DOCSLIB.ORG

An Activating Mutation in STAT3 Results in Neonatal Diabetes Through Reduced Insulin Synthesis

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
An Activating Mutation in STAT3 Results in Neonatal Diabetes Through Reduced Insulin Synthesis 1022 Diabetes Volume 66, April 2017 Teresa Velayos,1 Rosa Martínez,1 Milagros Alonso,2 Koldo Garcia-Etxebarria,3 Anibal Aguayo,1 Cristina Camarero,2 Inés Urrutia,1 Idoia Martínez de LaPiscina,1 Raquel Barrio,2 Izortze Santin,1 and Luis Castaño1 An Activating Mutation in STAT3 Results in Neonatal Diabetes Through Reduced Insulin Synthesis Diabetes 2017;66:1022–1029 | DOI: 10.2337/db16-0867 Neonatal diabetes mellitus (NDM) is a rare form of (1–3). Genetic studies have allowed the identification of diabetes diagnosed within the first 6 months of life. several causal point mutations and chromosomal aberra- Genetic studies have allowed the identification of sev- tions in ;20 genes implicated in b-cell development, glu- eral genes linked to the development of NDM; however, cose sensing and metabolism, membrane depolarization, genetic causes for ∼20% of the cases remain to be clar- and apoptosis (2). The most frequent cases of NDM are ified. Most cases of NDM involve isolated diabetes, but caused by aberrations in chromosome 6q24 and missense sometimes NDM appears in association with other mutations in the KATP channel genes (e.g., KCNJ11, pathological conditions, including autoimmune dis- ABCC8) and the insulin gene, but still, genetic causes of eases. Recent reports have linked activating mutations at least 20% of NDM cases remain to be clarified (3). in STAT3 with early-onset autoimmune disorders that Most cases of NDM involve isolated diabetes, but some- include diabetes of autoimmune origin, but the func- times NDM appears in association with other pathological tional impact of STAT3-activating mutations have not conditions, including early-onset autoimmune diseases been characterized at the pancreatic b-cell level. By us- ing whole-exome sequencing, we identified a novel mis- (4). The most common of these conditions is immunodys- sense mutation in the binding domain of the STAT3 regulation, polyendocrinopathy, enteropathy, X-linked FOXP3 PATHOPHYSIOLOGY protein in a patient with NDM. The functional analyses syndrome, which is caused by mutations in the showed that the mutation results in an aberrant activa- gene (5,6). More recently, activating mutations in the tion of STAT3, leading to deleterious downstream transcription factor STAT3 have been linked to the devel- effects in pancreatic b-cells. The identified mutation opment of early-onset autoimmune disorder and to iso- leads to hyperinhibition of the transcription factor Isl-1 lated permanent NDM with autoimmune etiology (7). and, consequently, to a decrease in insulin expression. STAT3 is a latent transcription factor activated by extra- These findings represent the first functional indication cellular signaling ligands, such as cytokines, growth fac- of a direct link between an NDM-linked activating muta- tors, and hormones (8,9). This transducer becomes tion in STAT3 and pancreatic b-cell dysfunction. activated in the cytoplasm by Janus kinases to regulate diverse biological functions, including cell differentiation, proliferation, apoptosis, and inflammation (8,9). STAT3 Neonatal diabetes mellitus (NDM) is a rare monogenic can act as a transcriptional activator or inhibitor by inter- form of diabetes characterized by the onset of hypergly- acting with other transcription factors and/or coactivators/ cemia within the first 6 months of life (1–3). Although corepressors, depending on the target promoter (10). In one-half of the cases are transient and can eventually re- the pancreas, STAT3 signaling is required for the correct lapse, permanent cases of NDM require lifelong treatment development and maintenance of endocrine pancreas 1Endocrinology and Diabetes Research Group, Hospital Universitario Cruces, Bio- Received 15 July 2016 and accepted 5 January 2017. Cruces Health Research Institute, CIBERDEM, CIBERER, UPV-EHU, Barakaldo, This article contains Supplementary Data online at http://diabetes Spain .diabetesjournals.org/lookup/suppl/doi:10.2337/db16-0867/-/DC1. 