 plants Populus, Phaseolus vulgaris and tomato. The first 20 amino acids from the protein amino terminus showed an amino acid identity of only 20% between Populus and Phaseolus vulgaris cDNAs (Fig. 3.7). Franke and Adams (1993) found the translation initiation codon ATG for tomato NADP+-malic enzyme by sequencing a genomic clone. The amino acid identity between the first 20 amino acids from tomato malic enzyme and Phaseolus vulgaris is 20%, while for tomato and Populus it is 25% (Fig. 3.7). Based on the data, the first 20 amino acids of malic enzyme do not show a conservative domain; however, it should be pointed out that the amino acid sequence found by Franke and Adams (1993) could be misread since they sequenced a genomic clone in which it may be difficult to identify the beginning and end of an exon. The base pair sequence published by Franke and Adams (1993) did not show any homology with ME-4 tomato fruit cDNA clone in the available overlapping Met Glu Ser Thr Leu Lys Glu Met Arg Asp Gly Ala Ser Val Leu Asp Met Asp Pro Lys Populus* S’-ATG GAG AGC ACG CTG AAG GAG ATG AGA GAC GGA GCT TCG GTG CTC GAC ATG GAC CCC AAA Phaseolus Met Ser Ser lie Ser Leu Lys Glu Asn Gly Gly Glu Val Ser Val Lys Lys Asp Tyr Ser vulgaris* 5’-ATG TCG AGC ATT TCC TTG AAG GAG AAC GGT GGT GAG GTT TCT GTG AAG AAG GAT TAT AGC Met Glu Ser Ala Leu Lys Asp Leu Ser Thr Pro Thr Gly Gly Val Glu Asp Val Tyr Gly Tomato0 5’-ATG GAG AGC GCA TTG AAG GAT CTG TCA ACT CCC ACC GGT GGC GTC GAG GAT GTT TAC GGT Ser Thr Val Gly Gly Gly Val Populus TCC ACT GTC GGT GGT GGT GTT-3’ Phaseolusten Gly Gly Gly Val Arg Asp vulgaris AAT GGT GGG GGT GTG AGG GAC-3' Glu Asp Cys Ala Thr Gly Asp Tomato GAG GAT TGC GCC ACT GAG GAT-3’ Ser Thr Val Thr Gly Gly Val ME-4 TCT ACT GTT ACT GGT GGA GTT-3’ * van Doorsselaereet al. (1991); b Walteret al. (1988), Walteret al. (1990); 0 Franke and Adams (1993) Figure 3.7. Nucleotide sequence and amino acid composition of NADP+-malic enzyme amino terminus in C3 plants. 133 stretch from the base number 60 to 81, but the ME-4 tomato clone showed nucleotide homology of 76% and amino acid identity of 86% with the Populus sequence (Fig. 3.7). Although the 20 first amino acids from the amino terminal of tomato malic enzyme protein is currently unavailable, an oligonucleotide could be synthesized based on the sequence published by Franke and Adams (1993). This oligonucleotide could be ligated to the 5' end of ME-4 cDNA clone, and the construct could be used to produce transgenic tomato plants which over express the enzyme. However, the validity of this approach depends on confirmation of the 5’ end sequence. Figure 3.8 shows a Southern hybridization analysis of genomic DNA from tomato digested with different restriction endonucleases and probed with the ME-2 tomato fruit clone. Digestion of genomic DNA with Hind III and Eco Rl produced two persistent bands for each restriction enzyme (Fig 3.8). Based on the data from the Southern blot, the gene encoding NADP+-malic enzyme seems to be present at low copy number in the tomato genome. Rajeevan et al. (1991) reached a similar conclusion from a genomic hybridization analysis of malic enzyme in Flaveria trinervia, F. linearis and F. pringlei. Since it was not possible to isolate a full length malic enzyme cDNA, the next step to be followed in this project could be to isolate a genomic clone from a tomato library to confirm the nucleotide sequence found by Franke and Adams (1993) for the missing 5’ end of the open reading frame of ME-4 cDNA. In addition, this would make it possible to isolate the promoter region of the 134 Figure 3.8. Genomic hybridization analysis of tomato NADP+-malic enzyme gene digested with Hind III (Lane 2), Pst I (Lane 3), Bam HI (Lane 4) and Eco Rl (Lane 5) restriction endonucleases. Probe: ME-2 (1.5 Kbp) tomato fruit NADP+-malic enzyme cDNA (Lane 1). 