Rfx6 Promotes the Differentiation of Peptide-Secreting Enteroendocrine Cells While Repressing Genetic Programs Controlling Serotonin Production

Home , Enterochromaffin cell, LMX1A, RFX6, VGF

bioRxiv preprint doi: https://doi.org/10.1101/704924; this version posted July 19, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Rfx6 promotes the differentiation of peptide-secreting enteroendocrine cells while repressing genetic programs controlling serotonin production

Julie Piccand1,2,3,4#, Constance Vagne1,2,3,4#, Florence Blot1,2,3,4#, Aline Meunier1,2,3,4, Anthony Beucher1,2,3,4, Perrine Strasser1,2,3,4, Mari L. Lund5, Sabitri Ghimire1,2,3,4, Laure Nivlet1,2,3,4, Céline Lapp1,2,3,4, Natalia Petersen5, Maja S. Engelstoft5, Christelle Thibault-Carpentier1,2,3,4, Céline Keime 1,2,3,4 , Sara Jimenez Correa1,2,3,4, Valérie Schreiber1,2,3,4, Nacho Molina1,2,3,4, Thue W. Schwartz5, Adèle De Arcangelis1,2,3,4* and Gérard Gradwohl1,2,3,4*

1Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC), 2Institut National de la Santé et de la Recherche Médicale (INSERM) U1258, 3Centre National de Recherche Scientifique (CNRS) UMR7104, 4Université de Strasbourg, 1 rue Laurent Fries, 67404 Illkirch, France. 5Centre for Metabolic Receptology, Novo Nordisk Foundation Center for Basic Metabolic Research, Faculty of Health Science, University of Copenhagen, Denmark.

# contributed equally

* Corresponding authors: Gérard Gradwohl or Adèle De Arcangelis 1 Rue Laurent Fries, 67404 Illkirch, France, Phone: 0033 3 88 65 33 12, Fax: 0033 3 88 65 32 01, email: [email protected]; [email protected].

1 bioRxiv preprint doi: https://doi.org/10.1101/704924; this version posted July 19, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

ABSTRACT

Objective: Enteroendocrine cells (EECs) of the gastro-intestinal tract sense gut luminal factors and release peptide hormones or serotonin (5-HT) to coordinate energy uptake and storage. Our goal is to decipher the gene regulatory networks controlling EECs specification from enteroendocrine progenitors. In this context, we studied the role of the transcription factor Rfx6 which had been identified as the cause of Mitchell-Riley syndrome characterized by neonatal diabetes and congenital malabsorptive diarrhea. We previously reported that Rfx6 was essential for pancreatic beta cell development and function, however, the role of Rfx6 in EECs differentiation remained to be elucidated.

Methods: We examined the molecular, cellular and metabolic consequences of constitutive and conditional deletion of Rfx6 in the embryonic and adult mouse intestine. We performed single cell and bulk RNA-Seq to characterize EECs diversity and identify Rfx6-regulated genes.

Results: Rfx6 is expressed in the gut endoderm; later it is turned on in, and restricted to, enteroendocrine progenitors and persists in hormone-positive EECs. In the embryonic intestine, the constitutive lack of Rfx6 leads to gastric heterotopia, suggesting a role in the maintenance of intestinal identity. In the absence of intestinal Rfx6, EECs differentiation is severely impaired both in the embryo and adult. However, the number of serotonin-producing enterochromaffin cells and mucosal 5-HT content are increased. Concomitantly, Neurog3-positive enteroendocrine progenitors accumulate. Combined analysis of single-cell and bulk RNA-Seq data revealed that enteroendocrine progenitors differentiate in two main cell trajectories, the enterochromaffin (EC) cells and the Peptidergic Enteroendocrine (PE) cells, whose differentiation programs are differentially regulated by Rfx6. Rfx6 operates upstream of Arx, Pax6 and Isl1 to trigger the differentiation of peptidergic EECs such as GIP- , GLP-1- or CCK-secreting cells. On the contrary, Rfx6 represses Lmx1a and Tph1, two genes essential for serotonin biosynthesis. Finally, we identified transcriptional changes uncovering adaptive responses to the prolonged lack of enteroendocrine hormones and leading to malabsorption and lower food efficiency ratio in Rfx6-deficient mouse intestine.

Conclusion: These studies identify Rfx6 as an essential transcriptional regulator of EECs specification and shed light on the molecular mechanisms of intestinal failures in human RFX6-deficiencies such as Mitchell-Riley syndrome.

Key words: Rfx6; Neurog3; Lmx1a; intestine; cell fate; serotonin; enteroendocrine cells; enterochromaffin cells; malabsorption; Mitchell Riley Syndrome

2 bioRxiv preprint doi: https://doi.org/10.1101/704924; this version posted July 19, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1. INTRODUCTION

Enteroendocrine cells (EECs) are one of the five main intestinal cell subtypes, which include enterocytes, goblet-, Paneth- and tuft-cells. EECs are scattered as individual cells in the lining of the gut epithelium from the duodenum to the colon. Although they represent 1% of all intestinal epithelial cells they constitute the largest endocrine system of the body. EECs sense gut luminal factors (nutrients, microbial components) that trigger the secretion of peptide hormones or amines regulating food intake, digestion or glucose metabolism. Peptide hormones include Glucagon-Like Peptide 1 and 2 (GLP-1, GLP-2), Peptide YY (PYY), Gastric Inhibitory Peptide (GIP), Somatostatin (SST), Cholecystokinin (CCK), Secretin (SCT), Gastrin (GAST), Neurotensin (NTS) and Ghrelin (GHRL). The monoamine serotonin (5-hydroxytryptamine; 5-HT) is produced by enterochromaffin cells, the most abundant enteroendocrine cell type. Historically, EECs were classified using a one letter code based on their location and main secretory product. However, co-expression [1; 2] and single-cell transcriptomic studies [3; 4] tend to support the obsolescence of this classification [5] given that virtually all EECs express several hormones albeit not at the same level. Recent findings suggest that the hormonal repertoire of EECs might be modulated, along the crypt-villi axis, by local signals [6; 7]. Despite these major breakthroughs, our understanding of the molecular mechanisms controlling the differentiation of EECs is still limited, both during development and renewal in the adult intestine.

Several transcription factors have been demonstrated to regulate EECs differentiation. A master regulator is the basic helix-loop-helix (bHLH) transcription factor Neurogenin3 (Ngn3 or Neurog3) which is expressed in endocrine progenitors and determines endocrine commitment in the embryonic [8-10] and adult intestine [11]. Neurog3-expressing cells are rare hormone–negative endocrine progenitors confined to the crypts and Neurog3 expression is turned off when cells migrate towards the villi and differentiate into hormone-expressing cells. Indeed, Neurog3-deficient mice (constitutive and intestinal deletion) lack EECs. The loss of all enteroendocrine cells in mice leads to growth retardation, impaired lipid absorption and increased lethality, underlying the importance of enteroendocrine function [11]. Neurog3-positive endocrine progenitors arise from intermediate crypt progenitors which express the bHLH transcription factor Atoh1 [12]. Downstream of Neurog3, a complex network of transcription factors control the differentiation of subpopulations of EECs such as NeuroD1 [13], Arx [14; 15], Pax4 [14; 16], Isl1 [17], Pax6 [16], Foxa1/2 [18] or Insm1 [19].

Transcription factors controlling EECs differentiation, in almost all cases, also regulate pancreatic islet cell differentiation, suggesting shared genetic programs. We and others have reported the critical role of the transcription factor Regulatory Factor X 6 (Rfx6) in beta-cell development [20; 21] and function [22]. A previous study reported the regulation of Gip by Rfx6 in STC1 cell line [23]. Still, Rfx6 expression and role in mouse intestine and EECs differentiation is unknown. Rfx6, initially expressed broadly in the gut endoderm, becomes restricted to the endocrine lineage in the pancreas during embryogenesis and persists in adult islet cells. Rfx6 is necessary for proper islet cell development in zebrafish, mouse and Xenopus [20; 21; 24]. Rfx6-deficient mice lack alpha-, beta- and delta-cells, they are diabetic and die shortly after birth. Rfx6 loss in adult beta cells leads to glucose intolerance, impaired beta-cell glucose

3 bioRxiv preprint doi: https://doi.org/10.1101/704924; this version posted July 19, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

sensing, and defective insulin secretion [22]. In humans, several mutations in RFX6 were identified as the cause of an autosomal recessive syndrome, named Mitchell-Riley syndrome, characterized by neonatal or childhood diabetes comprising hepatobiliary abnormalities and intestinal atresia [21; 25-32]. Most patients are presented with severe congenital malabsorptive diarrhea suggesting impaired EECs differentiation which however was not studied extensively.

In this study wa have investigated the function of Rfx6 in EECs differentiation in the embryonic and adult mouse. We have shown that EECs differentiation is severely impaired in Rfx6-deficient embryos, and only enterochromaffin cells are spared. Furthermore, we have detected patches of gastric cells in the small intestine of mutant newborns indicating gastric heterotopia. Constitutive intestinal deletion of Rfx6 is found to be lethal at early post-natal stages. Deletion of Rfx6 in the adult intestine is found to induces diarrhea, impaired lipid absorption and impaired food efficiency. Like in the embryo, EECs expressing peptide hormones were either happened to be lost or decreased in representation, while serotonin- positive enterochromaffin cells still developed with even slight increase in their number. Concomitantly, an increased number of Neurog3-positive enteroendocrine progenitors was also observed. Contrary to in vivo data, the removal of Rfx6 in small intestinal organoids was found to result in impaired differentiation of all EECs, including enterochromaffin cells. By comparative transcriptomic studies, we have determined early Rfx6-dependent targets in the EEC lineage, and have identified secondary enhanced expression of neoglucogenic and nutrient absorption machinery genes reflecting adaptive response to the absence of enteroendocrine hormones. In parallel single-cell transcriptomic studies of EECs, we have described the dynamics of Rfx6 expression and expression of other known and novel intestinal transcription factors. Overall, our results have shown that enteroendocrine progenitors differentiate in two main cell trajectories, the enterochromaffin (EC) cells and the Peptidergic Enteroendocrine (PE) cells, whose differentiation programs are differentially regulated by Rfx6.

4 bioRxiv preprint doi: https://doi.org/10.1101/704924; this version posted July 19, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

2. MATERIAL AND METHODS

2.1 Animals and animal handling All mice were housed in an animal facility licensed by the French Ministry of Agriculture (Agreement no. B67-218-5) and all animal experiments were supervised by GG (agreement no. C67-59) and approved by the Direction des Services Vétérinaires in compliance with the European legislation on care and use of laboratory animals. Rfx6fl/+ mice have been described previously [33] and were maintained on a heterozygous animals with C57BL/6N (Taconic) background. Rfx6+/- mice have been generated by crossing Rfx6f/+ females with CMV-Cre males. Neurog3-Cre mice are a gift from Dr. Shosei Yoshida [34], Villin-Cre and Villin-CreERT2 were generously given by Dr. Sylvie Robine [35]. Neurog3eYFP/+ mice have been described previously [36]. Genomic tail DNA was analyzed by PCR using the primers detailed below. To achieve recombination in inducible mutants, the mice were treated with tamoxifen (10mg) (Sigma) by gavage twice per day, every second day during 5 days. Primers for genotypic were as follows:

Neurog3 Forward: ctgcagtttagcagaacttcagaggga Cre Reverse: atcaacgttttgttttcgga Villin foward: ataggaagccagtttcccttc ERT forward: gcattaccggtcgatgcaacgagtgatgag ERT reverse: aggatctctagccaggcaca Rfx6 forward: gaaggtgcacccataaaagc Rfx6 reverse: tataagccacccagggtcag Neurog3 forward: cggcagatttgaatgagggc Neurog3 reverse: tctcgcctcttctggctttc GFP forward: cctgaagttcatctgcaccac GFP reverse: ttgtagttgtactccagcttgtgc

2.2 Histopathology and immunohistochemistry Mouse tissues were fixed in 4% paraformaldehyde at 4°C overnight and embedded in paraffin or Sandon Cryomatrix (Thermo Scientific). Standard histology techniques were used: - for conventional histology, 7 µm paraffin sections were stained with Harris haematoxylin and eosin (H&E); - for goblet cells analysis, 7 µm paraffin sections were stained with Periodic Acid-Schiff (PAS) and haematoxylin or Alcian blue (AB) (pH 2.5); - for lipid and fat deposits detection, 10 µm cryo-sections were stained with Oil red O. Immunostaining on 7 (paraffin) or 10 (cryo) μm sections was performed using standard protocols. For BrdU detection assays, BrdU was injected intraperitoneally at 100mg/kg body weight, 24h prior sacrifice. If required, antigen retrieval was performed in 10mM Sodium Citrate pH6 in a pressure cooker. Primary antibodies used: guinea pig anti-Neurog3 1:1000 (M. Sander, UCSD, CA, USA); goat anti-Neurog3 1:2000 (G. Gu, Vanderbilt University, TN, USA); rabbit anti-Neurog3 1:500 (2763; IGBMC); rat anti- somatostatin 1:500 (Chemicon); mouse anti-ghrelin (C. Tomasetto, IGBMC, Strasbourg, France); goat anti-chromograninA 1:200 (Santa Cruz); goat anti-Cck 1:50 (Santa Cruz); guinea pig anti-glucagon 1:2000 (Linco); goat anti-glp1 1:100 (Santa Cruz); goat anti-Gip 1:100 (Santa Cruz); goat anti-gastrin

5 bioRxiv preprint doi: https://doi.org/10.1101/704924; this version posted July 19, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1:50 (Santa Cruz); goat anti-secretin 1:50 (Santa Cruz); goat anti-serotonin 1:2000 (Abcam); rabbit anti- serotonin 1:2000 (Diasorin Incstar); rat anti-BrdU 1:10 (AbD Serotec), rabbit anti-Rfx6 1:500 (2766, IGBMC); chicken anti-GFP 1:2000 (Abcam). Secondary antibodies conjugated to Alexa Fluor® 594, DyLight® 488, DyLight® 549 and DyLight® 649 (Jackson ImmunoResearch) were used at 1:500. For BrdU, Neurog3 and Rfx6, signal amplification was performed using biotin anti-rabbit (JacksonImmunoResearch) coupled antibody at 1:500 and streptavidin-Cy3 (or-488) conjugate at 1:500 (Molecular Probes). Immunofluorescent stainings on mouse intestinal organoids were realized as previously described (O’Rourke K., P. et al., 2016).

