DOCSLIB.ORG

Lmx1a and Lmx1b Function Cooperatively to Regulate Proliferation, Specification, and Differentiation of Midbrain Dopaminergic Progenitors

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Lmx1a and Lmx1b Function Cooperatively to Regulate Proliferation, Specification, and Differentiation of Midbrain Dopaminergic Progenitors The Journal of Neuroscience, August 31, 2011 • 31(35):12413–12425 • 12413 Development/Plasticity/Repair Lmx1a and Lmx1b Function Cooperatively to Regulate Proliferation, Specification, and Differentiation of Midbrain Dopaminergic Progenitors Carol H. Yan,1* Martin Levesque,1* Suzanne Claxton,1 Randy L. Johnson,2 and Siew-Lan Ang1 1Department of Developmental Neurobiology, National Institute for Medical Research, The Ridgeway, London NW7 1AA, United Kingdom, and 2Department of Molecular Genetics, University of Texas M. D. Anderson Cancer Centre, Houston, Texas 77030 LIM homeodomain transcription factors, Lmx1a and Lmx1b, are required for the development of midbrain dopaminergic (mDA) neurons. Lmx1b is required for the specification and maintenance of mDA neurons, primarily due to its role in isthmic organizer development that is essential for the induction of mDA neurons. Here, we conditionally deleted Lmx1b in the ventral neural tube using ShhCre and found that Lmx1b conditional mutant mouse embryos show no defect in the development and maintenance of mDA neurons. In addition, Dreher (Lmx1a mutant) embryos display only a moderate reduction in the number of mDA neurons, suggesting that the related family member Lmx1b might compensate for Lmx1a function. We therefore generated Lmx1a and Lmx1b double mutants. Severe loss of mDA neurons occurred in Lmx1adr/dr;ShhCre/ϩ;Lmx1bf/f double mutants due to essential roles for Lmx1a and Lmx1b in regulating the proliferation and neuronal commitment of mDA progenitors through the expression of Wnt1 and Ngn2, respectively. Lmx1a and Lmx1b also negatively regulate Hes1 expression and consequently cell cycle exit through activation of p27 Kip1 expression. In addition, Lmx1a and Lmx1b also regulate the expression of floor plate genes such as Corin and Slit2 and specification of postmitotic mDA neurons. These defects were more severe with decreasing gene dosage of Lmx1a and Lmx1b or observed only when all four copies of Lmx1a and Lmx1bgeneswereinactivated.Together,ourresultsdemonstratethatLmx1aandLmx1bfunctioncooperativelytoregulateproliferation, specification, and differentiation of mDA progenitors, including their floor plate-like properties. Introduction code, including expression of Otx2, Foxa1, Foxa2, Lmx1a, and Midbrain dopaminergic (mDA) neurons have diverse roles in Lmx1b. regulating motor and cognitive functions (Bjorklund and Lind- Otx2 is a homeodomain transcription factor required for pat- vall, 1984). Degeneration or dysfunctions of these neurons can terning the mid-hindbrain region (Puelles et al., 2003) and spec- lead to severe neurological disorders such as Parkinson’s disease ification of mDA progenitors (Omodei et al., 2008). Foxa1 and (Lang and Lozano, 1998; Olanow et al., 2003). These neurons are Foxa2 are members of the forkhead/winged helix family of tran- thought to arise from progenitors in the floor plate region of the scription factors required for development and maintenance of caudal diencephalon and the mesencephalon (Marin et al., 2005; mDA neurons in adults (Ferri et al., 2007; Kittappa et al., 2007; Andersson et al., 2006a; Ono et al., 2007). Extrinsic signals, such Lin et al., 2009). Lmx1a and Lmx1b belong to the Lmx group of as sonic hedgehog (Shh), fibroblast growth factor-8 (Fgf8), LIM homeodomain transcription factors and share 64% homol- Wnt1, and transforming growth factor-␤2 (Tgf-␤2) and Tgf␤3 ogy in their overall amino acid composition (Hobert and West- specify mDA progenitor identity (Hynes et al., 1997; Ye et al., phal, 2000). Lmx1a spontaneous mutants dreher (Lmx1adr/dr) 1998; Farkas et al., 2003; Prakash et al., 2006). Consequently, exhibit a complex phenotype, including circling behavior, steril- mDA progenitors are assigned a combined transcription factor ity, pigmentation, and tail abnormalities (Lyons and Wahlsten, 1988; Chizhikov et al., 2006a). Loss- and gain-of-function studies in chick embryos also demonstrate that Lmx1a is an essential Received March 1, 2011; revised June 20, 2011; accepted July 7, 2011. Authorcontributions:C.H.Y.,M.L.,andS.