DOCSLIB.ORG

Lmx1b and Foxc Combinatorially Regulate Podocin Expression in Podocytes

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Lmx1b and Foxc Combinatorially Regulate Podocin Expression in Podocytes BASIC RESEARCH www.jasn.org Lmx1b and FoxC Combinatorially Regulate Podocin Expression in Podocytes †‡ | Bing He,* Lwaki Ebarasi, Zhe Zhao,§ Jing Guo,* Juha R.M. Ojala,* Kjell Hultenby, Sarah De †‡ Val,§ Christer Betsholtz, and Karl Tryggvason*¶ *Department of Medical Biochemistry and Biophysics, Division of Matrix Biology, and †Department of Medical Biochemistry and Biophysics, Division of Vascular Biology, and |Department of Laboratory Medicine, Division of Clinical Research Centre, Karolinska Institute, Stockholm, Sweden; ‡Department of Immunology, Genetics and Pathology, Rudbeck Laboratory, Uppsala University, Uppsala, Sweden; §Ludwig Institute for Cancer Research, Oxford University, Oxford, United Kingdom; and ¶Cardiovascular & Metabolic Disorders Program, Duke-NUS, Singapore ABSTRACT Podocin is a key protein of the kidney podocyte slit diaphragm protein complex, an important part of the glomerular filtration barrier. Mutations in the human podocin gene NPHS2 cause familial or sporadic forms of renal disease owing to the disruption of filtration barrier integrity. The exclusive expression of NPHS2 in podocytes reflects its unique function and raises interesting questions about its transcriptional regulation. Here, we further define a 2.5-kb zebrafish nphs2 promoter fragment previously described and identify a 49-bp podocyte-specific transcriptional enhancer using Tol2-mediated G0 transgenesis in zebrafish. Within this enhancer, we identified a cis-acting element composed of two adjacent DNA-binding sites (FLAT-E and forkhead) bound by transcription factors Lmx1b and FoxC. In zebrafish, double knockdown of Lmx1b and FoxC orthologs using morpholino doses that caused no or minimal phenotypic changes upon individual knockdown completely disrupted podocyte development in 40% of injected embryos. Co- overexpression of the two genes potently induced endogenous nphs2 expression in zebrafish podocytes. We found that the NPHS2 promoter also contains a cis-acting Lmx1b-FoxC motif that binds LMX1B and FoxC2. Furthermore, a genome-wide search identified several genes that carry the Lmx1b-FoxC motif in their promoter regions. Among these candidates, motif-driven podocyte enhancer activity of CCNC and MEIS2 was functionally analyzed in vivo. Our results show that podocyte expression of some genes is combinatorially regulated by two transcription factors interacting synergistically with a common enhancer. This finding provides insights into transcriptional mechanisms required for normal and pathologic podocyte functions. J Am Soc Nephrol 25: 2764–2777, 2014. doi: 10.1681/ASN.2012080823 Normal glomerular filtration function depends on mutations in podocyte-expressed genes as the un- structural integrity of the filtration barrier. Glo- derlying cause of inherited renal diseases.4 More- merular podocytesplaya key role in establishingand over, recent studies from genetically modified mice maintaining this unique filtration barrier structure. Mature podocytes are characterized by cell cycle Received August 18, 2012. Accepted March 25, 2014. arrest, foot process formation, and the presence of the slit diaphragm,1 which bridges the gaps between Published online ahead of print. Publication date available at the interdigitating foot processes of neighboring www.jasn.org. podocytes and functions as a size-selective filtration Correspondence: Dr. Bing He, Division of Matrix Biology, De- barrier.2,3 For their differentiation, as well as for partment of Medical Biochemistry and Biophysics, Karolinska Institute, 171 77 Stockholm, Sweden. Email: [email protected]. the maintenance of their complex architecture, Dr. Karl Tryggvason, Division of Matrix