Identification of Novel Candidate Genes and Variants for Hearing
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
1 Evidence for Gliadin Antibodies As Causative Agents in Schizophrenia
1 Evidence for gliadin antibodies as causative agents in schizophrenia. C.J.Carter PolygenicPathways, 20 Upper Maze Hill, Saint-Leonard’s on Sea, East Sussex, TN37 0LG [email protected] Tel: 0044 (0)1424 422201 I have no fax Abstract Antibodies to gliadin, a component of gluten, have frequently been reported in schizophrenia patients, and in some cases remission has been noted following the instigation of a gluten free diet. Gliadin is a highly immunogenic protein, and B cell epitopes along its entire immunogenic length are homologous to the products of numerous proteins relevant to schizophrenia (p = 0.012 to 3e-25). These include members of the DISC1 interactome, of glutamate, dopamine and neuregulin signalling networks, and of pathways involved in plasticity, dendritic growth or myelination. Antibodies to gliadin are likely to cross react with these key proteins, as has already been observed with synapsin 1 and calreticulin. Gliadin may thus be a causative agent in schizophrenia, under certain genetic and immunological conditions, producing its effects via antibody mediated knockdown of multiple proteins relevant to the disease process. Because of such homology, an autoimmune response may be sustained by the human antigens that resemble gliadin itself, a scenario supported by many reports of immune activation both in the brain and in lymphocytes in schizophrenia. Gluten free diets and removal of such antibodies may be of therapeutic benefit in certain cases of schizophrenia. 2 Introduction A number of studies from China, Norway, and the USA have reported the presence of gliadin antibodies in schizophrenia 1-5. Gliadin is a component of gluten, intolerance to which is implicated in coeliac disease 6. -
Core Transcriptional Regulatory Circuitries in Cancer
Oncogene (2020) 39:6633–6646 https://doi.org/10.1038/s41388-020-01459-w REVIEW ARTICLE Core transcriptional regulatory circuitries in cancer 1 1,2,3 1 2 1,4,5 Ye Chen ● Liang Xu ● Ruby Yu-Tong Lin ● Markus Müschen ● H. Phillip Koeffler Received: 14 June 2020 / Revised: 30 August 2020 / Accepted: 4 September 2020 / Published online: 17 September 2020 © The Author(s) 2020. This article is published with open access Abstract Transcription factors (TFs) coordinate the on-and-off states of gene expression typically in a combinatorial fashion. Studies from embryonic stem cells and other cell types have revealed that a clique of self-regulated core TFs control cell identity and cell state. These core TFs form interconnected feed-forward transcriptional loops to establish and reinforce the cell-type- specific gene-expression program; the ensemble of core TFs and their regulatory loops constitutes core transcriptional regulatory circuitry (CRC). Here, we summarize recent progress in computational reconstitution and biologic exploration of CRCs across various human malignancies, and consolidate the strategy and methodology for CRC discovery. We also discuss the genetic basis and therapeutic vulnerability of CRC, and highlight new frontiers and future efforts for the study of CRC in cancer. Knowledge of CRC in cancer is fundamental to understanding cancer-specific transcriptional addiction, and should provide important insight to both pathobiology and therapeutics. 1234567890();,: 1234567890();,: Introduction genes. Till now, one critical goal in biology remains to understand the composition and hierarchy of transcriptional Transcriptional regulation is one of the fundamental mole- regulatory network in each specified cell type/lineage. -
Synergistic Cytotoxicity of Renieramycin M and Doxorubicin in MCF-7 Breast Cancer Cells