2.3 Generation and maintenance and 4-hydroxytamoxifen treatment of mouse intestinal organoids Mouse intestinal organoids were generated as previously described (Sato et al., 2009) from small intestine of 2-6 month-old CD1 Neurog3eYFP/+ mice, Rfx6fl/fl and Rfx6fl/fl ; Villin CreERT2 mice. Briefly, crypts from duodenum or jejunum were isolated and cultured into Matrigel drops (Fisher ScientificTM) to develop organoids in presence of the following medium: Advanced DMEM/F-12, HEPES 10 mM, GlutaMax 2 mM, penicillin/streptomycin 100 U/mL, supplement B27 1X (all from GibcoTM), N-acetyl-L- cysteine 1 µM (Merck), human recombinant R-spondin-1 500 ng/mL (PeproTech®), murine recombinant EGF 50 ng/mL (PeproTech®) and human recombinant Noggin 100 ng/mL (R&D Systems®). Organoids

were maintained at 37°C, 5% CO2 and were split into 24-well plates every 5 to 7 days. To induce in vitro Cre recombinase activation and specific deletion of Rfx6, organoids derived from Rfx6fl/fl (controls) and Rfx6fl/fl; Villin-CreERT2 duodenum (n=4 per genotype) were treated two days after seeding with 4- hydroxytamoxifen (4-OHT; Sigma-Aldrich) 1.25 µM for 15h, after which the medium was replaced with fresh medium without 4-OHT. Organoids were harvested 8 days after 4-OHT treatment for RNA extraction.

2.4 Measurement of intestinal serotonin content After 11 days of tamoxifen injections, four adult male Rfx6fl/fl and three Rfx6fl/fl Villin-CreERT2 were euthanized by cervical dislocation and the entire gastrointestinal tract were excised. Using dermal biopsy punches (1.5 mm) intestinal samples were obtained from relevant sites throughout the GI tract (Duodenum, Jejunum, Ileum, Proximal Colon and Distal Colon). All samples were quickly homogenized and purified in ice-cold 1M perchloric acid to precipitate proteins. Following centrifugation at 14.000G at 4⸰C, 15 min, where after the supernatant were collected and taken through an additional purifying step adding similar volume 1M perchloric acid followed by mixing and centrifugation. The protein-free samples were diluted 2 or 10 times in MilliQ water prior HPLC injection (10µl). 5-HT concentration was measured by HPLC-ECD (HTEC-500, Eicom) with a PP-ODS2 column (Amuza) following manufacturer’s instructions regarding flow rate, mobile phase and applied potential. Retention time (3.8 seconds) for 5-HT were determined by a control 5-HT dilution of 1pM (Sigma-Aldrich). Results are stated as area under the curve (AUC) and presented as mean ± SD. Unpaired T-test was applied to calculate significance (*p≤0.05; **p≤0.01).

6 bioRxiv preprint doi: https://doi.org/10.1101/704924; this version posted July 19, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

2.5 Morphometric analysis Neurog3-positive cells or Neurog3/BrdU double positive cells were counted in adult mice after immunostaining on approximately 50 sections of duodenum, jejunum, ileum and colon three months after tamoxifen treatment (n=3 per genotype). The number of Neurog3-positive cells was normalized according to the area of the sections estimated by the surface of DAPI staining. The number of Neurog3/BrdU double positive cells was normalized to the total number of Neurog3 cells, and expressed as a percentage. 5-HT positive cells were counted after immunostaining on sections of duodenum and ileum from adult animals (n=3 per genotype), one week after tamoxifen treatment. At least 50 well- oriented crypt-villus sections per animal were analyzed and as indicated above the number of 5-HT- positive cells was normalized according to the DAPI-positive area.

2.6 Metabolic studies

Mice were fed with normal chow diet (DO3, SAFE) from weaning. Glucose tolerance tests were performed as described previously [22]. Food intake and feces production were measured over a 48h period. Feces energy content, energy excretion, energy ingested and food efficiency were measured by the Mouse Clinical Institute (MCI) metabolic platform (http://www.ics-mci.fr). Blood analysis were performed on plasma from adult males by the MCI. The energy content of the stools was evaluated using a bomb calorimeter (C503 control, IKA) The energy excreted is calculated as Feces Energy Content (Cal/g) X Feces Weight (g) / 2. The energy ingested is calculated as food intake per day (g) X diet calorific value (3.5 Kcal/g). The energy digested is calculated by the difference between total calories ingested and excreted in feces. It is then expressed as “food efficiency”.

2.7 Statistics Comparisons of means and medians were performed with Graphpad Prism 7.0 or R softwares. Values are presented as mean ± SD or SEM. p-values were determined using the 2-tailed Student t-test with unequal variance or the 2-tailed nonparametric test of Mann-Whitney offered in Prism. p≤ 0.05 was accepted as statistically significant.

2.8 Dissociation of mouse intestinal organoids into single cells Organoids were dissociated to single cells as previously described, with some modifications (Grün et al., Nature, 2015). Briefly, after medium removal and Matrigel disruption, organoids were dissociated in 500 µL of TrypLETM Express Enzyme (1X) (GibcoTM) at 37°C for 20 min, assisted by a mechanical dissociation (up and down with a p1000 and a final passage through a syringe fitted with a 18G needle). The dissociation was stopped in a medium containing Advanced DMEM/F-12, fetal calf serum 10%, N- acetylcysteine 0.5 mM, and supplement B27 1X. The cells were pelleted, washed 2 times and resuspended in the same medium. Finally, they were strained through a 50 µm cell strainer, and stained with DAPI (to exclude dead cells) before to be sorted by flow cytometry (FACS Aria II, BD).

2.9 RNA isolation and qPCR

7 bioRxiv preprint doi: https://doi.org/10.1101/704924; this version posted July 19, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Total RNA from whole small intestine (pups), duodenum (adults), jejunum (adults), ileum (adults) or colon (pups and adults) was extracted using TRI Reagent (Invitrogen) or RNeasy® Midi Kit (Qiagen), according to the manufacturer’s instructions. Total RNA from organoids was extracted using RNeasy® Mini Kit (Qiagen) according to the manufacturer’s instructions. Reverse transcription was performed using Transcriptor Reverse Transcriptase (Roche) and Random primers (Roche). Quantitative PCRs were performed using mouse-specific TaqMan primers and probes (Applied Biosystems) recognizing Neurog3 (Mm00437606_s1), ChgA (Mm00514341_m1), Arx (Mm00545903_m1), Pax4 (Mm01159036_m1), Pax6 (Mm00443081_m1), Isl1 (Mm00517585_m1), Lmx1a (Mm00473947_m1), Tac1 (Mm01166996_m1), Ucn3 (Mm00453206_s1), NeuroD1 (Mm00520715_m1), Pyy (Mm00520715_m1), Nts (Mm00481140_m1), Cck (Mm00446170_m1), Sct (Mm00441235_g1), Gip (Mm00433601_m1), Gcg/Glp1 (Mm00801712_m1), Tph1 (Mm00493794_m1), Gast (Mm00772211_g1), Sst (Mm00436671_m1), Ghrl (Mm00445450_m1), Nkx2.2 (as described in Gross S. et al., 2016; Forward primer: cctccccgagtggcagat; Reverse primer: gagttctatcctctccaaaagttcaaa; FAM-MGB Probe: ccattgactctgccccatcgctct) or UPL probes #83 for Rfx6 (Forward primer: tgcaggaaagagaaactggag; Reverse primer: ggaaatttttggcgaattgtc), with Light Cycler 480 Probes Master Mix (Roche) on Light Cycler 480 (Roche). Gene expression levels were normalized to Rplp0 (Mm01974474_gH).

2.10 Microarrays Samples processing: Microarray analysis was performed according to Agilent protocol “One-Color Microarray-Based Gene Expression Analysis – Low Input Quick Amp Labeling” version 6.5, May 2010 (Cat # G4140-90040). Complementary RNA (cRNA) samples were linearly amplified and labeled with cyanine 3 starting from 100 ng of total RNA. Following fragmentation, labeled cRNA were hybridized on Agilent “SurePrint G3 Mouse Gene Expression 8x60K Microarray” (Design ID: 028005), for 17 hrs, at 65°C under 10 rpm. Following washing, the slides were scanned using an Agilent G2565CA microarray Scanner System, at a 3 µm resolution in a 20-bit scan mode, according to the “AgilentG3_GX_1Color” protocol. Data analysis: Raw .tif images were then extracted using Agilent “Feature Extraction, version 10.10.1.1” following “GE1_1010_Sep10” protocol. Median raw expression values were further normalized by quantile method [37]. Differential expression analysis between Rfx6-/- vs controls and Rfx6ΔEndo vs controls) were performed using the R package limma version 3.36.5 [38]. Data have been deposited on GEO repository (GSE133038).

2.11 RNA Sequencing Ileon from adult Rfx6ΔAdInt mice was harvested at 8 days and 3 months after tamoxifen gavage. Total RNA was extracted using TRI-reagent or RNeasy® Midi Kit (Qiagen). Libraries were prepared using the total RNA-seq Ribo-zero protocol and sequenced on an Illumina HiSeq 2500 (single-end 50bp reads). Reads were identified and mapped onto the mm9 assembly of mouse genome using Tophat version 2.0.10 and the Bowtie2 version 2.1.0 aligner. Quantification of gene expression was performed using HTSeq version 0.6.1 and gene annotations from Ensembl release 67. Normalization of read counts and differential expression analysis between controls and Rfx6ΔAdInt samples were performed using the

8 bioRxiv preprint doi: https://doi.org/10.1101/704924; this version posted July 19, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

method implemented in the DESeq2 Bioconductor library version 1.0.19 [39]. Data have been deposited on GEO repository (GSE133038).

2.12 Single-cell RNA-Seq; sample processing eYFP+ cells, from dissociated Neurog3eYFP/+ intestinal organoids, were sorted directly into four 96 well plates « Precise WTA Single Cell Encoding Plate » (BDTM Precise WTA Single Cell Kit, BD Genomics) (1 cell/well) using a FACSAria Fusion (BD). DAPI was used to sort only living cells. The library was prepared according manufacturer’s recommendations (910000014 Rev. 02 11/2016, BD Genomics) and sequenced on an Illumina HiSeq 4000 using paired-end 2x100bp lanes sequencing. Data have been deposited on GEO repository (GSE133038).

2.13 Single-cell RNA-Seq analysis

2.13.1 Demultiplexing, alignment and quantification Fastq files were demultiplexed using the sample index encoded in reads 1. Reads 2 having a bad quality (--quality-cutoff 20,20) or corresponding to polyA sequences or to adapters were removed using Cutadapt version 1.10. Reads 2 mapping to rRNA were identified using Bowtie 2 version 2.2.8 and removed. Reads 2 were aligned to mm10 genome using STAR version 2.5.3a. After alignment, reads corresponding to technical duplicates were removed using UMI-Tools version 0.4.4 (method: “directional-adjacency”) [40]. Quantification of gene expression was performed using HTSeq version 0.6.1.post1 (parameter “--mode union”) and gene annotations from Ensembl release 90.

2.13.2 Quality filtering of cells Cells were filtered in function of several quality criteria: (i) Percentage of reads uniquely aligned to genome had to be superior or equal to 40%, (ii) percentage of UMIs assigned to genes had to be superior or equal to 50%, (iii) number of assigned UMIs had to be superior or equal to 200,000, (iv) proportion of UMIs assigned to mitochondrial genes had to be inferior to 20%. Finally, 290 cells were kept for further analyses. Among these filtered cells, the number of assigned UMIs varies from 200,000 to 2.3 million. Regarding the number of expressed genes per cell, it varies from 2,777 to 10,019 with a median equal to 4,606.

2.13.3 Normalization, dimensionality reduction and clustering Data were then analyzed using the Seurat package version 2.3.4 [41]. Before creating the Seurat object, a gene filtering was performed. On the 29,161 genes expressed in the data, only 9,057 were retained as they met two criteria: they were coding genes or lincRNA and had at least 5 UMIs assigned in 5 samples. The normalization and scaling of the data were performed using the functions NormalizeData (method “LogNormalize”) and ScaleData implemented in Seurat. Variable genes were identified using the FindVariableGenes function in the Seurat package: the 830 genes having a scaled dispersion superior or equal to 1 and a log-normalized average expression superior or equal to 0.2 were selected as variable genes. Then, a PCA (Principal Component Analysis) was done with the function RunPCA of Seurat, based on these 830 variable genes. The 13 first axes

9 bioRxiv preprint doi: https://doi.org/10.1101/704924; this version posted July 19, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

were used to create an UMAP, as they had a significant PCA score, according to the “Jack Straw” approach implemented in Seurat. The UMAP was performed with the function RunUMAP in Seurat (n_neighbors = 20 and min_dist =0.3). Finally, the clustering was performed based on the two first axis of the UMAP, using the SNN (shared nearest neighbor) modularity optimization algorithm implemented in the FindClusters function of Seurat. The following parameters were used: k.param = 30, resolution =0.9 and prune.SNN = 5/15. Eight groups of cells were found.

2.13.4 Identification of markers of the groups Before performing the differential expression analysis, genes were filtered. On the 9,057 already filtered genes, we kept only 8,644 genes as they had a normalized expression equal or superior at 1 in at least 1% of the cells. Differential expression analysis was done using the QLF (quasi-likelihood) approach implemented in the R package edgeR version 3.20.6 [42]. The detection rate was added as a covariate to the model as it improves the performance of the analysis [43]. To compare one group of cells to the others, we used the following contrasts: 1 for said group and -1/7 for the seven other groups. One gene was considered as the marker of a group if it was significantly over-expressed in this group with a FDR inferior or equal to 10-10 and if it was expressed in at least 20% of the cells of the said group.

2.13.5 Cell trajectory The log-transformed gene expression matrix of the 830 variable genes was used to generate diffusion map, using the function DiffusionMap (k = 15) implemented in destiny R package, version 2.12.0 [44].

10 bioRxiv preprint doi: https://doi.org/10.1101/704924; this version posted July 19, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

3. RESULTS

3.1 Rfx6 is expressed in endocrine progenitors in the crypts and in all nascent hormone- expressing cells at the base of villi in the adult mouse intestine To determine Rfx6 intestinal expression, we performed a series of immunofluorescence experiments in the embryo, as well as in adult CD1 mice (Figure 1). It was previously shown that Rfx6 is expressed broadly in the gut endoderm at E9 [20; 21]. From E13.5, Rfx6 becomes restricted to a small number of scattered cells in the embryonic intestine in a pattern of developing enteroendocrine cells (Figure 1A and data not shown). Accordingly, we found that Rfx6 is expressed in Neurog3-positive enteroendocrine progenitors during embryogenesis and in the adult small intestine. Indeed, we observed that Rfx6 is expressed in a subset of crypt based Neurog3-positive endocrine progenitor cells (40%; n=300; Figure 1B-D). The majority of Rfx6-positive-nuclei are found in the crypts (Suppl. Figure 1). Nevertheless, Rfx6 is maintained in hormone-expressing enteroendocrine cell types including incretin (GLP-1 and GIP) producing cells, as well as 5-HT enterochromaffin cells (Figure 1G-N, Suppl. Figure 1). We observed that cells positive for both Rfx6 and hormones show different intensity of Rfx6 staining along the crypt- villus axis. Rfx6 staining appears to be strongest in the crypts and in the lower part of villi and becomes weaker while enteroendocrine cells differentiate and migrate up toward the villus top (Figure 1J). Indeed, Chromogranin A (ChgA)-positive or 5-HT-positive but Rfx6-negative cells can be found at the villus top indicating gradual loss of Rfx6 as enteroendocrine cells differentiate and migrate up (Figure 1F, Suppl. Figure 1). In contrast, all GIP-expressing cells expressed Rfx6 (Suppl. Figure 1).