Biology, Department of podocytes require the expression of several specific Medical Biochemistry and Biophysics, Karolinska Institute, 171 77 genes in a correct spatial and temporal fashion. This Stockholm, Sweden. Email: [email protected] notion is supported by the identification of many Copyright © 2014 by the American Society of Nephrology 2764 ISSN : 1046-6673/2512-2764 JAmSocNephrol25: 2764–2777, 2014 www.jasn.org BASIC RESEARCH and the identification of genes responsible for human in addition to podocytes.24,27 Mutations in FOXC2 cause podocyte diseases have revealed a complex transcriptional lymphedema-distichiasis syndrome, which is characterized by network in podocytes critical for podocyte specification, dif- limb lymphedema and double rows of eyelashes. Lymphedema- ferentiation, and contributing to renal disease pathogenesis.5,6 distichiasis syndrome with proteinuria has been reported in a However, transcriptional regulatory mechanisms by which the family of German-Irish descent,28 suggesting that certain FOXC2 transcription factors govern expression of their target genes in mutations may cause renal disease. Thus, both Lmx1b and podocytes remain incompletely understood. FoxC2 have been implicated in the transcriptional regulation NPHS2 was identified by positional cloning because its of Nphs2. However, the molecular mechanism and potential in- mutations cause familial or sporadic forms of steroid-resistant teraction between these two transcription factors have not been nephrotic syndrome.7–9 Podocin is a key component of the slit addressed previously. diaphragm, where it interacts with nephrin, NEPH1, and In this study, we identified a 49-bp podocyte-specific CD2AP.10,11 In contrast to many other podocyte genes, enhancer in the zebrafish nphs2 promoter. This enhancer NPHS2 is exclusively and constitutively expressed in podocytes.7 contains a conserved cis-acting motif composed of two adja- This likely reflects its unique function, and in particular implies cent DNA-binding sites, combinatorially bound and activated the presence of a podocyte-specific enhancer. A putative en- by two transcription factors Lmx1b and FoxC. We show that hancer element in NPHS2 has been localized within a 2.5-kb the human NPHS2 promoter also contains the cis-acting motif DNA fragment upstream of its transcriptional start site, and it regulated by the mammalian orthologs LMX1B and FoxC2. drives reporter gene expression in transgenic mouse podocytes.12 Further, we genome-wide detected 26 genes carrying the We recently identified a zebrafish podocyte-specific enhancer Lmx1b-FoxC motifs in their promoter regions. Among them, element, which also lies within the 2.5-kb 59 flanking region.13 motif-driven podocyte enhancer activity of CCNC and MEIS2 However, the precise DNA-binding motifs in these regions and was functionally analyzed in vivo. The findings provide insights their potential interaction with specific transcription factors re- into the transcriptional regulatory mechanisms required for main unknown. normal podocyte functions, and for the development of certain Previous studies have shown that Lmx1b is essential for kidney diseases. mouse Nphs2 expression.14,15 Lmx1b is a LIM-homeobox transcription factor that controls dorsal-ventral limb pattern- ing during vertebrae development.16 Mutations in human RESULTS LMX1B cause nail-patella syndrome, which is characterized by skeletal abnormality, nail hypoplasia, and nephropathy.17,18 Identification of a Podocyte-Specific Enhancer by In mice, genetic ablation of Lmx1b leads to loss of Nphs2 ex- Analysis of Reporter Gene Expression in Zebrafish pression14,19 as well as loss of expression of the glomerular Using a 2.5-kb zebrafish nphs2 promoter fragment (Supple- basement membrane (GBM) collagens Col4a3 and Col4a4,20 mental Figure 1A), we previously generated a Tg(podocin: suggesting that Lmx1b