135 malic enzyme gene, which would help to study the factors that affect malic enzyme mRNA transcription, CONCLUSIONS A corn NADP+-malic enzyme cDNA fragment was used as a probe to isolate a corresponding cDNA from a lambda gt 11 library from mature-green tomato fruit. A 1.5 Kbp cDNA clone was isolated and nucleotide sequence analysis showed this to be a partial clone for malic enzyme. A lambda ZAP II cDNA library of ripe tomato fruit was screened with the 1.5 Kbp malic enzyme cDNA and a 1950 bp clone was isolated and identified as coding for malic enzyme. Sequence analysis showed that the cDNA was an incomplete malic enzyme gene. The isolated cDNA clone contains a single open reading frame with 1707 bp. Comparison of the tomato fruit cDNA open reading frame with the nucleotide sequence of malic enzyme in other C3 plants suggests that about 60 base pairs are missing from the 5’ end of the gene. Tomato fruit malic enzyme cDNA showed nucleotide homology ranging from 72% to 79% with similar genes in other plant sources. Northern hybridization analysis showed that the tomato NADP+-malic enzyme is a transcription product of a = 2.1 Kb messenger RNA. The malic enzyme mRNA was present in immature-green, mature-green, breaker and ripe tomato fruits, and also in tomato leaves. The intensity of hybridization showed that malic enzyme mRNA was present in higher amount at the mature-green and breaker stages; this suggests a transcriptional control of malic enzyme gene expression, since the enzyme also showed highest activities at those stages fruit development (Chapter I). Southern blot analysis of genomic tomato DNA showed that NADP+-malic enzyme gene is present at low copy number in the tomato plant genome. 137 LIST OF REFERENCES Bagchi S., Wise L. S., Brown M. L., Bregman D., Sook Sul H. and Rubin C. S. (1987). Structure and expression of murine malic enzyme mRNA. J. Biol. Chem. 262: 1558-1565. Biggs M. S., Harriman W. A. and Handa A. K. (1986). Changes in gene expression during tomato fruit ripening. Plant Physiol. 81: 395-403. Biggs M. S. and Handa A. K. (1989). Temporal regulation of polygalacturonase gene expression in fruit of normal, mutant and heterozygous tomato genotypes. Plant Physiol. 89: 117-125. Borsch D. and Westhoff P. (1990). Primary structure of NADP-dependent malic enzyme in the dicotyledonous C4 plat Flaveria trinervia. FEBS Letters 273: 111-115. Chung C. T., Niemela S. L. and Miller R. H. (1989). One-step preparation of competent Escherichia coli: Transformation and storage of bacterial cells in the same solution. Proc. Natl. Acad. Sci. USA 86: 2172-2175. Davies D. D. (1986). The fine control of cytosolic pH. Physiol. Plant. 67: 702- 706. DellaPenna D., Alexander D. C. and Bennett A. B. (1986). Molecular cloning of tomato fruit polygalacturonase: analysis of polygalacturonase mRNA levels during ripening. Proc. Natl. Acad. Sci. USA 83: 6420-6424. Doyle J. J. and Doyle J. L. (1990). Isolation of plant DNA from fresh tissue. Focus 12: 13-15. Edwards G. E. and Huber S. C. (1981). The C4 pathway. In The biochemistry of plants. A comprehensive treatise. Hatch M. D. and Boardman N. K. (Eds.). Vol, 8 pp 237-281, Academic Press, New York/London. 138 Edwards G. E. and Andreo C. S. (1992). NADP-Malic enzyme from plants. Phytochemistry 31: 1845-1857. Franke K. E. and Adams D. . (1993). N-Terminal amino acid and partial cDNA sequences for tomato malic enzyme (EC 1.1.1.40). Plant Physiol. 102:72 Goodenough P. W., Prosser I. M. and Young K. (1985). NADP-linked malic enzyme and malate metabolism in ageing tomato fruit. Phytochemistry 24: 1157-1162. Gray J., Picton J., Schuch W. and Grierson D. (1992). Molecular biology of fruit ripening its manipulation with antisense genes. Plant Mol. Biol. 19: 69-87. Kraft R., Tardiff J., Krauter K. S. and Leinwand L. A. (1988). Using mini- prep plasmid DNA for sequencing double stranded templates with Sequenase™. BioTechniques 6: 544-547. Krug M. S. and Berger S. L. (1987). First-strand cDNA synthesis primed with oligo (dT). In Methods in enzymology: guide for molecular cloning techniques, Berger S. L. and Kimmel A. R. (Eds.), Vol. 152, pp 316-325. Academic Press, New York/London. Langdale J. A., Rothermel B. A. and Nelson T. (1988). Cellular patern of photosynthetic gene expression in developing maize leaves. Genes & Development 2: 106-115. Magnuson M. A., Morioka H., Tecce M. F. and Nikodem V. M. (1986). Coding nucleotide sequence of rat liver malic enzyme mRNA. J. Biol. Chem. 261: 1183-1186. Pupillo P. and Bossi P. (1979). Two forms of NADP-dependent malic enzyme in expanding maize leaves. Planta 144: 283-289. Rajeevan M. S., Bassett C. L. and Hughes W. (1991). Isolation and characterization of cDNA clones for NADP-malic enzyme from leaves of Flaveria: transcript abundance distinguishes C3, C3-C4 and C4 photosynthetic types. Plant Mol. Biol. 17: 371-383. Rothermel B. A. and Nelson T. (1989). Primary structure of the maize NADP- dependent malic enzyme. J. Biol. Chem. 264: 19587-19592. 139 Ruffner H. P., Hawker J. S. and Hale C. R. (1976). Temperature and enzymic control of malate metabolism in berries of Vitis vinifera. Phytochemistry 15: 1877-1880. Sambrook J.( Fritsch E. F. and Maniatis T. (1989). Molecular cloning: A laboratory manual. 2nd ed. Cold Spring Harbor Laboratory, New York. Sanger F., Nicklen S. and Coulson A. R. (1977). DNA sequencing with chain- terminating inhibitors. Proc. Natl. Acad. Sci. USA 74: 5463-5467. Scagliarini S., Pupillo P. and Valenti V. (1988). Isoforms of NADP-dependent malic enzyme in tissues of the greening maize leaf. J. Exp. Bot. 39: 1109- 1119. Southern E. M. (1975). Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98: 503-517. Ting I. P. (1985). Crassulacean acid metabolism. Annu. Rev. Plant Physiol. 36: 595-622. van Doorsselaere J., Villerroel R., Van Montagu M. and Inze D. (1991). Nucleotide sequence of a cDNA encoding malic enzyme from poplar. Plant Physiol. 96: 1385-1386. Virca G. D., Northemann W., Shiels B. R.t Widera G. and Broome S. (1990). Simplified Northern blot hybridization using 5% sodium dodecyl sulfate. BioTechniques 8: 370-371. Walter M. H., Grima-Pettenati J., Grand C. and Boudet A. M. (1988). Cinnamyl- alcohol dehydrogenase, a molecular marker specific for lignin synthesis: cDNA cloning and mRNA induction by fungal elicitor. Proc. Natl. Acad. Sci. USA 85:5546-5550. Walter M. H.p Grima-Pettenati J., Grand C., Boudet A. M. and Lamb C. J. (1990). Extensive sequence similarity of the bean CAD4 (cinnamyl-alcohol dehyrogenase) to a maize malic enzyme. Plant Mol. Biol. 15: 525-526. SUMMARY AND CONCLUSIONS Tomato {Lycopersicon esculentum Mill., cv. Ohio 7814) fruits were harvested weekly after flowering to study changes in NADP+-malic enzyme (EC 1.1.1.40) activity and the levels of organic acids malate and citrate during fruit development. Although the total malic enzyme activity declined during fruit growth, its specific activity increased, reaching maximal activity at mature-green and breaker stages. During fruit ripening, malate content declined, followed by decreases in malic enzyme specific activity and citrate concentration. Locular fruit tissues presented the highest enzyme activity, as well as the highest malate and citrate concentrations. Malic enzyme activity was also detected in tomato leaves, stems and roots. The data showed that malic enzyme activity is proportional to malate concentration in the different fruit tissues. Although malic enzyme activity is associated with fruit growth and accumulation of organic acids, the data do not exclude a role for the enzyme in the metabolism of malate during ripening, since the enzyme activities present in the fruit could account for malate degradation. However, it is also possible that malic enzyme is involved in the regulation of cytoplasmic pH. 140 141 Tomato fruit malic enzyme was purified 80-fold by ammonium sulfate fractionation, ion exchange chromatography, gel permeation and pseudo affinity chromatography. The purified malic enzyme had an apparent native molecular weight of 260-KDa and it was shown showed to be specifically an NADP+-dependent dehydrogenase. SDS-polyacrylamidegel electrophoresis of a pure malic enzyme preparation indicated a subunit molecular weight of 65- KDa. Polyclonal antibodies raised against malic enzyme precipitated the enzyme in tomato fruit crude extracts; affinity purified antibodies