2Pediatrics Endocrinology, Ramon y Cajal University Hospital, Madrid, Spain © 2017 by the American Diabetes Association. Readers may use this article as 3Immunogenetics Research Laboratory, Department of Genetics, Physical Anthro- long as the work is properly cited, the use is educational and not for profit, and the pology and Animal Physiology, BioCruces Health Research Institute, UPV-EHU, work is not altered. More information is available at http://www.diabetesjournals.org/ Leioa, Spain content/license. Corresponding author: Luis Castaño, [email protected], and Izortze Santin, [email protected]. diabetes.diabetesjournals.org Velayos and Associates 1023 (11). In addition, leptin-induced activation of STAT3 plays prioritization strategy and excluded all inherited variants a crucial role in inhibiting insulin secretion in mice (12). on the basis of WES of both parents. Evaluation of the We identified by whole-exome sequencing (WES) a possible functional significance of the identified muta- novel activating mutation in the STAT3 gene linked to tions was performed with prediction software, including NDM among other autoimmune pathologies. The func- SIFT, PolyPhen-2, and MutationTaster. The candidate tional data reveal that the identified mutation in STAT3 variant (p.P330S) identified by WES in the STAT3 dysregulates insulin synthesis through inhibition of the gene (NM_139276) was confirmed by Sanger sequencing. transcriptional regulator insulin gene enhancer binding Culture of INS-1E and EndoC-bH Cells and Cytokine protein, factor 1 (Isl-1). Although activating mutations Treatment in STAT3 have been described to lead to early autoimmu- The rat INS-1E cell line was cultured in RPMI medium as nity by impairing T-cell development (13), this functional previously described (16). The same medium but without indication is the first of a direct link between an NDM- antibiotics was used for transfection experiments. The linked activating mutation in STAT3 and pancreatic b-cell EndoC-bH1 cell line (provided by R. Scharfmann, Univer- dysfunction. sity of Paris) was cultured in DMEM as previously de- scribed (17). The same medium but with 1% FBS and RESEARCH DESIGN AND METHODS without BSA and antibiotics was used for transfection Study Participants and Ethics Statement experiments. INS-1E cells were treated with rat IL-6 For WES, we selected a female patient with NDM with (R&D Systems, Abingdon, U.K.) at a concentration of detectable islet autoantibodies at the age of 3 months. 20 ng/mL for 12 h. This patient, whose clinical case has been previously Expression Plasmids described (14), presented neonatal hypothyroidism with Expression plasmid with the identified mutation (P330S) positive thyroid autoantibodies at birth. Watery diarrhea was generated by using an overexpression plasmid con- developed in the patient at the age of 13 months, and she taining the wild-type (WT) STAT3 cDNA (OriGene Tech- was given a diagnosis of celiac disease (positive gliadin nologies, Rockville, MD), and mutation was introduced by autoantibodies and partial duodenal atrophy). Her subse- using the QuikChange II Site-Directed Mutagenesis Kit quent course was frequently marked by episodes of watery (Agilent Technologies, Santa Clara, CA). diarrhea without blood or mucous. The celiac disease di- agnosis was corrected to collagenous gastritis and colitis Transfection Experiments and Luciferase at the age of 15 years. The patient had an appropriate Reporter Assay growth rate until age 4 years that remarkably decreased Empty, WT, or mutant STAT3 plasmids were transfected over time, with a final height SD score of 23. Initial ge- into INS-1E or EndoC-bH1 cells by using Lipofectamine netic testing by Sanger sequencing excluded potential 2000 lipid reagent (Thermo Fisher Scientific, Chicago, IL) damaging mutations in the KCNJ11, ABCC8, and INS (18). For STAT3 luciferase studies, INS-1E cells were genes. Genomic DNA of the patient was extracted from cotransfected with 200 ng STAT3-responsive dual firefly/ whole blood by using the QIAamp DNA Blood Mini Kit Renilla luciferase Cignal Reporter (QIAGEN). After 24 h, (QIAGEN, Hilden, Germany). The study was approved by cells were left untreated or treated with IL-6 (20 ng/mL) the local ethics committee (Cruces University Hospital, for 12 h, and luciferase activities were assayed by using Barakaldo, Spain), and written informed consent was the Dual-Luciferase Reporter Assay System (Promega, obtained from the patient’s parents. Madison, WI). WES Western Blot and Real-Time PCR Exome enrichment was carried out by using the Nextera Rapid Protein expression was evaluated by Western blot by Capture Expanded Exome Enrichment kit followed by high- using antibodies that target total STAT3 (sc-482; Santa throughput next-generation sequencing in a HiScanSQ (Illumina, Cruz Biotechnologies, Dallas, TX), phospho-STAT3 San Diego, CA) to generate WES in 75-base pair (bp) paired-end (#9507; Cell Signaling, Danvers, MA), Isl-1 (sc-390793; reads. Sequence reads were mapped to the reference human Santa Cruz Biotechnologies), insulin (#8138; Cell Signal- genome (UCSC GRCh37/hg19) by using the WES pipeline ing), and a-tubulin (T9026; Sigma-Aldrich) (used as load- Web tool (15). The same Web tool was used for duplicate ing control). Immunoreactive bands were revealed by removal, base quality recalibrations, single nucleotide using the SuperSignal West Femto chemiluminescent sub- polymorphism (SNP) and deletion/insertion polymor- strate (Thermo Fisher Scientific) and detected by using a phism calling, and annotation.
