Lmx1a and Lmx1b Function Cooperatively to Regulate Proliferation, Specification, and Differentiation of Midbrain Dopaminergic Progenitors
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
1 Evidence for Gliadin Antibodies As Causative Agents in Schizophrenia
1 Evidence for gliadin antibodies as causative agents in schizophrenia. C.J.Carter PolygenicPathways, 20 Upper Maze Hill, Saint-Leonard’s on Sea, East Sussex, TN37 0LG [email protected] Tel: 0044 (0)1424 422201 I have no fax Abstract Antibodies to gliadin, a component of gluten, have frequently been reported in schizophrenia patients, and in some cases remission has been noted following the instigation of a gluten free diet. Gliadin is a highly immunogenic protein, and B cell epitopes along its entire immunogenic length are homologous to the products of numerous proteins relevant to schizophrenia (p = 0.012 to 3e-25). These include members of the DISC1 interactome, of glutamate, dopamine and neuregulin signalling networks, and of pathways involved in plasticity, dendritic growth or myelination. Antibodies to gliadin are likely to cross react with these key proteins, as has already been observed with synapsin 1 and calreticulin. Gliadin may thus be a causative agent in schizophrenia, under certain genetic and immunological conditions, producing its effects via antibody mediated knockdown of multiple proteins relevant to the disease process. Because of such homology, an autoimmune response may be sustained by the human antigens that resemble gliadin itself, a scenario supported by many reports of immune activation both in the brain and in lymphocytes in schizophrenia. Gluten free diets and removal of such antibodies may be of therapeutic benefit in certain cases of schizophrenia. 2 Introduction A number of studies from China, Norway, and the USA have reported the presence of gliadin antibodies in schizophrenia 1-5. Gliadin is a component of gluten, intolerance to which is implicated in coeliac disease 6. -
Core Transcriptional Regulatory Circuitries in Cancer
Oncogene (2020) 39:6633–6646 https://doi.org/10.1038/s41388-020-01459-w REVIEW ARTICLE Core transcriptional regulatory circuitries in cancer 1 1,2,3 1 2 1,4,5 Ye Chen ● Liang Xu ● Ruby Yu-Tong Lin ● Markus Müschen ● H. Phillip Koeffler Received: 14 June 2020 / Revised: 30 August 2020 / Accepted: 4 September 2020 / Published online: 17 September 2020 © The Author(s) 2020. This article is published with open access Abstract Transcription factors (TFs) coordinate the on-and-off states of gene expression typically in a combinatorial fashion. Studies from embryonic stem cells and other cell types have revealed that a clique of self-regulated core TFs control cell identity and cell state. These core TFs form interconnected feed-forward transcriptional loops to establish and reinforce the cell-type- specific gene-expression program; the ensemble of core TFs and their regulatory loops constitutes core transcriptional regulatory circuitry (CRC). Here, we summarize recent progress in computational reconstitution and biologic exploration of CRCs across various human malignancies, and consolidate the strategy and methodology for CRC discovery. We also discuss the genetic basis and therapeutic vulnerability of CRC, and highlight new frontiers and future efforts for the study of CRC in cancer. Knowledge of CRC in cancer is fundamental to understanding cancer-specific transcriptional addiction, and should provide important insight to both pathobiology and therapeutics. 1234567890();,: 1234567890();,: Introduction genes. Till now, one critical goal in biology remains to understand the composition and hierarchy of transcriptional Transcriptional regulation is one of the fundamental mole- regulatory network in each specified cell type/lineage. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1. -
LMX1B Gene LIM Homeobox Transcription Factor 1 Beta