recognized a 65-KDa polypeptide in Western blots from SDS-polyacrylamide gel electrophoresis of total proteins from tomato fruit, tomato leaves and roots. Because of the low yield of purified enzyme, the presence of other isoforms cannot be rejected. However, immunological and enzymological data are consistent with the presence of a single malic enzyme protein in tomato fruits and vegetative tissues. The intracellular location of malic enzyme was studied in immature-green tomato fruit and leaves; corn was used as positive control. In contrast to corn chloroplasts, tomato fruit and leaf chloroplast preparations had very low malic enzyme activity. Most of the enzyme activity was present in the cytoplasmic protein fraction of tomato fruit and leaf extracts consistent with extraplastidic location. Purified antibodies did not detect a 65-KDa polypeptide in Western blots of tomato chloroplast preparations. However, the antibodies recognized a 74-KDa polypeptide of unknown function in tomato fruit chloroplasts. The 142 antibodies did react with a 65-KDa polypeptide in the total protein extract of corn roots and leaves; this is consistent with the presence of a cytoplasmic malic enzyme isoform. Based on malic enzyme activity and Western blot results, the enzyme isolated from tomato fruit seems to be located in the cytoplasm. Although the data do not support the presence of a malic enzyme isoform in the chloroplast, this possibility cannot be completely rejected. Isolation of tomato fruit malic enzyme cDNA was achieved by screening a lambda gt 11 cDNA library constructed from mature-green tomato fruits with a corn malic enzyme cDNA probe and a partial full length malic enzyme cDNA (1.5 Kbp) was obtained from the library. The 1,5 Kbp cDNA clone was used as probe to search for a full length mafic enzyme clone in a lambda ZAP II ripe tomato fruit cDNA library. A 1950 bp ZAP II clone was isolated and its nucleotide sequence showed a single 1707 bp open reading frame. Comparison of the tomato fruit malic enzyme cDNA nucleotide sequence with the sequence published for malic enzyme in Flaveria linearis, F. trinervia, maize, Populus, and Phaseolus vulgaris showed a nucleotide homology ranging from 72% to 79% and amino acid identity ranging from 75% to 84%. Furthermore, the tomato fruit cDNA malic enzyme open reading frame contained a 30 bp motif which codes for a highly conserved 10 amino acid domain identified as the NADP+ binding site. This site showed 100% amino acid identity with the NADP+ binding sites of other published plant sequences. The malic enzyme cDNA open reading frame of the C3 plants Populus and Phaseolus vulgaris is 1767 bp long; however, the tomato fruit clone was 1707 bp long, and the translation start codon, ATG for Met, was absent from the 5’ end of the open reading frame of the tomato fruit cDNA. The tomato fruit clone seems to be 60 bp shorter at the 5’ end when compared with the Populus and Phaseolus vulgaris open reading frames. The tomato fruit libraries screened in this experiment do not seem to contain a full length malic enzyme cDNA. The absence of such clone may be due to RNase activity present in the reverse transcriptase enzyme, which could partially degrade the mRNA during synthesis of the first strand cDNA. Although the tomato NADP+-malic enzyme cDNA does not apparently code for the first 20 amino acids from the enzyme’s amino terminus, a 5’ end DNA fragment with 200 to 400 base pairs could be used in the construction of an antisense gene. However, the construction of a gene for over-expression of malic enzyme in tomato plants would require a complete coding sequence. A putative partial sequence of the 5’ end of tomato NADP+-malic enzyme gene has been reported based on analysis of a genomic clone. However, the overlap in this DNA sequence with the 1950 bp cDNA clone did not show any homology. This suggests that part of an intron was interpreted as an exon in the published sequence. A further goal for this project, would be to isolate a NADP+-malic enzyme genomic clone from a tomato library, using