3.2 Ectopic expression of gastric genes and impaired enteroendocrine cell differentiation in the embryonic intestine lacking Rfx6 At first, Rfx6 is expressed in the embryonic gut endoderm and then becomes restricted to the enteroendocrine lineage at later stages of development suggesting different roles. To decipher Rfx6 intestinal functions, we compared the transcriptome of the embryonic small intestine of Rfx6 null mice (Rfx6-/-), as well as of mice with an endocrine specific deletion of the gene (Rfx6f/f; Neurog3-Cre; called thereafter Rfx6ΔEndo) to wild-type controls. We observed a strong down-regulation of the vast majority of genes encoding enteroendocrine hormones, Gcg (stands herein for preproglucagon gene), Gip, Ghrl, Sst, Nts, Cck, Pyy, Sct, both in Rfx6-/- as well as in Rfx6ΔEndo intestine (Figure 2 A, B, Table S1 and 2). Lmx1a, a transcription factor regulating Tph1 expression and thus important for 5-HT production in EC cells, is up-regulated in Rfx6-/- intestine (Fold Change (FC) =1.7; adjusted p-value=0.01). Indeed, recent studies revealed the importance of Nkx2-2 transcription factor for enterochromaffin cell differentiation through control of Lmx1a expression [45]. Lmx1a in turn transactivates Tph1 encoding Tryptophan hydroxylase 1, the rate-limiting enzyme for the production of peripheral serotonin. Accordingly, we observed a trend for Tph1 to increase (FC= 1.3; p-value 0.016; adjusted p-value=0.13).

Unexpectedly, transcriptome comparison revealed that many gastric genes were strongly up-regulated in Rfx6-/- (Figure 2A), but not in Rfx6ΔEndo embryonic intestine, compared with wild-type. These genes include Gkn2, Tff1 and Muc5b, which are normally expressed in pit cells of the gastric glands, as well

11 bioRxiv preprint doi: https://doi.org/10.1101/704924; this version posted July 19, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

as Atp4b, which encodes a subunit of the gastric proton pump expressed in parietal cells of the fundic gland. These data suggest that heterotopic gastric mucosa forms in the small intestine of Rfx6-deficient mice. We were able to confirm this hypothesis by RT-qPCR for Gkn2 and Tff1 (data not shown) and at the protein level for TFF1 (Figure 2C). In agreement with the transcriptomic data, we found many patches of TFF1-positive cells in the small intestine of Rfx6-deficient newborn mice but never in controls (not shown). Next, we investigated gastric enteroendocrine cell differentiation. Tph1 expression was, similarly to the intestine, up-regulated, while the expression of Gast, Sst and Ghrl was severely decreased in the stomach of Rfx6-deficient newborn mice (Figure 2D). Thus, our study suggests that, in the mouse embryo, Rfx6 controls enteroendocrine cell differentiation in the gastro-intestinal tract and is required for the maintenance of intestinal cell identity.

3.3 Constitutive, but not adult-induced intestinal deletion of Rfx6, is lethal To further study Rfx6 intestinal function and to bypass any effect related to its pancreatic function, we generated intestine-specific Rfx6-deficient mice (Rfx6fl/fl; Villin-Cre, referred as Rfx6ΔInt). Rfx6ΔInt mice died shortly after birth (between P2-P5, n=14 litters), except one animal who survived up to 13 weeks. The presence of milk in the stomach testified that mutants were fed properly, however, they sometimes failed to thrive. Similarly to Rfx6-/- embryonic intestine, RT-qPCRs revealed that Gcg, Gip, Cck, Pyy, Nts, Sst and Ghrl transcripts are mostly undetectable in newborns Rfx6ΔInt small intestine, Sct is decreased and Tph1 increased (data not shown). Because of the early lethality of Rfx6ΔInt pups, the role of Rfx6 in the adult intestine could not be studied in this model. We thus generated mice with an inducible deletion of Rfx6 (Rfx6fl/fl; Villin-CreERT2, referred as Rfx6ΔAdInt). Tamoxifen gavage efficiently deleted Rfx6, as shown by the absence of wild-type Rfx6 mRNA and protein in the small intestine and the colon of Rfx6ΔAdInt mice 8 days after treatment (Suppl. Figure 2A and data not shown). Rfx6ΔAdInt mice started to lose weight one week after tamoxifen treatment, however they caught up 7 days later (Figure 3A). Only one Rfx6ΔAdInt mice did not overcome the weight loss and died 11 days after the beginning of the treatment. Thus, except this single case, we did not observe any death upon Rfx6 intestinal deletion in the adult mouse (n≥100). In summary, the lack of functional intestinal Rfx6 is lethal at early postnatal stages but is not life threatening in the adult mice.

3.4 Deletion of Rfx6 in the adult intestine induces diarrhea and impairs lipid absorption and food efficiency We next investigated the metabolic consequences of induced intestinal deletion of Rfx6 in the adult mice one month after tamoxifen treatment (Figure 3). First, we noticed that mutant mice exhibited liquid and yellowish stools (data not shown) suggesting diarrhea and steatorrhea. In agreement with the later hypothesis, Oil red O staining of the mutant gut revealed a clear reduction in the presence of neutral lipids content in the enterocytes and the lamina propria in the small intestine as well as accumulation of lipid droplets in the colon (Figure 3B). In addition, although total cholesterol and HDL levels are not affected, levels of LDL cholesterol were reduced in the serum of Rfx6ΔAdInt mice (Figure 3 C-E). Triglycerides concentrations were also reduced, but not significantly (p=0.11), free fatty acids and glycerol levels were not affected (Figure 3F-H). Since serum pancreatic lipase levels are unchanged

12 bioRxiv preprint doi: https://doi.org/10.1101/704924; this version posted July 19, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

(Figure 3I), these results suggest that the reduced numbers of Oil red O-positive lipid droplets and the reduced serum levels of LDL cholesterol found in Rfx6ΔAdInt mice are due to impaired lipid absorption rather than impaired lipid processing.

Glucose clearance was explored by oral (OGTT) and intraperitoneal (IPGTT) glucose tolerance tests (Figure 3N, O). After glucose gavage, blood glucose concentration raised similarly in mutant and control mice suggesting normal intestinal glucose absorption. OGTT revealed that Rfx6ΔAdInt mice are slightly glucose intolerant. This effect could result from the lack of incretin hormones. Indeed, when the incretin effect is bypassed in IPGTT, glucose clearance is unchanged. To further characterize these mice, we performed analyses of food efficiency (Figure 3 J-M). Mice, in which Rfx6 was deleted from the adult intestine, showed an increased production of feces due, at least in part, to an increased food intake (Figure 3J-K). Fecal energy measurement, using bomb calorimetry (Figure 3L), revealed fecal energy loss in Rfx6ΔAdInt mice compared to the controls, suggesting malabsorption. Despite increased food intake, Rfx6ΔAdInt mice have a decreased food efficiency ratio (Figure 3M). Together, these data suggest that decreased food efficiency of Rfx6ΔAdInt mice could result from diarrhea and lipid malabsorption. This is in agreement with previous work in mice lacking all enteroendocrine cells [11] as well as with symptoms of Mitchell Riley patients [21].

3.5 Impaired production of all enteroendocrine hormones except serotonin which is increased in Rfx6-deficient adult intestine To decipher the mechanisms underlying Rfx6 function in the adult intestine we determined the genes differentially expressed in the ileum upon Rfx6 removal one week (Figure 4A-C, table S3) and 3 months (Figure 4D-F, table S4) after tamoxifen treatment by RNA sequencing. RT-qPCR were also performed in other segments of the small intestine and in the colon. (Suppl Figure 2). This strategy allowed us to identify early targets and later transcriptome changes. RNA-Seq revealed that 78 and 74 genes were respectively found up and down-regulated 1 week after tamoxifen treatment (Adjusted p-value ≤ 0.05) while these numbers increased to 1393 and 1483 after 3 months, suggesting adaptive responses. Overall, we found that transcripts for many intestinal hormones are almost undetectable (Gcg, Pyy, Gip, Ghrl, Nts) or decreased (Cck, Sst, Nts, Sct) in the small intestine of Rfx6ΔAdInt mice compared to controls (Figure 4B, E, Suppl Figure 2). Gcg and Pyy transcripts are decreased as well in the mutant colon (Suppl Figure 2B). In sharp contrast, Tph1, encoding the 5-HT/serotonin-generating enzyme in EC-cells, was up-regulated in the small and large intestine of Rfx6ΔAdInt mice. Tph1 transcripts were increased as early as one week after Rfx6 removal, in the duodenum (Suppl Figure 2A) and ileum (Figure 4B), and after one month in the jejunum and colon of Rfx6ΔAdInt mice (Suppl Figure 2B). Accordingly, ChgA expression, known to be enriched in EC-cells, was increased likewise upon Rfx6 deletion (Figure 4E, Suppl. Figure 2B). In agreement with the transcriptomic data, we have not been able to find any SCT, GLP1-, GIP-, CCK-, or SST-expressing cell by immunofluorescence (data not shown). On the contrary, the number of serotonin (5-HT)-positive cells was increased already 1 week after Rfx6 deletion compared to controls (Figure 5D). Consequently mucosal 5-HT content was higher in Rfx6ΔAdInt mice (Figure 5E). These observations suggest that the differentiation of endocrine cells producing peptides is impaired in

13 bioRxiv preprint doi: https://doi.org/10.1101/704924; this version posted July 19, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

absence of Rfx6, whilst the number of 5-HT cells is increased. Apart from the endocrine lineage, we did not observe any perturbation of the differentiation of other intestinal epithelial cells - including Paneth cells, goblet-cells or enterocytes - or of the crypt/villi morphogenesis (Suppl. Figure 3).

To determine the position of Rfx6 in the transcriptional network controlling enteroendocrine cell differentiation, we next examined the expression of transcription factors known to control enteroendocrine cell differentiation. We found that Arx, Isl1 and Pax6 are strongly decreased (Figure 4C, F, Suppl. Figure 2) as early as 1 week after tamoxifen treatment, in agreement with the impaired differentiation of peptidergic enteroendocrine cells and suggesting that Rfx6 acts upstream of these transcription factors. In contrast, the expression of several transcription factors was up-regulated (Figure 4C, F, Suppl. Figure 2) such as Pax4 which is also up-regulated in Rfx6-deficent pancreatic beta cells. Neurog3 transcripts are increased as well, suggesting that Rfx6 deletion perturbs endocrine progenitor cell development (Figure 5). Importantly, we also found that Lmx1a is increased upon Rfx6 deletion in the adult intestine, and so it is the case for Nkx2-2, an upstream regulator of Lmx1a, 3 months after tamoxifen treatment. Lmx1a upregulation likely explains the increased expression of Tph1, the rate limiting enzyme for serotonin synthesis. RNA-Seq did not reveal any changes in expression for other endocrine transcription factors, such as Insm1, Sox4, NeuroD1 or for Atoh1 which is necessary for secretory lineage specification. Unaltered gene expression reflects either that the average gene expression levels are unchanged -which does not exclude variation in single cells- or that gene expression is independent of Rfx6. Taken together, our results suggest that Rfx6 controls transcriptional programs which promote the differentiation of enteroendocrine cells expressing peptide hormones (PE cells) while repressing the differentiation of enterochromaffin cells secreting serotonin (EC cells) in the digestive tract.

We next addressed the question whether Rfx6 similarly controls enteroendocrine cell differentiation in Rfx6ΔAdInt small intestinal organoids (Figure 4G, H). Briefly, tamoxifen was added to organoids cultures to remove Rfx6 and organoids were analyzed 8 days after treatment. As expected, RT-qPCR analysis confirmed the decreased expression of Gip, Gcg, Cck (Sct unchanged) upon Rfx6 deletion. Unexpectedly, Tph1 expression was also decreased, as Ucn3 and Tac1, two other markers of EC cells (see last section results). In agreement with the decreased expression of EC enriched genes, Lmx1a was down-regulated as well in this culture system, suggesting that the consequences of Rfx6 removal on EC cells differentiation programs are different in vivo and ex vivo.

3.6 Enhanced expression of neoglucogenic and nutrient absorption machinery genes in the small intestine of mice upon Rfx6 deletion To evaluate the long-term effect of impaired enteroendocrine cell function and lipid metabolism consecutively to Rfx6 deficiency, we examined the expression of intestinal genes that are not endocrine specific. Surprisingly we observed a strong and fast upregulation of genes involved in intestinal gluconeogenesis [46]. These include Fructose 1,6 biphosphatase (Fbp1) and Glucose 6 phosphatase (G6pc) as well as Glutaminase (Gls), the enzyme which hydrolyzes glutamine, the main gluconeogenic

14 bioRxiv preprint doi: https://doi.org/10.1101/704924; this version posted July 19, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

substrate in the small intestine (Figure 4 A, D, table S4). The expression of the gene encoding the brush border enzyme sucrase-isomaltase (Sis), which hydrolyses dietary carbohydrates was also found to be up-regulated. A major long-term adaptation to intestinal Rfx6 deletion, not observed at 1 week, is the strong upregulation of the glucose transporter type 2 Slc2a2 (also known as Glut2). Slc2a2 transporter is thought to facilitate the passage of dietary sugars in the blood stream [47] at the basolateral side of enterocytes. The expression of the sodium-coupled co-transporter Sglt1, which triggers glucose absorption at the apical membrane of enterocytes, was however not differentially expressed. We also found an up-regulation of ApoA4, an important chylomicron component, as well as of other apoliproteins such as Apoc3, Apoc2 and their upstream regulator, the transcription factor Creb3l3/CREB-H [48]. Together, our data suggest that Rfx6ΔAdInt mice adapt to overcome decreased food efficiency by promoting intestinal glucose and lipid absorption, as well as glucose production.

3.7 Increased number of enteroendocrine progenitors in intestinal crypts of Rfx6ΔAdInt mice. Unexpectedly, when analyzing RNA-Seq data, we found increased levels of Neurog3 transcripts in the ileum of adult Rfx6ΔAdInt mice 3 months after Rfx6 deletion (Figure 4 C, F). Similarly, RT-qPCR data showed that Neurog3 was up-regulated in the jejunum (2-fold) and in the colon (1.6-fold) compared to controls (Figure 5A) and in the duodenum as early as one week after Rfx6 deletion (Suppl. Figure 2A). Similar results were observed in Rfx6ΔInt neonates (data not shown). Morphometric analysis revealed a 1.3-5 fold increase in the number of Neurog3-cells per mm2 in all segments of the small intestine as well as in the colon of Rfx6ΔAdInt mice (Figure 5B). To determine whether the increased pool of enteroendocrine progenitors resulted from an increased proliferation of endocrine progenitors, we quantified the percentage of Neurog3+/BrdU+ double-positive cells. Neurog3 cell proliferation was not affected in the duodenum and jejunum while was increased in the ileum and colon (Figure 5C). Neurog3- positive cells did not co-stain for 5-HT (Figure 5F) suggesting that the increased number of 5-HT-positive cells does not result from premature expression of 5-HT in enteroendocrine progenitors. Taken together, our results support that the increase of Neurog3 transcripts in Rfx6-deficient intestine results from increased number of enteroendocrine progenitors.