-L.A.designedresearch;C.H.Y.,M.L.,andS.C.performedresearch;R.L.J. determinant of mDA neuron development (Andersson et al., contributed unpublished reagents/analytic tools; C.H.Y., M.L., and S.-L.A. analyzed data; C.H.Y., M.L., and S.-L.A. 2006a). However, only 46% of mDA neurons are lost in wrote the paper. Lmx1adr/dr mutant mouse embryos, suggesting that the related This work was supported by Medical Research Council United Kingdom and by a research grant from Parkinson’s family member Lmx1b may compensate for Lmx1a function United Kingdom (S.-L.A.). We thank members of the laboratory for critical reading of this manuscript, Drs. T. Perlmann and J. Ericson for sharing data prior to publication, and Dr. B. Harfe for generously providing ShhCre/ϩ (Ono et al., 2007). mice. Loss-of-function studies demonstrate that Lmx1b regulates *C.H.Y. and M.L. contributed equally to this work. mid-hindbrain patterning, and consequently severe reduction of Correspondence should be addressed to Siew-Lan Ang, Division of Developmental Neurobiology, National Insti- mDA neuron number is primarily due to early loss of most of the tute for Medical Research, The Ridgeway, London NW7 1AA, UK. E-mail: [email protected]. Ϫ/ Ϫ C. H. Yan’s present address: Department of Biochemistry, University of Hong Kong, Hong Kong. midbrain in Lmx1b mouse embryos (Guo et al., 2007). DOI:10.1523/JNEUROSCI.1077-11.2011 Lmx1b also failed to rescue the loss of mDA neurons in chick Copyright © 2011 the authors 0270-6474/11/3112413-13$15.00/0 embryos with specific downregulation of Lmx1a in the ventral 12414 • J. Neurosci., August 31, 2011 • 31(35):12413–12425 Yan et al. • Lmx1a and Lmx1b Regulate Dopamine Neuron Development midbrain using siRNAs (Andersson et al., 2006a), suggesting that number of cells of the mDA region was obtained by multiplying raw Lmx1b cannot compensate for Lmx1a function in the develop- counts by 12. For E18.5 data, we counted all THϩ neurons from five ment of these neurons. In contrast, Lmx1a and Lmx1b show matching sections of 12 ␮m (one section every six) from wild-type, dr/dr dr/dr cre/ϩ f/f ϭ similar roles in mDA neuron development in gain-of-function Lmx1a , and Lmx1a Shh Lmx1b embryos (n 3 for each studies in mouse embryos (Lin et al., 2009; Nakatani et al., 2010) genotype). The rostral-most level corresponds to mouse brain atlas at bregma Ϫ2.78 mm (Allen Institute for Brain Science). At this level, part and in ES cells (Chung et al., 2009); however, in these experi- of the posterior hypothalamus and the fasciculus retroflexus are located ments, Lmx1b induces Lmx1a expression in mDA cells and a dorsally and medially to the VTA. The posterior-most section corre- specific role of Lmx1b in mDA neuron development remains sponds to bregma Ϫ3.08, where the fasciculus retroflexus forms a round unclear. bundle of fiber located ventrally to the VTA. The total number of em- We therefore investigated whether Lmx1a and Lmx1b func- bryos counted was 74 that were harvested from 24 litters. Quantitative tion cooperatively to regulate mDA neuron development using data represent mean Ϯ SEM for cell counts of the entire midbrain. Two- genetic studies in mice. ShhCre/ϩ;Lmx1bflox/flox embryos (referred tailed Student’s t tests or ANOVA were used to determine statistical to as ShhCre/ϩ;Lmx1bf/f) showed no obvious phenotype in the significance. *p Ͻ 0.05; **p Ͻ 0.01; ***p Ͻ 0.001; N.S., not