the ME-4 tomato fruit cDNA as a probe. This approach could make it possible to deduce the missing 5’ end of the open reading frame of the tomato fruit malic enzyme cDNA. This would also allow the isolation of the malic enzyme gene promoter region, which would help to study the factors involved in control of malic enzyme message transcription. A genomic hybridization analysis of total tomato DNA showed that the NADP+-malic enzyme gene is present in low copy number (<3) in the plant genome, this makes easier the isolation and sequencing of the malic enzyme gene. Further restriction endonuclease analysis is necessary to test the hypothesis that only one gene is present. The ability to transform and regenerate plants that over- and under express the enzyme will allow new experiments to further elucidate the role for NADP+-malic enzyme role in fruit ripening, and in C3 plants in general. LIST OF REFERENCES Bagchi S., Wise L. S., Brown M. L., Bregman D., Sook Sul H. and Rubin C. S. (1987). Structure and expression of murine malic enzyme mRNA. J. Biol. Chem. 262: 1558-1565. Bartley G. E., Viitanen P. V., Bacot K. O. and Scolnik P. A. (1992). A tomato gene expressed during fruit ripening encodes an enzyme of the carotenoid biosynthesis pathway, J. Biol. Chem. 267: 5036-5039. Bergmeyer M. V. (1983). Methods of enzymatic analysis. 3rd ed. Vol. VII. pp 39-47, VCH Publishers, Weinheim. Berry S. Z. and Gould W. A. (1983). ’Ohio 7814’ tomato. HortScience 18: 494-496. Biale J. B. and Young R. E. (1981). Respiration and ripening in fruits- retrospect and prospect. In Recent advances in biochemistry of fruit and vegetables. Friend J. and Rhodes M. J. C. (Eds.), pp 1-39, Academic Press, New York/London. Biggs M. S., Harriman W. A. and Handa A. K. (1986). Changes in gene expression during tomato fruit ripening. Plant Physiol. 81: 395-403. Biggs M. S. and Handa A. K. (1989). Temporal regulation of polygalacturonase gene expression in fruit of normal, mutant and heterozygous tomato genotypes. Plant Physiol. 89: 117-125. Bird C. R., Ray J. A., Fletcher J. D., Boniwell J. M., Bird A. S., Teulieres C., Blain I., Bramley P. M. and Schuch W. (1991). Using antisense RNAto study gene function: inhibition of carotenoid biosynthesis in transgenic tomatoes. Bio/Technology 9: 635-639. 145 146 Borsch D. and Westhoff P. (1990). Primary structure of NADP-dependent malic enzyme in the dicotyledonous C4 plant Flaveria trinervia. FEBS Letters 273: 111-115. Bradford M. M. (1976). A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72: 248-254. Buescher R. W. (1975). Organic acid and sugar levels in tomato pericarp as influenced by storage at low temperature. HortScience 10: 158-159. Chung C. T., Niemela S. L. and Miller R. H. (1989). One-step preparation of competent Escherichia coli: Transformation and storage of bacterial cells in the same solution. Proc. Natl. Acad. Sci. USA 86: 2172-2175. Coombe B. G. (1976). The development of fleshy fruits, Annu. Rev. Plant Physiol. 27: 507-528. Dalai K. B., Salunkhe D. K., Boe A. A. and Olson L. E. (1965). Certain physiological and biochemical changes in the developing tomato fruit {Lycopersicon esculentum Mill.) J. Fd. Sci. 30: 504-508. Danner J. and Ting I. P. (1967). C 0 2 Metabolism in corn roots. II. Intracellular distribution of enzymes. Plant Physiol. 42: 719-724. Davies J. N. (1964). Effect of nitrogen, phosphorus and potassium fertilizers on the non-volatile organic acids of tomato fruit. J. Sci. Fd. Agric. 15: 665- 673. Davies J. N. (1966). Changes in the non-volatile organic acids of tomato fruit during ripening. J. Sci. Fd. Agric. 17: 396-400. Davies D. D. (1986). The fine control of cytosolic pH. Physiol. Plant. 67: 702- 706. Davies D. D. and Patil K. D. (1974). Regulation of ’malic’ enzyme of Solanum tuberosum by metabolites, Biochem. J. 137: 45-53. DellaPenna D., Alexander D. C. and Bennett A. B. (1986). Molecular cloning of tomato fruit polygalacturonase: analysis of polygalacturonase mRNA levels during ripening. Proc. Natl. Acad. Sci. USA 83: 6420-6424. 