Lmx1b and Foxc Combinatorially Regulate Podocin Expression in Podocytes

BASIC RESEARCH www.jasn.org

Lmx1b and FoxC Combinatorially Regulate Podocin Expression in Podocytes

†‡ | Bing He,* Lwaki Ebarasi, Zhe Zhao,§ Jing Guo,* Juha R.M. Ojala,* Kjell Hultenby, Sarah De †‡ Val,§ Christer Betsholtz, and Karl Tryggvason*¶

*Department of Medical Biochemistry and Biophysics, Division of Matrix Biology, and †Department of Medical Biochemistry and Biophysics, Division of Vascular Biology, and |Department of Laboratory Medicine, Division of Clinical Research Centre, Karolinska Institute, Stockholm, Sweden; ‡Department of Immunology, Genetics and Pathology, Rudbeck Laboratory, Uppsala University, Uppsala, Sweden; §Ludwig Institute for Cancer Research, Oxford University, Oxford, United Kingdom; and ¶Cardiovascular & Metabolic Disorders Program, Duke-NUS, Singapore

ABSTRACT Podocin is a key protein of the kidney podocyte slit diaphragm protein complex, an important part of the glomerular filtration barrier. Mutations in the human podocin gene NPHS2 cause familial or sporadic forms of renal disease owing to the disruption of filtration barrier integrity. The exclusive expression of NPHS2 in podocytes reflects its unique function and raises interesting questions about its transcriptional regulation. Here, we further define a 2.5-kb zebrafish nphs2 promoter fragment previously described and identify a

49-bp podocyte-specific transcriptional enhancer using Tol2-mediated G0 transgenesis in zebrafish. Within this enhancer, we identified a cis-acting element composed of two adjacent DNA-binding sites (FLAT-E and forkhead) bound by transcription factors Lmx1b and FoxC. In zebrafish, double knockdown of Lmx1b and FoxC orthologs using morpholino doses that caused no or minimal phenotypic changes upon individual knockdown completely disrupted podocyte development in 40% of injected embryos. Co- overexpression of the two genes potently induced endogenous nphs2 expression in zebrafish podocytes. We found that the NPHS2 promoter also contains a cis-acting Lmx1b-FoxC motif that binds LMX1B and FoxC2. Furthermore, a genome-wide search identified several genes that carry the Lmx1b-FoxC motif in their promoter regions. Among these candidates, motif-driven podocyte enhancer activity of CCNC and MEIS2 was functionally analyzed in vivo. Our results show that podocyte expression of some genes is combinatorially regulated by two transcription factors interacting synergistically with a common enhancer. This finding provides insights into transcriptional mechanisms required for normal and pathologic podocyte functions.

J Am Soc Nephrol 25: 2764–2777, 2014. doi: 10.1681/ASN.2012080823

Normal glomerular filtration function depends on mutations in podocyte-expressed genes as the un- structural integrity of the filtration barrier. Glo- derlying cause of inherited renal diseases.4 More- merular podocytesplaya key role in establishingand over, recent studies from genetically modified mice maintaining this unique filtration barrier structure. Mature podocytes are characterized by cell cycle Received August 18, 2012. Accepted March 25, 2014. arrest, foot process formation, and the presence of the slit diaphragm,1 which bridges the gaps between Published online ahead of print. Publication date available at the interdigitating foot processes of neighboring www.jasn.org. podocytes and functions as a size-selective filtration Correspondence: Dr. Bing He, Division of Matrix Biology, De- barrier.2,3 For their differentiation, as well as for partment of Medical Biochemistry and Biophysics, Karolinska Institute, 171 77 Stockholm, Sweden. Email: [email protected]. the maintenance of their complex architecture, Dr. Karl Tryggvason, Division of Matrix Biology, Department of podocytes require the expression of several specific Medical Biochemistry and Biophysics, Karolinska Institute, 171 77 genes in a correct spatial and temporal fashion. This Stockholm, Sweden. Email: [email protected] notion is supported by the identification of many Copyright © 2014 by the American Society of Nephrology

2764 ISSN : 1046-6673/2512-2764 JAmSocNephrol25: 2764–2777, 2014 www.jasn.org BASIC RESEARCH and the identification of genes responsible for human in addition to podocytes.24,27 Mutations in FOXC2 cause podocyte diseases have revealed a complex transcriptional lymphedema-distichiasis syndrome, which is characterized by network in podocytes critical for podocyte specification, dif- limb lymphedema and double rows of eyelashes. Lymphedema- ferentiation, and contributing to renal disease pathogenesis.5,6 distichiasis syndrome with proteinuria has been reported in a However, transcriptional regulatory mechanisms by which the family of German-Irish descent,28 suggesting that certain FOXC2 transcription factors govern expression of their target genes in mutations may cause renal disease. Thus, both Lmx1b and podocytes remain incompletely understood. FoxC2 have been implicated in the transcriptional regulation NPHS2 was identified by positional cloning because its of Nphs2. However, the molecular mechanism and potential in- mutations cause familial or sporadic forms of steroid-resistant teraction between these two transcription factors have not been nephrotic syndrome.7–9 Podocin is a key component of the slit addressed previously. diaphragm, where it interacts with nephrin, NEPH1, and In this study, we identified a 49-bp podocyte-specific CD2AP.10,11 In contrast to many other podocyte genes, enhancer in the zebrafish nphs2 promoter. This enhancer NPHS2 is exclusively and constitutively expressed in podocytes.7 contains a conserved cis-acting motif composed of two adja- This likely reflects its unique function, and in particular implies cent DNA-binding sites, combinatorially bound and activated the presence of a podocyte-specific enhancer. A putative en- by two transcription factors Lmx1b and FoxC. We show that hancer element in NPHS2 has been localized within a 2.5-kb the human NPHS2 promoter also contains the cis-acting motif DNA fragment upstream of its transcriptional start site, and it regulated by the mammalian orthologs LMX1B and FoxC2. drives reporter gene expression in transgenic mouse podocytes.12 Further, we genome-wide detected 26 genes carrying the We recently identified a zebrafish podocyte-specific enhancer Lmx1b-FoxC motifs in their promoter regions. Among them, element, which also lies within the 2.5-kb 59 flanking region.13 motif-driven podocyte enhancer activity of CCNC and MEIS2 However, the precise DNA-binding motifs in these regions and was functionally analyzed in vivo. The findings provide insights their potential interaction with specific transcription factors re- into the transcriptional regulatory mechanisms required for main unknown. normal podocyte functions, and for the development of certain Previous studies have shown that Lmx1b is essential for kidney diseases. mouse Nphs2 expression.14,15 Lmx1b is a LIM-homeobox transcription factor that controls dorsal-ventral limb patterning during vertebrae development.16 Mutations in human RESULTS LMX1B cause nail-patella syndrome, which is characterized by skeletal abnormality, nail hypoplasia, and nephropathy.17,18 Identification of a Podocyte-Specific Enhancer by In mice, genetic ablation of Lmx1b leads to loss of Nphs2 ex- Analysis of Reporter Gene Expression in Zebrafish pression14,19 as well as loss of expression of the glomerular Using a 2.5-kb zebrafish nphs2 promoter fragment (Supple- basement membrane (GBM) collagens Col4a3 and Col4a4,20 mental Figure 1A), we previously generated a Tg(podocin: suggesting that Lmx1b potentially acts as a common upstream GFP) zebrafish line, in which green fluorescence protein regulator of these genes through binding to the FLAT ele- (GFP) is exclusively expressed in podocytes.13 To fine-map ments.21 Although this hypothesis is supported by an electro- this 59 sequence by in vivo experiments, we first compared phoresis mobility shift assay (EMSA), conflicting results the GFP expression patterns driven by this promoter between have been reported regarding the ability of a putative Lmx1b- injected G0 and Tg(podocin:GFP) G1 embryos. The two types binding enhancer to activatereportergeneexpression.14,15 of embryos exhibited similar podocyte-specific GFP expression Moreover, Lmx1b is exclusively expressed in the glomerulus pattern at 4 days postfertilization (dpf), despite the expected 22 of the kidney, as well as in other organs, including limb, eye, mosaic expression in G0 embryos (Supplemental Figure 1B). 19,23 and brain, during development. Thus, although Lmx1b is The robust expression was observed in 18%64% of G0 embryos, necessary for podocyte-specific expression of certain genes, it is verified by three independent injections. Thus, we found it plau- not specific to podocytes, nor is it alone sufficient to direct sible to use G0 transgenic zebrafish for a rapid fine-mapping of podocyte-specific gene expression. Authors have argued that the promoter fragment. Lmx1b may interact with coactivators through its LIM do- Further analysis of the 2.5-kb promoter fragment revealed mains,19 and Ldb1 has been shown as a candidate coactivator that deletions from 22.5 kb to an ApaI site situated at 21.0 kb in podocytes.22 However, its role in regulating Nphs2 expres- preserved the podocyte specificity and frequency of GFP ex- sion remains to be determined. pression (Figure 1A). However, further deletion to a Kpn2I site In a previous study, we demonstrated that Foxc22/2 mice, situated at 2185 bp increased the expression rate from 18% to similar to Lmx1b2/2 mice, lose the expression of Nphs2, 33% and also induced a low but significant frequency (5%–10%) Col4a3, and Col4a4.24 FoxC2 belongs to a subgroup of the of ectopic GFP expression in extrarenal tissues (Figure 1A). forkhead transcription factor family that is involved in a broad This expression pattern was preserved upon further deletion range of developmental processes.25 The mammalian FoxC to 2110 bp (Figure 1A), suggesting that a podocyte-specific subfamily has two highly related members, FoxC1 and enhancer element resides within 110 bp upstream of the tran- FoxC2, where mouse Foxc2 is expressed in multiple tissues26 scription start site. Within the 110-bp sequence, we observed

J Am Soc Nephrol 25: 2764–2777, 2014 Combinatorial Control of Podocin Expression 2765 BASIC RESEARCH www.jasn.org

whereas no glomerular GFP expression was observed in 211 control embryos (Figure 1C), suggesting that the 49-bp element containing a FLAT-E/forkhead motif constitutes a podocyte-speciﬁcenhancersufﬁcient to direct GFP expression in podocytes independent of the native nphs2 minimal promoter.