3.8 Single cell transcriptomics revealed Rfx6 dependent genetic programs in the Peptidergic enteroendocrine and Enterochromaffin cell lineages To gain knowledge into the mechanisms controlling enteroendocrine cell differentiation and diversity as well as into the role of Rfx6, we performed single-cell RNA sequencing of sorted EECs. Enteroendocrine cells were captured at various stages of their development, from endocrine progenitors to hormone expressing cells. Endocrine cells were purified from Neurog3eYFP/+ mouse intestinal organoids. In this model, due to the stability of the eYFP protein, both crypt-based endocrine progenitors as well differentiating hormone-expressing EECs express the fluorescent reporter (Figures 6A and S4). After data filtering, 290 cells were analyzed. Shared Nearest Neighbor (SNN) clustering revealed eight groups of cells (Figures 6B and S5A) which were visualized in two dimensions using the Uniform Manifold Approximation and Projection (UMAP) algorithm. These clusters include 4 groups of progenitors (P1-4); P2-P4 expressing the endocrine progenitor marker Neurog3 (Suppl. Figure 5A). Group P1 expresses

15 bioRxiv preprint doi: https://doi.org/10.1101/704924; this version posted July 19, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

markers of Paneth (Defa 17, Lyz1) and goblet (Muc2, Tff3) cells, suggesting multiple lineages priming in secretory progenitors as previously described [49]. The four other clusters represent subsets of Enterochomaffin cells (EC early and EC) expressing Tph1 (Figure 6E and S5A), and Peptidergic Enteroendocrine cells (PE early and PE) expressing Glc, Cck, Sct, Gip, Ghrl and Sst (Figure 6F and S5A), at different stages of maturation. Clusters gene signature includes known and novel makers of EC and PE cells (Suppl. Figure 5A). Single-cell analysis confirmed that Rfx6 is expressed both in endocrine progenitors as well as in more mature enteroendocrine cells of both EC and PE lineages (Figure 6D, O) and that single EECs can co-express several hormones genes (Figure 6O). Temporal resolution of transcriptome dynamics using diffusion map algorithm predicted cell state transition trajectories. Data analysis showed that endocrine progenitors differentiate in two branches: the EC and PE lineages (Figures 6C). Examples of genes expressed along the EC and PE branches are shown in Figure 6G-N and Suppl. Figure 6. Importantly, pseudotemporal ordering of single cells also revealed dynamics of transcription factors during EC or PE cell differentiation (Figures 6 and S6). Some transcription factors are clearly enriched in EC (Lmx1a, Mnx1, Atf6, Glis3, Lhx1) or PE (Arx, Isl1, Pax6, Etv1) lineage branches. Some other transcription factors (Pax4, Neurod1, Nkx2-2, Insm1, Mlxipl), like Rfx6, are found both in progenitors and more mature enteroendocrine cells (Suppl. Figure 6 Q-X) but are not specifically enriched in EC and PE lineages according to our selection criteria.

Our data show that Rfx6 differentially controls genetic programs regulating PE and EC cells, which appeared to be the two main EEC lineages. We thus determined, among the genes defining the signature of PE and EC lineages, which one are actually regulated by Rfx6 in the adult small intestine (Figures 6P ad Supll. Figure 5B). As expected, most PE enriched genes, like hormone genes (e.g Sct, Gcg, Gip, Sst, Cck), related transcription factors (e.g. Arx, Isl1, Pax6), GPCRs (e.g Gpr119, Ffar1) as well as other PE markers (Abcc8, Scgn, Fapb5) are down regulated in absence of Rfx6. Surprisingly rare PE enriched genes are either up-regulated (Rbp2) or have their expression unchanged (Gpr112, Rbp4, Scg3, data not shown). Furthermore, the vast majority of EC enriched genes are up-regulated in absence of Rfx6, including endocrine markers (Tph1, ChgA, Scn3a), transcription factors (Lmx1a, Glis3), GPCRs (Olfr558, Olfr78) or other markers (e.g Cacna1d, Disp2, Cwh43). However, the expression of highly specific markers of the EC lineage was not affected (e.g Tac1, Ucn3, Lhx1, Mnx1, Atf6) or decreased (Pappa2, Ly6a) by the loss of Rfx6. Taken together, these results suggest that Rfx6 regulates specific genetic programs in the EC and PE lineages, while others genes are independent of Rfx6.

16 bioRxiv preprint doi: https://doi.org/10.1101/704924; this version posted July 19, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

4. DISCUSSION

Mutations in RFX6 are causal of Mitchell-Riley syndrome in human. This syndrome is characterized by neonatal diabetes and intestinal failures including malabsorption [21]. Previous studies showed that Rfx6 controls beta-cell development in the mouse embryo as well as insulin secretion in adult mouse and human beta cells [21; 22; 31]. However, the function of Rfx6 in the mouse intestine was unknown. In this study we show that, as in the pancreas, Rfx6 is expressed in Neurog3-endocrine progenitors and persists in all hormone-expressing cells in the intestine, and not only in Gip-expressing cells as previously thought [23]. Analysis of mice with a constitutive or inducible intestinal deletion of Rfx6 resulted, in all cases, into a severe loss of enteroendocrine cells expressing peptide hormones while enterochromaffin cells were still present and genes controlling serotonin-production were increased. Unlike newborns that die, adult mice can cope with the induction of this massive reduction of peptidergic EECs. However, intestinal absorption is perturbed leading to impaired food efficiency. RNA-Seq revealed enhanced expression of neoglucogenic and nutrient absorption machinery genes that we hypothesize to be a compensatory mechanism to cope with the malabsorption. Importantly, using single- cell transcriptomics we found that EECs differentiate from endocrine progenitors according to two cell trajectories: the Enterochromaffin cells (EC) and Peptidergic Enteroendocrine (PE) cells. Similar conclusions were drawn recently in a single-cell study [50]. Identification of specific gene signatures and dynamics in the EC and PE lineages allowed us to determine their respective dependence on Rfx6. We propose that Rfx6 positively regulates genetics programs leading to PE cells differentiation, and represses 5-HT production, as well as other, but not all, EC cell specific programs (Figure 7).

In addition to the severe alteration in Peptidergic Enteroendocrine cell differentiation, our studies demonstrated that constitutive inactivation of Rfx6 leads to gastric heterotopia in the embryonic mouse intestine. Heterotopic gastric mucosa was reported in only 3 patients carrying compound heterozygote mutations in RFX6 [29; 30]. These patches of gastric heterotopia were revealed after histological analysis of intestinal resection to treat hemorrhagic ulcers. It has been proposed that mucosa alteration could be caused by acid secretion of the ectopic gastric tissue [30]. It is likely that gastric heterotopia is a general feature of patients with Rfx6 mutation, since anemia and melena were reported in many cases and could result from intestinal bleeding [30]. In one case, ectopic pancreatic tissue was also reported in the jejunum [30], a feature that we did not observe in Rfx6-deficient mice. Importantly, we observed gastric tissue only in the intestine of mice with a constitutive deletion of Rfx6, never when Rfx6 was deleted in the endocrine lineage or when Rfx6 was inactivated in the adult intestine. These observations suggest that gastric heterotopia is unrelated to the impairment of the endocrine lineage but rather results from an early function of Rfx6 in mouse endoderm patterning, similarly to what has been suggested in Xenopus [24]. Nevertheless, we did not observe any gross defect of intestinal or gastric organogenesis, suggesting functional redundancy. The patchy pattern of gastric tissue in Rfx6-deficient intestine might thus be explained by the lack of functional compensation in some pluripotent endodermal stem cells that consequently lost or did not acquire the proper regional identity.

17 bioRxiv preprint doi: https://doi.org/10.1101/704924; this version posted July 19, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Rfx6 inactivation led to an increased expression of Tph1, which is critical for 5-HT biosynthesis in enterochromaffin cells, at all stages and conditions studied in vivo throughout the intestine. Furthermore, in the adult intestine, we measured an increased number of 5-HT-positive cells and mucosal 5-HT content in the small intestine upon Rfx6 removal. We thus propose that Rfx6 represses 5-HT biosynthesis. Of note, we found that the expression of Lmx1a, shown previously to control, downstream of Nkx2-2, the expression of Tph1 [51], was up-regulated. This suggests that increased Tph1 results from increased Lmx1a. By contrast, Nkx2-2 transcripts were unaffected one week after Rfx6 deletion, suggesting that Rfx6 does thus not repress Lmx1a via Nkx2-2. However, since 3 months after the tamoxifen treatment, Nkx2-2 expression was increased, we cannot exclude a contribution of Nkx2-2 in Lmx1a and Tph1 up-regulation at a later stage. Importantly, the unchanged expression of several specific markers of the EC lineage, identified in our single cell transcriptome study of enteroendocrine cells, such as Ucn3, Tac1, Atf6, Lmx1a and Mnx1, suggests that Rfx6 does not act as a genetic switch promoting PE and inhibiting EC destiny. Rather, Rfx6 represses the genetic program leading to 5-HT biosynthesis and possibly others specific features of EC cells. However, as some of these genes are also expressed outside of enterochromaffin cells, such as Ucn3 or Tac1 which are found in enteric neurons [52], it is possible that we could not detect variation in their mucosal expression when performing bulk RNA-Seq on the entire intestinal tissue. Of note, the cellular origin of the increased expression of Lmx1a and Tph1 remains unclear. One hypothesis is that the loss of Rfx6 results into the ectopic induction of the serotonergic program in the PE lineage. Another possibility would be that Rfx6 modulates the levels of 5-HT in EC cells by controlling the expression of Lmx1a and Tph1. The absence of cells co-expressing Neurog3 and 5-HT in Rfx6ΔAdInt mice suggests that Rfx6 does not represses the serotonergic program in enteroendocrine progenitors but rather at later stages of EEC cell differentiation.

Our study also sheds light on the position of Rfx6 in the regulatory network of transcription factors controlling EECs differentiation. We found that Pax6, Isl1, and Arx are down-regulated, while Pax4 is up-regulated by the inactivation of Rfx6 suggesting that Rfx6 operates upstream of these transcription factors. In Arx-deficient mice, the expression of Gcg, Gip, Cck and Nts was reduced [14; 15], suggesting that Rfx6 regulates the expression of these hormone-encoding genes through the regulation of Arx. Pax4 and Arx are known to repress each other in the developing pancreas [53]. However, this does not seem to be the case in the gut. Indeed, Pax4 expression is unchanged in Arx-deficient intestine. Thus, increased Pax4 expression, in absence of Rfx6, is probably not the consequence of Arx down- regulation. Nevertheless, Pax4 was shown to be required for EC cell differentiation [14] in agreement with the maintenance of EC cells in Rfx6-deficient mice. Rfx6 is thus turned on in endocrine progenitors and operates downstream of Neurog3 to regulate a network of transcription factors including Lmx1a, Pax4, Arx, Pax6 and Isl1 which will control later steps of EEC differentiation. Our study revealed that Neurog3 expression and the number of Neurog3-positive endocrine progenitor cells increased upon induction of Rfx6 deletion in both the small intestine and colon. One explanation for this increase would be that Rfx6 normally represses Neurog3 expression in late endocrine progenitors. Alternatively, endocrine progenitors accumulate because they cannot differentiate further into Peptidergic enteroendocrine cells. Unexpectedly, when we studied the consequences of the induction of Rfx6

18 bioRxiv preprint doi: https://doi.org/10.1101/704924; this version posted July 19, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

deletion in small intestine organoid cultures, we found that development of all EECs was impaired including EC cells. In line with this observation, the expression of Lmx1a and Tph1 was down-regulated ex vivo upon Rfx6 deletion. A similar conclusion was reported recently in a study where Rfx6 was inactivated directly, ex vivo, in mouse intestinal organoids [50]. We propose that these in vivo/ex vivo differences on the role of Rfx6 in EC cell development could reflect limitations of the organoid culture system to faithfully mimic alternative cell differentiation pathways when genetic networks are perturbed. We cannot exclude that the promotion of serotonergic programs in the absence of Rfx6 results from an adaptation due to a systemic effect or an effect of the microbiota that would not occur ex vivo. However, we do not favor this hypothesis as we saw the induction of Lmx1a and or Tph1 when Rfx6 is lacking, not only in the adult but also in the embryonic intestine and in the developing stomach suggesting a general function of Rfx6 in repressing enterochromaffin cell differentiation. In conclusion, this study revealed that Rfx6 is essential, downstream of Neurog3, for the differentiation of peptidergic enteroendocrine cells during development and in the adult. Rfx6-dependent impairment of enteroendocrine cells perturbs food efficiency. In addition, we show that Rfx6 also represses genetic programs leading to the biosynthesis of 5-HT. These findings shed new light on the molecular mechanisms underlying intestinal malabsorption and energy metabolism in RFX6 deficiency in humans

19 bioRxiv preprint doi: https://doi.org/10.1101/704924; this version posted July 19, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

AUTHOR CONTRIBUTION

J.P. designed and performed most of the mouse experiments, analyzed the data and wrote the paper, C.V. performed bioinformatic analysis, interpreted results and wrote the paper. F.B. and A.D.A. performed single cell experiments, interpreted results and wrote the paper. F.B., A.D.A. and N.P performed all organoids experiments and interpreted results. S.G., L.N., M.L.L. M.E. and C.T.C helped initially with the design and realization of single cell experiments. C.K., S.J.C. and N.M. contributed to the bioinformatic analysis. M.M.L performed serotonin measurements. J.P. and A.D.A. performed morphometric analysis. A.M., A.B., P.S. and V.S., performed experiments and contributed to data analysis. C.L assisted with the immunostaining experiments. T.W.S provided conceptual input. G.G. oversaw the entire project, designed experiments, analyzed data, wrote the paper and obtained financial support.

ACKNOWLEDGEMENTS

The authors thank the members of the Genomeast platform for RNASeq and Doulaye Dembele for initial analyses of the data, of the Cell sorting facility, of the Mouse Clinical Institute Metabolic Exploration Plateform (MCI, Strasbourg, France) for their help with the metabolic analyses. We thank N. Messaddec (IGBMC), for Electron microscopy and Martine Poulet for technical assistance and Tao Ye (IGBMC) for submission of data to GEO. We thank Miriam Ejarque (IGBMC), Catherine Tomasetto (IGBMC), Natalie Terry (Division of GI, Hepatology, and Nutrition Children's Hospital of Philadelphia) and Klaus Kaestner for helpful discussions. This study was funded by the Novo Nordisk Foundation (Challenge Grant NNF14OC0013655) and by Grants from the Agence Nationale pour la Recherche (ANR Rfx- PancInt) and from the Foundation pour la Recherche Médicale (FRM). IGBMC is supported by the grant ANR-10-LABX-0030-INRT, a French State fund managed by the Agence Nationale de la Recherche under the frame program Investissements d’Avenir ANR-10-IDEX-0002-02.

CONFLICT OF INTEREST

The authors have declared no competing interest

AUTHOR CONTRIBUTION

20 bioRxiv preprint doi: https://doi.org/10.1101/704924; this version posted July 19, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

oversaw the entire project, designed experiments, analyzed data, wrote the paper and obtained financial support.