potentially acts as a common upstream GFP) zebrafish line, in which green fluorescence protein regulator of these genes through binding to the FLAT ele- (GFP) is exclusively expressed in podocytes.13 To fine-map ments.21 Although this hypothesis is supported by an electro- this 59 sequence by in vivo experiments, we first compared phoresis mobility shift assay (EMSA), conflicting results the GFP expression patterns driven by this promoter between have been reported regarding the ability of a putative Lmx1b- injected G0 and Tg(podocin:GFP) G1 embryos. The two types binding enhancer to activatereportergeneexpression.14,15 of embryos exhibited similar podocyte-specific GFP expression Moreover, Lmx1b is exclusively expressed in the glomerulus pattern at 4 days postfertilization (dpf), despite the expected 22 of the kidney, as well as in other organs, including limb, eye, mosaic expression in G0 embryos (Supplemental Figure 1B). 19,23 and brain, during development. Thus, although Lmx1b is The robust expression was observed in 18%64% of G0 embryos, necessary for podocyte-specific expression of certain genes, it is verified by three independent injections. Thus, we found it plau- not specific to podocytes, nor is it alone sufficient to direct sible to use G0 transgenic zebrafish for a rapid fine-mapping of podocyte-specific gene expression. Authors have argued that the promoter fragment. Lmx1b may interact with coactivators through its LIM do- Further analysis of the 2.5-kb promoter fragment revealed mains,19 and Ldb1 has been shown as a candidate coactivator that deletions from 22.5 kb to an ApaI site situated at 21.0 kb in podocytes.22 However, its role in regulating Nphs2 expres- preserved the podocyte specificity and frequency of GFP ex- sion remains to be determined. pression (Figure 1A). However, further deletion to a Kpn2I site In a previous study, we demonstrated that Foxc22/2 mice, situated at 2185 bp increased the expression rate from 18% to similar to Lmx1b2/2 mice, lose the expression of Nphs2, 33% and also induced a
Load more

Recommended publications
  • 1 Evidence for Gliadin Antibodies As Causative Agents in Schizophrenia
    1 Evidence for gliadin antibodies as causative agents in schizophrenia. C.J.Carter PolygenicPathways, 20 Upper Maze Hill, Saint-Leonard’s on Sea, East Sussex, TN37 0LG [email protected] Tel: 0044 (0)1424 422201 I have no fax Abstract Antibodies to gliadin, a component of gluten, have frequently been reported in schizophrenia patients, and in some cases remission has been noted following the instigation of a gluten free diet. Gliadin is a highly immunogenic protein, and B cell epitopes along its entire immunogenic length are homologous to the products of numerous proteins relevant to schizophrenia (p = 0.012 to 3e-25). These include members of the DISC1 interactome, of glutamate, dopamine and neuregulin signalling networks, and of pathways involved in plasticity, dendritic growth or myelination. Antibodies to gliadin are likely to cross react with these key proteins, as has already been observed with synapsin 1 and calreticulin. Gliadin may thus be a causative agent in schizophrenia, under certain genetic and immunological conditions, producing its effects via antibody mediated knockdown of multiple proteins relevant to the disease process. Because of such homology, an autoimmune response may be sustained by the human antigens that resemble gliadin itself, a scenario supported by many reports of immune activation both in the brain and in lymphocytes in schizophrenia. Gluten free diets and removal of such antibodies may be of therapeutic benefit in certain cases of schizophrenia. 2 Introduction A number of studies from China, Norway, and the USA have reported the presence of gliadin antibodies in schizophrenia 1-5. Gliadin is a component of gluten, intolerance to which is implicated in coeliac disease 6.