FLAT-E/forkhead Motif Defines the Enhancer Required for Podocyte- Specific Expression By analyzing the 5-kb Nphs2 promoter with a complete sequence in all vertebrates available, the motif with two adjacent binding sites is present in 90% of analyzed species (28 of 31 species) and the motif with 5-bp or 7-bp spacing between two sites ac- counts for 75% of 28 species (Supplemen- tal Table 1), suggesting that the binding motif is highly conserved. To characterize the motif, we generated mutations targeting the FLAT-E and forkhead sites, respectively. A single mutation (A→C) in the FLAT-E element almost completely abol- ished expression (reduced to 3%; P,0.001) in comparison with the wild-type (32%). A point mutation at the forkhead site (A→G) likewise resulted in a significantly decreased expression frequency (11%; P,0.001) (Figure 2A). Further deletion of fi fi Figure 1. Identi cation of a 49-bp enhancer suf cient to direct GFP expression in the entire forkhead site led to a complete zebrafish podocytes. (A) Fine-mapping of the zebrafish nphs2 promoter fragment by loss of glomerular expression (Figure 2B), deletion analysis. The constructs carrying different sizes of inserts are schematically suggesting that the two sites are both re- shown in left panel. GFP expression rate, defined as percentage of positive G0 embryos expressing GFP in glomeruli or extrarenal structures out of total embryos, is quired for podocyte expression. illustrated with bar graphs. Total number of G0 embryos is indicated in parentheses. It is known that Lmx1b binds to the SD in the bar graph shows a variation in three independent injections. (B) DNA se- FLAT elements.21 Moreover, Lmx1b and quence analysis. The zebrafish nphs2 promoter element from 2110 to 250 bp is Foxc2 are critical for the Nphs2 expres- shown. Consensus of the FLAT-E or -F element and the forkhead-binding site are sion.14,19,24 Therefore, we hypothesized denoted.21,25 The putative DNA-binding sites in the sequence are marked in bold and that the two proteins bind to the FLAT-E/ underline. (C) Heterologous promoter analysis. The zebrafish promoter element with forkhead motif with a synergistic effect on 2 2 two putative binding sites marked in red between 185 and 62 bp was subcloned in Nphs2 transcription. In zebrafish, no the Tol2-cfos-GFP plasmid (zpmotif-cfos-GFP) and is schematically illustrated. The FoxC2 homolog exists. Instead, two foxc1 mouse c-fos minimal promoter (arrow) in the plasmid is indicated. The empty plasmid paralogs (foxc1a, b) have been identified, was used as a control. GFP expression rate described above is shown. Microscopic of which only foxc1a is expressed in the imaging laterally and dorsally shows GFP expression in G0 glomerulus (arrow). GFP is 29 also visible in other tissues. pronephros. We next performed EMSA to test binding potentials of the two proteins to the zebrafish motif. Lmx1b two adjacent DNA-binding sites: a 59 located FLAT-E element (lmx1b.1 and LMX1B) and foxc1a robustly and specifically (TAATTA) and a 39 located forkhead-binding site (ATAAACA) bound to the FLAT-E element and the forkhead site, respec- separated by seven nucleotides (Figure 1B). To test the cis- tively (Figure 2C). Mouse Foxc1 and Foxc2 could also bind to acting potential, we coupled the zebrafish motif element be- the zebrafish forkhead-binding site, but this binding was sig- tween 2185 and 262 bp to a mouse c-fos minimal promoter nificantly weaker than that observed for zebrafish foxc1a (Fig- and analyzed GFP expression in G0 embryos (Figure 1C). This ure 2C). Competition assay supported the binding specificity, resulted in glomerular GFP expression in 25% of embryos, since the bindings were efficiently competed by the same

2766 Journal of the American Society of Nephrology J Am Soc Nephrol 25: 2764–2777, 2014 www.jasn.org BASIC RESEARCH

Lmx1b and Foxc1a Are Both Required for Nphs2 Expression and Slit Diaphragm Formation in Zebrafish To determine whether two proteins are required for nphs2 expression in vivo,we knocked down lmx1b.1, lmx1b.2, foxc1a and foxc1b by injection of morpholinos (MOs) in Tg(podocin:GFP) embryos. Peri- cardial edema, associated with pronephric kidney dysfunctions,31,32 and glomerular GFP loss in 4-dpf embryos were used to evaluate the kidney phenotypic conse- quences of the knockdowns (Figure 3A). Double knockdown of lmx1b.1 and lmx1b.2 led to kidney phenotype in 90% of morphants. Single knockdown of lmx1b.1 resulted in a phenotype that was almost as severe as the double knockdown, whereas single knockdown of lmx1b.2 resulted in a less penetrant, but qualitatively similar, phenotype. These results suggest nonredundant but overlapping roles of Figure 2. Characterization of two putative DNA-binding sites bound by Lmx1b and lmx1b.1 and lmx1b.2.Doubleknockdown FoxC proteins. (A) Mutagenesis analysis of two putative DNA-binding sites. Two point- of foxc1a and foxc1b also led to severe phe- mutation carrying plasmids and their wild-type (ZP-0.2k) are illustrated. The putative notype, but so did single foxc1a knock- binding sites are marked in bold, and the mutation at the 287 or 273 position is down (89% and 85%, respectively). Foxc1b indicated in lowercase letters. GFP expression rate and number of G0 embryos in parentheses are shown. (B) Deletion of the forkhead-binding site. The sequence be- knockdown lacked these effects. To test a tween 2185 and 277 bp, in which the forkhead-binding site was completely deleted, combinatorial requirement of the two pro- was subcloned in the Tol2-based cfos-GFP plasmid (see Figure 1C). GFP expression teins for nphs2 expression in vivo,wefirst rate controlled by the 15-bp deletion plasmid and its wild-type (zpmotif-cfos-GFP) are determined subphenotypic doses of MOs displayed. (C) EMSA. Radiolabeled oligonucleotide probes (wt) encompassing the for individual knockdown. Individual in- zebrafish FLAT-E and the forkhead-binding sites and recombinant Lmx1b and FoxC jection of 0.25 ng lmx1b.1-MO or 1 ng proteins were used in EMSA. The mutations of the mutant probe (mu) are identical to foxc1a-MO led to no or little phenotype fi fi that used in mutagenesis assay, shown in part A. An ef cient binding of zebra sh (Figure 3B). Combinatorial knockdown lmx1b.1 and human LMX1B to the FLAT-E site was observed (lanes 2, 9 in Lmx1b fi of lmx1b.1 and foxc1a with the same doses panel). Zebra sh foxc1a strongly bound to the forkhead-binding site (lane 1 in foxc1a of MOs resulted in severe kidney pheno- panel). The binding of Foxc1 and Foxc2 was notably weaker than zebrafish foxc1a (lanes 1 in panels for Foxc1 and Foxc2). To test binding specificity, 12.5-fold, 25-fold, type in 40% of morphants (Figure 3B). and 37.5-fold excess unlabeled wild-type probes or mutant probes, indicated with Glomerular ultrastructure of lmx1b.1 fi gradients from low to high, were used for competition assays. Labeled probes were and foxc1a morphants exhibit signi cant efficiently competed by unlabeled wild-type probes with elevated amounts for five developmental defects in podocytes as tested proteins (lanes 3–5, lanes 10–12 in Lmx1b panel; lanes 2–4 in panels for foxc1a, well as capillary endothelium, which dis- Foxc1, and Foxc2), but not by unlabeled mutant probes (lanes 6–8, lanes 13–15 in rupt the glomerular filtration barrier integ- Lmx1b panel; lanes 5–7 in panels for foxc1a, Foxc1, and Foxc2). rity, resulting in the phenotype observed (Figure 4). At low magnification, defects in the lmx1b.1 morphant appear to be unlabeled wild-type probes with different amounts, but not by podocyte-restricted. However, the foxc1a morphant shows the unlabeled mutant probes with different amounts (Figure severe defects in developing podocytes and migration of glo- 2C). High homology (84% identity and 89% similarity) of merular capillary endothelial cells, although the podocyte LMX1B with zebrafish lmx1b.130 is in agreement with suffi- specification already occurs (Figure 4, A, C, and E). At higher cient binding of LMX1B to the zebrafish enhancer. Although magnification, two morphants showed a common defect in repeated attempts with different methods and conditions were glomeruli: aberrant or flattened podocyte foot processes and a made, we could not detect a tertiary band that indicates co- complete loss of the slit diaphragm in comparison to wild-type binding of two proteins to the probe at the same time by a (Figure 4, B, D, and F). This is compatible with the known role conventional EMSA in vitro. of podocin in podocyte foot process formation.31,33,34 Taken

J Am Soc Nephrol 25: 2764–2777, 2014 Combinatorial Control of Podocin Expression 2767 BASIC RESEARCH www.jasn.org

injection. At 1 dpf, quantitative PCR showed no signiﬁcant difference of nphs2 expression between any of the experimen- tal situations, although lmx1b.1 and foxc1a were strongly over- expressed (17- to 124-fold) individually or in combination (Figure 5). At 2 dpf, however, co-overexpression (12- to 27- fold) of the combined lmx1b.1 and foxc1a potently induced nphs2 expression, whereas overexpression (7- to 36-fold) of the single transcription factor lacked effect (Figure 5). The results provide additional evidence for that lmx1b and foxc1a combinatorially regulate nphs2 expression in zebraﬁsh podocytes. In addition, we did not observe notable ectopic expression, implying that a unique cellular environment in the podocytes also plays a role in nphs2 expression.