21 bioRxiv preprint doi: https://doi.org/10.1101/704924; this version posted July 19, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Bibliography

[1] Egerod, K.L., Engelstoft, M.S., Grunddal, K.V., Nøhr, M.K., Secher, A., Sakata, I., et al., 2012. A Major Lineage of Enteroendocrine Cells Coexpress CCK, Secretin, GIP, GLP-1, PYY, and Neurotensin but Not Somatostatin. Endocrinology.

[2] Habib, A.M., Richards, P., Cairns, L.S., Rogers, G.J., Bannon, C.A.M., Parker, H.E., et al., 2012. Overlap of endocrine hormone expression in the mouse intestine revealed by transcriptional profiling and flow cytometry. Endocrinology 153(7):3054-3065.

[3] Grün, D., Lyubimova, A., Kester, L., Wiebrands, K., Basak, O., Sasaki, N., et al., 2015. Single- cell messenger RNA sequencing reveals rare intestinal cell types. Nature 525(7568):251-255.

[4] Haber, A.L., Biton, M., Rogel, N., Herbst, R.H., Shekhar, K., Smillie, C., et al., 2017. A single- cell survey of the small intestinal epithelium. Nature 551(7680):1-28.

[5] Drucker, D.J., 2016. Evolving Concepts and Translational Relevance of Enteroendocrine Cell Biology. Journal of Clinical Endocrinology & Metabolism 101(3):778-786.

[6] Beumer, J., Artegiani, B., Post, Y., Reimann, F., Gribble, F., Nguyen, T.N., et al., 2018. Enteroendocrine cells switch hormone expression along the crypt-to-villus BMP signalling gradient. Nature Cell Biology 20(8):909-916.

[7] Shivdasani, R.A., 2018. Limited gut cell repertoire for multiple hormones. Nature Cell Biology.

[8] Jenny, M., 2002. Neurogenin3 is differentially required for endocrine cell fate specification in the intestinal and gastric epithelium. The EMBO Journal 21(23):6338-6347.

[9] Lee, C.S., Perreault, N., Brestelli, J.E., Kaestner, K.H., 2002. Neurogenin 3 is essential for the proper specification of gastric enteroendocrine cells and the maintenance of gastric epithelial cell identity. Genes & development 16(12):1488-1497.

[10] Schonhoff, S.E., Giel-Moloney, M., Leiter, A.B., 2004. Neurogenin 3-expressing progenitor cells in the gastrointestinal tract differentiate into both endocrine and non-endocrine cell types. 270(2):443- 454.

[11] Mellitzer, G., Beucher, A., Lobstein, V., Michel, P., Robine, S., Kedinger, M., et al., 2010. Loss of enteroendocrine cells in mice alters lipid absorption and glucose homeostasis and impairs postnatal survival. The Journal of clinical investigation 120(5):1708-1721.

[12] Shroyer, N.F., Helmrath, M.A., Wang, V.Y.C., Antalffy, B., Henning, S.J., Zoghbi, H.Y., 2007. Intestine-specific ablation of mouse atonal homolog 1 (Math1) reveals a role in cellular homeostasis. YGAST 132(7):2478-2488.

22 bioRxiv preprint doi: https://doi.org/10.1101/704924; this version posted July 19, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

[13] Naya, F.J., Huang, H.P., Qiu, Y., Mutoh, H., DeMayo, F.J., Leiter, A.B., et al., 1997. Diabetes, defective pancreatic morphogenesis, and abnormal enteroendocrine differentiation in BETA2/neuroD- deficient mice. Genes & development 11(18):2323-2334.

[14] Beucher, A., Gjernes, E., Collin, C., Courtney, M., Meunier, A., Collombat, P., et al., 2012. The homeodomain-containing transcription factors Arx and Pax4 control enteroendocrine subtype specification in mice. PLoS One 7(5):e36449.

[15] Du, A., McCracken, K.W., Walp, E.R., Terry, N.A., Klein, T.J., Han, A., et al., 2012. Arx is required for normal enteroendocrine cell development in mice and humans. 365(1):175-188.

[16] Larsson, L.I., St-Onge, L., Hougaard, D.M., Sosa-Pineda, B., Gruss, P., 1998. Pax 4 and 6 regulate gastrointestinal endocrine cell development. Mechanisms of Development 79(1-2):153-159.

[17] Terry, N.A., Walp, E.R., Lee, R.A., Kaestner, K.H., May, C.L., 2014. Impaired enteroendocrine development in intestinal-specific Islet1 mouse mutants causes impaired glucose homeostasis. AJP: Gastrointestinal and Liver Physiology 307(10):G979-G991.

[18] Ye, D.Z., Kaestner, K.H., 2009. Foxa1 and Foxa2 control the differentiation of goblet and enteroendocrine L- and D-cells in mice. Gastroenterology 137(6):2052-2062.

[19] Gierl, M.S., Karoulias, N., Wende, H., Strehle, M., Birchmeier, C., 2006. The zinc-finger factor Insm1 (IA-1) is essential for the development of pancreatic beta cells and intestinal endocrine cells. Genes & development 20(17):2465-2478.

[20] Soyer, J., Flasse, L., Raffelsberger, W., Beucher, A., Orvain, C., Peers, B., et al., 2010. Rfx6 is an Ngn3-dependent winged helix transcription factor required for pancreatic islet cell development. Development (Cambridge, England) 137(2):203-212.

[21] Smith, S.B., Qu, H.-Q., Taleb, N., Kishimoto, N.Y., Scheel, D.W., Lu, Y., et al., 2010. Rfx6 directs islet formation and insulin production in mice and humans. Nature 463(7282):775-780.

[22] Piccand, J., Strasser, P., Hodson, D.J., Meunier, A., Ye, T., Keime, C., et al., 2014. Rfx6 maintains the functional identity of adult pancreatic β cells. Cell reports 9(6):2219-2232.

[23] Suzuki, K., Harada, N., Yamane, S., Nakamura, Y., Sasaki, K., Nasteska, D., et al., 2013. Transcriptional Regulatory Factor X6 (Rfx6) Increases Gastric Inhibitory Polypeptide (GIP) Expression in Enteroendocrine K-cells and Is Involved in GIP Hypersecretion in High Fat Diet-induced Obesity. The Journal of biological chemistry 288(3):1929-1938.

[24] Pearl, E.J., Jarikji, Z., Horb, M.E., 2011. Functional analysis of Rfx6 and mutant variants associated with neonatal diabetes. 351(1):135-145.

23 bioRxiv preprint doi: https://doi.org/10.1101/704924; this version posted July 19, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

[25] Spiegel, R., Dobbie, A., Hartman, C., de Vries, L., Ellard, S., Shalev, S.A., 2011. Clinical characterization of a newly described neonatal diabetes syndrome caused by RFX6 mutations. American journal of medical genetics. Part A 155A(11):2821-2825.

[26] Concepcion, J.P., Reh, C.S., Daniels, M., Liu, X., Paz, V.P., Ye, H., et al., 2014. Neonatal diabetes, gallbladder agenesis, duodenal atresia, and intestinal malrotation caused by a novel homozygous mutation in RFX6. Pediatric diabetes 15(1):67-72.

[27] Artuso, R., Provenzano, A., Mazzinghi, B., Giunti, L., Palazzo, V., Andreucci, E., et al., 2014. Therapeutic implications of novel mutations of the RFX6 gene associated with early-onset diabetes. Pharmacogenomics J.

[28] Zegre Amorim, M., Houghton, J.A.L., Carmo, S., Salva, I., Pita, A., Pereira-da-Silva, L., 2015. Mitchell-Riley Syndrome: A Novel Mutation in RFX6 Gene. Case reports in genetics 2015:937201.

[29] Sansbury, F.H., Kirel, B., Caswell, R., Lango Allen, H., Flanagan, S.E., Hattersley, A.T., et al., 2015. Biallelic RFX6 mutations can cause childhood as well as neonatal onset diabetes mellitus. European journal of human genetics : EJHG 23(12):1744-1748.

[30] Skopkova, M., Ciljakova, M., Havlicekova, Z., Vojtkova, J., Valentinova, L., Danis, D., et al., 2016. Two novel RFX6 variants in siblings with Mitchell-Riley syndrome with later diabetes onset and heterotopic gastric mucosa. European Journal of Medical Genetics 59(9):429-435.

[31] Chandra, V., Albagli-Curiel, O., Hastoy, B., Piccand, J., Randriamampita, C., Vaillant, E., et al., 2014. RFX6 regulates insulin secretion by modulating Ca2+ homeostasis in human β cells. Cell reports 9(6):2206-2218.

[32] Khan, N., Dandan, W., Al Hassani, N., Hadi, S., 2016. A Newly-Discovered Mutation in the RFX6 Gene of the Rare Mitchell-Riley Syndrome. J Clin Res Pediatr Endocrinol 8(2):246-249.

[33] Piccand , J., Strasser, P., Hodson, D.J., Meunier, A., Ye, T., Keime, K., et al., 2014. Rfx6 maintains the functional identity of adult pancreatic β-cells. Manuscript in revision.

[34] Yoshida, S., Takakura, A., Ohbo, K., Abe, K., Wakabayashi, J., Yamamoto, M., et al., 2004. Neurogenin3 delineates the earliest stages of spermatogenesis in the mouse testis., Dev. Biol., pp. 447- 458.

[35] El Marjou, F., Janssen, K.-P., Chang, B.H.-J., Li, M., Hindie, V., Chan, L., et al., 2004. Tissue- specific and inducible Cre-mediated recombination in the gut epithelium., Genesis, pp. 186-193.

[36] Mellitzer, G., Martin, M., Sidhoum-Jenny, M., Orvain, C., Barths, J., Seymour, P.A., et al., 2004. Pancreatic islet progenitor cells in neurogenin 3-yellow fluorescent protein knock-add-on mice. Mol.Endocrinol. 18(11):2765-2776.

24 bioRxiv preprint doi: https://doi.org/10.1101/704924; this version posted July 19, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

[37] Bolstad, B.M., Irizarry, R.A., Astrand, M., Speed, T.P., 2003. A comparison of normalization methods for high density oligonucleotide array data based on variance and bias. Bioinformatics 19(2):185-193.

[38] Ritchie, M.E., Phipson, B., Wu, D., Hu, Y., Law, C.W., Shi, W., et al., 2015. limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res 43(7):e47.

[39] Love, M.I., Huber, W., Anders, S., 2014. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15(12):550.

[40] Smith, T., Heger, A., Sudbery, I., 2017. UMI-tools: modeling sequencing errors in Unique Molecular Identifiers to improve quantification accuracy. Genome Res 27(3):491-499.

[41] Satija, R., Farrell, J.A., Gennert, D., Schier, A.F., Regev, A., 2015. Spatial reconstruction of single-cell gene expression data. Nat Biotechnol 33(5):495-502.

[42] Robinson, M.D., McCarthy, D.J., Smyth, G.K., 2010. edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 26(1):139-140.

[43] Soneson, C., Robinson, M.D., 2018. Bias, robustness and scalability in single-cell differential expression analysis. Nat Methods 15(4):255-261.

[44] Haghverdi, L., Buettner, F., Theis, F.J., 2015. Diffusion maps for high-dimensional single-cell analysis of differentiation data. Bioinformatics 31(18):2989-2998.

[45] Gross, S., Garofalo, D.C., Balderes, D.A., Mastracci, T.L., Dias, J.M., Perlmann, T., et al., 2016. The novel enterochromaffin marker Lmx1a regulates serotonin biosynthesis in enteroendocrine cell lineages downstream of Nkx2.2. Development (Cambridge, England) 143(14):2616-2628.

[46] Croset, M., Rajas, F., Zitoun, C., Hurot, J.M., Montano, S., Mithieux, G., 2001. Rat small intestine is an insulin-sensitive gluconeogenic organ. Diabetes 50(4):740-746.

[47] Kellett, G.L., Brot-Laroche, E., Mace, O.J., Leturque, A., 2008. Sugar absorption in the intestine: the role of GLUT2. Annual review of nutrition 28:35-54.

[48] Lee, A.-H., 2012. The role of CREB-H transcription factor in triglyceride metabolism. Current Opinion in Lipidology 23(2):141-146.

[49] Kim, T.-H., Saadatpour, A., Guo, G., Saxena, M., Cavazza, A., Desai, N., et al., 2016. Single- Cell Transcript Profiles Reveal Multilineage Priming in Early Progenitors Derived from Lgr5+ Intestinal Stem Cells. Cell reports 16(8):2053-2060.

25 bioRxiv preprint doi: https://doi.org/10.1101/704924; this version posted July 19, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

[50] Gehart, H., van Es, J.H., Hamer, K., Beumer, J., Kretzschmar, K., Dekkers, J.F., et al., 2019. Identification of Enteroendocrine Regulators by Real-Time Single-Cell Differentiation Mapping. Cell 176(5):1158-1173 e1116.

[51] Desai, S., Loomis, Z., Pugh-Bernard, A., Schrunk, J., Doyle, M.J., Minic, A., et al., 2008. Nkx2.2 regulates cell fate choice in the enteroendocrine cell lineages of the intestine. 313(1):58-66.

[52] Zeisel, A., Hochgerner, H., Lonnerberg, P., Johnsson, A., Memic, F., van der Zwan, J., et al., 2018. Molecular Architecture of the Mouse Nervous System. Cell 174(4):999-1014 e1022.

[53] Collombat, P., 2003. Opposing actions of Arx and Pax4 in endocrine pancreas development. Genes & development 17(20):2591-2603.

26 bioRxiv preprint doi: https://doi.org/10.1101/704924; this version posted July 19, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Legend to Figures

Figure 1: Expression of Rfx6 in the intestinal endocrine lineage of embryonic and adult mice. (A-D) Double immunofluorescence for Rfx6 (green) and Neurog3 (red) on cryosections of embryonic E15.5 (A) and adult small intestine (B-C). Yellow arrows point to Rfx6/Neurog3 double positive cells. (E-N) Double immunofluorescence for Rfx6 in red and ChromograninA (ChgA), Glucagon like peptide- 1 (GLP-1), Gastric inhibitory Polypeptide (GIP), Somatostatin (Sst), Serotonin (5-HT), Ghrelin (Ghrl), Cholecystokinin (CCK) or Gastrin (Gast), in green. Nuclei are stained with DAPI (blue). Scale bar 10µM.