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • LMX1B Gene LIM Homeobox Transcription Factor 1 Beta
    LMX1B gene LIM homeobox transcription factor 1 beta Normal Function The LMX1B gene provides instructions for producing a protein that attaches (binds) to specific regions of DNA and regulates the activity of other genes. On the basis of this role, the LMX1B protein is called a transcription factor. The LMX1B protein appears to be particularly important during early embryonic development of the limbs, kidneys, and eyes. Health Conditions Related to Genetic Changes Nail-patella syndrome At least 145 mutations in the LMX1B gene have been found to cause nail-patella syndrome. Most mutations result in the production of an abnormally short, nonfunctional version of the LMX1B protein or change a single protein building block (amino acid). Mutations that substitute one amino acid for another amino acid reduce or eliminate the protein's ability to bind to DNA, disrupting the regulation of other genes during early development. Deletions of the entire LMX1B gene or large portions of the gene have also been shown to cause nail patella syndrome. It is unclear exactly how mutations in the LMX1B gene lead to the signs and symptoms of nail-patella syndrome. Other Names for This Gene • LIM homeo box transcription factor 1, beta • LIM homeobox transcription factor 1, beta • LMX1.2 • LMX1B_HUMAN • MGC138325 • MGC142051 • NPS1 Reprinted from MedlinePlus Genetics (https://medlineplus.gov/genetics/) 1 Additional Information & Resources Tests Listed in the Genetic Testing Registry • Tests of LMX1B (https://www.ncbi.nlm.nih.gov/gtr/all/tests/?term=4010[geneid])
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Phox2a Defines a Developmental Origin of the Anterolateral System in Mice And
    bioRxiv preprint doi: https://doi.org/10.1101/2020.06.10.144659; this version posted June 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Title: Phox2a defines a developmental origin of the anterolateral system in mice and 2 humans 3 4 Authors: R. Brian Roome1,2, Farin B. Bourojeni1,2, Bishakha Mona3, Shima Rastegar- 5 Pouyani1,2, Raphael Blain4, Annie Dumouchel1, Charleen Salesse1, W. Scott Thompson1, 6 Megan Brookbank1, Yorick Gitton4, Lino Tessarollo5, Martyn Goulding6, Jane E. 7 Johnson3,7, Marie Kmita1,9, Alain Chédotal4 and Artur Kania1,2,8,9,#,* 8 9 Affiliations : 10 1Institut de Recherches Cliniques de Montréal (IRCM), Montréal, QC, H2W 1R7, 11 Canada 12 2Integrated Program in Neuroscience, McGill University, Montréal, QC, H3A 2B4, 13 Canada 14 3Department of Neuroscience, UT Southwestern Medical Center, Dallas, TX, 75390, 15 United States 16 4Sorbonne Université, INSERM, CNRS, Institut de la Vision, 17 Rue Moreau, Paris, 17 75012, France 18 5Neural Development Section, Mouse Cancer Genetics Program, National Cancer 19 Institute, Frederick, MD, 21702, United States 20 6Molecular Neurobiology Laboratory, The Salk Institute for Biological Studies, La Jolla, 21 CA, 92037, United States 22 7Department of Pharmacology, UT Southwestern Medical Center, Dallas, TX, 75390, 23 United States 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.06.10.144659; this version posted June 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
    [Show full text]
  • Rbpj-Dependent and -Independent Notch2 Signaling Regulates
    RBPJ-DEPENDENT AND -INDEPENDENT NOTCH2 SIGNALING REGULATES CILIARY BODY DEVELOPMENT IN THE MOUSE EYE By Yi Zhou B.S., Tsinghua University, 2010 Submitted to the graduate degree program in Anatomy and Cell Biology and the Graduate Faculty of the University of Kansas in partial fulfillment of the requirements for the degree of Doctor of Philosophy. ________________________________ Ting Xie, Ph.D., Co-Chair ________________________________ William Kinsey, Ph.D., Co-Chair ________________________________ Dale Abrahamson, Ph.D. ________________________________ Peter Smith, Ph.D. ________________________________ Jerry Workman, Ph.D. Date Defended: Jan 6th, 2016 The Dissertation Committee for Yi Zhou certifies that this is the approved version of the following dissertation: RBPJ-DEPENDENT AND -INDEPENDENT NOTCH2 SIGNALING REGULATES CILIARY BODY DEVELOPMENT IN THE MOUSE EYE ________________________________ Ting Xie, Ph.D., Co-Chair ________________________________ William Kinsey, Ph.D., Co-Chair Date Approved: Jan 15th, 2016 ii ABSTRACT The ciliary body (CB) is a two-layered structure in the anterior eye, which is composed of the pigmented outer ciliary epithelium (OCE) and the non-pigmented inner ciliary epithelium (ICE). It is responsible for aqueous humor secretion and lens accommodation. Despite the important roles in maintaining normal eye functions, its development still remains poorly understood. The Notch signaling pathway is an evolutionarily conserved pathway that has diverse functions during tissue development and homeostasis. Canonical Notch signaling is mediated through the recombination signal binding protein for immunoglobulin kappa J region (RBPJ)-dependent transcription activation and repression. In this study, I have demonstrated that Notch2 and RBPJ are important regulators of CB development by conditionally deleting them in the developing CB.
