The Novel Enterochromaffin Marker Lmx1a Regulates Serotonin Biosynthesis in Enteroendocrine Cell Lineages Downstream of Nkx2.2 Stefanie Gross1, Diana C
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
1 Evidence for Gliadin Antibodies As Causative Agents in Schizophrenia
1 Evidence for gliadin antibodies as causative agents in schizophrenia. C.J.Carter PolygenicPathways, 20 Upper Maze Hill, Saint-Leonard’s on Sea, East Sussex, TN37 0LG [email protected] Tel: 0044 (0)1424 422201 I have no fax Abstract Antibodies to gliadin, a component of gluten, have frequently been reported in schizophrenia patients, and in some cases remission has been noted following the instigation of a gluten free diet. Gliadin is a highly immunogenic protein, and B cell epitopes along its entire immunogenic length are homologous to the products of numerous proteins relevant to schizophrenia (p = 0.012 to 3e-25). These include members of the DISC1 interactome, of glutamate, dopamine and neuregulin signalling networks, and of pathways involved in plasticity, dendritic growth or myelination. Antibodies to gliadin are likely to cross react with these key proteins, as has already been observed with synapsin 1 and calreticulin. Gliadin may thus be a causative agent in schizophrenia, under certain genetic and immunological conditions, producing its effects via antibody mediated knockdown of multiple proteins relevant to the disease process. Because of such homology, an autoimmune response may be sustained by the human antigens that resemble gliadin itself, a scenario supported by many reports of immune activation both in the brain and in lymphocytes in schizophrenia. Gluten free diets and removal of such antibodies may be of therapeutic benefit in certain cases of schizophrenia. 2 Introduction A number of studies from China, Norway, and the USA have reported the presence of gliadin antibodies in schizophrenia 1-5. Gliadin is a component of gluten, intolerance to which is implicated in coeliac disease 6. -
Core Transcriptional Regulatory Circuitries in Cancer
Oncogene (2020) 39:6633–6646 https://doi.org/10.1038/s41388-020-01459-w REVIEW ARTICLE Core transcriptional regulatory circuitries in cancer 1 1,2,3 1 2 1,4,5 Ye Chen ● Liang Xu ● Ruby Yu-Tong Lin ● Markus Müschen ● H. Phillip Koeffler Received: 14 June 2020 / Revised: 30 August 2020 / Accepted: 4 September 2020 / Published online: 17 September 2020 © The Author(s) 2020. This article is published with open access Abstract Transcription factors (TFs) coordinate the on-and-off states of gene expression typically in a combinatorial fashion. Studies from embryonic stem cells and other cell types have revealed that a clique of self-regulated core TFs control cell identity and cell state. These core TFs form interconnected feed-forward transcriptional loops to establish and reinforce the cell-type- specific gene-expression program; the ensemble of core TFs and their regulatory loops constitutes core transcriptional regulatory circuitry (CRC). Here, we summarize recent progress in computational reconstitution and biologic exploration of CRCs across various human malignancies, and consolidate the strategy and methodology for CRC discovery. We also discuss the genetic basis and therapeutic vulnerability of CRC, and highlight new frontiers and future efforts for the study of CRC in cancer. Knowledge of CRC in cancer is fundamental to understanding cancer-specific transcriptional addiction, and should provide important insight to both pathobiology and therapeutics. 1234567890();,: 1234567890();,: Introduction genes. Till now, one critical goal in biology remains to understand the composition and hierarchy of transcriptional Transcriptional regulation is one of the fundamental mole- regulatory network in each specified cell type/lineage. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1. -
SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line -
Goblet Cell LRRC26 Regulates BK Channel Activation and Protects Against Colitis in Mice