Figure 2: Severe impairment of enteroendocrine cell differentiation in the gastro-intestinal tract of Rfx6-deficient embryos and presence of gastric heterotopia in mutant neonates. (A, B) Gene expression profiling of the embryonic small intestine of mice with constitutive (Rfx6-/-) or endocrine- specific deletion (Rfx6ΔEndo) of Rfx6 at E18.5. (A) Rfx6 -/- vs control comparison (micro-array data). MA- plot representing the log Fold-Change as a function of the mean of normalized intensity. Green and red points represent significantly (Adjusted p-value ≤ 0.1) up- and down-regulated genes, respectively. (B) Rfx6ΔEndo vs control comparison (micro-array data). MA-plot representing the log Fold-Change as a function of the mean of normalized intensity. Green and red points represent significantly (Adjusted p- value ≤ 0.1) up- and down-regulated genes, respectively. (C) Immunofluorescence for TFF1 on small intestine cryosections of two Rfx6-/- new born mice revealing gastric heterotopia. (D) RT-qPCR analysis of relevant genes in the stomach (P0.5) of Rfx6-/- and wild-type mice. Analysis was performed on n=4 animals per genotype. Data are represented as mean ± SD; unpaired t-test, **** p≤0.0001 ***, p≤0.001, ** p≤0.01, * p≤0.05, ns: not significant. AU stands for Arbitrary Unit. SI: Small Intestine. E18.5: Embryonic day 18.5. P0.5: postnatal day 0.5.

Figure 3: Energy homeostasis in Rfx6ΔAdInt mice. (A) Weight follow-up of controls and Rfx6ΔAdInt mice after tamoxifen gavages. (B) Oil Red O staining on cryosections from jejunum and colon from Rfx6ΔAdInt and control animals one month after tamoxifen gavage. (C-E) Blood concentration of total (T. Chol, C), high density lipoprotein (HDL Chol, D), and low-density lipoprotein cholesterol (LDL Chol, E) in Rfx6ΔAdInt mice. (F-I) Blood concentration of triglycerides (F), free fatty acids (FFA) (G), glycerol (H) and lipase (I) in Rfx6ΔAdInt mice. (J-M) Decreased food efficiency and increased food intake and feces production in Rfx6ΔAdInt mice. Food intake (J) and feces production (K) of control and mutant mice during 48h. (L) Energy (NRJ) content of the stools was evaluated in a bomb calorimeter and Food Efficiency (M) calculated (calories ingested/excreted in feces). (C-F) analysis performed 3 months after tamoxifen treatment. (N, O) oral (N, OGTT) and intraperitoneal (O, IPGTT) glucose tolerance tests on adult control and Rfx6ΔAdInt mice one month after tamoxifen-induced Rfx6 deletion. n=5-6 animals were analyzed per group. Data are represented as mean ± SEM; unpaired t-test, *** p≤0.001, ** p≤0.01*, p≤0.05.

Figure 4: Gene expression profiling of the small intestine of adult Rfx6ΔAdInt mice. (A-F) RNA- Seq analysis of the small intestine (ileum) of adult Rfx6ΔAdInt mice 8 days (A-C) and 3 months (D-F) after Rfx6 deletion. n=3-4 animals were analyzed per group. (A, D) MA-plot representing the estimated bioRxiv preprint doi: https://doi.org/10.1101/704924; this version posted July 19, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

log2 Fold-Change as a function of the mean of normalized counts. Green and red points represent significantly (adjusted pvalue ≤ 0.05) up- and down-regulated genes, respectively in Rfx6ΔAdInt versus controls, 8 days (A) or 3 months (D) after Rfx6 deletion (RNA-Seq data). (B, C, E, F) Histograms showing RNA-Seq data for a selection of genes encoding enteroendocrine hormones or the rate limiting enzyme Tph1 for serotonin synthesis (B, E) or transcription factors (C, F). All controls values are adjusted to 1. ns: non-significant, adjusted p-value >0.05 between controls and mutant. For all other genes adjusted p-value is ≤0.05. (G, H) RT-qPCR expression analysis of relevant genes in Rfx6DAdint duodenal organoids, 8 days after a 15 hours treatment with 1.25 µM Tamoxifen (4-OHT) to delete Rfx6 gene. Data are represented as mean ± SD. Organoids were generated from n=4 mice per group. Statistics: non-parametric Mann-Whitney test, *** p≤0.001, ** p≤0.01, * p≤0.05.

Figure 5: Increased number of Neurog3-positive endocrine progenitors and 5-HT-positive cells upon Rfx6 deletion in the adult intestine. (A) RT-qPCR. Expression of Neurog3 mRNA in the adult jejunum and colon three months after Rfx6 deletion (n=4 mice per group). Unpaired t-test. (B) Quantification of the number of Neurog3-positive cells per mm2 of tissue in each segment of the adult intestine (n=3-4 mice per group) three months after Rfx6 deletion. (C) Quantification of the number of proliferating Neurog3 cells expressed as the percentage of BrdU+/Neurog3+ cells on total Neurog3+ cells. (D) Quantification of the number of 5-HT-positive cells per mm2 of tissue in the duodenum and ileum of Rfx6ΔAdInt and control mice, 8 days after Rfx6 deletion (n=3 mice per group). (E) Mucosal 5-HT content analysis throughout the intestinal tract from day 11 of tamoxifen-treated control Rfx6ΔAdInt mice (n =3-4 mice per group). Biopsies were sampled from Duodenum (Duo), Jejunum (Jej), Ileum, Prox. Colon (P. olon) and Dist. Colon (D. colon). 5-HT content were analysed on a HPLC-ECD and results stated as area under the curve (AUC). (F) Double immunofluorescence for Neurog3 and 5-HT on duodenal cryosections of control and Rfx6ΔAdInt mice (8 days post Tamoxifen treatment). Red and green arrows in D and E point to some Neurog3- and 5-HT-positive cells, respectively. Data are represented as mean ± SD; unpaired t-test was applied to calculate significance *p≤0.05; **p≤0.01. Scale bar represents 50 μm.

Figure 6: Single-cell RNA-Seq analysis of enteroendocrine cells of adult small intestine and Rfx6-dependent genetic programs. (A) Small intestinal organoid of Neurog3eYFP/+ mice (intrinsic eYFP fluorescence). eYFP labels Neurog3-positive endocrine progenitors and differentiated enteroendocrine cells. After organoid cell dissociation, fluorescence activated cell sorting (FACS) is used to isolate individual endocrine cells in 96 well plates. scRNA-Seq is then used to profile the cells. (B) Uniform Manifold Approximation and Projection (UMAP) representing the cell clusters. The 290 single cells were clustered based on the expression of 830 biologically variable genes. EC: Enterochromaffin cells; EC early: precursors of EC cells; PE: Peptidergic Enteroendocrine cells; PE early: precursors of PE cells; P1-4:groups of progenitors. (C) Cell clusters along the cell trajectory. Diffusion map, built from the log-expression of 830 biologically variables genes, was used to reconstruct the cell trajectory. (D-F) UMAP representing the expression of Rfx6, Tph1 and Gip (normalized counts) in the 290 single cells. (G-N) Expression (normalized counts) of genes enriched in the EC (G-J) and PE (K-N) branches along the cell trajectory. (O) Heatmap (normalized counts) bioRxiv preprint doi: https://doi.org/10.1101/704924; this version posted July 19, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

showing expression of hormone genes and Rfx6 in individual cells. (P) Heatmap (Z-score of normalized counts) showing expression of some markers of EC and PE lineages affected by Rfx6 deletion, in Rfx6ΔAdInt (3 months after Rfx6 removal) and control conditions. Shown is the expression (row-wise Z-score), in Rfx6ΔAdInt and control conditions, of markers of EC populations (EC and/or EC- early populations) and PE populations (PE and/or PE-early populations) which are differentially expressed after Rfx6 deletion.

Figure 7: Proposed model for the role of Rfx6 in enteroendocrine lineages specification in the adult intestine. Neurog3 triggers the endocrine fate. Rfx6 is then activated in endocrine progenitors downstream of Neurog3 and represses Neurog3 transcription allowing differentiation to proceed. Rfx6 promotes peptidergic endocrine (PE) cell differentiation upstream of Arx, Isl1 and Pax6. Rfx6 represses, upstream of Lmx1a, a genetic program leading to Tph1 expression and 5-HT production. Green and Red: genes respectively down or up-regulated in the Rfx6DAdInt compared to wild-type controls.

Rfx6/Neurog3 Neurog3 Rfx6 Merge A B C D

E15.5 Rfx6/ChgA Rfx6/ChgA Rfx6/GLP-1 Rfx6/GIP Rfx6/ SST E F G H I

Rfx6/GLP-1 Rfx6/5-HT Rfx6/Ghrl Rfx6/CCK Rfx6/Gast J K L M N

Villus base

Figure 1 Rfx6-/- versus controls (E18.5 SI) Rfx6DEndo versus controls (E18.5 SI) A B Fold Change (Log2) Fold Change (Log2)

Average normalized intensity Average normalized intensity

C TFF1 TFF1 - / - Rfx6

P0.5 P0.5

D Rfx6 Gast Sst

Ghrl Tph1 ChgA

Controls Rfx6-/-

Figure 2 A B jejunum colon

CTRL 35 Rfx6ΔAdInt 30 ] Control [ g

25 t

h 20 ** g * ** i **

e 15

W 10 5 0 0 1 2 3 4 7 9 11 14 17 21 28 35 42 49 56 ΔAdInt Days Post TM gavages Rfx6

C T. Chol D HDL Chol E LDL Chol F Triglycerides G FFA CTRL Rfx6ΔAdInt 3 p=0.06 2.5 p=0.17 0.4 2 p=0.11 1.5 p=0.29 2.5 2 0.3 1.5 2 1 1.5 *** 1.5 0.2 1 mEq/l mmol/l mmol/l mmol/l mmol/l 1 1 0.5 0.1 0.5 0.5 0.5 0 0 0 0 0

H Glycerol I Lipase J Food Intake K Feces L Feces NRJ M Food efficiency CTRL Rfx6ΔAdInt content 5000 4 500 p=0.88 120 14 5 *** *** *** ) 100 12 4000 400 l / 4 3

U 80 10 ( 300 3000 e 8 3 ***

s 60 2 a µmol/l 200 6 2000 p

Food [g] 2

i 40 Feces [g] Cal/g feces L 4 1 100 1 1000 20 2 0 0 0 0 0 0

N O CTRL IPGTT CTRL OGTT 400 Rfx6ΔAdInt 450 Rfx6ΔAdInt 350 400 350 * 300 300 250 250 200 200 150 150 Glucose [mg/dL]

Glucose [mg/dL] 100 100 50 50 0 0 T0 T5 T15 T30 T45 T60 T120 T0 T5 T15 T30 T45 T60 T120 Time [min] Time [min]

Figure 3 8 days after Rfx6 deletion 3 Months after Rfx6 deletion A D Fold Change (Log2) Fold Change (Log2) Change Fold

Means of normalized counts Means of normalized counts B 8d_EE_FC E 11W_EE_FC 2.0 Controls 5 controls Rfx6DAdInt ns Rfx6f/f; 4 1.5 controls Villin- CreERT 3 Rfx6f/f; Villin-CreERT2 1.0 2 2 ns Fold Change Fold Change 0.5 1

0.0 0

Gip Sst Nts Sct Gcg Pyy Gip Cck Sst Nts Sct Gcg Pyy Ghrl Cck Tac1 Ghrl Chga Tac1 Tph1 Chga Tph1 C Adult8d_TF_FC Ileum F 11W_TF_FCAdult Ileum 4 ns 5 controls controls Rfx6f/f; 3 4 Rfx6f/f; Villin-Cre Villin- ns CreER3 2 T2 2 Fold Change 1 Fold Change 1

0 0

Isl1Arx Fev Pax6Hes1Pdx1 Sox4Gfi1 Pax4 Isl1Arx Fev Gfi1 Ascl1 Atoh1 Insm1 Pax6Hes1Pdx1 Ascl1 Sox4 Pax4 Nkx6-3 Nkx2-2Lmx1a Nkx6-3 Atoh1 Insm1 Nkx2-2Lmx1a Neurod1Neurog3 Neurod1Neurog3 Adult Ileum Adult Ileum G H Control organoids Rfx6DAdInt organoids

Figure 4 Neurog3 A B 2 Control Rfx6ΔAdInt ΔAdInt m 40

Control Rfx6 m / ** s

l 35 l

e *

2.5 c 30

** + 2 3 25 n

g 20 N

1.5 * 15 o f

1 r

e 10

b * 0.5 5 m u

mRNA Levels [AU] 0 0 Jejunum Colon N Duodenum Jejunum Ileum Colon

C Control Rfx6 ΔAdInt 45 * *

cells 35 + cells

+ 25 -BrdU + 15 /Ngn3 5 % Ngn3 0 Duodenum Jejunum Ileum Colon

D E 3000 ΔAdInt ΔAdInt Control Rfx6 * 2 Control Rfx6 150 * *

C 2000 100 U * ** A T H -

50 5 1000 * m number of 5-HT+ Cells/m 5-HT+ of number 0 0 Duodenum Ileum Duodenum Jejunum Ileum P. colon D. colon

F Control Rfx6 ΔAdInt / 5-HT Ngn3

Figure 5 umap Diffusion maps

● 126 ●●● P1 ●●●● ● EC ● C ● A B ● ● ● ●● ● P2 ● ● ● EC early ● ● ● ● ●● 0.15 ● ● ● ● P1 PE ● ● ● ● ● ● ● ● ● ● ●● ● P3 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ●●● ● ● ● ● ● ● ● P4 ● ● ● ● ● ● ● ●● ● ●● ●● ● ● ● ● 124 ● ● ● ●● ● ● ● P4 ● 0.10 PE early ● ●● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ●● PE ●● ● ● ● ● ● ● ● ● ● ● ● PE early ● ● ● ● ● ● ● ● ● ● ● ● ● ● EC early ● ● ● ●● ● ● ●

● ● ● 0.05 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ●●●●● EC ● ● ● ● ● ● ● ● ● ● ● ● ● P2 ●● ● ● ●● ● ● ● ● ● ● ● ● ●●●● ● ● 122 ● ● ● ● ●●●●● ● ● ● DC2 ●●●●● ●●●●●● ●● ● ● ● ● ● ● ● ●● ●●● ● ●●●● ● ● ● ● umap2 ● ● ● ● ● ● ●● ● ● ● ● ● ●● ● ●● ●●● ● ● ●● ● ● ● ● ● ●●●●● ●●●● umap2 ● ● ● ● ●● ●● ●● ● ●●●●●●● ●● ● ● ● ● ●●●● ●●● ● ● ● ● ● ●●● ●●●●●●●●● ● ● 0.00 ● ●● ●●●●●●●●● ● ● ● P3 ●●● ● ●● ● ● ● ● ● ● ●●●● ● ● ● ● ● ●●●● ●●

● ● Component 2 ● ● ● ● ● ● ● ●●●●●● ●● ● ● ● ● ●● EC early ● ● ●●● ● ● EC ● ● ● ● ● ● ● ● P4 ● ● ● ● ● ●● ●● ● ● ● ● ● P2● ● ● ● ● ● ● ●● ● −0.05 ● ●● ● ● ● ● ● ●● ● 120 ● ● ● ● ● ● ● ● ● ● ● ● ● ● P3 ● ● ● ●● ●●● ● ● ● ●● ● ● ● ● ● ● ● ●● ● ●● ●●●● ●● PE ●● PE early −0.10 ●● ●● ● ● ● ● ●● P1 ●●● ●●●● 118 −0.15

122 124 126 128 130 132 −0.05 0.00 0.05 0.10 umap − Rfx6 norm counts umap1 Component 1 umapumap1 − Tph1 norm counts umapDC1 − Gip norm counts