    [Show full text]
  • A Transcription Factor Code Defines Nine Sensory Interneuron Subtypes in the Mechanosensory Area of the Spinal Cord
    A Transcription Factor Code Defines Nine Sensory Interneuron Subtypes in the Mechanosensory Area of the Spinal Cord Marta Garcia Del Barrio1, Steeve Bourane1, Katja Grossmann1, Roland Schu¨ le2, Stefan Britsch3,4, Dennis D.M. O’Leary1, Martyn Goulding1* 1 Molecular Neurobiology Laboratory, The Salk Institute for Biological Studies, La Jolla, California, United States of America, 2 Urologische Klinik/Frauenklinik und Zentrale Klinische Forschung, Klinikum der Universita¨t Freiburg, Freiburg, Germany, 3 Department of Medical Genetics, Max-Delbru¨ck-Center for Molecular Medicine, Berlin-Buch, Germany, 4 Institute for Molecular and Cellular Anatomy Ulm University, Ulm, Germany Abstract Interneurons in the dorsal spinal cord process and relay innocuous and nociceptive somatosensory information from cutaneous receptors that sense touch, temperature and pain. These neurons display a well-defined organization with respect to their afferent innervation. Nociceptive afferents innervate lamina I and II, while cutaneous mechanosensory afferents primarily innervate sensory interneurons that are located in lamina III–IV. In this study, we outline a combinatorial transcription factor code that defines nine different inhibitory and excitatory interneuron populations in laminae III–IV of the postnatal cord. This transcription factor code reveals a high degree of molecular diversity in the neurons that make up laminae III–IV, and it lays the foundation for systematically analyzing and manipulating these different neuronal populations to assess their function. In addition, we find that many of the transcription factors that are expressed in the dorsal spinal cord at early postnatal times continue to be expressed in the adult, raising questions about their function in mature neurons and opening the door to their genetic manipulation in adult animals.
    [Show full text]
  • Hereditary Hearing Impairment with Cutaneous Abnormalities
    G C A T T A C G G C A T genes Review Hereditary Hearing Impairment with Cutaneous Abnormalities Tung-Lin Lee 1 , Pei-Hsuan Lin 2,3, Pei-Lung Chen 3,4,5,6 , Jin-Bon Hong 4,7,* and Chen-Chi Wu 2,3,5,8,* 1 Department of Medical Education, National Taiwan University Hospital, Taipei City 100, Taiwan; [email protected] 2 Department of Otolaryngology, National Taiwan University Hospital, Taipei 11556, Taiwan; [email protected] 3 Graduate Institute of Clinical Medicine, National Taiwan University College of Medicine, Taipei City 100, Taiwan; [email protected] 4 Graduate Institute of Medical Genomics and Proteomics, National Taiwan University College of Medicine, Taipei City 100, Taiwan 5 Department of Medical Genetics, National Taiwan University Hospital, Taipei 10041, Taiwan 6 Department of Internal Medicine, National Taiwan University Hospital, Taipei 10041, Taiwan 7 Department of Dermatology, National Taiwan University Hospital, Taipei City 100, Taiwan 8 Department of Medical Research, National Taiwan University Biomedical Park Hospital, Hsinchu City 300, Taiwan * Correspondence: [email protected] (J.-B.H.); [email protected] (C.-C.W.) Abstract: Syndromic hereditary hearing impairment (HHI) is a clinically and etiologically diverse condition that has a profound influence on affected individuals and their families. As cutaneous findings are more apparent than hearing-related symptoms to clinicians and, more importantly, to caregivers of affected infants and young individuals, establishing a correlation map of skin manifestations and their underlying genetic causes is key to early identification and diagnosis of syndromic HHI. In this article, we performed a comprehensive PubMed database search on syndromic HHI with cutaneous abnormalities, and reviewed a total of 260 relevant publications.