147 Dittrich P. (1976). Nicotinamide adenine dinucleotide-specific "malic" enzyme in Kalanchoe daigremontiana and other plants exhibiting crassulacean acid metabolism. Plant Physiol. 57: 310-314. Dixon R. A. and Harrison M. J. (1990). Activation, structure, and organization of genes involved in microbial defense in plants. In Advances in genetics. Genomic responses to environmental stress. Scandalios J. G. (Ed.), Vol 28, pp 165-234, Academic Press, New York/London. Doyle J, J. and Doyle J. L. (1990). Isolation of plant DNA from fresh tissue. Focus 12: 13-15. Douce, R. and Neuburger M. (1989). The uniqueness of plant mitochondria. Annu. Rev. Plant Physiol. 40: 371-414. Dubery I. A. and Schabort J. C. (1981). Purification and characterization of the NADP-linked malate dehydrogenase (decarboxylating) from Mangifera indica. Biochim. Biophys. Acta 662: 102-110. Dubery I. A., Schabort C. and Cloete F. (1984). Some properties of the NADP- malic enzyme from mango fruit, Mangifera indica. Int. J. Biochem. 16: 417- 422. Drouet A. G. and Hartmann C. J. R. (1977). Activity of pear fruit malic enzyme; its regulation by metabolites. Phytochemistry 16: 505-508. Edwards G. E. and Huber S. C. (1981). The C4 pathway. In The biochemistry of plants. A comprehensive treatise. Hatch M. D. and Boardman N. K. (Eds.). Vol. 8 pp 237-281, Academic Press, New York/London. Edwards G. E. and Andreo C. S. (1992). NADP-Malic enzyme from plants. Phytochemistry 31:1845-1857. El-Shora H. M. and ap Rees T. (1991). Intracellular location of NADP+-linked malic enzyme in C3 plants. Planta 185: 362-367. Fathi M. and Schnarrenberger C. (1990). Purification by immunoadsortion and immunochemical properties of NADP-dependent malic enzymes from leaves of C3, C4, and crassulacean acid metabolism plants. Plant Physiol. 92: 710-717. Franke K. E. and Adams D. . (1993). N-Terminal amino acid and partial cDNA sequences for tomato malic enzyme (EC 1.1.1.40). Plant Physiol. 102:72 148 Giovannoni J. J., DellaPenna D., Bennett A. B. and Fischer R. L. (1989). Expression of a chimeric polygalacturonase gene in transgenic rin (ripening inhibitor) tomato fruit results in polyuronide degradation but not fruit softening. The Plant Cell 1; 53-63. Goodenough P.W., Tucker G. A., Grierson D. and Thomas T. (1982). Changes in colour, polygalacturonase, monosaccharides and organic acids during storage of tomatoes. Phytochemistry 21: 281-284. Goodenough P. W., Prosser I. M. and Young K. (1985). NADP-linked malic enzyme and malate metabolism in ageing tomato fruit. Phytochemistry 24: 1157-1162. Gray J., Picton J., Schuch W. and Grierson D. (1992). Molecular biology of fruit ripening its manipulation with antisense genes. Plant Mol. Biol. 19: 69- 87. Hamilton A. J., Lycett G. W. and Grierson D. (1990). Antisense gene that inhibits synthesis of the hormone ethylene in transgenic plants. Nature 346: 284-287. Hobson G. E. and Davies J. N. (1971). The tomato. In The biochemistry of fruits and their products. Hulme A. C. (Eds.) Vol. 2. pp 437-475, Academic Press, London/New York. Horsch R. B., Fry J, E., Hoffmann N. L., Eichholtz D., Rogers S. G. and Fraley R. T. (1985). A simple and general method for transferring genes into plants. Science 227: 1229-1231. Iglesias A. A. and Andreo C. S. (1989). Purification of NADP-malic enzyme and phosphoenolpyruvate carboxylase from sugar cane leaves. Plant Cell Physiol. 30: 399-405. Jeffery D., Smith C., Goodenough P., Prosser I. and Grierson D. (1984). Ethylene-independent and ethylene-dependent biochemical changes in ripening tomatoes. Plant Physiol. 74: 32-38. Jenkins C. L. D. and Boag S. (1985). Isolation of bundle sheath cell chloroplasts from the NADP-ME type C4 plant Zea mays. Plant Physiol. 79: 84-89. 149 Johnson L. M., Snyder M,, Chang L. M, S,, Davis R, W. and Campbell J. L. (1985). Isolation of the gene encoding yeast DNA polymerase I. Cell 43: 369- 377. Klee H., Horsch R. and Rogers S. (1987). Agrobacterium-mediated plant transformation and its further applications to plant biology. Annu. Rev. Plant Physiol. 