Lmx1b-FoxC Motif Is Present in Human NPHS2 and Many Other Genes By conservation analysis (Supplemental Table 1), we found that the binding motif is also present in the human NPHS2 proximate promoter, suggesting a similar regulatory mechanism controlling its expression by mammalian orthologs Lmx1b and FoxC2. Thus, we evaluated its binding potentials by EMSA. LMX1B and Foxc2 potently and specifically bound to the FLAT-F site and the forkhead site, respectively (Figure 6A). The bindings were specific because the binding signals were completely competed out by unlabeled wild-type probes with three different titrations, but not by unlabeled mutant probes. We observed that the binding by Foxc1 was significantly weaker than that by Foxc2 (Figure 6A). Figure 3. Lmx1b and FoxC are both required for nphs2 ex- We then tested cis-acting potentials of the NPHS2 motif pression in zebrafish. (A) MO-mediated knockdown of lmx1b and using the transgenic zebrafish in vivo. For this experiment, the foxc1 genes. Microscopic images of 4-dpf morphants of in- NPHS2 element containing the putative motif was subcloned dividual or double knockdown as well as controls are displayed. in the Tol2-based cfos-GFP plasmid (Figure 6B) and was Pericardial edema is indicated (arrow) in bright-field imaging, and injected in wild-type embryos. The NPHS2 motif drove glo- glomerular GFP expression is indicated (arrowhead) in dark-field imaging. The percentage of pericardial edema is shown. Number merular GFP expression in 5.5% (11 of 200) of embryos, com- of morphants is indicated in parentheses. (B) Combinatorial pared with no glomerular expression in controls injected with knockdown of lmx1b.1 and foxc1a genes. A low dose of lmx1b.1- an empty cfos-GFP plasmid (0 of 211). A low homology (48% MO (0.25 ng) or foxc1a-MO (1 ng) was individually injected in Tg identity) between FoxC2 and zebrafish foxc1a may lead to this (podocin:GFP) embryos. Glomerular GFP expression is indicated low expression rate. As shown in Figure 6B, glomerular ex- (arrowhead) in dark-field imaging. For double knockdown, 0.25 pression driven by the NPHS2 motif element was validated ng lmx1b.1-MO and 1 ng foxc1a-MO were coinjected in em- through their location and appearance. Together, the motif bryos. The percentage of pericardial edema in 4-dpf morphants is is likely to be a cis-acting element controlling podocyte ex- shown. Number of morphants is indicated in parentheses. pression of NPHS2. It is interesting to know whether the identified motifs could predict novel genes coexpressed with NPHS2 in podocytes. On together, Lmx1b and FoxC are both required for nphs2 expres- the basis of the motif consensus sequences (Figure 7A), we sion through a combinatorial action on the enhancer and the detected 26 candidates genome-wide that carry the motifs in formation of a functional pronephric kidney. their promoter regions in addition to NPHS2 (Table 1). Among them, glomerular expression levels of CCNC,which Lmx1b.1 and Foxc1a Synergistically Induce nphs2 encodes the cyclin C protein, and MEIS2, which encodes the Expression in Zebrafish Meis homeobox 2 protein, were downregulated almost 3-fold Totest whether coexpression of lmx1b and foxc1a could induce in Foxc22/2 mice,24 suggesting that their expression is regu- endogenous and/or ectopic nphs2 expression in vivo, we gen- lated by Foxc2. Thus, we tested cis-acting potentials of these erated the transgene of lmx1b.1 and foxc1a in zebrafish G0 two genes. To verify podocyte expression for the two predicted embryos (see Concise Methods). To visualize potential ectopic podocyte genes, we reconstructed Tol2-based plasmids, where GFP expression, the Tg(podocin:GFP) embryos were used for the CCNC and MEIS2 motifs were coupled with the mCherry

2768 Journal of the American Society of Nephrology J Am Soc Nephrol 25: 2764–2777, 2014 www.jasn.org BASIC RESEARCH

cDNA, and then injected them in the Tg (podocin:GFP) embryos. Colocalization of mCherry (red) with glomerular GFP (green) analyzed using confocal microscopy could provide direct evidence for podocyte expression. In addition, we also examined whether the proteins are present in mouse glomeruli. The CCNC element drove glomerular mCherry expression in 7% (7 of 100) of embryos. Similar to the positive control for glomerular colocalization (Figure 7B, upper panel), mosaic mCherry expression driven by the CCNC motif was co-localized with glomerular GFP expression (Figure 7B, middle panel). The MEIS2 motif also drove mCherry expression in 5.4% (6 of 110) of injected embryos, which was colocalized with glomerular GFP (Figure 7B, lower panel). Furthermore, immunostaining of mouse kidney sections showed that cyclin C was presentinmouseglomeruli,andwas mainly localized in cytoplasm (Figure 7C). Confocal images showed partial overlap (arrow) between cyclin C and nephrin, suggesting its expression in podocytes as well as other cells such as mesangial cells and endothelial cells (Figure 7C). MEIS2 shows strong nuclear expression in human glomeruli (http://www.proteinatlas.org). This antibody did not work in our immunofluorescence staining on mouse kidney sections. Glomerular expression of mouse Meis2 was, however, clearly detected by Western blotting (Figure 7D). We further asked whether a low rate of glomerular reporter expression driven by the human motifs in zebrafish could reflect real podocyte enhancer activity. To answer this question, we knocked down zebrafish ccnc and tested whether the phenotype generated by MOs was related to podocyte Figure 4. Glomerular ultrastructures in lmx1b.1 and foxc1a morphants at 4 dpf. At low defects. As shown in Figure 8A, injection of magnification, whole glomeruli (arrow) are exhibited (A, C, and E). Compared with MOs, targeting two different regions of wild-type (A), capillary lumens in the lmx1b.1 morphant are abnormally enlarged (C), ccnc,inTg(podocin:GFP) embryos resulted and the foxc1a morphant shows that two glomeruli fail to merge at the midline and in severe pericardial edema and glomerular fi glomerular capillaries are missing (E). Detailed morphology of the glomerular ltration GFP loss (Figure 8, A and C). The pheno- fi fi barrier is displayed at higher magni cation (B, D, and F). In wild-type, ne foot pro- type was significantly rescued by co- cesses, slit diaphragm (arrowhead) and fenestrated endothelium together with GBM injection of heterologous mouse mRNA are clearly visible (B). The lmx1b.1 morphant displays typical effacement (arrowhead), , lack of endothelial fenestration, and a complete loss of the slit diaphragm (D). The (P 0.001) (Figure 8C). Glomerular ultra- foxc1a morphant shows aberrant podocyte foot processes on disorganized GBM and structure of ccnc morphants displayed absence of endothelial cells. Normal cell-cell junctions by the slit diaphragm disap- widespread effacement of podocyte foot pear and instead typical adherens junctions (arrowhead) occur between adjacent processes and lack of the slit diaphragm podocytes (F). cap, capillary; DA, dorsal aorta; E, endothelium; NC, notochord; (Figure 8D). Together, the observed pheno- P, podocyte. Magnification is shown by scale bars 10 mmand500nm. type caused by ccnc MOs suggests that the