significant. generation of mDA neurons. In contrast, severe loss of mDA In vivo proliferation assays. Pregnant females received intraperitoneal neurons occurred in Lmx1adr/dr;ShhCre/ϩ;Lmx1bf/f double mu- injection of BrdU (100 mg/kg; Sigma-Aldrich) 1 h before embryos being harvested and fixed with 4% paraformaldehyde. Sections were immuno- tants. Together, our results demonstrate cooperative roles for stained with rat anti-BrdU in combination with mDA cell marker (anti- Lmx1a and Lmxb in regulating proliferation, specification, and Lmx1a or anti-Lmx1b) and/or with anti-Ki67. differentiation of mDA progenitors. Quitting fraction. Twenty-four hours before harvesting embryos, preg- nant females received intraperitoneal injection of BrdU (100 mg/kg; Materials and Methods Sigma-Aldrich). Sections from E11.5 embryos were then triple stained Animals. Lmx1adr/dr mutant mice (B6C3Fe-a/a-Lmx1adr-J; The Jackson for Ki67, BrdU, and Lmx1b. The quitting fraction is obtained by Laboratory), ShhCre/ϩ (Harfe et al., 2004), and Lmx1b floxed (Lmx1bf/f) dividing the number of BrdU-labeled cells that had left the cell cycle Ϫ ϩ ϩ mice (Zhao et al., 2006) were genotyped as previously described (Ki67 BrdU Lmx1b ) by the number of BrdU-labeled cells that ϩ ϩ ϩ (Mishima et al., 2009). All the mice were maintained in a mixed back- were still cycling (Ki67 BrdU Lmx1b ). ground. Conditional Lmx1b mice were generated by intercrossing ShhCre/ϩ and Lmx1bf/f mouse lines. Timed mating was set up for 3 h between dr/ϩ Cre/ϩ f/ϩ dr/ϩ f/f Results Lmx1a ;Shh ;Lmx1b males and Lmx1a ;Lmx1b females for Expression of Lmx1b in mDA progenitors and neurons is not Lmx1a/b double-mutant studies, after which the mice were separated. required for their generation and maintenance The embryos were staged as E0 when a vaginal plug was detected. Tissue analysis. The procedures for whole-mount and section in situ To study the specific effect of Lmx1b on mDA neuron develop- hybridization have been described previously (Conlon and Herrmann, ment without disrupting the isthmic organizer, the Lmx1b floxed
Load more

Recommended publications
  • 1 Evidence for Gliadin Antibodies As Causative Agents in Schizophrenia
    1 Evidence for gliadin antibodies as causative agents in schizophrenia. C.J.Carter PolygenicPathways, 20 Upper Maze Hill, Saint-Leonard’s on Sea, East Sussex, TN37 0LG [email protected] Tel: 0044 (0)1424 422201 I have no fax Abstract Antibodies to gliadin, a component of gluten, have frequently been reported in schizophrenia patients, and in some cases remission has been noted following the instigation of a gluten free diet. Gliadin is a highly immunogenic protein, and B cell epitopes along its entire immunogenic length are homologous to the products of numerous proteins relevant to schizophrenia (p = 0.012 to 3e-25). These include members of the DISC1 interactome, of glutamate, dopamine and neuregulin signalling networks, and of pathways involved in plasticity, dendritic growth or myelination. Antibodies to gliadin are likely to cross react with these key proteins, as has already been observed with synapsin 1 and calreticulin. Gliadin may thus be a causative agent in schizophrenia, under certain genetic and immunological conditions, producing its effects via antibody mediated knockdown of multiple proteins relevant to the disease process. Because of such homology, an autoimmune response may be sustained by the human antigens that resemble gliadin itself, a scenario supported by many reports of immune activation both in the brain and in lymphocytes in schizophrenia. Gluten free diets and removal of such antibodies may be of therapeutic benefit in certain cases of schizophrenia. 2 Introduction A number of studies from China, Norway, and the USA have reported the presence of gliadin antibodies in schizophrenia 1-5. Gliadin is a component of gluten, intolerance to which is implicated in coeliac disease 6.