marine drugs Article Synergistic Cytotoxicity of Renieramycin M and Doxorubicin in MCF-7 Breast Cancer Cells Jortan O. Tun 1,*, Lilibeth A. Salvador-Reyes 1,2 , Michael C. Velarde 3 , Naoki Saito 4 , Khanit Suwanborirux 5 and Gisela P. Concepcion 1,2,* 1 The Marine Science Institute, University of the Philippines Diliman, Quezon City 1101, Philippines; [email protected] 2 Philippine Genome Center, University of the Philippines Diliman, Quezon City 1101, Philippines 3 Institute of Biology, University of the Philippines Diliman, Quezon City 1101, Philippines; [email protected] 4 Graduate School of Pharmaceutical Sciences, Meiji Pharmaceutical University, Tokyo 204-8588, Japan; [email protected] 5 Department of Pharmacognosy and Pharmaceutical Botany, Faculty of Pharmaceutical Sciences, Center for Bioactive Natural Products from Marine Organisms and Endophytic Fungi (BNPME), Chulalongkorn University, Pathumwan, Bangkok 10330, Thailand; [email protected] * Correspondence: [email protected] (J.O.T.); [email protected] (G.P.C.); Tel.: +632-922-3959 (J.O.T. & G.P.C.) Received: 23 July 2019; Accepted: 7 August 2019; Published: 16 September 2019 Abstract: Renieramycin M (RM) is a KCN-stabilized tetrahydroisoquinoline purified from the blue sponge Xestospongia sp., with nanomolar IC50s against several cancer cell lines. Our goal is to evaluate its combination effects with doxorubicin (DOX) in estrogen receptor positive MCF-7 breast cancer cells. MCF-7 cells were treated simultaneously or sequentially with various combination ratios of RM and DOX for 72 h. Cell viability was determined using the MTT assay. Synergism or antagonism was determined using curve-shift analysis, combination index method and isobologram analysis. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
CURRICULUM VITAE George M. Weinstock, Ph.D
CURRICULUM VITAE George M. Weinstock, Ph.D. DATE September 26, 2014 BIRTHDATE February 6, 1949 CITIZENSHIP USA ADDRESS The Jackson Laboratory for Genomic Medicine 10 Discovery Drive Farmington, CT 06032 [email protected] phone: 860-837-2420 PRESENT POSITION Associate Director for Microbial Genomics Professor Jackson Laboratory for Genomic Medicine UNDERGRADUATE 1966-1967 Washington University EDUCATION 1967-1970 University of Michigan 1970 B.S. (with distinction) Biophysics, Univ. Mich. GRADUATE 1970-1977 PHS Predoctoral Trainee, Dept. Biology, EDUCATION Mass. Institute of Technology, Cambridge, MA 1977 Ph.D., Advisor: David Botstein Thesis title: Genetic and physical studies of bacteriophage P22 genomes containing translocatable drug resistance elements. POSTDOCTORAL 1977-1980 Postdoctoral Fellow, Department of Biochemistry TRAINING Stanford University Medical School, Stanford, CA. Advisor: Dr. I. Robert Lehman. ACADEMIC POSITIONS/EMPLOYMENT/EXPERIENCE 1980-1981 Staff Scientist, Molec. Gen. Section, NCI-Frederick Cancer Research Facility, Frederick, MD 1981-1983 Staff Scientist, Laboratory of Genetics and Recombinant DNA, NCI-Frederick Cancer Research Facility, Frederick, MD 1981-1984 Adjunct Associate Professor, Department of Biological Sciences, University of Maryland, Baltimore County, Catonsville, MD 1983-1984 Senior Scientist and Head, DNA Metabolism Section, Lab. Genetics and Recombinant DNA, NCI-Frederick Cancer Research Facility, Frederick, MD 1984-1990 Associate Professor with tenure (1985) Department of Biochemistry -
Ppzvn2fxegiagrfn1cznnrmqw
We gratefully acknowledge the following Authors from the Originating laboratories responsible for obtaining the specimens, as well as the Submitting laboratories where the genome data were generated and shared via GISAID, on which this research is based. All Submitters of data may be contacted directly via www.gisaid.org Authors are sorted alphabetically. Accession ID Originating Laboratory Submitting Laboratory Authors EPI_ISL_1562503 Aegis Sciences Corporation Centers for Disease Control and Prevention Division of Viral Dakota Howard, Dhwani Batra, Peter W. Cook, Kara Moser, Adrian Paskey, Jason Caravas, Benjamin Rambo-Martin, Shatavia Morrison, Christopher Diseases, Pathogen Discovery Gulvick, Scott Sammons, Yvette Unoarumhi, Darlene Wagner, Matthew Schmerer, Cyndi Clark, Patrick Campbell, Rob Case, Vikramsinha Ghorpade, Holly Houdeshell, Ola Kvalvaag, Dillon Nall, Ethan Sanders, Alec Vest, Shaun Westlund, Matthew Hardison, Clinton R. Paden, Duncan MacCannell EPI_ISL_1648208 Quest Diagnostics Incorporated Centers for Disease Control and Prevention Division of Viral Dakota Howard, Dhwani Batra, Peter W. Cook, Kara Moser, Adrian Paskey, Jason Caravas, Benjamin Rambo-Martin, Shatavia Morrison, Christopher Diseases, Pathogen Discovery Gulvick, Scott Sammons, Yvette Unoarumhi, Darlene Wagner, Matthew Schmerer, S. H. Rosenthal, A. Gerasimova, R. M. Kagan, B. Anderson, M. Hua, Y. Liu, L.E. Bernstein, K.E. Livingston, A. Perez, I. A. Shlyakhter, R. V. Rolando, R. Owen, P. Tanpaiboon, F. Lacbawan, Clinton R. Paden, Duncan MacCannell EPI_ISL_1660458 -