J Am Soc Nephrol 25: 2764–2777, 2014 Combinatorial Control of Podocin Expression 2769 BASIC RESEARCH www.jasn.org

with neighboring binding sites in a FOX: ETS enhancer present in several endothelial- specific genes.36 Accordingly, this principle is likely to apply to a portion of podocyte- specific gene expression. Thus, NPHS2 may represent an ideal gene for test because of its unique expression pattern. Using in vivo zebrafish models, we identified a 49-bp podocyte-specific enhancer that contains two adjacent DNA-binding sites, potentially bound by Lmx1b and FoxC. To claim combinatorial control, several basic points should be addressed: the DNA binding sites of the enhancers, coexpression of transcription factors required in a target cell, and cooperativity of protein-protein as well as protein-DNA. For the binding site, we found that the putative binding motif within the zebrafish nphs2 proximal promoter is highly conserved across species, implying a functional potential. Interestingly, 5- or 7-bp Figure 5. Lmx1b.1 and foxc1a potently induces endogenous nphs2 expression in spacing between two sites represents a major zebrafish. Transient overexpression of lmx1b.1 and foxc1a was made by the Tol2 form. The spacing in the motif may be critical transposon-mediated transgenesis (see Concise Methods). The Tol2-based plasmids in configuration of the DNA-protein com- coexpressing lmx1b.1 and foxc1a at the same time, and expressing the two genes plex. The DNA double-helical periodicity is individually, under the control of the universal EF1a promoter, were injected in Tg 10.4 bp per turn,37 and therefore the interac- (podocin:GFP) embryos. An empty plasmid was injected as a control. Gene expression (DCt) was evaluated by quantitative PCR and presented as fold changes, defined as tion between two transcription factors may 2 mean 2 DCt in tested divided by that in control. Error bars indicate the SEM. Ex- or may not be possible depending on what pression levels of lmx1b.1 and foxc1a in fold changes are indicated in parentheses side of the double helix they bind. By in vitro above corresponding bars, respectively. *P,0.001. EMSA and in vivo mutagenesis analyses, we demonstrate that the two adjacent DNA- binding sites are specifically bound by defect is podocyte-restricted, although ccnc expression occurs Lmx1b and FoxC and are both required for the activation of also in other cell types. transcription, providing molecular basis for the combinatorial binding by two proteins. At the structure level, DNA binding of multiple proteins may lead to various alterations in protein struc- DISCUSSION ture, including the formation of additional secondary structural elements, reorientation of loops, rearrangements of hydrophobic Expression of NPHS2 is highly restricted to podocytes and is cores, and changes of their quaternary structure.35 These alter- constantly active once it is activated during the podocyte de- ations in the stereo-specific complex may highly depend on the velopment.7 Here, we show that podocyte-specific expression cellular microenvironment, and detecting the cobinding of two of NPHS2 or zebrafish nphs2 is combinatorially regulated proteins to DNA as a complex by a conventional EMSA in vitro is by Lmx1b and FoxC through binding to two adjacent DNA- likely to be difficult. binding sites. We designate this cis-acting motif as the Lmx1b- Lmx1b and FoxC2 are both expressed in mammalian FoxC enhancer, in which the forkhead site is bound by FoxC2 podocytes.14,15,24 In frog glomerulus, foxc2 is one of the earli- in mammals and foxc1a in zebrafish. This enhancer is also est expressed transcription factors at stage 20, and lmx1b and present in many other genes. nphs2 simultaneously appear at stage 27.38 In zebrafish, foxc1a Combinatorial control represents an important gene reg- expression appears in podocyte progenitors at 8-somite stage, ulatory mechanism in which multiple transcription factors while nphs2 expressesinmaturepodocytesat1.5dpf.39 In come together to exert specific transcriptional control.35 This agreement with data from mouse knockout studies,14,15 our regulatory manner has been hypothesized for some tissue- zebrafish data support that lmx1b.1 is essential for nphs2ex- restricted expression in multicellular organisms. A recent study pression because the ultrastructural alteration by lmx1b.1 revealed that transcriptional regulation of endothelium-specific knockdown is compatible with the observed pronephros dys- gene expression follows this principle, and specifically that function and with the known role of podocin in podocyte foot FoxC and Ets transcription factors cooperate by interacting process formation.31,33,34 Theroleoffoxc1a in developing

2770 Journal of the American Society of Nephrology J Am Soc Nephrol 25: 2764–2777, 2014 www.jasn.org BASIC RESEARCH

independently on the targets, the phenotypic penetrance by double knockdown is likely to be similar to that by individual knockdowns. Furthermore, in vivo overexpression experiments showed that endogenous expression of nphs2 in zebrafish was potently induced only by co-overexpression of lmx1b.1 and foxc1a, but not by individual overexpression. Taken together, these two experiments strongly support a combinatorial action of the two proteins on the nphs2 enhancer. The LIM domains of Lmx1b me- diate protein-protein interaction and have been shown to interact with LDB1, E47/ shPan1,40 and PAX2.41 LIM-homeodomain proteins might interact combinatorially with other transcription factors in a homomeric or heteromeric fashion, and the formation of higher-order transcriptional-regulator complex may regulate expression in a tissue- specificmanner.42 We thus speculate that fi Figure 6. Characterization of the Lmx1b-FoxC motif in the human NPHS2 promoter. the Nphs2 enhancer motif is bound speci - (A) EMSA. A putative Lmx1b-FoxC motif was identified at 2743 bp in the NPHS2 cally by the homeodomain of Lmx1b and the promoter. Radiolabeled wild-type probes (wt) with the FLAT-F (TTAATAA) and the helix-turn-helix structure of FoxC. The spe- forkhead-binding site (CTAAATA) and recombinant LMX1B, Foxc1, and Foxc2 pro- cific spacing between two sites allows the in- teins were used in EMSA. Gel shift assay shows that LMX1B (lane 2 in LMX1B panel) teraction of two DNA-bound proteins binds to the FLAT-F element. Both Foxc1 and Foxc2 (lanes 5, 8 in FoxC panel) also through the LIM domain of Lmx1b, leading bind to the forkhead site, but this binding of Foxc2 is much stronger than of Foxc1. For to the formation of a regulator complex competition assays, 12.5-, 25-, and 37.5-fold excess unlabeled wild-type (wt) or mu- for activating Nphs2 transcription. In vivo tant probes (mu), indicated with gradients from low to high, were used. Labeled chromatin-immunoprecipitation or in vitro probes were efficiently competed by unlabeled wild-type probes with elevated amounts, but not by unlabeled mutant probes (lanes 3–8 in LMX1B panel; lanes 3–8 co-immunoprecipitation in transfected po- for Foxc1, lanes 10–15 for Foxc2 in FoxC panel). This supports specificity of the docytes is of great help in providing evidence bindings. (B) In vivo evaluation of the human cis-acting motif. A 178-bp motif- for the interaction. The work deserves fur- containing element was subcloned in the Tol2-based cfos-GFP plasmid illustrated in ther exploration. left panel. The plasmid ZP0.2k (Figure 1A) was used as a positive control. GFP ex- We reasoned that the evolutionarily pression (arrow) in zebrafish glomerulus is displayed laterally and dorsally. conserved Lmx1b-FoxC enhancer might regulate many other genes important for glomeruli seems to be more complex. Our data show that the podocyte development and function. Through a genome- foxc1a knockdown is unlikely to affect the podocyte specifica- wide search for the motifs in the promoter regions throughout tion; instead it significantly disrupts podocyte differentiation all human genes, we identified 26 novel podocyte-expressed and recruitment of endothelial cells, suggesting that foxc1a genes, but, to our knowledge, none of them have been plays a role in cross-talking between two types of cells for previously demonstrated to play a functional role in podocytes. functional glomerulus formation in addition to regulating Therefore, we are cautious in characterizing the predicted data. the nphs2 expression. FoxC2/foxc1a is probably involved in To validate podocyte expression of these predicted genes, we regulating VEGF-A gene expression in podocytes and contrib- used two evaluating assays: (1) in vivo reporter expression in utes to the VEGF signaling cascade. zebrafish and (2) endogenous expression in mouse glomeruli, Whether Lmx1b and FoxC cooperatively act on nphs2 en- preferably using double immunofluorescence staining. Two hancer represents a key aspect for a combinatorial control, selected genes—CCNC and MEIS2—for follow-up analysis although they are both required for nphs2 expression. To ad- met the criteria. Podocyte expression of CCNC was further dress their cooperativity, we carried out assays for loss-of- supported by the zebrafish ccnc knockdown, demonstrating function and gain-of-function strategies. First, combinatorial that CCNC is required for podocyte development and normal knockdown of the two genes completely disrupts the podocyte podocyte functions. Together, the Lmx1b-FoxC motif may be development in 40% of morphants, in comparison with no or an efficient predictor to identify novel podocyte-expressed little phenotype by individual knockdown of lmx1b.1 or foxc1a genes, although they are not necessarily podocyte-specific. It using the same doses of MOs. Thus, if lmx1b.1 or foxc1a acts is interesting how a member of the cyclin protein family that is

J Am Soc Nephrol 25: 2764–2777, 2014 Combinatorial Control of Podocin Expression 2771 BASIC RESEARCH www.jasn.org

involved in regulating cell cycle progression plays an important role in terminally differ- entiated podocytes. Cyclins function through activating their partners, cyclin- dependent kinases. The role of cyclin C in the cell cycle is unclear.43 Thus far, Cdk8 and Cdk3 are the only known kinases associated with cyclin C.44,45 Podocytes rapidly lose their characteris- tic and specific protein expression pattern when cultured in vitro.1 To evaluate cis- regulatory elements controlling podocyte gene expression, we therefore reasoned that in vivo models are likely required. In this study, we validate that G0 embryos are suitable for rapid evaluation of potential cis-acting elements in vivo. Interestingly, the human Lmx1b-FoxC motif can be activated in zebrafish podocytes, albeit at a relatively low expression rate. Thus, this system may be useful in identifying other cell type–specific enhancers. In summary, the complex architecture and unique function of podocytes apparently require the cooperation of common transcription factors to achieve specific podocyte gene expression. We show that through binding to a unique DNA motif, Lmx1b and FoxC combinatorially regulate gene expression in podocytes. Our findings also indicate novel podocyte genes coexpressed with Nphs2. Our results provide insights into the transcriptional regulatory mechanisms required for normal podocyte functions and likely also important for renal diseases.