    [Show full text]
  • A Spectrum of LMX1B Mutations in Nail-Patella Syndrome
    ARTICLE A spectrum of LMX1B mutations in Nail-Patella syndrome: New point mutations, deletion, and evidence of mosaicism in unaffected parents Monica Marini, PhD1, Renata Bocciardi, PhD1, Stefania Gimelli, MS2, Marco Di Duca3, Maria T. Divizia, MD1, Anwar Baban, MD1, Harald Gaspar, MD4, Isabella Mammi, MD5, Livia Garavelli, MD6, Roberto Cerone, MD7, Francesco Emma, MD8, Maria F. Bedeschi, MD9, Romano Tenconi, MD10, Alberto Sensi, MD11, Andrea Salmaggi, MD12, Mario Bengala, MD13, Francesca Mari, MD14, Gianluca Colussi, MD15, Krzysztof Szczaluba, MD16, Stylianos E. Antonarakis, MD2, Marco Seri, MD17, Margherita Lerone, MD1, and Roberto Ravazzolo, MD1,18 Purpose: Nail-Patella syndrome (MIM 161200) is a rare autosomal mosaicism in unaffected parents in two cases, which, to our knowledge, dominant disorder characterized by hypoplastic or absent patellae, dys- are the first reported cases of inheritance of a mutated LMX1B allele in trophic nails, dysplasia of the elbows, and iliac horn. In 40% of cases, Nail-Patella syndrome patients from a mosaic parent. Conclusion: The a glomerular defect is present and, less frequently, ocular damage is study of the described case series provides some original observations observed. Inter- and intrafamilial variable expressivity of the clinical in an “old” genetic disorder. Genet Med 2010:12(7):431–439. phenotype is a common finding. Mutations in the human LMX1B gene Key Words: Nail-Patella syndrome, LMX1B gene, mutation, deletion, have been demonstrated to be responsible for Nail-Patella syndrome in mosaicism around 80% of cases. Methods: Standard polymerase chain reaction and sequencing methods were used for mutation and single nucleotide polymorphism identification and control of cloned sequences.
    [Show full text]
  • Isolation and Growth Factor Inducibility of the Xenopus Laevis Lmx1b Gene
    Int. J. Dev. Biol. 47: 253-262 (2003) Original Article Isolation and growth factor inducibility of the Xenopus laevis Lmx1b gene CAROLINE E. HALDIN, SARJIT NIJJAR1, KARINE MASSÉ, MARK W. BARNETT2 and ELIZABETH A. JONES* Cell and Molecular Development Group, Department of Biological Sciences, Warwick University, Coventry, U.K., 1School of Biosciences, University of Birmingham, U.K. 2Department of Anatomy, University of Edinburgh Medical School, University of Edinburgh, U.K. ABSTRACT This paper reports the cloning of the full length Xenopus laevis Lmx1b gene, Xlmx1b. Xlmx1b is a LIM homeodomain protein with high conservation to homologues identified in human, mouse, hamster and chick. In situ hybridisation and RT-PCR analysis showed that Xlmx1b has a specific temporal expression pattern which can be separated into three main spatial domains. An Xlmx1b probe hybridized to regions of the nervous system from stage 13 onwards; these regions included the placodes and otic vesicles, the eye and specific sets of neurons. Sectioning of in situ hybridised embryos confirmed the location of transcripts as discreet regions of staining in ventro- lateral regions of the neural tube. From stage 27, transcripts could be detected in the capsule of pronephric glomus. Finally, transcripts were detected by Northern blot analysis in the developing fore and hind limbs. Xlmx1b transcripts were also detected by Northern blot analysis in eye, brain, muscle and mesonephros tissue in metamorphosing tadpoles. RT-PCR analysis showed that zygotic expression of Xlmx1b is initiated at stage 10.5 and the temporal sequence of Xlmx1b expression is identical in both neural and presumptive pronephros regions. The effects of the growth factors activin A, retinoic acid (RA) and basic fibroblast growth factor (bFGF) on the regulation of Xlmx1b were also studied.