    [Show full text]
  • Core Transcriptional Regulatory Circuitries in Cancer
    Oncogene (2020) 39:6633–6646 https://doi.org/10.1038/s41388-020-01459-w REVIEW ARTICLE Core transcriptional regulatory circuitries in cancer 1 1,2,3 1 2 1,4,5 Ye Chen ● Liang Xu ● Ruby Yu-Tong Lin ● Markus Müschen ● H. Phillip Koeffler Received: 14 June 2020 / Revised: 30 August 2020 / Accepted: 4 September 2020 / Published online: 17 September 2020 © The Author(s) 2020. This article is published with open access Abstract Transcription factors (TFs) coordinate the on-and-off states of gene expression typically in a combinatorial fashion. Studies from embryonic stem cells and other cell types have revealed that a clique of self-regulated core TFs control cell identity and cell state. These core TFs form interconnected feed-forward transcriptional loops to establish and reinforce the cell-type- specific gene-expression program; the ensemble of core TFs and their regulatory loops constitutes core transcriptional regulatory circuitry (CRC). Here, we summarize recent progress in computational reconstitution and biologic exploration of CRCs across various human malignancies, and consolidate the strategy and methodology for CRC discovery. We also discuss the genetic basis and therapeutic vulnerability of CRC, and highlight new frontiers and future efforts for the study of CRC in cancer. Knowledge of CRC in cancer is fundamental to understanding cancer-specific transcriptional addiction, and should provide important insight to both pathobiology and therapeutics. 1234567890();,: 1234567890();,: Introduction genes. Till now, one critical goal in biology remains to understand the composition and hierarchy of transcriptional Transcriptional regulation is one of the fundamental mole- regulatory network in each specified cell type/lineage.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • LMX1B Gene LIM Homeobox Transcription Factor 1 Beta
    LMX1B gene LIM homeobox transcription factor 1 beta Normal Function The LMX1B gene provides instructions for producing a protein that attaches (binds) to specific regions of DNA and regulates the activity of other genes. On the basis of this role, the LMX1B protein is called a transcription factor. The LMX1B protein appears to be particularly important during early embryonic development of the limbs, kidneys, and eyes. Health Conditions Related to Genetic Changes Nail-patella syndrome At least 145 mutations in the LMX1B gene have been found to cause nail-patella syndrome. Most mutations result in the production of an abnormally short, nonfunctional version of the LMX1B protein or change a single protein building block (amino acid). Mutations that substitute one amino acid for another amino acid reduce or eliminate the protein's ability to bind to DNA, disrupting the regulation of other genes during early development. Deletions of the entire LMX1B gene or large portions of the gene have also been shown to cause nail patella syndrome. It is unclear exactly how mutations in the LMX1B gene lead to the signs and symptoms of nail-patella syndrome. Other Names for This Gene • LIM homeo box transcription factor 1, beta • LIM homeobox transcription factor 1, beta • LMX1.2 • LMX1B_HUMAN • MGC138325 • MGC142051 • NPS1 Reprinted from MedlinePlus Genetics (https://medlineplus.gov/genetics/) 1 Additional Information & Resources Tests Listed in the Genetic Testing Registry • Tests of LMX1B (https://www.ncbi.nlm.nih.gov/gtr/all/tests/?term=4010[geneid])