CONCISE METHODS

Zebrafish The wild-type AB zebrafish and the Tg(podocin: GFP) line13 were maintained at the Karolinska Figure 7. Podocyte enhancer activity analyses of the predicted Lmx1b-FoxC motifs in Institute zebrafish core facility. CCNC and MEIS2 promoter. (A) Two sequence logos representing the position weight matrix of the Lmx1b-FoxC motif were used for the genome-wide search. Spacing sizes Transgenic Zebrafish of 5 or 7 nucleotides between two sites were included. (B) In vivo assay for podocyte fi enhancer activity. Colocalization between transient mCherry expression and stable To generate transgenic zebra sh, we used the glomerular GFP expression in living zebrafish was analyzed using confocal microscopy. Tol2 transposon-mediated transgenesis in The zebrafish nphs2 enhancer was used as a positive control (upper panel). Mosaic mCherry expression (red, arrowhead) driven by the motifs of CCNC (middle panel) and MEIS2 (lower panel) shows colocalization (arrow) with glomerular GFP (green, arrow- two distinct bands (arrows), one with ap- head). (C) Confocal images of the mouse kidney section stained for cyclin C (green), proximately 52-kD (predicted molecular mass, nephrin (red), and nucleus with DAPI (blue). An image of cyclin C staining without 52 kD) and one with about 110 kD, in mouse DAPI (lower left panel) is included for assessment of nuclear staining in comparison to whole glomerular lysates (Glom). In nuclear cyclin C staining with DAPI. Arrowhead indicates podocytes, and arrow indicates the extract of HEK293 cells, only a single strong overlap between cyclin C and nephrin. (D) In Western blotting, Meis2 was detected as band with about 110 kD was detected.

2772 Journal of the American Society of Nephrology J Am Soc Nephrol 25: 2764–2777, 2014 www.jasn.org BASIC RESEARCH

Table 1. Candidate podocyte genes identified by a genome-wide search of the Lmx1b-FoxC motif in human and mouse genomes Human Mouse Gene Description Motif Sequence Position Motif Sequence Position ABHD1 TAATTAccctaATAAACA 26418 TATTTATttaatTAATTA 25998 Abhydrolase domain containing 1 ANKRD6 TATTTGTgataacaTAATTA 22998 TAATTAcatgcagATAAACA 27198 Ankyrin repeat domain 6 ATP5H TAATTAcagtgACAAACA 21978 TGTTTGTtttgtttTTATTAA 23178 ATP synthase, H+ transporting, mitochondrial Fo complex, subunit d CASQ2 TAATTAtttagaaATAAACA 29778 TAATTAttttaATAAATA 28518 Calsequestrin 2 (cardiac muscle) CCNC TATTTAGaaaaaTAATTA 21438 TGTTTATgtaagTAATTA 24258 Cyclin C COL6A3 TAATTAtaaaaCCAAACA 27018 TAATTAaaaaaCCAAATA 27798 Collagen, type VI, alpha 3 CYB5R4 TATTTGTatataaaTTATTAA 22218 TATTTGTatatacaTTATTAA 22158 Cytochrome b5 reductase 4 DCAF15 TATTTATtaaatTAATTA 28398 TATTTATtaccaTTATTAA 2838 DDB1 and CUL4 associated factor 15 DUT TGTTTGGtttaataTAATTA 26238 TAATTAtctggATAAACA 25398 Deoxyuridine triphosphatase EREG TTAATAAtttacACAAATA 26418 TGTTTAGtatgaaaTAATTA 24798 Epiregulin FOXA2 TATTTAGctcatcaTTATTAA 28098 TAATTAttataATAAATA 28158 Forkhead box A2 GABRP TATTTATaatcaTTATTAA 29418 TTAATAAtaataATAAATA 22398 g-aminobutyric acid (GABA) A receptor, pi GATA6 TTAATAAtgataATAAATA 24798 TTAATAAtgactCTAAATA 25038 GATA binding protein 6 KIF2B TATTTAGgagatagTTATTAA 25218 TATTTAGaagacaaTTATTAA 26298 Kinesin family member 2B LMBRD2 TATTTATtttctTAATTA 23298 TAATTAgaatttgATAAATA 28758 LMBR1 domain containing 2 MEIS2 TATTTATccctcTAATTA 28938 TATTTATccctcTAATTA 2 9598 Meis homeobox 2 MIR128-1 TAATTAttcaaCCAAATA 21018 TAATTAttcagCCAAATA 21318 MicroRNA 128-1 NPHS2 TTAATAAagaccCTAAATA 2778 TATTTGTtgtctggTAATTA 24138 Nephrosis 2, idiopathic, steroid-resistant (podocin) POGZ TGTTTAGctgagccTAATTA 22338 TGTTTGTgaagcTAATTA 2358 Pogo transposable element with ZNF domain RAB14 TAATTAcaaagATAAATA 26778 TGTTTAGttttactTAATTA 25638 Rab14, member RAS oncogene family SLC16A9 TGTTTAGtatttTAATTA 27138 TTAATAAacaggggATAAACA 22998 Solute carrier family 16, member 9 SOHLH2 TGTTTAGtgaaattTAATTA 29598 TATTTATaaatataTAATTA 22038 Spermatogenesis and oogenesis specific basic helix-loop-helix 2 SRPX2 TATTTGTtgaatTAATTA 21318 TATTTGTtgaatTAATTA 22278 Sushi-repeat containing protein, X-linked 2 STMN4 TGTTTATtttgaaaTAATTA 26958 TATTTATttattgtTAATTA 24078 Stathmin-like 4 TSPAN6 TAATTAattcaACAAATA 22938 TAATTAattcaACAAATA 27798 Tetraspanin 6 VPS37B TATTTGTgatcgccTAATTA 2298 TAATTAaataacaATAAATA 26718 Vacuolar protein sorting 37 homolog B (S. cerevisiae) ZSCAN30 TGTTTAGagcagctTTATTAA 28458 TAATTAagaaaATAAATA 21738 Zinc finger and SCAN domain containing 30

zebrafish as described.46 The Tol2 transposon-based plasmids contain in Supplemental Table 2. An unrelated standard control MO (control- two Tol2 transposable sequences flanking the insertion fragment MO), provided by the manufacturer, was used as a negative control. In sites, and they were comicroinjected, together with the Tol2 trans- addition, a mismatch lmx1b.1 MO was also used as a gene-specific posase mRNA, in one- to two-cell zebrafish embryos. The translated control. About 4–6 ng of MOs were normally injected into the yolk transposase protein from injected mRNA in fertilized eggs catalyzes of one- or two-cell Tg(podocin:GFP) embryos. For knockdown of excision of the Tol2 transposable elements from the plasmid, leading zebrafish ccnc gene, a translation-blocking MO (ATG-ccnc-MO) to stable integration of the excised DNA fragments in the genome. and a splice-blocking MO (E3I3-ccnc-MO) were used. The splice- Generally, the insertion fragment consists of a promoter and a down- blocking efficacy by the E3I3-ccnc-MO was evaluated by using RT- stream reporter gene such as GFP or any cDNA sequences to be ex- PCR. As shown in Figure 8B, an in-frame deletion of exon 3 caused by pressed in zebrafish. In this study, we analyzed glomerular expression this MO at 4 dpf was detected as a decrease in amplicon size (448 bp) of GFP or mCherry in injected G0 embryos at 4 dpf as a rapid in vivo compared with wild-type (533 bp). For the mRNA rescue, mouse ccnc expression system. We showed that despite its mosaic pattern, this mRNA (400 pg), in vitro transcribed from a mouse full-length ccnc transient expression assay accurately reflects expression of germline cDNA plasmid (Origene) using the mMESSAGE mMACHINE kit zebrafish (see Results and Supplemental Figure 1). The Ethics Com- (Ambion), was coinjected with MOs. Embryos injected with 4–6ng mittee of Karolinska Institute has approved the experiments using the control-MO and with 6 ng mismatch lmx1b.1-MO did not produce transgenic manipulation in zebrafish. any discernable pericardial edema, similar to wild-type embryos.