    [Show full text]
  • Molecular Regulation in Dopaminergic Neuron Development
    International Journal of Molecular Sciences Review Molecular Regulation in Dopaminergic Neuron Development. Cues to Unveil Molecular Pathogenesis and Pharmacological Targets of Neurodegeneration Floriana Volpicelli 1 , Carla Perrone-Capano 1,2 , Gian Carlo Bellenchi 2,3, Luca Colucci-D’Amato 4,* and Umberto di Porzio 2 1 Department of Pharmacy, University of Naples Federico II, 80131 Naples, Italy; fl[email protected] (F.V.); [email protected] (C.P.C.) 2 Institute of Genetics and Biophysics “Adriano Buzzati Traverso”, CNR, 80131 Rome, Italy; [email protected] (G.C.B.); [email protected] (U.d.P.) 3 Department of Systems Medicine, University of Rome Tor Vergata, 00133 Rome, Italy 4 Department of Environmental, Biological and Pharmaceutical Sciences and Technologies, University of Campania “Luigi Vanvitelli”, 81100 Caserta, Italy * Correspondence: [email protected]; Tel.: +39-0823-274577 Received: 28 April 2020; Accepted: 1 June 2020; Published: 3 June 2020 Abstract: The relatively few dopaminergic neurons in the mammalian brain are mostly located in the midbrain and regulate many important neural functions, including motor integration, cognition, emotive behaviors and reward. Therefore, alteration of their function or degeneration leads to severe neurological and neuropsychiatric diseases. Unraveling the mechanisms of midbrain dopaminergic (mDA) phenotype induction and maturation and elucidating the role of the gene network involved in the development and maintenance of these neurons is of pivotal importance to rescue or substitute these cells in order to restore dopaminergic functions. Recently, in addition to morphogens and transcription factors, microRNAs have been identified as critical players to confer mDA identity. The elucidation of the gene network involved in mDA neuron development and function will be crucial to identify early changes of mDA neurons that occur in pre-symptomatic pathological conditions, such as Parkinson’s disease.
    [Show full text]
  • Lmx1a and Lmx1b Function Cooperatively to Regulate Proliferation, Specification, and Differentiation of Midbrain Dopaminergic Progenitors
    The Journal of Neuroscience, August 31, 2011 • 31(35):12413–12425 • 12413 Development/Plasticity/Repair Lmx1a and Lmx1b Function Cooperatively to Regulate Proliferation, Specification, and Differentiation of Midbrain Dopaminergic Progenitors Carol H. Yan,1* Martin Levesque,1* Suzanne Claxton,1 Randy L. Johnson,2 and Siew-Lan Ang1 1Department of Developmental Neurobiology, National Institute for Medical Research, The Ridgeway, London NW7 1AA, United Kingdom, and 2Department of Molecular Genetics, University of Texas M. D. Anderson Cancer Centre, Houston, Texas 77030 LIM homeodomain transcription factors, Lmx1a and Lmx1b, are required for the development of midbrain dopaminergic (mDA) neurons. Lmx1b is required for the specification and maintenance of mDA neurons, primarily due to its role in isthmic organizer development that is essential for the induction of mDA neurons. Here, we conditionally deleted Lmx1b in the ventral neural tube using ShhCre and found that Lmx1b conditional mutant mouse embryos show no defect in the development and maintenance of mDA neurons. In addition, Dreher (Lmx1a mutant) embryos display only a moderate reduction in the number of mDA neurons, suggesting that the related family member Lmx1b might compensate for Lmx1a function. We therefore generated Lmx1a and Lmx1b double mutants. Severe loss of mDA neurons occurred in Lmx1adr/dr;ShhCre/ϩ;Lmx1bf/f double mutants due to essential roles for Lmx1a and Lmx1b in regulating the proliferation and neuronal commitment of mDA progenitors through the expression of Wnt1 and Ngn2, respectively. Lmx1a and Lmx1b also negatively regulate Hes1 expression and consequently cell cycle exit through activation of p27 Kip1 expression. In addition, Lmx1a and Lmx1b also regulate the expression of floor plate genes such as Corin and Slit2 and specification of postmitotic mDA neurons.
    [Show full text]