28 June 2019 25 – 28 Fjuneaculty of 2019 Scienc E Kasetsart University, Bangkok Faculty of Science Kasetsart University, Bangkok
25 - 28 June 2019 25 – 28 FJuneaculty of 2019 Scienc e Kasetsart University, Bangkok Faculty of Science Kasetsart University, Bangkok This page is intentionally left blank. T A B L E O F C ONTENT Workshop schedule 2 Opening and Welcome speeches 6 Sponsors’ Info 11 Organizing Committee 15 Presenters’ Biographies 17 Participants’ Info 27 Invited Talks and Talks 31 Lecture Summary 44 Poster Abstracts 50 1 W O R K S H O P S CHEDULE 08:00-08:40 Registration 08:40-08:45 Celebration of Coronation of King Rama X 08:45-09:05 Welcome and opening ceremony Group Photo 09:05-09:15 Overview of the Empowering agricultural research through (meta)genomics workshop Alexie Papanicolaou 09:15-10:15 Plenary Talk: “Genomes, Genes, Allele and Mechanisms.” Roger Hellens 10:15:10:30 Tea break and networking (Room 352) 10:30-10:50 Invited Talk: High Resolution Profiling of Bacterial Communities using Full-Length 16S rRNA Sequence Data from PacBio SMRT Sequencing System Wirulda Pootakarm 10:50-11:10 Invited Talk: From Omics to System Biology: Impact on Industrial Biotechnology and Human Health Wanwipa Vongsangnak 11:10-11:50 Invited talk: Functional Genomics of Tropical Plants Goh Hoe Han 11:50-13:00 Lunch and Product presentation by Sponsors (Room 352) 12:00-12.20: Advancing metagenomics research with Illumina solutions - Cara Lim 12:20-12:40: QIAGEN’s Innovative Solutions for Advancing Microbiome Research from Challenging Samples to Insight with Confidence - Wasin Sakulkoo 2 12:40-12:50: Sequencing solution on DNBSEQ platform - Honghong Liu 13:00:13:40 Invited -
Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1. -
POU Domain Family Values: Flexibility, Partnerships, and Developmental Codes
Downloaded from genesdev.cshlp.org on October 1, 2021 - Published by Cold Spring Harbor Laboratory Press REVIEW POU domain family values: flexibility, partnerships, and developmental codes Aimee K. Ryan and Michael G. Rosenfeld 1 Howard Hughes Medical Institute, Department and School of Medicine, University of California at San Diego, La Jolla, Califiornia 92093-0648 USA Transcription factors serve critical roles in the progres- primary focus of this review. Crystallization of the Oct-1 sive development of general body plan, organ commit- and Pit-1 POU domains on DNA and in vitro studies ment, and finally, specific cell types. It has been the hope examining the specificity of POU domain cofactor inter- of most developmental biologists that comparison of the actions suggest that the flexibility with which the POU biological roles of a series of individual members within domain recognizes DNA-binding sites is a critical com- a family will permit at least some predictive generaliza- ponent of its ability to regulate gene expression. The tions regarding the developmental events that are likely implications of these data with respect to the mecha- to be regulated by a particular class of transcription fac- nisms utilized by the POU domain family of transcrip- tors. Here, we present an overview of the developmental tion factors to control developmental events will also be functions of the family of transcription factors charac- discussed. terized by the POU DNA-binding motif afforded by re- cent in vivo studies. Conformation of the POU domain on DNA The POU domain family of transcription factors was defined following the observation that the products of High-affinity site-specific DNA binding by POU domain three mammalian genes, Pit-l, Oct-l, and Oct-2 and the transcription factors requires both the POU-specific do- protein encoded by the Caenorhabditis elegans gene main and the POU homeodomain (Sturm and Herr 1988; unc-86 shared a region of homology, known as the POU Ingraham et al. -
SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line -
Abnormal Mesenchymal Differentiation in the Superior Semicircular Canal of Brn4/Pou3f4 Knockout Mice
ORIGINAL ARTICLE 2 Abnormal Mesenchymal Differentiation in the Superior Semicircular Canal of Brn4/Pou3f4 Knockout Mice Steven E. Sobol, MD, MSc; Xiuyin Teng, MSc; E. Bryan Crenshaw III, PhD Objective: To examine the developmental time course of the SSCC in Brn4 knockout mice was initially detect- of the mutant phenotype and cellular mechanisms that able at P14. Interestingly, the mutant SSCC is indistin- result in malformations of the superior semicircular ca- guishable from control mice at earlier neonatal time points. nal (SSCC) in Brn4 knockout mice. Mutations in the Brn4/ In mutant neonates, there is persistence of immature wo- Pou3f4 gene result in characteristic inner ear abnormali- ven bone with high cellularity surrounding the perilym- ties in mutant mouse pedigrees, and the findings in these phatic space of the SSCC. These findings are not pres- mice are similar to those in human X-linked deafness type ent in control animal specimens, which demonstrate III. appropriate lamellar bony architecture. Design: Mutant and control mice were killed at vari- Conclusions: In Brn4 knockout mice, constriction of the ous neonatal time points to assess the development of SSCC with narrowing of the bony labyrinth develops in the SSCC. Measurements of SSCC diameter were made the postnatal period at approximately P14. The persis- on paint-perfused specimens at postnatal day (P) 0, P7, tence of immature bone in affected mice indicates that P10, and P14. Histologic evaluation of the SSCC was signaling abnormalities disrupt normal mesenchymal dif- made on hematoxylin-eosin–stained sections at P10. ferentiation in the SSCC. Results: A dysmorphic constriction of the superior arc Arch Otolaryngol Head Neck Surg. -
Creating a Roadmap for Building a Sustainable Genomics Facility in the Philippines
Philippine Journal of Science 148 (S1): 15-32, Special Issue on Genomics ISSN 0031 - 7683 Date Received: 19 Mar 2019 Creating a Roadmap for Building a Sustainable Genomics Facility in the Philippines Alexander T. Young* Philippine Genome Center University of the Philippines Diliman, Quezon City 1101 Philippines Genomics, bioinformatics, and high-throughput technologies provide a means to create breakthrough solutions for a remarkably wide diversity of fields – including medicine, agriculture, fisheries, livestock, and biodiversity. Significantly, the precision of genomics and DNA enable the creation of applications that are specifically optimized for the Philippines. Dissemination of these technologies throughout the country is accelerated by genomics facilities that provide access to core technologies. However, there are significant scientific and business challenges for creating a sustainable genomics facility in the Philippines. The historical successes and challenges of genomics and high-throughput technologies are reviewed, which point to potential solutions for creating a sustainable genomics facility in the Philippines. Keywords: bioinformatics, drug discovery, functional genomics, genomics, high-throughput DNA sequencing INTRODUCTION systems in order to find new applications that benefit society. In conjunction with the technological advances in biology New and exciting advances in genomics and high-throughput and engineering, advances in computational sciences have technologies are revolutionizing the application of biological enabled the daunting task of interpreting the massive amounts sciences. Advances in engineering, microfluidics, robotics, of data that these technologies generate (bioinformatics). and miniaturization have created machines that can rapidly The ability to profile thousands to millions of biological determine the DNA sequence of an organism’s genes or molecules in a massively parallel fashion promises to create the entire genome.