Morpholino-Mediated Knockdown Cloning, Plasmids and Mutagenesis MOs were used to knock down zebrafish genes lmx1b.1, lmx1b.2, For fine-mapping the promoter, the Tol2-based plasmid carrying the foxc1a, foxc1b, and ccnc. The sequences of these MOs used are shown 2.5-kb zebrafish nphs2 promoter fragment was subjected to a series of

J Am Soc Nephrol 25: 2764–2777, 2014 Combinatorial Control of Podocin Expression 2773 BASIC RESEARCH www.jasn.org

digestions at naturally occurring restriction sites (Supplemental Figure 1A), followed by religa- tions. PCR was also used to generate the plasmid carrying the shortest element (ZP-0.1k) between 2110 and 63 bp. For the heterologous promoter analysis and the forkhead site deletion analysis, the elements between 2185 and 262 and between 2185 and 277 were generated by PCR and then subcloned upstream of the mouse c-fos minimal promoter in the Tol2-based pGW-cfos- GFP plasmid, provided by Dr. Andrew S. McCallion (Johns Hopkins University School ofMedicine,Baltimore,MD).Thisplasmid, with some modification, such as replacement of GFP by mCherry, was also used to evaluate cis-acting potentials of putative enhancer motifs in CCNC and MEIS2 in vivo.Inaddition,a mCherry plasmid coupled with zebrafish nphs2 promoter (nphs2-mCherry) was used as a positive control for glomerular colocalization. To induce zebrafish endogenous nphs2 expression, full-length cDNA of zebrafish foxc1a and lmx1b.1 was amplified from cDNA of 4- dpf wild-type embryos and was constructed in the pT2KXIG plasmid,46 in which GFP sequence was replaced by the lmx1b.1-IRES-foxc1a cDNA fragment. This construct contains a Xenopus EF1a enhancer/promoter that strongly drives ubiquitous expression in zebrafish. A pcDNA plasmid encoding human LMX1B was provided by Dr. Brendan Lee (Baylor College of Medicine, Houston, TX). In addition, two pcDNA plasmids expressing mouse Foxc1 and Foxc2 were obtained elsewhere. The point mutations were generated using QuickChange II Site-Direct

glomerulus, fine foot processes of podocytes (arrowhead), fenestrated endothelial cells and GBM are clearly visible (upper panel). At higher magnification (lower panel), the slit diaphragm (arrowhead) is visible. In contrast, Figure 8. Morpholino-mediated knockdown of zebrafish ccnc gene. (A) Individual podocytes in the morphants generated by injection of two ccnc MOs, ATG-ccnc-MO and E3I3-ccnc-MO, in zebrafish embryos injection of the ATG-ccnc-MO exhibit ir- resulted in similar kidney phenotype (pericardial edema and glomerular GFP loss) at 4 regular, abnormally flattened podocyte foot dpf, compared with the control-MO. Pericardial edema (arrowhead) in bright-field processes (arrow in upper panel) and lack of imaging and glomerular GFP signal (arrow) in dark-field imaging are indicated, re- the slit diaphragm (lower panel), suggesting spectively. (B) RT-PCR demonstrated efficacy of ccnc knockdown generated by diffuse podocyte effacement. Normal glo- E3I3-ccnc-MO. At 4 dpf, compared with control mRNA showing a single 533-bp band, merular endothelium in ccnc morphants be- ccnc morphants appear as two bands (533 bp and 448 bp), indicating deletion of the comes invisible at higher magnification (lower 85-bp exon 3 generated by this MO. (C) The phenotype caused by ccnc MOs was panel). Compared with wild-type, GBM shows significantly rescued by coinjection of mouse Ccnc mRNA (400 pg) (P,0.001). The no notable difference (upper panel). cap, cap- phenotype penetrance generated by MOs and mRNA rescue is illustrated by bar illary lumen; E, endothelium; P, podocyte; graphs. Phenotypic number of morphants and total number of morphants are indicated. RBC, red blood cells. Magnification is shown (D) Glomerular ultrastructural analysis of ccnc morphants at 4 dpf. In the wild-type by scale bars 2 mmand500nm.

2774 Journal of the American Society of Nephrology J Am Soc Nephrol 25: 2764–2777, 2014 www.jasn.org BASIC RESEARCH

Mutagenesis kit (Stratagen) according to the manufacturer’sinstruc- before staining in 2% OsO4 in cacodylate buffer for 1 hour at room tions. The primer sequences used for cloning and mutagenesis are temperature. Samples were dehydrated and en bloc staining was per- shown in Supplemental Table 3. formed in 2% uranyl acetate in absolute ethanol for 1 hour at room temperature; samples were then taken through an Epon 812/acetone Quantitative PCR series and embedded at 60°C in pure Epon 812. Thin sections of 70 nm Total RNAwas isolated from a mixture of five whole embryos using the thickness were made on a Leica EM UC6 Ultratome and mounted on RNeasy Mini Kit (Qiagen). The first-strand cDNA synthesis was Formvar-coated copper slot grids. Poststaining was done with 2% carried out using the iScript cDNA synthesis kit (Bio-Rad). Quan- aqueous acetate (pH, 3.5) and Venable and Coggleshall lead citrate. titative PCR was performed on the ABI PRISM 7300 Sequence Grids were analyzed on an FEI TECNAI electron microscope. Detection System using the TaqMan or SYBR Green method (Applied Biosystems). Triplicates for each sample were carried out. The relative Genome-Wide Identification of the Conserved Lmx1b- quantification of gene expression was analyzed using the comparative FoxC Motifs threshold method. Data were presented as mean6SEM 2-DCt. The 59 flanking DNA sequences within 10 kb in length upstream from the transcription start sites of all human and mouse genes were Immunofluorescence Staining and Western Blotting downloaded from the Ensembl databases (http://www.ensembl.org/ Kidneys from C57BL/6 mice were snap-frozen and embedded in downloads.html) and were scanned using the Lmx1b-FoxC motifs. optimal cutting temperature media. Cryosections (8 mm) were post- The position weight matrix for the motif scanning, based on the two fixed with cold acetone for 10 minutes, followed by blocking in 5% motif sequences from zebrafish and human with 5- or 7-bp spacing, normal goat or donkey serum. For immunofluorescence staining, the was shown in Figure 7A. Resulting hits from the two genomes were primary antibodies to cyclin C (1:100, ab2950; Abcam), MEIS2 further analyzed. Final candidates were determined if the hit was (1) (1:100, HPA003256; Sigma-Aldrich) and nephrin (1:200, guinea present in two genomes and (2) protein-coding locus or noncoding pig;AcrisAntibodiesGmbH)wereincubatedat37°Cfor1hour, locus with transcript evidence. Pseudogenes were excluded. followed by 45-minute incubation with corresponding Alexa fluor (Invitrogen) secondary antibodies. Western blotting was performed with standard procedures. Whole glomerular lysates isolated from ACKNOWLEDGMENTS adult C57BL/6 mice using Dynabead perfusion24 and nuclear extract of HEK293 cells were used. The primary antibody to MEIS2 (1:800, We acknowledge Susan Warner and her colleagues at the Karolinska HPA003256; Sigma-Aldrich) was used. The local ethical committee Institute zebrafish core facility for maintaining fish and providing (the North Stockholm district court) approved studies in mice. embryos. Partial results of this study were presented in abstract form at the annual meeting of the American Society of Nephrology in 2012. EMSA This work was supported in part by grants from Foundations of the EMSAs were performed as previously described.47 Recombinant Knut and Alice Wallenberg, Söderberg and Hedlund Foundations, the proteins were in vitro synthesized using the TNT Quick Couple Swedish Research Council, and the Swedish Foundation for Strategic Transcription/Translation System (Promega) according to the man- Research. ufacturer’s protocols. mRNA used for these protein synthesis was transcribed from plasmids expressing LMX1B, lmx1b.1, foxc1a, Foxc1, and Foxc2 using SP6 or T7 polymerase. Specificity of EMSA was evaluated by competition assay, where unlabeled wild-type or DISCLOSURES mutant probes in three titrations of 12.5-fold (0.25 mg), 25-fold None. (0.5 mg), and 37.5-fold (0.75 mg) excess were used as competitor to labeled wild-type probes. Oligonucleotide sequences used for EMSA are provided in Supplemental Table 4. REFERENCES

Confocal Imaging 1. Pavenstädt H, Kriz W, Kretzler M: Cell biology of the glomerular For in vivo imaging of transgenic zebrafish glomerulus, confocal mi- podocyte. Physiol Rev 83: 253–307, 2003 croscopy (Leica TCS SP8) was performed (magnification 320). Larvae 2. Somlo S, Mundel P: Getting a foothold in nephrotic syndrome. Nat – at 5 dpf were anesthetized by 0.1% tricaine and embedded in 1% low- Genet 24: 333 335, 2000 3. Tryggvason K, Wartiovaara J: How does the kidney filter plasma? melt agarose gel. Confocal imaging of mouse kidney immunostaining Physiology (Bethesda) 20: 96–101, 2005 fi 3 was performed using Zeiss LSM 700 (magni cation 63). 4. Tryggvason K, Patrakka J, Wartiovaara J: Hereditary proteinuria syn- dromes and mechanisms of proteinuria. N Engl J Med 354: 1387–1401, Transmission Electron Microscopy 2006 fi Transmission electron microscopy was performed as previously 5. Quaggin SE: Transcriptional regulation of podocyte speci cation and differentiation. Microsc Res Tech 57: 208–211, 2002 48 fl fi fi described. Brie y, larvae were xed in the xation solution buffer 6. Quaggin SE, Kreidberg JA: Development of the renal glomerulus: (2% glutaraldehyde, 0.5% paraformaldehyde, 0.1 M cacodylate, 0.1 M Good neighbors and good fences. Development 135: 609–620, sucrose, 3 mM CaCl2) and washed in 0.1 M cacodylate buffer (pH, 7.4) 2008

J Am Soc Nephrol 25: 2764–2777, 2014 Combinatorial Control of Podocin Expression 2775 BASIC RESEARCH www.jasn.org