126 17 126 126 87 3,998 ● ● Rfx6 ● ●● Tph1 F Gip ● D ● E ●● ● ● ● ● ● ● ● ● ● ●● ●● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ●● ● ● ● ● ● ● ● ● ● ● ●● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ●●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ●● ●●● ●● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ●● ●● ● ● ● ● ● ● ● ● ● 124 ● ● ● ●● 8●● ● ● ●● ● ● ● ●● ●● ●● ● 124 ● ● ● ●● ●28 ● ● ● ● ● ● ● ● ● ● 124 ● ● ● ●● 502 ● ● ●● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 122 ● 3 ● ● ● ● ● ● ● 122 ● ● ● ● 8 ● ● ● ● ● ● 122 ● ● ● ● 62 ● ● ● ● ● ● umap2 ● umap2 ● ● ● ● ● umap2 ● ● ● umap2 ● ● ● ● ● ● ● ● ● ● ● ● umap2 ● ● ● ● ● ● ● ● ● ● ● ● ● umap2 ● ● ● ● ● ● ● ●● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ●● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ●● ●● ● ● ● ● ● ● ● ● ● ● ●● ●● ● ● ● ● ● ●● ● ● umap − Pax4 norm counts ●● ● ● umap − Pax4 norm counts umap − Pax4 norm counts ●● ● ● ● ● ●● ● ● ● ● ● ● ● ● 120 ● 1 ● ● ● 120 ● ● 2 ●● ● ● ● 126 ● 126 126 ● ● + 17 ● ● ● + 17 ● ● ● + 17

● 120 ● 7 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ●● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ●● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ●● ●● ● ● ●● ● ●● ●● ● ● ● ●● ● ●● ●● ● ● ● ● ● 124 ● ● ● ●● 8 124 ● ● ● ●● 8 ● 124 ● ● ● ●● 8 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ●● ● ● ● ●● ●● ● ● ● ● ● ●● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ●● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ●● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 122 ● ● ● ● 3 122 ● ● ● ● 3 122 ● ● ● ● 3 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●

umap2 ● ● umap2 ● ● ● umap2 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ●● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ●● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●●● ● ● ● ● ●●● ● ● ● ●●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 120 ● 1 120 ● 1 ● 120 ● 1 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ●●● ● ● ● ●● ●●● ● ● ● ●● ●●● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ●● ● ●● ● ●●●● ●●●● ●●●● ●● ●● ● ●● ●● ●● ● ●● ● ● ● ● ● ●

0 0 0 118 118 118

122 124 126 128 130 132 122 124 126 128 130 132 0 122 124 126 128 130 132 118 0 118 umap1 - umap1 - umap1 - 0 118

122 124 126 128 130 132 122 124 126 128 130 132 122 124 126 128 130 132 umap1 umap1 umap1 umap1 umap1 Gstt1 umap1 Tph1 Tac1 Lmx1a

● ● ● ● ●● ●● umap − Pax4 norm counts ●●● umap − Pax4 norm counts ●● umap − Pax4 norm counts ●● umap − Pax4 norm counts ●●● ●●●● ●●● ●●● ●● ● ● ● ●● 126 126 126 126 G + 17 H ● + 17 I ●● + 17 J ●● + 17 ● ● ● ● ● ● ● ● ●● ● ●● ● ●● ● ●● ● ●● ●● ●● ●● ● ● ● ● ● ● ●● ● ● ● ● ● ●● ● ● ● ● ● ● ●● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 0.15 ● ● ● ● ● ● Tph1● ● ● ● Tac1● ● ● ● Gstt1● ● ● ● 0.15 Lmx1a● ● ● ● ● ● ●● ● ● ● ●● ● ● ●● ● ● ●● ● ●● ● 0.15 ● ●● ● ● ●● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 0.15 ●● ● ●● ●● ● ● ● ●● ● ●● ●● ● ● ● ●● ● ●● ●● ● ● ● ●● ● ●● ●● ● ● ● 124 ● ● ● ●● 8 124 ● ● ● ●● 8 124 ● ● ● ●● 8 124 ● ● ● ●● 8 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ●● ● ● ● ●● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ●● ● ● ● ● ● ●● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ●● ● ● ● ●● ● ● ● ●● ●● ● ● ● ● ● ●● ● ● ● ● ● ●● ● ● ● ● ● ●● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ●● ● ● ● ● ● ●● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ●● ● ● ● ● ● ● ●● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 122 ● ● ● 3 122 ● ● ● 3 122 ● ● ● 3 122 ● ● ● 3 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● umap2 ● ● ● ● umap2 ● ● ● ● umap2 ● ● ● ● umap2 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ●● ● ●● ●● ● ●● ●● ● ●● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ●● ● ● ● ● ● ●● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 0.10 ● ● ● ● ● ● ● ● ● ● ● ● 0.10 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 0.10 ●● ● ● ●● ● ● ●● ● ● ●● ● ● ● ●● ● ● ● ● ● ●● ● ● ● ● ● ● ●● ● ● ● ● ● ● ●● ● ● ● ● ● 120 ● ● 1 120 ● ● 1 120 ● ● 1 120 ● ● 1 0.10 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ●●● ● ● ● ●● ●●● ● ● ● ●● ●●● ● ● ● ●● ●●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ●● ● ●● ● ●● ● ●●●● ●●●● ●●●● ●●●● ●● ●● ●● ●● ●● ●● ●● ●● ● ● ● ● ● ● ● ● ● ● ● ● 0 0 0 0 118 ● 118 ● 118 ● 118 ● ● ● 122 124 126 128 130 132 ● 122 124 126 128 130 132 ● 122 124 126 128 130 132 ● 122 124 126 128 130 132 ● ● ● umap1 - umap1 - umap1 - umap1 -

0.05 ● ● 0.05 ● ● 0.05 ● ● ● ● ● ● 0.05 ● ● ● ● ● ● ● ●● ●● ● ●● ● ● ●● ●● ●● ●●● ●●●●● ●● ● ● ● ● ● ● ●● ●● ●● ● ● ●●● ●● ● ● ●● ● ● ●● ●● ● ●● ● ● ●●●●●● ● ● ● ● ● ●●●● ● ● ●●● ● ● ●● ● ● ●●●●●●● ● ● ●●●● ● ●●●●● ● ● EC ●●●●●●● ● ● ●●● ● ●●●●● ●●●● ●● ● ● ●● ● ●● ● ●● ● ●●●● ●● ●●●●● ●●●●●● ●● ● ● ●●●●●● ● ●●●● ● ● ● ● ●●●●●●●● ● ●●●● ● ● ● ●●●●● ●●●●●●● ●● ● ● ● ●● ●● ● ●●●● ● ● ● ● ● ● ●● ●● ●● ● ● ●● ●● ● ● ● ●●●●● ●● ● ●● ●● ● ● ● ●● ● ●●● ●● ● ● ● ● ●● ●● ●● ●● ● ● ●● ●● ● ● ●● ● ●● ●● ● ● ● ● ● ●●● ●●●●●●●●● ●●●●●●●●● ● ●●● ● ●● ●● ● ● ●● ● ● ●●● ●●●●●●●● ●●●●●●●●● ●● ●● ●● ●● ● ● ● ●● ● ● ● ●● ● ● ●● ●● ● ● ● ● ● ●●● ●●●●●●●●● ●●●●●●●●● ●●● ●●●● ●●●● ● ● ● ● ● ●●● ●●●●●●●●● ● ●●●● ●● ●●● ● ● ● ● ●●● ● ●●●●●● ● ●● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● 0.00 ● ● ●●●●●●● ● ● ● ●● ● ● ● ●● ●●● ●● ●● ●●● ●●●●●●●●●●● ●●●● ● ● ●● ● ● ● ● ●●●●●●●● ● ●● ●● ● ●●● ● 0.00 ●● ●●● ● ● ●●●●●●●●● ● ●●● ● ● ● ● ● ● 0.00 ● ● ●●●●●●●●● ● ● ● ● ● ● ● ● ● ●● ● ● ● Component 2 ● ● ● ● ●● ● ● ● Component 2 ● 0.00 ● ● ● ● ●●●●●●●●● ● ● ● ● ● ● ● ●● ●● Component 2 ●● ● ●●● ● ● ● ●●●● ● Component 2 ● ● ● ● ● ● ● ● ●●●● ● ●●●●●● ● ● ● ● ● ●● ● ●●●● ● ●● ● ●●●●● ●●●● ●●●● ● ●●●●●● ●● ● ●●● ● ●●● ● ● ● ● ● ● ● ● Component 2 ●● ● ● ● ● Component 2 ●● ● ●● ● ●●● ● ● ● ● ● ●●

Component 2 ● ●● ●● ● ● ● ● ● ● ● Component 2 ● ● ●● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● −0.05 ● ● ● ● ● ● ● −0.05 ● ● ● ● −0.05 ● ● ●● ● −0.05 ● ● ●● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ●● ●● ●● ●● ● ● ● ● ●● ● ● ●● ● ● ● ● ● ● ●● ● ●● ●● ●●

● −0.10 ● ●● ●● ●● −0.10 ● ● −0.10 ● ● −0.10 ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ●● ●● ● ●● ●●●●● ●● ●●● ●●●●● ● ●●●● ●●●● ● −0.15 −0.15 −0.15 −0.15 −0.05 0.00 0.05 0.10 −0.05 0.00 0.05 0.10 −0.05 0.00 0.05 0.10 −0.05 0.00 0.05 0.10 ComponentComponent 1 1 ComponentComponent 1 1 ComponentComponent 1 1 ComponentComponent 1 1 Gip Gcg Cck Isl1

● ● ● ● umap − Pax4 norm counts ●● umap − Pax4 norm counts ●● umap − Pax4 norm counts umap − Pax4 norm counts ●● ●● ●●● ●●● ●●● M ●●● ● ● N ●●● ● ● 126 126 126 ● 17 L 17 126 17 17 ●● + + + + ●● ●● ● ● ● ● ● ●● ● ● ●● ● ●● ● ●● ● ●● ● ●● ●● ●● ●● K ● ● ● ● ● ● ●● ● ● ● ● ● ●● ● ● ● ● ● ●● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ●● ●● ●● ●● ●● ● ●● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● Gcg ● ● ● ● ● ● ● Isl1 ● ● ● ●● ● ● ● ●● ●● ● ● ● ●● ● ●● ● ● ● ●● ●● ● ● ● ●● ● ● ● 0.15 ● ●

● 0.15 ● ● ● ● ● ● ● ● Cck ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● Gip ● ● ● ● ● ● ● ● ● ● ● ● 0.15 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ●● ●● ● ● ● ●● ● ●● ●● ● ● ● ●● ● ●● ●● ● ● ● ●● ● ●● ●● ● ● ● 0.15 124 124 124 ● ● ● ●● 8 ● ● ● ●● 8 124 ● ● ● ●● 8 ● ● ● ●● 8 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ●● ● ● ● ● ●● ●● ● ● ● ●● ●● ● ● ● ● ● ●● ● ● ● ● ● ●● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ●● ● ● ●● ● ● ●● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ●● ● ● ● ● ● ●● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 122 122 122 ● ● ● 3 ● ● ● 3 122 ● ● ● 3 ● ● ● 3 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● umap2 umap2 umap2 ● ● ● ● ● ● ● ● umap2 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ●● ● ●● ●● ● ●● ●● ● ●● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ●● ● ● ● ● ●● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ●● ● ● ●● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 0.10

0.10 ● ●● ● ● ●● ● ● ●● ● ● 0.10 ●● ● ● ●● ● ● ● ● ● ●● ● ● ● ● ● ●● ● ● ● ● ● ●● ● ● ● ● ● 120 120 120 ● ● ● ● ● 1 ● ● ● ● ● 1 120 ● ● ● ● ● 1 ● ● ● ● ● 1 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 0.10 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ●●● ● ● ● ●● ●●● ● ● ● ●● ●●● ● ● ● ●● ●●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ●● ● ●● ● ●● ● ●●●● ●●●● ●●●● ●●●● ●● ●● ●● ●● ●● ●● ●● ●● ● ● ● ● ● ● ● ● ● ● ● 0 0 0 0 118 118 118 ● 118 ● ● ● ● 122 124 126 128 130 132 ● 122 124 126 128 130 132 ● 122 124 126 128 130 132 ● 122 124 126 128 130 132 ● ● ● ● ● umap1 - umap1 - umap1 - umap1 -

0.05 ● ● 0.05 0.05 ● ● ● ● ● ● ● ● 0.05 ● ● ● ● ● ● ● ● ● ● ● ●●●●● ●●● ● ●●●●● ●● ●● ● ● ● ●● ●● ● ●● ● ● ● ●● ● ● ●● ● ● ●● ● ●●● ● ● ●● ● ● ● ●●●● ● ● ●● ● ● ● ● ●● ● ● ●●● ● ●●●●●●● ● ● ●●●● ● ● ●●●●●●● ● ● ● ●●●●●● ● ● ● ●●●● ●● ●● ● ● ●● ●● ● ●● ● ● ● ●● ● ●●●● ● ●●●● ●●●●●●● ●●● ● ● ● ●●●●●●●●● ● ●● ● ● ● ● ●●●●●●●●●● ●●●● ● ● ● ●●●●● ●●●● ●● ● ● ● ●● ●● ● ●●● ●● ● ● ● ● ● ●●● ● ●● ●● ● ●● ● ● ● ● ●●● ● ●● ●● ● ● ●● ● PE ●●●●● ● ● ● ● ● ●● ● ●● ● ● ● ● ● ● ● ● ● ●● ● ●●● ●● ● ● ● ● ●● ● ●● ●●● ● ● ●● ● ● ● ● ● ●●●●● ●●●● ● ● ●● ●● ● ● ● ● ● ●●● ●●●●●●●●● ●●●●●●●●● ● ●●● ● ●● ●● ● ● ●● ● ● ●●● ●●●●●●●● ●●●●●●●●● ●● ●● ●● ●● ● ● ● ●● ● ● ● ●● ●●●●● ●● ● ● ● ●● ●● ● ●●●●●●● ●● ●●●●● ● ●●●● ●●● ● ● ● ● ● ●●● ●●●●●●●●● ● ●●●● ● ●●● ● ● ● ● ●● ● ●●●●●● ● ●●● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● 0.00 ● ●● ●●●●●● ● ● ●● ● ● ●● ● ● ●● ● ● ● ●● ● ●●●● ● ● ●●● 0.00 ● ●● ●●●●●●● ●●●● ●● ● ● ● ●● ● ● ● ●●●●● ● ●●●●● ● 0.00 ●● ●●● ●● ● ●●●●●●●●● ● ●●● ●● ● ● ●●● ●● ● ●●● ● ● ● ● ● Component 2 ● ● ●●●● ● ● ● ● Component 2 ● 0.00 ● ● ● ●●●●●●● Component 2 ● ● ●●● ●● ● ●●● ● ● ● ●●●● ● ● ● ● ●●●● ● ● ● ●●●● ● Component 2 ●● ●●●● ● ● ● ● ●●●● ● ● ● ● ●●●● ● ●● ● ●●● ●●●● ● ● ● ●●●●●● ●●● ● ●●● ● ●●●●● ● ●● ●● ●● ● ● ● ● ● ● ● ● ● ● ● ●● ● ●● ●● ●● ● ● ● ● Component 2 ● ● ● ●● ●● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● Component 2 ● −0.05 ● ● ● ● ● ● −0.05 ● ● ● ● ● −0.05 ● ● ●● ●● −0.05 ● ●● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ●● ●● ●● ● ● ● ● ● ●● ●● ● ● ● ● ● ● ● ●● ●● ●● ●● ●●