Goblet cell LRRC26 regulates BK channel activation and protects against colitis in mice Vivian Gonzalez-Pereza,1, Pedro L. Martinez-Espinosaa, Monica Sala-Rabanala, Nikhil Bharadwaja, Xiao-Ming Xiaa, Albert C. Chena,b, David Alvaradoc, Jenny K. Gustafssonc,d,e, Hongzhen Hua, Matthew A. Ciorbab, and Christopher J. Linglea aDepartment of Anesthesiology, Washington University School of Medicine in St. Louis, St. Louis, MO 63110; bMcKelvey School of Engineering, Washington University in St. Louis, St. Louis, MO 63130; cDepartment of Internal Medicine, Division of Gastroenterology, Washington University School of Medicine in St. Louis, St. Louis, MO 63110; dDepartment of Medical Chemistry and Cell Biology, University of Gothenburg, 405 30 Gothenburg, Sweden; and eDepartment of Physiology, University of Gothenburg, 405 30 Gothenburg, Sweden Edited by Richard W. Aldrich, The University of Texas at Austin, Austin, TX, and approved December 21, 2020 (received for review September 16, 2020) Goblet cells (GCs) are specialized cells of the intestinal epithelium Despite this progress, ionic transport in GCs and its implications contributing critically to mucosal homeostasis. One of the func- in GC physiology is a topic that remains poorly understood. tions of GCs is to produce and secrete MUC2, the mucin that forms Here, we address the role of the Ca2+- and voltage-activated K+ the scaffold of the intestinal mucus layer coating the epithelium channel (BK channel) in GCs. and separates the luminal pathogens and commensal microbiota GCs play two primary roles: One related to the maintenance from the host tissues. Although a variety of ion channels and of the mucosal barrier (reviewed in refs. -
The Influence of the Pharmaceutical Industry on Medicine, As Exemplified by Proton Pump Inhibitors
The Influence of the Pharmaceutical Industry on Medicine, as Exemplified by Proton Pump Inhibitors The Influence of the Pharmaceutical Industry on Medicine, as Exemplified by Proton Pump Inhibitors By Helge L. Waldum The Influence of the Pharmaceutical Industry on Medicine, as Exemplified by Proton Pump Inhibitors By Helge L. Waldum This book first published 2020 Cambridge Scholars Publishing Lady Stephenson Library, Newcastle upon Tyne, NE6 2PA, UK British Library Cataloguing in Publication Data A catalogue record for this book is available from the British Library Copyright © 2020 by Helge L. Waldum All rights for this book reserved. No part of this book may be reproduced, stored in a retrieval system, or transmitted, in any form or by any means, electronic, mechanical, photocopying, recording or otherwise, without the prior permission of the copyright owner. ISBN (10): 1-5275-5882-7 ISBN (13): 978-1-5275-5882-3 CONTENTS Acknowledgements .................................................................................. vii Preface ....................................................................................................... ix Chapter 1 .................................................................................................... 1 Background References ............................................................................................. 7 Chapter 2 .................................................................................................... 9 Gastric Juice and its Function Regulation of gastric acid secretion -
The Relationship Between Duodenal Enterochromaffin Cell Distribution
The Relationship Between Duodenal Enterochromaffin Cell Distribution and Degree of Inflammatory Bowel Disease (IBD) In Dogs 1 2 2 2 3 2 2 Twito, R., Famigli Bergamini,, P., Galiazzo, G., Peli, A., Cocchi, M., Bettini, G., Chiocchetti, R., Bresciani, F.2 and Pietra, M.2 * 1 Private Practitioner, Tierklinik Dr. Krauß, Düsseldorf GmbH, Germany. 2 Departement of Veterinary Medical Sciences, School of Agriculture and Veterinary Medicine, University of Bologna, Ozzano dell’Emilia (BO), Italy. 3 L.U.DE.S. University, Lugano, Switzerland. * Corresponding Author: Prof. Marco Pietra, University of Bologna, School of Agriculture and Veterinary Medicine, Department of Veterinary Medical Sciences, Ozzano dell’Emilia (BO), Italy. Tel.