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Phox2a Defines a Developmental Origin of the Anterolateral System in Mice And
    bioRxiv preprint doi: https://doi.org/10.1101/2020.06.10.144659; this version posted June 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Title: Phox2a defines a developmental origin of the anterolateral system in mice and 2 humans 3 4 Authors: R. Brian Roome1,2, Farin B. Bourojeni1,2, Bishakha Mona3, Shima Rastegar- 5 Pouyani1,2, Raphael Blain4, Annie Dumouchel1, Charleen Salesse1, W. Scott Thompson1, 6 Megan Brookbank1, Yorick Gitton4, Lino Tessarollo5, Martyn Goulding6, Jane E. 7 Johnson3,7, Marie Kmita1,9, Alain Chédotal4 and Artur Kania1,2,8,9,#,* 8 9 Affiliations : 10 1Institut de Recherches Cliniques de Montréal (IRCM), Montréal, QC, H2W 1R7, 11 Canada 12 2Integrated Program in Neuroscience, McGill University, Montréal, QC, H3A 2B4, 13 Canada 14 3Department of Neuroscience, UT Southwestern Medical Center, Dallas, TX, 75390, 15 United States 16 4Sorbonne Université, INSERM, CNRS, Institut de la Vision, 17 Rue Moreau, Paris, 17 75012, France 18 5Neural Development Section, Mouse Cancer Genetics Program, National Cancer 19 Institute, Frederick, MD, 21702, United States 20 6Molecular Neurobiology Laboratory, The Salk Institute for Biological Studies, La Jolla, 21 CA, 92037, United States 22 7Department of Pharmacology, UT Southwestern Medical Center, Dallas, TX, 75390, 23 United States 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.06.10.144659; this version posted June 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
    [Show full text]
  • Rbpj-Dependent and -Independent Notch2 Signaling Regulates
    RBPJ-DEPENDENT AND -INDEPENDENT NOTCH2 SIGNALING REGULATES CILIARY BODY DEVELOPMENT IN THE MOUSE EYE By Yi Zhou B.S., Tsinghua University, 2010 Submitted to the graduate degree program in Anatomy and Cell Biology and the Graduate Faculty of the University of Kansas in partial fulfillment of the requirements for the degree of Doctor of Philosophy. ________________________________ Ting Xie, Ph.D., Co-Chair ________________________________ William Kinsey, Ph.D., Co-Chair ________________________________ Dale Abrahamson, Ph.D. ________________________________ Peter Smith, Ph.D. ________________________________ Jerry Workman, Ph.D. Date Defended: Jan 6th, 2016 The Dissertation Committee for Yi Zhou certifies that this is the approved version of the following dissertation: RBPJ-DEPENDENT AND -INDEPENDENT NOTCH2 SIGNALING REGULATES CILIARY BODY DEVELOPMENT IN THE MOUSE EYE ________________________________ Ting Xie, Ph.D., Co-Chair ________________________________ William Kinsey, Ph.D., Co-Chair Date Approved: Jan 15th, 2016 ii ABSTRACT The ciliary body (CB) is a two-layered structure in the anterior eye, which is composed of the pigmented outer ciliary epithelium (OCE) and the non-pigmented inner ciliary epithelium (ICE). It is responsible for aqueous humor secretion and lens accommodation. Despite the important roles in maintaining normal eye functions, its development still remains poorly understood. The Notch signaling pathway is an evolutionarily conserved pathway that has diverse functions during tissue development and homeostasis. Canonical Notch signaling is mediated through the recombination signal binding protein for immunoglobulin kappa J region (RBPJ)-dependent transcription activation and repression. In this study, I have demonstrated that Notch2 and RBPJ are important regulators of CB development by conditionally deleting them in the developing CB.