38: 467-486. Kraft R., Tardiff J., Krauter K. S. and Leinwand L. A. (1988). Using mini- prep plasmid DNA for sequencing double stranded templates with Sequenase™. BioTechniques 6: 544-547. Krishnamurthy S., Patwardhan M. V. and Subramanyam H. (1971). Biochemical changes during ripening of the mango fruit. Phytochemistry 10: 2277-2281. Krug M. S. and Berger S. L. (1987). First-strand cDNA synthesis primed with oligo (dT). In Methods in enzymology: guide for molecular cloning techniques, Berger S. L. and Kimmel A. R. (Eds.), Vol. 152, pp 316-325. Academic Press, New York/London. Laemmli U. R, (1970). Cleavage of structural proteins during assembly of the head of bacteriophage T4. Nature 227: 680-685. Lagrimini L. M. (1992). Plant peroxidases: under- and over-expression in transgenic plants and physiological consequences. In Plant peroxidases 1980-1990, topics and detailed literature on molecular, biochemical, and physiological aspects. Penel C.; Gaspar Th. and Greppin H. (Eds.), pp 59- 69, University of Geneva. Langdale J. A., Rothermel B. A. and Nelson T. (1988). Cellular pattern of photosynthetic gene expression in developing maize leaves. Genes & Development 2: 106-115. Lasko A. N. and Kliewer M. W. (1975). The influence of temperature on malic acid metabolism in grape berries. Plant Physiol. 56: 370-372. Lilley R. McC. and Walker D. A. (1974), An improved spectrophotometric assay for ribulosebis-phosphate carboxylase. Biochim. Biophys. Acfa358:226-229. Magnuson M. A., Morioka H., Tecce M. F. and Nikodem V. M. (1986). Coding nucleotide sequence of rat liver malic enzyme mRNA. J. Biol. Chem. 261: 1183-1186. 150 Mahakun N., Leeper P. W. and Burns E. E. (1979). Acidic constituents of various tomato fruit types. J. Fd. Sci. 44: 1241-1244. Moellering H. and Gruber W. (1966). Determination of citrate with citrate lyase. Anal. Biochem. 17: 369-376. Nelson T. and Langdale J. A. (1992). Developmental genetics of C4 photosynthesis. Annu. Rev. Plant Physiol. Plant Mol. Biol. 43: 25-47. Oeller P. W., Min-Wong L., Taylor L. P., Pike D. A. and Theologis A. (1991). Reversible inhibition of tomato fruit senescence by antisense RNA. Science 254: 437-439. Osmond C. B. and Holtum J. A. M. (1981). Crassulacean acid metabolism. In The biochemistry of plants. A comprehensive treatise. Hatch M. D. and Boardman N. K. (Eds.). Vol. 8 pp 283-328, Academic Press, New York/London. Possner D., Ruffner H. P. and Rast D. M. (1981). Isolation and biochemical characterization of grape malic enzyme. Planta 151: 549-554. Pratt H. K. and Workman M. (1961). Studies on the physiology of tomato fruits III. The effect of ethylene on respiration and ripening behavior of fruits stored at 20°C after harvest. Proc. Amer. Soc. Hort. Sci. 81 467-478. Price C. A., Cushman J. C., Mendiola-Morgenthaler L. R. and Reardon E. M. (1987). Isolation of plastids in density gradients of percoll and other silica sols. In Methods in enzymology: plant cells membranes, Packer L. and Douce R. (Eds.), Vol. 148, pp 157-179. Academic Press, New York/London. Pupillo P. and Bossi P. (1979). Two forms of NADP-dependent malic enzyme in expanding maize leaves. Planta 144: 283-289. Rajeevan M. S., Bassett C. L. and Hughes W. (1991). Isolation and characterization of cDNA clones for NADP-malic enzyme from leaves of Flaveria: transcript abundance distinguishes C3, C3-C4 and C4 photosynthetic types. Plant Mol. Biol. 17: 371-383. Roberts J. K. M., Hooks M. A., Miaullis A. P., Edwards J. and Webster C. (1992). Contribution of malate and amino acid metabolism to cytoplasmic pH regulation in hypoxic maize root tips studied using nuclear resonance spectroscopy. Plant Physiol. 98: 480-487. 151 Romano C. P., Cooper M. L. and Klee H.J. (1993). Uncoupling auxin and ethylene effects in transgenic tobacco and arabidopsis plants. The Plant Cell 5: 181-189. Rothermel B. A. and Nelson T. (1989). Primary structure of the maize NADP-dependent malic enzyme. J. Biol. Chem. 264: 19587-19592. Ruffner H. P., Hawker J. S. and Hale C. R. (1976). Temperature and enzymic control of malate metabolism in berries of Vitis vinifera. Phytochemistry 15: 1877-1880. Ruffner H. P. and Hawker J. S. (1977). Control of glycolysis in ripening berries of Vitis vinifera. Phytochemistry 16: 1171-1175. Sambrook J., Fritsch E. F. and Maniatis T. (1989). Molecular cloning: A laboratory manual. 