7. Boute N, Gribouval O, Roselli S, Benessy F, Lee H, Fuchshuber A, identification of genes implicated in kidney glomerulus development Dahan K, Gubler MC, Niaudet P, Antignac C: NPHS2, encoding the and function. EMBO J 25: 1160–1174, 2006 glomerular protein podocin, is mutated in autosomal recessive steroid- 25. Carlsson P, Mahlapuu M: Forkhead transcription factors: Key players in resistant nephrotic syndrome. Nat Genet 24: 349–354, 2000 development and metabolism. Dev Biol 250: 1–23, 2002 8. Frishberg Y, Rinat C, Megged O, Shapira E, Feinstein S, Raas-Rothschild 26. Miura N, Iida K, Kakinuma H, Yang XL, Sugiyama T: Isolation of the A: Mutations in NPHS2 encoding podocin are a prevalent cause of mouse (MFH-1) and human (FKHL 14) mesenchyme fork head-1 genes steroid-resistant nephrotic syndrome among Israeli-Arab children. reveals conservation of their gene and protein structures. Genomics 41: JAmSocNephrol13: 400–405, 2002 489–492, 1997 9. Karle SM, Uetz B, Ronner V, Glaeser L, Hildebrandt F, Fuchshuber A: 27. Brunskill EW, Georgas K, Rumballe B, Little MH, Potter SS: Defining the Novel mutations in NPHS2 detected in both familial and sporadic molecular character of the developing and adult kidney podocyte. steroid-resistant nephrotic syndrome. J Am Soc Nephrol 13: 388–393, PLoS ONE 6: e24640, 2011 2002 28. Yildirim-Toruner C, Subramanian K, El Manjra L, Chen E, Goldstein S, 10. Schwarz K, Simons M, Reiser J, Saleem MA, Faul C, Kriz W, Shaw AS, Vitale E: A novel frameshift mutation of FOXC2 gene in a family with Holzman LB, Mundel P: Podocin, a raft-associated component of the hereditary lymphedema-distichiasis syndrome associated with renal glomerular slit diaphragm, interacts with CD2AP and nephrin. JClin disease and diabetes mellitus. Am J Med Genet A 131: 281–286, 2004 Invest 108: 1621–1629, 2001 29. Topczewska JM, Topczewski J, Shostak A, Kume T, Solnica-Krezel L, 11. Sellin L, Huber TB, Gerke P, Quack I, Pavenstädt H, Walz G: NEPH1 Hogan BL: The winged helix transcription factor Foxc1a is essential for defines a novel family of podocin interacting proteins. FASEB J 17: somitogenesis in zebrafish. Genes Dev 15: 2483–2493, 2001 115–117, 2003 30. O’Hara FP, Beck E, Barr LK, Wong LL, Kessler DS, Riddle RD: Zebrafish 12. Moeller MJ, Sanden SK, Soofi A, Wiggins RC, Holzman LB: Two gene Lmx1b.1 and Lmx1b.2 are required for maintenance of the isthmic or- fragments that direct podocyte-specific expression in transgenic mice. ganizer. Development 132: 3163–3173, 2005 JAmSocNephrol13: 1561–1567, 2002 31. Kramer-Zucker AG, Wiessner S, Jensen AM, Drummond IA: Organi- 13. He B, Ebarasi L, Hultenby K, Tryggvason K, Betsholtz C: Podocin-green zation of the pronephric filtration apparatus in zebrafish requires fluorescence protein allows visualization and functional analysis of Nephrin, Podocin and the FERM domain protein Mosaic eyes. Dev Biol podocytes. JAmSocNephrol22: 1019–1023, 2011 285: 316–329, 2005 14. Miner JH, Morello R, Andrews KL, Li C, Antignac C, Shaw AS, Lee B: 32. Majumdar A, Drummond IA: The zebrafish floating head mutant Transcriptional induction of slit diaphragm genes by Lmx1b is required demonstrates podocytes play an important role in directing glomerular in podocyte differentiation. JClinInvest109: 1065–1072, 2002 differentiation. Dev Biol 222: 147–157, 2000 15. Rohr C, Prestel J, Heidet L, Hosser H, Kriz W, Johnson RL, Antignac C, 33. Mollet G, Ratelade J, Boyer O, Muda AO, Morisset L, Lavin TA, Kitzis D, Witzgall R: The LIM-homeodomain transcription factor Lmx1b plays a Dallman MJ, Bugeon L, Hubner N, Gubler MC, Antignac C, Esquivel EL: crucial role in podocytes. J Clin Invest 109: 1073–1082, 2002 Podocin inactivation in mature kidneys causes focal segmental glo- 16. Johnson RL, Tabin CJ: Molecular models for vertebrate limb de- merulosclerosis and nephrotic syndrome. JAmSocNephrol20: 2181– velopment. Cell 90: 979–990, 1997 2189, 2009 17. Chen H, Lun Y, Ovchinnikov D, Kokubo H, Oberg KC, Pepicelli CV, Gan 34. Roselli S, Heidet L, Sich M, Henger A, Kretzler M, Gubler MC, Antignac L, Lee B, Johnson RL: Limb and kidney defects in Lmx1b mutant mice C: Early glomerular filtration defect and severe renal disease in podocin- suggest an involvement of LMX1B in human nail patella syndrome. Nat deficient mice. Mol Cell Biol 24: 550–560, 2004 Genet 19: 51–55, 1998 35. Reményi A, Schöler HR, Wilmanns M: Combinatorial control of gene 18. Dreyer SD, Zhou G, Baldini A, Winterpacht A, Zabel B, Cole W, Johnson expression. Nat Struct Mol Biol 11: 812–815, 2004 RL, Lee B: Mutations in LMX1B cause abnormal skeletal patterning and 36. De Val S, Chi NC, Meadows SM, Minovitsky S, Anderson JP, Harris IS, renal dysplasia in nail patella syndrome. Nat Genet 19: 47–50, 1998 Ehlers ML, Agarwal P, Visel A, Xu SM, Pennacchio LA, Dubchak I, Krieg 19. Dreyer SD, Morello R, German MS, Zabel B, Winterpacht A, Lunstrum PA, Stainier DY, Black BL: Combinatorial regulation of endothelial gene GP, Horton WA, Oberg KC, Lee B: LMX1B transactivation and ex- expression by ets and forkhead transcription factors. Cell 135: 1053– pression in nail-patella syndrome. Hum Mol Genet 9: 1067–1074, 1064, 2008 2000 37. Prunell A, Kornberg RD, Lutter L, Klug A, Levitt M, Crick FH: Periodicity 20. Morello R, Zhou G, Dreyer SD, Harvey SJ, Ninomiya Y, Thorner PS, of deoxyribonuclease I digestion of chromatin. Science 204: 855–858, Miner JH, Cole W, Winterpacht A, Zabel B, Oberg KC, Lee B: Regula- 1979 tion of glomerular basement membrane collagen expression by LMX1B 38. White JT, Zhang B, Cerqueira DM, Tran U, Wessely O: Notch signaling, contributes to renal disease in nail patella syndrome. Nat Genet 27: wt1 and foxc2 are key regulators of the podocyte gene regulatory 205–208, 2001 network in Xenopus. Development 137: 1863–1873, 2010 21. German MS, Wang J, Chadwick RB, Rutter WJ: Synergistic activation 39. O’Brien LL, Grimaldi M, Kostun Z, Wingert RA, Selleck R, Davidson AJ: of the insulin gene by a LIM-homeo domain protein and a basic helix- Wt1a, Foxc1a, and the Notch mediator Rbpj physically interact and loop-helix protein: Building a functional insulin minienhancer complex. regulate the formation of podocytes in zebrafish. Dev Biol 358: 318– Genes Dev 6: 2165–2176, 1992 330, 2011 22. Suleiman H, Heudobler D, Raschta AS, Zhao Y, Zhao Q, Hertting I, 40. Jurata LW, Gill GN: Functional analysis of the nuclear LIM domain in- Vitzthum H, Moeller MJ, Holzman LB, Rachel R, Johnson R, Westphal H, teractor NLI. Mol Cell Biol 17: 5688–5698, 1997 Rascle A, Witzgall R: The podocyte-specific inactivation of Lmx1b, Ldb1 41. Marini M, Giacopelli F, Seri M, Ravazzolo R: Interaction of the LMX1B and E2a yields new insight into a transcriptional network in podocytes. and PAX2 gene products suggests possible molecular basis of differ- Dev Biol 304: 701–712, 2007 ential phenotypes in Nail-Patella syndrome. Eur J Hum Genet 13: 789– 23. Dunston JA, Reimschisel T, Ding YQ, Sweeney E, Johnson RL, Chen ZF, 792, 2005 McIntosh I: A neurological phenotype in nail patella syndrome (NPS) 42. Hobert O, Westphal H: Functions of LIM-homeobox genes. Trends patients illuminated by studies of murine Lmx1b expression. Eur J Hum Genet 16: 75–83, 2000 Genet 13: 330–335, 2005 43. Sage J: Cyclin C makes an entry into the cell cycle. Dev Cell 6: 607–608, 24. Takemoto M, He L, Norlin J, Patrakka J, Xiao Z, Petrova T, Bondjers C, 2004 Asp J, Wallgard E, Sun Y, Samuelsson T, Mostad P, Lundin S, Miura N, 44. Ren S, Rollins BJ: Cyclin C/cdk3 promotes Rb-dependent G0 exit. Cell Sado Y, Alitalo K, Quaggin SE, Tryggvason K, Betsholtz C: Large-scale 117: 239–251, 2004

2776 Journal of the American Society of Nephrology J Am Soc Nephrol 25: 2764–2777, 2014 www.jasn.org BASIC RESEARCH

45. Tassan JP, Jaquenoud M, Léopold P, Schultz SJ, Nigg EA: Identifi- conserved endothelial cell-specificenhancer.Dev Biol 275: 424–434, cation of human cyclin-dependent kinase 8, a putative protein ki- 2004 nase partner for cyclin C. Proc Natl Acad Sci U S A 92: 8871–8875, 48. Ebarasi L, He L, Hultenby K, Takemoto M, Betsholtz C, Tryggvason K, 1995 Majumdar A: A reverse genetic screen in the zebrafish identifies crb2b 46. Kawakami K, Takeda H, Kawakami N, Kobayashi M, Matsuda N, as a regulator of the glomerular filtration barrier. Dev Biol 334: 1–9, 2009 Mishina M: A transposon-mediated gene trap approach identifies developmentally regulated genes in zebrafish. Dev Cell 7: 133–144, 2004 47. De Val S, Anderson JP, Heidt AB, Khiem D, Xu SM, Black BL: Mef2c is This article contains supplemental material online at http://jasn.asnjournals. activated directly by Ets transcription factors through an evolutionarily org/lookup/suppl/doi:10.1681/ASN.2012080823/-/DCSupplemental.