Load more

Recommended publications
  • 1 Evidence for Gliadin Antibodies As Causative Agents in Schizophrenia
    1 Evidence for gliadin antibodies as causative agents in schizophrenia. C.J.Carter PolygenicPathways, 20 Upper Maze Hill, Saint-Leonard’s on Sea, East Sussex, TN37 0LG [email protected] Tel: 0044 (0)1424 422201 I have no fax Abstract Antibodies to gliadin, a component of gluten, have frequently been reported in schizophrenia patients, and in some cases remission has been noted following the instigation of a gluten free diet. Gliadin is a highly immunogenic protein, and B cell epitopes along its entire immunogenic length are homologous to the products of numerous proteins relevant to schizophrenia (p = 0.012 to 3e-25). These include members of the DISC1 interactome, of glutamate, dopamine and neuregulin signalling networks, and of pathways involved in plasticity, dendritic growth or myelination. Antibodies to gliadin are likely to cross react with these key proteins, as has already been observed with synapsin 1 and calreticulin. Gliadin may thus be a causative agent in schizophrenia, under certain genetic and immunological conditions, producing its effects via antibody mediated knockdown of multiple proteins relevant to the disease process. Because of such homology, an autoimmune response may be sustained by the human antigens that resemble gliadin itself, a scenario supported by many reports of immune activation both in the brain and in lymphocytes in schizophrenia. Gluten free diets and removal of such antibodies may be of therapeutic benefit in certain cases of schizophrenia. 2 Introduction A number of studies from China, Norway, and the USA have reported the presence of gliadin antibodies in schizophrenia 1-5. Gliadin is a component of gluten, intolerance to which is implicated in coeliac disease 6.
    [Show full text]
  • Core Transcriptional Regulatory Circuitries in Cancer
    Oncogene (2020) 39:6633–6646 https://doi.org/10.1038/s41388-020-01459-w REVIEW ARTICLE Core transcriptional regulatory circuitries in cancer 1 1,2,3 1 2 1,4,5 Ye Chen ● Liang Xu ● Ruby Yu-Tong Lin ● Markus Müschen ● H. Phillip Koeffler Received: 14 June 2020 / Revised: 30 August 2020 / Accepted: 4 September 2020 / Published online: 17 September 2020 © The Author(s) 2020. This article is published with open access Abstract Transcription factors (TFs) coordinate the on-and-off states of gene expression typically in a combinatorial fashion. Studies from embryonic stem cells and other cell types have revealed that a clique of self-regulated core TFs control cell identity and cell state. These core TFs form interconnected feed-forward transcriptional loops to establish and reinforce the cell-type- specific gene-expression program; the ensemble of core TFs and their regulatory loops constitutes core transcriptional regulatory circuitry (CRC). Here, we summarize recent progress in computational reconstitution and biologic exploration of CRCs across various human malignancies, and consolidate the strategy and methodology for CRC discovery. We also discuss the genetic basis and therapeutic vulnerability of CRC, and highlight new frontiers and future efforts for the study of CRC in cancer. Knowledge of CRC in cancer is fundamental to understanding cancer-specific transcriptional addiction, and should provide important insight to both pathobiology and therapeutics. 1234567890();,: 1234567890();,: Introduction genes. Till now, one critical goal in biology remains to understand the composition and hierarchy of transcriptional Transcriptional regulation is one of the fundamental mole- regulatory network in each specified cell type/lineage.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Islet1 and Its Co-Factor Ldb1 Are Expressed in Quiescent Cells of Mouse Intestinal Epithelium