LMX1B gene LIM homeobox transcription factor 1 beta Normal Function The LMX1B gene provides instructions for producing a protein that attaches (binds) to specific regions of DNA and regulates the activity of other genes. On the basis of this role, the LMX1B protein is called a transcription factor. The LMX1B protein appears to be particularly important during early embryonic development of the limbs, kidneys, and eyes. Health Conditions Related to Genetic Changes Nail-patella syndrome At least 145 mutations in the LMX1B gene have been found to cause nail-patella syndrome. Most mutations result in the production of an abnormally short, nonfunctional version of the LMX1B protein or change a single protein building block (amino acid). Mutations that substitute one amino acid for another amino acid reduce or eliminate the protein's ability to bind to DNA, disrupting the regulation of other genes during early development. Deletions of the entire LMX1B gene or large portions of the gene have also been shown to cause nail patella syndrome. It is unclear exactly how mutations in the LMX1B gene lead to the signs and symptoms of nail-patella syndrome. Other Names for This Gene • LIM homeo box transcription factor 1, beta • LIM homeobox transcription factor 1, beta • LMX1.2 • LMX1B_HUMAN • MGC138325 • MGC142051 • NPS1 Reprinted from MedlinePlus Genetics (https://medlineplus.gov/genetics/) 1 Additional Information & Resources Tests Listed in the Genetic Testing Registry • Tests of LMX1B (https://www.ncbi.nlm.nih.gov/gtr/all/tests/?term=4010[geneid]) -
SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line -
Phox2a Defines a Developmental Origin of the Anterolateral System in Mice And
bioRxiv preprint doi: https://doi.org/10.1101/2020.06.10.144659; this version posted June 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Title: Phox2a defines a developmental origin of the anterolateral system in mice and 2 humans 3 4 Authors: R. Brian Roome1,2, Farin B. Bourojeni1,2, Bishakha Mona3, Shima Rastegar- 5 Pouyani1,2, Raphael Blain4, Annie Dumouchel1, Charleen Salesse1, W. Scott Thompson1, 6 Megan Brookbank1, Yorick Gitton4, Lino Tessarollo5, Martyn Goulding6, Jane E. 7 Johnson3,7, Marie Kmita1,9, Alain Chédotal4 and Artur Kania1,2,8,9,#,* 8 9 Affiliations : 10 1Institut de Recherches Cliniques de Montréal (IRCM), Montréal, QC, H2W 1R7, 11 Canada 12 2Integrated Program in Neuroscience, McGill University, Montréal, QC, H3A 2B4, 13 Canada 14 3Department of Neuroscience, UT Southwestern Medical Center, Dallas, TX, 75390, 15 United States 16 4Sorbonne Université, INSERM, CNRS, Institut de la Vision, 17 Rue Moreau, Paris, 17 75012, France 18 5Neural Development Section, Mouse Cancer Genetics Program, National Cancer 19 Institute, Frederick, MD, 21702, United States 20 6Molecular Neurobiology Laboratory, The Salk Institute for Biological Studies, La Jolla, 21 CA, 92037, United States 22 7Department of Pharmacology, UT Southwestern Medical Center, Dallas, TX, 75390, 23 United States 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.06.10.144659; this version posted June 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. -
Rbpj-Dependent and -Independent Notch2 Signaling Regulates
RBPJ-DEPENDENT AND -INDEPENDENT NOTCH2 SIGNALING REGULATES CILIARY BODY DEVELOPMENT IN THE MOUSE EYE By Yi Zhou B.S., Tsinghua University, 2010 Submitted to the graduate degree program in Anatomy and Cell Biology and the Graduate Faculty of the University of Kansas in partial fulfillment of the requirements for the degree of Doctor of Philosophy. ________________________________ Ting Xie, Ph.D., Co-Chair ________________________________ William Kinsey, Ph.D., Co-Chair ________________________________ Dale Abrahamson, Ph.D. ________________________________ Peter Smith, Ph.D. ________________________________ Jerry Workman, Ph.D. Date Defended: Jan 6th, 2016 The Dissertation Committee for Yi Zhou certifies that this is the approved version of the following dissertation: RBPJ-DEPENDENT AND -INDEPENDENT NOTCH2 SIGNALING REGULATES CILIARY BODY DEVELOPMENT IN THE MOUSE EYE ________________________________ Ting Xie, Ph.D., Co-Chair ________________________________ William Kinsey, Ph.D., Co-Chair Date Approved: Jan 15th, 2016 ii ABSTRACT The ciliary body (CB) is a two-layered structure in the anterior eye, which is composed of the pigmented outer ciliary epithelium (OCE) and