J Am Soc Nephrol 25: 2764–2777, 2014 Combinatorial Control of Podocin Expression 2777

Figure S1. GFP expression driven by the 2.5 kb zebrafish nphs2 promoter fragment in injected (G0) and germline (G1) embryos. (A) Genomic structure of the promoter fragment used for GFP expression. The UTR in blue color and the coding region in red color are indicated with frames. (B) Comparison of

GFP expression between G0 embryos and G1 embryos from germline fish at 4 dpf. The pronephric glomerulus is indicated with arrows.

Table S1. DNA sequence analysis of the 5-kb Nphs2 promoter fragment upstream of the transcription start site in different species

Species Potential motif sequence

Primates Bushbaby TAATTAcatatcAAAAATA Human TTAATAAagaccCTAAATA Gibbon TTAATAAagaccCTAAATA Gorilla TTAATAAagaccCTAAATA Macaque TTAATAAagacgCTAAATA Marmoset TTAATAAagaccCTAAATA Orangutan TTAATAAagaccCTAAATA Rodents Guinea Pig TGTTTATtctggaaaaaaaaactcaaaTTATTAA Mouse TATTTGTtgtctggTAATTA Rabbit TAATTAcagaggaatctaaaaGAAAACA Rat TATTTGTtatccggTAATTA Squirrel TAATTActgtattCCCAACA Placental mammals Cow TATTCAGtgagaaaTTATTAA Dog TAATTAaacatGGCAATA Dolphin TAATTAtgTTAAATA Ferret TAATTAaacatGGTAATA Horse TATTGCTaatcttcTAATTA Megabat No Microbat TGTTCATatcctTAATTA Opossum TATTTATtttttTAATTA Pig TATTACTaatcattTAATTA Tasmanian devil TTAATAAttcggcTGAAACA Sauropsida Anole lizard TGTTTTCatctcagGTATTAA Chicken No Fish Coelacanth TATTTAAtatttcTTATTAA Fugu TTAAGAAttaagatgaaACCAATA Medaka TAATTAtttttAACAATA Platyfish TAATTAtgaaaatGCAAATA Stickleback TATTTTGacattTTCTTAA Tetraodon No Zebrafish TAATTAgaagagtATAAACA

Of note, only complete DNA sequence within 5 kb was included for analysis. FLAT-E/F binding consensus: TAATTA/TTAAKAM Forkhead binding consensus: RYMAAYA (K=G/T; M=A/C; R=A/G; Y=C/T)

Table S2. Sequences of primers used for cloning, mutagenesis and qPCR ______zfin_nphs2prom-5: 5´-GGTGATTCTATGCTCTTTGCGCTTTGT zfin_nphs2prom-3: 5´-TTTCTCTATCTCCGCAGGAAGCATCGT zp0.1k_finemap-5: 5´-GGTGTTTCTTCTGTGGAAAG zfin_nphs2prom-3: 5´-TTTCTCTATCTCCGCAGGAAGCATCGT zp0.2_lmxmut-5: 5´-TTCTGTGGAAAGTTACTTAGAAGAGTATAAACACTCCCAC zp0.2_lmxmut-3: 5´-GTGGGAGTGTTTATACTCTTCTAAGTAACTTTCCACAGAA zp_motif-5: 5´-CGGAAGACTAGTCAGGAAAG zp_motif-3: 5´-TGTGGGAGTGTTTATACTCT zp_motif-5: 5´-CGGAAGACTAGTCAGGAAAG zp_motif_del-3: 5´-ACTCTTCTAATTAACTTTCCAC zp0.2_foxmut-5: 5´-ATTAGAAGAGTATAGACACTCCCACATTATCAAATAAATC zp0.2_foxmut-3: 5´-GATTTATTTGATAATGTGGGAGTGTCTATACTCTTCTAAT

GFP_qPCR-5: 5´-ACCACTACCTGAGCACCCAGTC GFP_qPCR-3: 5´-GTCCATGCCGAGAGTGATCC zbactin_qPCR-5: 5´-CGAGCAGGAGATGGGAACC zbactin_qPCR-3: 5´-CAACGGAAACGCTCATTGC zpodocin_qPCR-5: 5´-CGAGAGATACTGGCCCATCA zpodocin_qPCR-3: 5´-CCACTTTAATACCCCACCTG zlmx1b1_qPCR-5: 5´-CCGGGAGAGGAAACTTTACT zlmx1b1_qPCR-3: 5´-ATGGTAAACACACTCCAGCG zfoxc1a_qPCR-5: 5´-GAGGACCGAGGTGTTAAAGA zfoxc1a_qPCR-3: 5´-TAATGTCCTGAATGCGCACG hp_motif-5: 5´-CCCAACTCCTGCTTTCATCA hp_motif-3: 5´-CTCTCTTTGCGATGTGTTTC zfoxc1a_cDNA_AgeI-5: 5´-ACCGGTCGCCACCATGCAGGCGCGCTATTCCGT zfoxc1a_cDNA_ClaI-3: 5´-ATCGATGGTTTGGTCAAAATTTGCTGCAGTCA zlmx1b1_cDNA_AgeI-5: 5´-ACCGGTCGCCACCATGTTGGACGGTATAAAAATCG zlmx1b1_cDNA_ClaI-3: 5´-ATCGATTTCATGAGGCGAAATAGGAGCTCTG hccnc_motif-5: 5´- GGTCTCCACCTACAATGTGA hccnc_motif-3: 5´- GAGCAGCGGAATCAACAGTT hmeis2_motif-5: 5´- TTATGCACATATTTATCCCTCTAA hmeis2_motif_BamHI-3: 3´- GGATCCCACTCTCCTCTTGTAAAGCG zccnc splicing-5: 5´-CTTCTGGCAGAGTTCACATT zccnc splicing-3: 5´-CGTTTACTATTCTCCAAGCC ______Table S3. Sequences of oligonucleotide probes used for EMSA

Zebrafish zfin podocin WT: 5ĆTAGTGTGGAAAGTTAATTAGAAGAGTATAAACACTCCCACATT zfin podocin mutLmx1: 5ĆTAGTGTGGAAAGTTAcTTAGAAGAGTATAAACACTCCCACATT zfin podocin mutFox: 5ĆTAGTGTGGAAAGTTAATTAGAAGAGTATAgACACTCCCACATT zfin podocin mutAll: 5ĆTAGTGTGGAAAGTTAcTTAGAAGAGTATAgACACTCCCACATT Human human podocin WT: 5ĆTAGGGCATAAGCATTAATAAAGACCCTAAATAATAACAGAGAC human podocin mutLmx1: 5ĆTAGGGCATAAGCATTggTgAAGACCCTAAATAATAACAGAGAC human podocin mutFox: 5ĆTAGGGCATAAGCATTAATAAAGACCCTAggTgATGACAGAGAC human podocin mutAll: 5ĆTAGGGCATAAGCATTggTgAAGACCCTAggTgATGACAGAGAC

All probes have CTAG tails at the 5´end for labeling purposes. Mutants are marked in bold and lower case.

Table S4. Sequences of morpholino antisense oligos (MOs) used for zebrafish gene knockdown ______

Control-MO: 5´- CCTCTTACCTCAGTTACAATTTATA (www.gene-tools.com)

ATG-lmx1b1-MO: 5´- CTTCGATTTTTATACCGTCCAACAT (ref. 29)

ATG-lmx1b2-MO: 5´- CCTCAATTTTGATTCCGTCCAGCAT (ref. 29)

Mismatch ATG-lmx1b1-MO: 5´- CaTCcATTTTaATcCCGTCCAcCAT (ref. 29)

ATG-foxc1a-MO: 5´- CCTGCATGACTGCTCTCCAAAACGG (ref. 28)

ATG-foxc1b-MO: 5´- GCATCGTACCCCTTTCTTCGGTACA (ref. 28)

ATG-ccnc-MO: 5´-AACTCTGCCAGAAGTTCCCTGCCAT

E3I3-ccnc-MO: 5´-ACGGCACTGCACTGCTCACCTGGCA ______