    [Show full text]
  • Islet1 and Its Co-Factor Ldb1 Are Expressed in Quiescent Cells of Mouse Intestinal Epithelium
    Islet1 and Its Co-Factor Ldb1 Are Expressed in Quiescent Cells of Mouse Intestinal Epithelium Evgeny Makarev, Marat Gorivodsky* Section on Mammalian Molecular Genetics, Laboratory of Mammalian Genes and Development, Eunice Kennedy Shriver National Institute of Child Health and Human Development, Bethesda, Maryland, United States of America Abstract Islet1 belongs to Lim homeobox (Lhx) gene family which encodes transcription factors that have been conserved in evolution. They form complexes with other transcriptional regulators, among them obligatory co-factors encoded by Ldb genes. Isl1 (Islet1), Lhx and Ldb1 genes play a crucial role in organ patterning, cell fate determination and cell differentiation in both embryonic and adult tissues. In this study we analyzed expression pattern of Isl1 and its co-factor Ldb1 in small intestine. We also studied the biological role of Ldb1 in gut endoderm. Quantitative PCR analysis revealed a relatively high level of expression of Lhx1, Isl1, Isl2, Lmx1a, Ldb1 and Ldb2 mRNAs in the gut tissue as compared to the level of less abundant detectable Lmx1b mRNA. Immunohistochemical studies demonstrated a unique pattern of Ldb1 and Islet1 proteins in the crypt compartment. Ldb1 is produced at a low level in majority of crypt cells; but, its abundant expression was demonstrated for some single cells. Islet1 is also expressed in single cells of the crypt. Double staining experiments with Ldb1 and Isl1 antibodies showed that both genes are co-expressed in certain cells of the crypt. Further analysis revealed the Ldb1-expressing cells in the gut are both of endodermal and mesodermal origin. Proliferation studies using antibodies to phospho-histone H3 and Ki-67 antigens, as well as long-term BrdU labeling, showed that cells prominently expressing Ldb1/ Islet1 are quiescent but do not belong to any known terminally differentiated cell lineages.
    [Show full text]
  • A Transcription Factor Code Defines Nine Sensory Interneuron Subtypes in the Mechanosensory Area of the Spinal Cord
    A Transcription Factor Code Defines Nine Sensory Interneuron Subtypes in the Mechanosensory Area of the Spinal Cord Marta Garcia Del Barrio1, Steeve Bourane1, Katja Grossmann1, Roland Schu¨ le2, Stefan Britsch3,4, Dennis D.M. O’Leary1, Martyn Goulding1* 1 Molecular Neurobiology Laboratory, The Salk Institute for Biological Studies, La Jolla, California, United States of America, 2 Urologische Klinik/Frauenklinik und Zentrale Klinische Forschung, Klinikum der Universita¨t Freiburg, Freiburg, Germany, 3 Department of Medical Genetics, Max-Delbru¨ck-Center for Molecular Medicine, Berlin-Buch, Germany, 4 Institute for Molecular and Cellular Anatomy Ulm University, Ulm, Germany Abstract Interneurons in the dorsal spinal cord process and relay innocuous and nociceptive somatosensory information from cutaneous receptors that sense touch, temperature and pain. These neurons display a well-defined organization with respect to their afferent innervation. Nociceptive afferents innervate lamina I and II, while cutaneous mechanosensory afferents primarily innervate sensory interneurons that are located in lamina III–IV. In this study, we outline a combinatorial transcription factor code that defines nine different inhibitory and excitatory interneuron populations in laminae III–IV of the postnatal cord. This transcription factor code reveals a high degree of molecular diversity in the neurons that make up laminae III–IV, and it lays the foundation for systematically analyzing and manipulating these different neuronal populations to assess their function. In addition, we find that many of the transcription factors that are expressed in the dorsal spinal cord at early postnatal times continue to be expressed in the adult, raising questions about their function in mature neurons and opening the door to their genetic manipulation in adult animals.