    Islet1 and Its Co-Factor Ldb1 Are Expressed in Quiescent Cells of Mouse Intestinal Epithelium Evgeny Makarev, Marat Gorivodsky* Section on Mammalian Molecular Genetics, Laboratory of Mammalian Genes and Development, Eunice Kennedy Shriver National Institute of Child Health and Human Development, Bethesda, Maryland, United States of America Abstract Islet1 belongs to Lim homeobox (Lhx) gene family which encodes transcription factors that have been conserved in evolution. They form complexes with other transcriptional regulators, among them obligatory co-factors encoded by Ldb genes. Isl1 (Islet1), Lhx and Ldb1 genes play a crucial role in organ patterning, cell fate determination and cell differentiation in both embryonic and adult tissues. In this study we analyzed expression pattern of Isl1 and its co-factor Ldb1 in small intestine. We also studied the biological role of Ldb1 in gut endoderm. Quantitative PCR analysis revealed a relatively high level of expression of Lhx1, Isl1, Isl2, Lmx1a, Ldb1 and Ldb2 mRNAs in the gut tissue as compared to the level of less abundant detectable Lmx1b mRNA. Immunohistochemical studies demonstrated a unique pattern of Ldb1 and Islet1 proteins in the crypt compartment. Ldb1 is produced at a low level in majority of crypt cells; but, its abundant expression was demonstrated for some single cells. Islet1 is also expressed in single cells of the crypt. Double staining experiments with Ldb1 and Isl1 antibodies showed that both genes are co-expressed in certain cells of the crypt. Further analysis revealed the Ldb1-expressing cells in the gut are both of endodermal and mesodermal origin. Proliferation studies using antibodies to phospho-histone H3 and Ki-67 antigens, as well as long-term BrdU labeling, showed that cells prominently expressing Ldb1/ Islet1 are quiescent but do not belong to any known terminally differentiated cell lineages.
    [Show full text]
  • Hereditary Hearing Impairment with Cutaneous Abnormalities
    G C A T T A C G G C A T genes Review Hereditary Hearing Impairment with Cutaneous Abnormalities Tung-Lin Lee 1 , Pei-Hsuan Lin 2,3, Pei-Lung Chen 3,4,5,6 , Jin-Bon Hong 4,7,* and Chen-Chi Wu 2,3,5,8,* 1 Department of Medical Education, National Taiwan University Hospital, Taipei City 100, Taiwan; [email protected] 2 Department of Otolaryngology, National Taiwan University Hospital, Taipei 11556, Taiwan; [email protected] 3 Graduate Institute of Clinical Medicine, National Taiwan University College of Medicine, Taipei City 100, Taiwan; [email protected] 4 Graduate Institute of Medical Genomics and Proteomics, National Taiwan University College of Medicine, Taipei City 100, Taiwan 5 Department of Medical Genetics, National Taiwan University Hospital, Taipei 10041, Taiwan 6 Department of Internal Medicine, National Taiwan University Hospital, Taipei 10041, Taiwan 7 Department of Dermatology, National Taiwan University Hospital, Taipei City 100, Taiwan 8 Department of Medical Research, National Taiwan University Biomedical Park Hospital, Hsinchu City 300, Taiwan * Correspondence: [email protected] (J.-B.H.); [email protected] (C.-C.W.) Abstract: Syndromic hereditary hearing impairment (HHI) is a clinically and etiologically diverse condition that has a profound influence on affected individuals and their families. As cutaneous findings are more apparent than hearing-related symptoms to clinicians and, more importantly, to caregivers of affected infants and young individuals, establishing a correlation map of skin manifestations and their underlying genetic causes is key to early identification and diagnosis of syndromic HHI. In this article, we performed a comprehensive PubMed database search on syndromic HHI with cutaneous abnormalities, and reviewed a total of 260 relevant publications.