the non-pigmented inner ciliary epithelium (ICE). It is responsible for aqueous humor secretion and lens accommodation. Despite the important roles in maintaining normal eye functions, its development still remains poorly understood. The Notch signaling pathway is an evolutionarily conserved pathway that has diverse functions during tissue development and homeostasis. Canonical Notch signaling is mediated through the recombination signal binding protein for immunoglobulin kappa J region (RBPJ)-dependent transcription activation and repression. In this study, I have demonstrated that Notch2 and RBPJ are important regulators of CB development by conditionally deleting them in the developing CB. -
Islet1 and Its Co-Factor Ldb1 Are Expressed in Quiescent Cells of Mouse Intestinal Epithelium
Islet1 and Its Co-Factor Ldb1 Are Expressed in Quiescent Cells of Mouse Intestinal Epithelium Evgeny Makarev, Marat Gorivodsky* Section on Mammalian Molecular Genetics, Laboratory of Mammalian Genes and Development, Eunice Kennedy Shriver National Institute of Child Health and Human Development, Bethesda, Maryland, United States of America Abstract Islet1 belongs to Lim homeobox (Lhx) gene family which encodes transcription factors that have been conserved in evolution. They form complexes with other transcriptional regulators, among them obligatory co-factors encoded by Ldb genes. Isl1 (Islet1), Lhx and Ldb1 genes play a crucial role in organ patterning, cell fate determination and cell differentiation in both embryonic and adult tissues. In this study we analyzed expression pattern of Isl1 and its co-factor Ldb1 in small intestine. We also studied the biological role of Ldb1 in gut endoderm. Quantitative PCR analysis revealed a relatively high level of expression of Lhx1, Isl1, Isl2, Lmx1a, Ldb1 and Ldb2 mRNAs in the gut tissue as compared to the level of less abundant detectable Lmx1b mRNA. Immunohistochemical studies demonstrated a unique pattern of Ldb1 and Islet1 proteins in the crypt compartment. Ldb1 is produced at a low level in majority of crypt cells; but, its abundant expression was demonstrated for some single cells. Islet1 is also expressed in single cells of the crypt. Double staining experiments with Ldb1 and Isl1 antibodies showed that both genes are co-expressed in certain cells of the crypt. Further analysis revealed the Ldb1-expressing cells in the gut are both of endodermal and mesodermal origin. Proliferation studies using antibodies to phospho-histone H3 and Ki-67 antigens, as well as long-term BrdU labeling, showed that cells prominently expressing Ldb1/ Islet1 are quiescent but do not belong to any known terminally differentiated cell lineages. -
A Transcription Factor Code Defines Nine Sensory Interneuron Subtypes in the Mechanosensory Area of the Spinal Cord
A Transcription Factor Code Defines Nine Sensory Interneuron Subtypes in the Mechanosensory Area of the Spinal Cord Marta Garcia Del Barrio1, Steeve Bourane1, Katja Grossmann1, Roland Schu¨ le2, Stefan Britsch3,4, Dennis D.M. O’Leary1, Martyn Goulding1* 1 Molecular Neurobiology Laboratory, The Salk Institute for Biological Studies, La Jolla, California, United States of America, 2 Urologische Klinik/Frauenklinik und Zentrale Klinische Forschung, Klinikum der Universita¨t Freiburg, Freiburg, Germany, 3 Department of Medical Genetics, Max-Delbru¨ck-Center for Molecular Medicine, Berlin-Buch, Germany, 4 Institute for Molecular and Cellular Anatomy Ulm University, Ulm, Germany Abstract Interneurons in the dorsal spinal cord process and relay innocuous and nociceptive somatosensory information from cutaneous receptors that sense touch, temperature and pain. These neurons display a well-defined organization with respect to their afferent innervation. Nociceptive afferents innervate lamina I and II, while cutaneous mechanosensory afferents primarily innervate sensory interneurons that are located in lamina III–IV. In this study, we outline a combinatorial transcription factor code that defines nine different inhibitory and excitatory interneuron populations in laminae III–IV of the postnatal cord. This transcription factor code reveals a high degree of molecular diversity in the neurons that make up laminae III–IV, and it lays the foundation for systematically analyzing and manipulating these different neuronal populations to assess their function. In addition, we find that many of the transcription factors that are expressed in the dorsal spinal cord at early postnatal times continue to be expressed in the adult, raising questions about their function in mature neurons and opening the door to their genetic manipulation in adult animals. -