    [Show full text]
  • Hereditary Hearing Impairment with Cutaneous Abnormalities
    G C A T T A C G G C A T genes Review Hereditary Hearing Impairment with Cutaneous Abnormalities Tung-Lin Lee 1 , Pei-Hsuan Lin 2,3, Pei-Lung Chen 3,4,5,6 , Jin-Bon Hong 4,7,* and Chen-Chi Wu 2,3,5,8,* 1 Department of Medical Education, National Taiwan University Hospital, Taipei City 100, Taiwan; [email protected] 2 Department of Otolaryngology, National Taiwan University Hospital, Taipei 11556, Taiwan; [email protected] 3 Graduate Institute of Clinical Medicine, National Taiwan University College of Medicine, Taipei City 100, Taiwan; [email protected] 4 Graduate Institute of Medical Genomics and Proteomics, National Taiwan University College of Medicine, Taipei City 100, Taiwan 5 Department of Medical Genetics, National Taiwan University Hospital, Taipei 10041, Taiwan 6 Department of Internal Medicine, National Taiwan University Hospital, Taipei 10041, Taiwan 7 Department of Dermatology, National Taiwan University Hospital, Taipei City 100, Taiwan 8 Department of Medical Research, National Taiwan University Biomedical Park Hospital, Hsinchu City 300, Taiwan * Correspondence: [email protected] (J.-B.H.); [email protected] (C.-C.W.) Abstract: Syndromic hereditary hearing impairment (HHI) is a clinically and etiologically diverse condition that has a profound influence on affected individuals and their families. As cutaneous findings are more apparent than hearing-related symptoms to clinicians and, more importantly, to caregivers of affected infants and young individuals, establishing a correlation map of skin manifestations and their underlying genetic causes is key to early identification and diagnosis of syndromic HHI. In this article, we performed a comprehensive PubMed database search on syndromic HHI with cutaneous abnormalities, and reviewed a total of 260 relevant publications.
    [Show full text]
  • Fig1-13Tab1-5.Pdf
    Supplementary Information Promoter hypomethylation of EpCAM-regulated bone morphogenetic protein genes in advanced endometrial cancer Ya-Ting Hsu, Fei Gu, Yi-Wen Huang, Joseph Liu, Jianhua Ruan, Rui-Lan Huang, Chiou-Miin Wang, Chun-Liang Chen, Rohit R. Jadhav, Hung-Cheng Lai, David G. Mutch, Paul J. Goodfellow, Ian M. Thompson, Nameer B. Kirma, and Tim Hui-Ming Huang Tables of contents Page Table of contents 2 Supplementary Methods 4 Supplementary Figure S1. Summarized sequencing reads and coverage of MBDCap-seq 8 Supplementary Figure S2. Reproducibility test of MBDCap-seq 10 Supplementary Figure S3. Validation of MBDCap-seq by MassARRAY analysis 11 Supplementary Figure S4. Distribution of differentially methylated regions (DMRs) in endometrial tumors relative to normal control 12 Supplementary Figure S5. Network analysis of differential methylation loci by using Steiner-tree analysis 13 Supplementary Figure S6. DNA methylation distribution in early and late stage of the TCGA endometrial cancer cohort 14 Supplementary Figure S7. Relative expression of BMP genes with EGF treatment in the presence or absence of PI3K/AKT and Raf (MAPK) inhibitors in endometrial cancer cells 15 Supplementary Figure S8. Induction of invasion by EGF in AN3CA and HEC1A cell lines 16 Supplementary Figure S9. Knockdown expression of BMP4 and BMP7 in RL95-2 cells 17 Supplementary Figure S10. Relative expression of BMPs and BMPRs in normal endometrial cell and endometrial cancer cell lines 18 Supplementary Figure S11. Microfluidics-based PCR analysis of EMT gene panel in RL95-2 cells with or without EGF treatment 19 Supplementary Figure S12. Knockdown expression of EpCAM by different shRNA sequences in RL95-2 cells 20 Supplementary Figure S13.
    [Show full text]