+39 051 20 9 7303, Fax +39 051 2097038. Email: [email protected] ABSTRACT Despite numerous studies carried out over the last 15 years in veterinary medicine, the pathogenesis of canine Inflammatory Bowel Disease (IBD) has still not been completely elucidated. In particular, unlike what has been demonstrated in human medicine, the influence of serotonin on clinical signs in canine IBD has not yet been clarified. The objective of this paper has been to seek a possible correlation between duodenal epithelial distribution of serotonin-producing cells (enterochromaffin cells) and disease-grading parameters (clinical, clinico-pathological, endoscopic and histopathological) in dogs with IBD. The medical records of dogs with a diagnosis of IBD were retrospectively reviewed and 21 client-owned dogs with a diagnosis of IBD were registered. Clinical score (by Canine Chronic Enteropathy Clinical Activity Index), laboratory examinations (albumin, total cholesterol, folate, cobalamin), endoscopic score and histopathological score, were compared by regression analysis with duodenal enterochromaffin cell percentage. -
Islet1 and Its Co-Factor Ldb1 Are Expressed in Quiescent Cells of Mouse Intestinal Epithelium
Islet1 and Its Co-Factor Ldb1 Are Expressed in Quiescent Cells of Mouse Intestinal Epithelium Evgeny Makarev, Marat Gorivodsky* Section on Mammalian Molecular Genetics, Laboratory of Mammalian Genes and Development, Eunice Kennedy Shriver National Institute of Child Health and Human Development, Bethesda, Maryland, United States of America Abstract Islet1 belongs to Lim homeobox (Lhx) gene family which encodes transcription factors that have been conserved in evolution. They form complexes with other transcriptional regulators, among them obligatory co-factors encoded by Ldb genes. Isl1 (Islet1), Lhx and Ldb1 genes play a crucial role in organ patterning, cell fate determination and cell differentiation in both embryonic and adult tissues. In this study we analyzed expression pattern of Isl1 and its co-factor Ldb1 in small intestine. We also studied the biological role of Ldb1 in gut endoderm. Quantitative PCR analysis revealed a relatively high level of expression of Lhx1, Isl1, Isl2, Lmx1a, Ldb1 and Ldb2 mRNAs in the gut tissue as compared to the level of less abundant detectable Lmx1b mRNA. Immunohistochemical studies demonstrated a unique pattern of Ldb1 and Islet1 proteins in the crypt compartment. Ldb1 is produced at a low level in majority of crypt cells; but, its abundant expression was demonstrated for some single cells. Islet1 is also expressed in single cells of the crypt. Double staining experiments with Ldb1 and Isl1 antibodies showed that both genes are co-expressed in certain cells of the crypt. Further analysis revealed the Ldb1-expressing cells in the gut are both of endodermal and mesodermal origin. Proliferation studies using antibodies to phospho-histone H3 and Ki-67 antigens, as well as long-term BrdU labeling, showed that cells prominently expressing Ldb1/ Islet1 are quiescent but do not belong to any known terminally differentiated cell lineages. -
Hereditary Hearing Impairment with Cutaneous Abnormalities
G C A T T A C G G C A T genes Review Hereditary Hearing Impairment with Cutaneous Abnormalities Tung-Lin Lee 1 , Pei-Hsuan Lin 2,3, Pei-Lung Chen 3,4,5,6 , Jin-Bon Hong 4,7,* and Chen-Chi Wu 2,3,5,8,* 1 Department of Medical Education, National Taiwan University Hospital, Taipei City 100, Taiwan; [email protected] 2 Department of Otolaryngology, National Taiwan University Hospital, Taipei 11556, Taiwan; [email protected] 3 Graduate Institute of Clinical Medicine, National Taiwan University College of Medicine, Taipei City 100, Taiwan; [email protected] 4 Graduate Institute of Medical Genomics and Proteomics, National Taiwan University College of Medicine, Taipei City 100, Taiwan 5 Department of Medical Genetics, National Taiwan University Hospital, Taipei 10041, Taiwan 6 Department of Internal Medicine, National Taiwan University Hospital, Taipei 10041, Taiwan 7 Department of Dermatology, National Taiwan University Hospital, Taipei City 100, Taiwan 8 Department of Medical Research, National Taiwan University Biomedical Park Hospital, Hsinchu City 300, Taiwan * Correspondence: [email protected] (J.