Hereditary Hearing Impairment with Cutaneous Abnormalities
G C A T T A C G G C A T genes Review Hereditary Hearing Impairment with Cutaneous Abnormalities Tung-Lin Lee 1 , Pei-Hsuan Lin 2,3, Pei-Lung Chen 3,4,5,6 , Jin-Bon Hong 4,7,* and Chen-Chi Wu 2,3,5,8,* 1 Department of Medical Education, National Taiwan University Hospital, Taipei City 100, Taiwan; [email protected] 2 Department of Otolaryngology, National Taiwan University Hospital, Taipei 11556, Taiwan; [email protected] 3 Graduate Institute of Clinical Medicine, National Taiwan University College of Medicine, Taipei City 100, Taiwan; [email protected] 4 Graduate Institute of Medical Genomics and Proteomics, National Taiwan University College of Medicine, Taipei City 100, Taiwan 5 Department of Medical Genetics, National Taiwan University Hospital, Taipei 10041, Taiwan 6 Department of Internal Medicine, National Taiwan University Hospital, Taipei 10041, Taiwan 7 Department of Dermatology, National Taiwan University Hospital, Taipei City 100, Taiwan 8 Department of Medical Research, National Taiwan University Biomedical Park Hospital, Hsinchu City 300, Taiwan * Correspondence: [email protected] (J.-B.H.); [email protected] (C.-C.W.) Abstract: Syndromic hereditary hearing impairment (HHI) is a clinically and etiologically diverse condition that has a profound influence on affected individuals and their families. As cutaneous findings are more apparent than hearing-related symptoms to clinicians and, more importantly, to caregivers of affected infants and young individuals, establishing a correlation map of skin manifestations and their underlying genetic causes is key to early identification and diagnosis of syndromic HHI. In this article, we performed a comprehensive PubMed database search on syndromic HHI with cutaneous abnormalities, and reviewed a total of 260 relevant publications. -
Fig1-13Tab1-5.Pdf
Supplementary Information Promoter hypomethylation of EpCAM-regulated bone morphogenetic protein genes in advanced endometrial cancer Ya-Ting Hsu, Fei Gu, Yi-Wen Huang, Joseph Liu, Jianhua Ruan, Rui-Lan Huang, Chiou-Miin Wang, Chun-Liang Chen, Rohit R. Jadhav, Hung-Cheng Lai, David G. Mutch, Paul J. Goodfellow, Ian M. Thompson, Nameer B. Kirma, and Tim Hui-Ming Huang Tables of contents Page Table of contents 2 Supplementary Methods 4 Supplementary Figure S1. Summarized sequencing reads and coverage of MBDCap-seq 8 Supplementary Figure S2. Reproducibility test of MBDCap-seq 10 Supplementary Figure S3. Validation of MBDCap-seq by MassARRAY analysis 11 Supplementary Figure S4. Distribution of differentially methylated regions (DMRs) in endometrial tumors relative to normal control 12 Supplementary Figure S5. Network analysis of differential methylation loci by using Steiner-tree analysis 13 Supplementary Figure S6. DNA methylation distribution in early and late stage of the TCGA endometrial cancer cohort 14 Supplementary Figure S7. Relative expression of BMP genes with EGF treatment in the presence or absence of PI3K/AKT and Raf (MAPK) inhibitors in endometrial cancer cells 15 Supplementary Figure S8. Induction of invasion by EGF in AN3CA and HEC1A cell lines 16 Supplementary Figure S9. Knockdown expression of BMP4 and BMP7 in RL95-2 cells 17 Supplementary Figure S10. Relative expression of BMPs and BMPRs in normal endometrial cell and endometrial cancer cell lines 18 Supplementary Figure S11. Microfluidics-based PCR analysis of EMT gene panel in RL95-2 cells with or without EGF treatment 19 Supplementary Figure S12. Knockdown expression of EpCAM by different shRNA sequences in RL95-2 cells 20 Supplementary Figure S13.