    [Show full text]
  • Fig1-13Tab1-5.Pdf
    Supplementary Information Promoter hypomethylation of EpCAM-regulated bone morphogenetic protein genes in advanced endometrial cancer Ya-Ting Hsu, Fei Gu, Yi-Wen Huang, Joseph Liu, Jianhua Ruan, Rui-Lan Huang, Chiou-Miin Wang, Chun-Liang Chen, Rohit R. Jadhav, Hung-Cheng Lai, David G. Mutch, Paul J. Goodfellow, Ian M. Thompson, Nameer B. Kirma, and Tim Hui-Ming Huang Tables of contents Page Table of contents 2 Supplementary Methods 4 Supplementary Figure S1. Summarized sequencing reads and coverage of MBDCap-seq 8 Supplementary Figure S2. Reproducibility test of MBDCap-seq 10 Supplementary Figure S3. Validation of MBDCap-seq by MassARRAY analysis 11 Supplementary Figure S4. Distribution of differentially methylated regions (DMRs) in endometrial tumors relative to normal control 12 Supplementary Figure S5. Network analysis of differential methylation loci by using Steiner-tree analysis 13 Supplementary Figure S6. DNA methylation distribution in early and late stage of the TCGA endometrial cancer cohort 14 Supplementary Figure S7. Relative expression of BMP genes with EGF treatment in the presence or absence of PI3K/AKT and Raf (MAPK) inhibitors in endometrial cancer cells 15 Supplementary Figure S8. Induction of invasion by EGF in AN3CA and HEC1A cell lines 16 Supplementary Figure S9. Knockdown expression of BMP4 and BMP7 in RL95-2 cells 17 Supplementary Figure S10. Relative expression of BMPs and BMPRs in normal endometrial cell and endometrial cancer cell lines 18 Supplementary Figure S11. Microfluidics-based PCR analysis of EMT gene panel in RL95-2 cells with or without EGF treatment 19 Supplementary Figure S12. Knockdown expression of EpCAM by different shRNA sequences in RL95-2 cells 20 Supplementary Figure S13.
    [Show full text]
  • Identification of Novel Candidate Genes and Variants for Hearing
    G C A T T A C G G C A T genes Article Identification of Novel Candidate Genes and Variants for Hearing Loss and Temporal Bone Anomalies Regie Lyn P. Santos-Cortez 1,2,3,*, Talitha Karisse L. Yarza 3,4, Tori C. Bootpetch 1, Ma. Leah C. Tantoco 3,4,5, Karen L. Mohlke 6, Teresa Luisa G. Cruz 3,5, Mary Ellen Chiong Perez 7, Abner L. Chan 3,5, Nanette R. Lee 8, Celina Ann M. Tobias-Grasso 9, Maria Rina T. Reyes-Quintos 3,4,5, Eva Maria Cutiongco-de la Paz 10,11 and Charlotte M. Chiong 3,4,5,12,* 1 Department of Otolaryngology—Head and Neck Surgery, School of Medicine, University of Colorado Anschutz Medical Campus, Aurora, CO 80045, USA; [email protected] 2 Center for Children’s Surgery, Children’s Hospital Colorado, Aurora, CO 80045, USA 3 Philippine National Ear Institute, University of the Philippines (UP) Manila–National Institutes of Health (NIH), Manila 1000, Philippines; [email protected] (T.K.L.Y.); [email protected] (M.L.C.T.); [email protected] (T.L.G.C.); [email protected] (A.L.C.); [email protected] (M.R.T.R.-Q.) 4 Newborn Hearing Screening Reference Center, UP Manila—NIH, Manila 1000, Philippines 5 Department of Otorhinolaryngology, UP Manila College of Medicine—Philippine General Hospital (UP-PGH), Manila 1000, Philippines 6 Department of Genetics, University of North Carolina, Chapel Hill, NC 27599, USA; [email protected] 7 Department of Anesthesiology, UP Manila College of Medicine, Manila 1000, Philippines; [email protected] Citation: Santos-Cortez, R.L.P.; 8 Office of Population Studies and Department
    [Show full text]
  • Molecular Regulation in Dopaminergic Neuron Development
    International Journal of Molecular Sciences Review Molecular Regulation in Dopaminergic Neuron Development. Cues to Unveil Molecular Pathogenesis and Pharmacological Targets of Neurodegeneration Floriana Volpicelli 1 , Carla Perrone-Capano 1,2 , Gian Carlo Bellenchi 2,3, Luca Colucci-D’Amato 4,* and Umberto di Porzio 2 1 Department of Pharmacy, University of Naples Federico II, 80131 Naples, Italy; fl[email protected] (F.V.); [email protected] (C.P.C.) 2 Institute of Genetics and Biophysics “Adriano Buzzati Traverso”, CNR, 80131 Rome, Italy; [email protected] (G.C.B.); [email protected] (U.d.P.) 3 Department of Systems Medicine, University of Rome Tor Vergata, 00133 Rome, Italy 4 Department of Environmental, Biological and Pharmaceutical Sciences and Technologies, University of Campania “Luigi Vanvitelli”, 81100 Caserta, Italy * Correspondence: [email protected]; Tel.: +39-0823-274577 Received: 28 April 2020; Accepted: 1 June 2020; Published: 3 June 2020 Abstract: The relatively few dopaminergic neurons in the mammalian brain are mostly located in the midbrain and regulate many important neural functions, including motor integration, cognition, emotive behaviors and reward. Therefore, alteration of their function or degeneration leads to severe neurological and neuropsychiatric diseases. Unraveling the mechanisms of midbrain dopaminergic (mDA) phenotype induction and maturation and elucidating the role of the gene network involved in the development and maintenance of these neurons is of pivotal importance to rescue or substitute these cells in order to restore dopaminergic functions. Recently, in addition to morphogens and transcription factors, microRNAs have been identified as critical players to confer mDA identity. The elucidation of the gene network involved in mDA neuron development and function will be crucial to identify early changes of mDA neurons that occur in pre-symptomatic pathological conditions, such as Parkinson’s disease.