2nd ed. Cold Spring Harbor Laboratory, New York. Sanger F., Nicklen S. and Coulson A. R. (1977). DNA sequencing with chain- terminating inhibitors. Proc. Natl. Acad. Sci. USA 74: 5463-5467. Sapers G. M., Phillips J. G., Panasiuk O., Carre J., Stoner A. K. and Barksdale T. (1978). Factors affecting the acidity of tomatoes. HortScience 13:187-189. Sato T. and Theologis A. (1989). Cloning the mRNA encoding 1- aminocyclopropane-1-carboxylate synthase, the key enzyme for ethylene biosynthesis in plants. Proc. Natl. Acad. Sci. USA 86: 6621-6625. Scagliarini S., Pupillo P. and Valenti V. (1988). Isoforms of NADP-dependent malic enzyme in tissues of the greening maize leaf. J. Exp. Bot. 39: 1109- 1119. Schnarrenberger C., GroB D., Burkhard Ch. and Herbert M. (1980). Cell organelles from crassulacean acid metabolism (CAM) plants. II. Compartimentalization of enzymes of the crassulacean acid metabolism. Planta 147: 477-484. Schuch W., Bird C. R., Ray J., Smith C. J. S., Watson C. F., Morris P. C., Gray J. E., Arnold C., Seymour G. B., Tucker G. A. and Grierson D. (1989). Control and manipulation of gene expression during tomato fruit ripening. Plant Mol. Biol. 13: 303-311. Smith A. M. and ap Rees T. (1979). Effects of anaerobiosis on carbohydrate oxidation by roots of Pisum sativum. Phytochemistry 18: 1453-1458. 152 Smith C. J. S., Watson C. F,, Ray J., Bird C. R., Morris P. C., Schuch W. and Grierson D. (1988). Antisense RNA inhibition of polygalacturonase gene expression in transgenic tomatoes. Nature 334: 724-726. Smith C. J. S., Watson C. F., Morris P. C., Bird C. R., Seymour G. B., Gray J. E., Arnold C., Tucker G. A., Schuch W.( Harding S. and Grierson D. (1990). Inheritance and effect on ripening of antisense polygalacturonase genes in transgenic tomatoes. Plant Mol. Biol. 14: 369-379. Southern E. M. (1975). Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98: 503-517. Ting I. P. (1985). Crassulacean acid metabolism. Annu. Rev. Plant Physiol. 36: 595-622. TomaszewskaB., Schramm R. W., Kokot A. and Mazurowa H. (1983). Isolation and characterization of cytoplasmic NADP+-malic enzyme from Lupinus luteus leaves. Physiol. Plant. 59: 641-646. Thompson S. T., Cass K. H. and Stellwagen E. (1975). Blue dextran- sepharose: an affinity column for the dinucleotide fold proteins. Proc. Natl. Acad. Sci. USA 72: 669-672. Thorne S. N. and Efiuvwevwere J. O. (1988). Changes in organic acids in chilled tomato fruit ( Lycopersicon esculentum Mill). J. Sci. Fd. Agric. 44: 309- 319. Ulrich R. (1970). Organic acids. In The biochemistry of fruits and their products. Hulme A. C. (Ed.) Vol. I. pp 89-118, Academic Press, London/New York. van Doorsselaere J., Villerroel R., Van Montagu M. and Inze D. (1991). Nucleotide sequence of a cDNA encoding malic enzyme from poplar. Plant Physiol. 96: 1385-1386. Virca G. D., Northemann W., Shiels B. R., Widera G. and Broome S. (1990). Simplified Northern blot hybridization using 5% sodium dodecyl sulfate. BioTechniques 8: 370-371. Walter M. H., Grima-Pettenati J., Grand C. and Boudet A. M. (1988). Cinnamyl- alcohol dehydrogenase, a molecular marker specific for lignin synthesis: cDNA cloning and mRNA induction by fungal elicitor. Proc. Natl. Acad. Sci. USA 85:5546-5550. 153 Walter M. H., Grima-Pettenati J., Grand C., Boudet A. M. and Lamb C. J. (1990). Extensive sequence similarity of the bean CAD4 (cinnamyl-alcohol dehydrogenase) to a maize malic enzyme. Plant Mol. Biol. 15: 525-526. Wedding R.T. (1989). Malic enzymes of higher plants. Plant Physiol. 90: 367-371. Winsor G. W., Davies N. J. and Massey D. M. (1962). Composition of tomato fruit III. - Juices from whole fruit and locules at different stages of ripeness. J. Sci. Fd. Agric. 13: 108-115. Wolf I. D., Schwartau C. M., Thompson D. R., Zottola E. A. and Davis D. W. (1979). The pH of 107 varieties of Minnesota-grown tomatoes. J. Fd. Sci. 44: 1008-1010.