-B.H.); [email protected] (C.-C.W.) Abstract: Syndromic hereditary hearing impairment (HHI) is a clinically and etiologically diverse condition that has a profound influence on affected individuals and their families. As cutaneous findings are more apparent than hearing-related symptoms to clinicians and, more importantly, to caregivers of affected infants and young individuals, establishing a correlation map of skin manifestations and their underlying genetic causes is key to early identification and diagnosis of syndromic HHI. In this article, we performed a comprehensive PubMed database search on syndromic HHI with cutaneous abnormalities, and reviewed a total of 260 relevant publications. -
Fig1-13Tab1-5.Pdf
Supplementary Information Promoter hypomethylation of EpCAM-regulated bone morphogenetic protein genes in advanced endometrial cancer Ya-Ting Hsu, Fei Gu, Yi-Wen Huang, Joseph Liu, Jianhua Ruan, Rui-Lan Huang, Chiou-Miin Wang, Chun-Liang Chen, Rohit R. Jadhav, Hung-Cheng Lai, David G. Mutch, Paul J. Goodfellow, Ian M. Thompson, Nameer B. Kirma, and Tim Hui-Ming Huang Tables of contents Page Table of contents 2 Supplementary Methods 4 Supplementary Figure S1. Summarized sequencing reads and coverage of MBDCap-seq 8 Supplementary Figure S2. Reproducibility test of MBDCap-seq 10 Supplementary Figure S3. Validation of MBDCap-seq by MassARRAY analysis 11 Supplementary Figure S4. Distribution of differentially methylated regions (DMRs) in endometrial tumors relative to normal control 12 Supplementary Figure S5. Network analysis of differential methylation loci by using Steiner-tree analysis 13 Supplementary Figure S6. DNA methylation distribution in early and late stage of the TCGA endometrial cancer cohort 14 Supplementary Figure S7. Relative expression of BMP genes with EGF treatment in the presence or absence of PI3K/AKT and Raf (MAPK) inhibitors in endometrial cancer cells 15 Supplementary Figure S8. Induction of invasion by EGF in AN3CA and HEC1A cell lines 16 Supplementary Figure S9. Knockdown expression of BMP4 and BMP7 in RL95-2 cells 17 Supplementary Figure S10. Relative expression of BMPs and BMPRs in normal endometrial cell and endometrial cancer cell lines 18 Supplementary Figure S11. Microfluidics-based PCR analysis of EMT gene panel in RL95-2 cells with or without EGF treatment 19 Supplementary Figure S12. Knockdown expression of EpCAM by different shRNA sequences in RL95-2 cells 20 Supplementary Figure S13. -
Stomach, Duodenum, and Jejunum
Gut, 1970, 11, 649-658 The endocrine polypeptide cells of the human Gut: first published as 10.1136/gut.11.8.649 on 1 August 1970. Downloaded from stomach, duodenum, and jejunum A. G. E. PEARSE, I. COULLING, B. WEAVERS, AND S. FRIESEN' From the Department of Histochemistry, Royal Postgraduate Medical School, London SUMMARY Thirty specimens of stomach, duodenum, and jejunum, removed at operation, were examined by optical microscopical, cytochemical, and electron microscopical techniques. The overall distribution of four types of endocrine polypeptide cell in the stomach, and three in the intestine, was determined. The seven cell types are described by names and letters belonging to a scheme for nomenclature agreed upon at the 1969 Wiesbaden conference o* gastrointestinal hormones. The gastrin-secreting G cell was the only cell for which firm identification with a known hormone was possible. Although there was wide variation in the distribution of the various cells, from one case to another, striking differences were never- theless observable, with respect to the G cell, between antra from carcinoma and from ulcer cases. http://gut.bmj.com/ This study was undertaken with a view to estab- tive shorthand terminology. Correlation with the lishing the overall topographical distribution of terminology used by Solcia, Vassallo, and Capella the various types of endocrine polypeptide cells (1969b) and by Vassallo, Solcia, and Capella in the human stomach and upper intestine. (1969) had to be equated, if possible, with the Adequate sampling was regarded as a pre- scheme used by Forssmann, Orci, Pictet, Renold, on September 28, 2021 by guest. Protected copyright.