    [Show full text]
  • Ncomms9896.Pdf
    ARTICLE Received 29 Jan 2015 | Accepted 14 Oct 2015 | Published 17 Nov 2015 DOI: 10.1038/ncomms9896 OPEN Generation of functional hippocampal neurons from self-organizing human embryonic stem cell-derived dorsomedial telencephalic tissue Hideya Sakaguchi1,2,3, Taisuke Kadoshima1,w, Mika Soen1, Nobuhiro Narii1, Yoshihito Ishida1,w, Masatoshi Ohgushi1, Jun Takahashi3, Mototsugu Eiraku1,2 & Yoshiki Sasai1,z The developing dorsomedial telencephalon includes the medial pallium, which goes on to form the hippocampus. Generating a reliable source of human hippocampal tissue is an important step for cell-based research into hippocampus-related diseases. Here we show the generation of functional hippocampal granule- and pyramidal-like neurons from self-orga- nizing dorsomedial telencephalic tissue using human embryonic stem cells (hESCs). First, we develop a hESC culture method that utilizes bone morphogenetic protein (BMP) and Wnt signalling to induce choroid plexus, the most dorsomedial portion of the telencephalon. Then, we find that titrating BMP and Wnt exposure allowed the self-organization of medial pallium tissues. Following long-term dissociation culture, these dorsomedial telencephalic tissues give rise to Zbtb20 þ /Prox1 þ granule neurons and Zbtb20 þ /KA1 þ pyramidal neurons, both of which were electrically functional with network formation. Thus, we have developed an in vitro model that recapitulates human hippocampus development, allowing the generation of functional hippocampal granule- and pyramidal-like neurons. 1 Laboratory for Organogenesis and Neurogenesis, RIKEN Center for Developmental Biology, 2-2-3 Minatojima-Minamimachi, Chuo-ku, Kobe 650-0047, Japan. 2 Laboratory for in vitro Histogenesis, RIKEN Center for Developmental Biology, 2-2-3 Minatojima-Minamimachi, Chuo-ku, Kobe 650-0047, Japan.
    [Show full text]
  • BMC Biology Biomed Central
    BMC Biology BioMed Central Research article Open Access Classification and nomenclature of all human homeobox genes PeterWHHolland*†1, H Anne F Booth†1 and Elspeth A Bruford2 Address: 1Department of Zoology, University of Oxford, South Parks Road, Oxford, OX1 3PS, UK and 2HUGO Gene Nomenclature Committee, European Bioinformatics Institute (EMBL-EBI), Wellcome Trust Genome Campus, Hinxton, Cambridgeshire, CB10 1SA, UK Email: Peter WH Holland* - [email protected]; H Anne F Booth - [email protected]; Elspeth A Bruford - [email protected] * Corresponding author †Equal contributors Published: 26 October 2007 Received: 30 March 2007 Accepted: 26 October 2007 BMC Biology 2007, 5:47 doi:10.1186/1741-7007-5-47 This article is available from: http://www.biomedcentral.com/1741-7007/5/47 © 2007 Holland et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background: The homeobox genes are a large and diverse group of genes, many of which play important roles in the embryonic development of animals. Increasingly, homeobox genes are being compared between genomes in an attempt to understand the evolution of animal development. Despite their importance, the full diversity of human homeobox genes has not previously been described. Results: We have identified all homeobox genes and pseudogenes in the euchromatic regions of the human genome, finding many unannotated, incorrectly annotated, unnamed, misnamed or misclassified genes and pseudogenes.
    [Show full text]