● −0.10 ●● ● −0.10 ● ● ●● −0.10 ● ● ● −0.10 ● ●● ● ● ●● ● ● ● ● ● ●● ●● ● ●● ●● ●●● ●● ●● ●●●● ●●● ●● ●●●● ● ● ●●●● −0.15 −0.15 −0.15 −0.15 −0.05 0.00 0.05 0.10 −0.05 0.00 0.05 0.10 −0.05 0.00 0.05 0.10 −0.05 0.00 0.05 0.10 Component 1 ComponentComponent 1 1 ComponentComponent 1 1 ComponentComponent 11 Component3 months 1

O P Controls Rfx6ΔAdInt Condition 2 Condition Tac1 Ucn3 11w_RF Pappa2 Lhx1 11w_RFVCT exp exp Afp exp exp Atf6 1 group 1e+03 exp1 Fxyd6 group exp1 Mnx1 1e+03 exp2 annot_row Vgf exp2 Amigo2 Vgf exp3 Reg4 Reg4 1e+02 exp3 Gnao1 EC 1e+02 exp4 Olfr78 Olfr780 Pyy exp4 Rab3c PEE Pyy Disp2 1e+01 group Ptprn 1e+01 group Syn2 Insl5 EC Sept4 Insl5 EC Tph1 Tph1 P3 Chga −1 1e+00 P3 Chgb ChgA 1e+00 P4 Gast Olfr558 Olfr558 Gast P4 Rab30 P2 exp exp P2 Scn3a Scn3a

EC Insc Ntsgroup exp1P1 Nts 1e+03 P1 Slc38a11 −2 exp2PE Pros1 Vgf PE Galnt18 Ghrl exp3EC_early Prkg2 Ghrl 1e+02 EC_early Pdxk exp4PE_early Ddc Ddc Pyy PE_early Npc1l1 Gcg 1e+01 group 3 months Lmx1a Lmx1a Gcg Cwh43 Cwh43 Insl5 EC Trpc7 Tpbg P3 Tpbg GipGip 1e+00 Cacna1d Gast P4 Kcnc3 Glis3 Glis3 P2 Adgrf5 SstSst Malat1 2 Nts P1 Fabp5 Condition Condition PE Sst SstTac1 normalized Dbpht2 Ucn3 11w_RF Rfx6 Pappa2 Rfx6Ghrl EC_early Ffar1 Lhx1 11w_RFVCT counts Ube2l6 Ffar1Afp PE_early Atf6 1 AW112010 Fxyd6 Ifit1bl1 Mnx1 annot_row Tph1Tph1Gcg Abcg2 Amigo2 Reg4 A2ml1 Gnao1 EC Cd177 Olfr78 0 Rab3c Papss2 PEE Tac1Tac1Gip Disp2 Sct SctPtprn Scgn Syn2 Sept4 Sst PE Gpr119 Gpr119Tph1 CckCck Gcg Chga −1 Isl1 Chgb Isl1Olfr558 Gip Rab30 Rfx6 Arx Scn3a Gip Insc Sct Ghrl Arx Sct Slc38a11 Tmem184c Pros1 −2 A05_exp2 C06_exp2 F09_exp4 C07_exp4 D12_exp4 D05_exp3 B12_exp4 G04_exp3 B01_exp3 C09_exp3 D10_exp3 H04_exp3 H02_exp3 D08_exp3 A07_exp3 F07_exp3 B12_exp1 D01_exp1 E04_exp1 A11_exp1 A09_exp1 B09_exp1 A05_exp3 G12_exp3 C06_exp1 G12_exp1 A05_exp1 B07_exp1 G01_exp3 D06_exp4 B06_exp3 D12_exp3 E10_exp3 B05_exp2 G08_exp2 B02_exp2 F06_exp2 E07_exp2 A09_exp2 G03_exp2 C01_exp1 A12_exp1 C05_exp1 A10_exp3 D03_exp3 A08_exp3 F08_exp3 F06_exp3 B06_exp1 C10_exp1 C01_exp2 D11_exp2 C05_exp2 F11_exp2 A10_exp1 C07_exp1 G10_exp4 G11_exp4 F12_exp4 H04_exp4 F11_exp4 D07_exp4 H01_exp4 G07_exp4 D05_exp4 F04_exp4 F03_exp3 E04_exp4 G03_exp4 F07_exp4 H05_exp4 F08_exp4 G12_exp4 F10_exp4 H05_exp3 G05_exp4 G08_exp4 C01_exp4 E03_exp4 A05_exp4 G09_exp4 D08_exp4 E07_exp4 D04_exp4 E02_exp4 C07_exp2 H01_exp2 A08_exp2 A12_exp2 B10_exp2 E02_exp2 D07_exp2 H05_exp2 E03_exp2 D09_exp2 F08_exp2 C08_exp2 D06_exp2 G05_exp2 E05_exp3 G06_exp3 D02_exp1 A04_exp1 D10_exp1 A02_exp1 G05_exp1 H03_exp1 F04_exp3 B10_exp1 D08_exp1 E06_exp2 H07_exp2 E01_exp3 C10_exp2 G10_exp2 A02_exp2 D04_exp2 F12_exp2 D03_exp2 E01_exp2 C08_exp3 E05_exp4 G12_exp2 D08_exp2 H06_exp2 D11_exp4 B06_exp4 E11_exp4 A03_exp2 H07_exp4 F10_exp3 H02_exp4 D11_exp3 C05_exp4 F02_exp4 G07_exp3 C04_exp3 E04_exp3 A03_exp3 E06_exp3 B08_exp3 C11_exp3 F05_exp3 E08_exp3 B02_exp3 F09_exp3 E11_exp1 H07_exp1 H01_exp1 A03_exp1 E03_exp1 E05_exp1 G08_exp1 H08_exp1 B11_exp1 B05_exp1 A07_exp1 D09_exp1 D06_exp1 A08_exp1 F05_exp1 D12_exp1 E07_exp3 H06_exp3 G11_exp3 A01_exp1 D09_exp3 H01_exp3 C11_exp1 H04_exp1 E01_exp1 F01_exp1 E10_exp1 F09_exp1 G11_exp1 F04_exp1 G10_exp1 E02_exp1 G03_exp1 G09_exp1 H02_exp1 C09_exp1 F12_exp1 A06_exp1 C02_exp1 E09_exp1 D03_exp1 F10_exp1 E06_exp1 E07_exp1 F03_exp1 F11_exp1 H05_exp1 D06_exp3 C05_exp3 D02_exp3 G02_exp3 B11_exp3 G03_exp3 C07_exp3 H03_exp3 A11_exp3 A12_exp3 F06_exp4 G04_exp4 H07_exp3 F05_exp4 E06_exp4 E09_exp4 H08_exp4 B01_exp1 B03_exp1 D05_exp1 B09_exp2 E09_exp2 B12_exp2 A04_exp2 D01_exp2 E04_exp2 E08_exp2 B01_exp2 G02_exp2 A01_exp2 E12_exp2 E10_exp2 D02_exp2 B06_exp2 B11_exp2 G06_exp2 C04_exp2 F10_exp2 A06_exp2 C12_exp2 D10_exp2 C11_exp2 H04_exp2 C03_exp2 B04_exp2 D05_exp2 F05_exp2 A10_exp2 G11_exp2 A11_exp2 G09_exp2 H03_exp2 F04_exp2 G04_exp2 C09_exp2 F09_exp2 D12_exp2 E05_exp2 E11_exp2 B07_exp2 B08_exp2 A07_exp2 F02_exp2 C10_exp4 D03_exp4 C11_exp4 E01_exp4 B04_exp3 C12_exp4 H03_exp4 D02_exp4 H06_exp4 E10_exp4 F01_exp4 C02_exp4 E08_exp4 G06_exp4 C08_exp4 A09_exp3 C04_exp4 B04_exp1 C08_exp1 B12_exp3 E11_exp3 A06_exp3 E02_exp3 C10_exp3 F03_exp4 G10_exp3 E03_exp3 E09_exp3 C01_exp3 F12_exp3 C06_exp3 D10_exp4 D07_exp3 G08_exp3 A05_exp2 C06_exp2 F09_exp4 C07_exp4 D12_exp4 D05_exp3 B12_exp4 G04_exp3 B01_exp3 C09_exp3 D10_exp3 H04_exp3 H02_exp3 D08_exp3 A07_exp3 F07_exp3 B12_exp1 D01_exp1 E04_exp1 A11_exp1 A09_exp1 B09_exp1 A05_exp3 G12_exp3 C06_exp1 G12_exp1 A05_exp1 B07_exp1 G01_exp3 D06_exp4 B06_exp3 D12_exp3 E10_exp3 B05_exp2 G08_exp2 B02_exp2 F06_exp2 E07_exp2 A09_exp2 G03_exp2 C01_exp1 A12_exp1 C05_exp1 A10_exp3 D03_exp3 A08_exp3 F08_exp3 F06_exp3 B06_exp1 C10_exp1 C01_exp2 D11_exp2 C05_exp2 F11_exp2 A10_exp1 C07_exp1 G10_exp4 G11_exp4 F12_exp4 H04_exp4 F11_exp4 D07_exp4 H01_exp4 G07_exp4 D05_exp4 F04_exp4 F03_exp3 E04_exp4 G03_exp4 F07_exp4 H05_exp4 F08_exp4 G12_exp4 F10_exp4 H05_exp3 G05_exp4 G08_exp4 C01_exp4 E03_exp4 A05_exp4 G09_exp4 D08_exp4 E07_exp4 D04_exp4 E02_exp4 C07_exp2 H01_exp2 A08_exp2 A12_exp2 B10_exp2 E02_exp2 D07_exp2 H05_exp2 E03_exp2 D09_exp2 F08_exp2 C08_exp2 D06_exp2 G05_exp2 E05_exp3 G06_exp3 D02_exp1 A04_exp1 D10_exp1 A02_exp1 G05_exp1 H03_exp1 F04_exp3 B10_exp1 D08_exp1 E06_exp2 H07_exp2 E01_exp3 C10_exp2 G10_exp2 A02_exp2 D04_exp2 F12_exp2 D03_exp2 E01_exp2 C08_exp3 E05_exp4 G12_exp2 D08_exp2 H06_exp2 D11_exp4 B06_exp4 E11_exp4 A03_exp2 H07_exp4 F10_exp3 H02_exp4 D11_exp3 C05_exp4 F02_exp4 G07_exp3 C04_exp3 E04_exp3 A03_exp3 E06_exp3 B08_exp3 C11_exp3 F05_exp3 E08_exp3 B02_exp3 F09_exp3 E11_exp1 H07_exp1 H01_exp1 A03_exp1 E03_exp1 E05_exp1 G08_exp1 H08_exp1 B11_exp1 B05_exp1 A07_exp1 D09_exp1 D06_exp1 A08_exp1 F05_exp1 D12_exp1 E07_exp3 H06_exp3 G11_exp3 A01_exp1 D09_exp3 H01_exp3 C11_exp1 H04_exp1 E01_exp1 F01_exp1 E10_exp1 F09_exp1 G11_exp1 F04_exp1 G10_exp1 E02_exp1 G03_exp1 G09_exp1 H02_exp1 C09_exp1 F12_exp1 A06_exp1 C02_exp1 E09_exp1 D03_exp1 F10_exp1 E06_exp1 E07_exp1 F03_exp1 F11_exp1 H05_exp1 D06_exp3 C05_exp3 D02_exp3 G02_exp3 B11_exp3 G03_exp3 C07_exp3 H03_exp3 A11_exp3 A12_exp3 F06_exp4 G04_exp4 H07_exp3 F05_exp4 E06_exp4 E09_exp4 H08_exp4 B01_exp1 B03_exp1 D05_exp1 B09_exp2 E09_exp2 B12_exp2 A04_exp2 D01_exp2 E04_exp2 E08_exp2 B01_exp2 G02_exp2 A01_exp2 E12_exp2 E10_exp2 D02_exp2 B06_exp2 B11_exp2 G06_exp2 C04_exp2 F10_exp2 A06_exp2 C12_exp2 D10_exp2 C11_exp2 H04_exp2 C03_exp2 B04_exp2 D05_exp2 F05_exp2 A10_exp2 G11_exp2 A11_exp2 G09_exp2 H03_exp2 F04_exp2 G04_exp2 C09_exp2 F09_exp2 D12_exp2 E05_exp2 E11_exp2 B07_exp2 B08_exp2 A07_exp2 F02_exp2 C10_exp4 D03_exp4 C11_exp4 E01_exp4 B04_exp3 C12_exp4 H03_exp4 D02_exp4 H06_exp4 E10_exp4 F01_exp4 C02_exp4 E08_exp4 G06_exp4 C08_exp4 A09_exp3 C04_exp4 B04_exp1 C08_exp1 B12_exp3 E11_exp3 A06_exp3 E02_exp3 C10_exp3 F03_exp4 G10_exp3 E03_exp3 E09_exp3 C01_exp3 F12_exp3 C06_exp3 D10_exp4 D07_exp3 G08_exp3 Abcc8 Galnt18 Tph1 Prkg2 Pax6 Pdxk Z-score of Cck CckDdc Slc6a19 Npc1l1 Lmx1a normalized Tac1 Slc35g1 Cwh43 Rbp2 Trpc7 counts

annot_row RF130 RF113 RF117 RF124 RFVCT132 RFVCT133 RFVCT116 RFVCT129 Tpbg Cacna1d Cck Kcnc3 Glis3 Adgrf5 Malat1 Fabp5 Sct Sst Dbpht2

A05_exp2 C06_exp2 F09_exp4 C07_exp4 D12_exp4 D05_exp3 B12_exp4 G04_exp3 B01_exp3 C09_exp3 D10_exp3 H04_exp3 H02_exp3 D08_exp3 A07_exp3 F07_exp3 B12_exp1 D01_exp1 E04_exp1 A11_exp1 A09_exp1 B09_exp1 A05_exp3 G12_exp3 C06_exp1 G12_exp1 A05_exp1 B07_exp1 G01_exp3 D06_exp4 B06_exp3 D12_exp3 E10_exp3 B05_exp2 G08_exp2 B02_exp2 F06_exp2 E07_exp2 A09_exp2 G03_exp2 C01_exp1 A12_exp1 C05_exp1 A10_exp3 D03_exp3 A08_exp3 F08_exp3 F06_exp3 B06_exp1 C10_exp1 C01_exp2 D11_exp2 C05_exp2 F11_exp2 A10_exp1 C07_exp1 G10_exp4 G11_exp4 F12_exp4 H04_exp4 F11_exp4 D07_exp4 H01_exp4 G07_exp4 D05_exp4 F04_exp4 F03_exp3 E04_exp4 G03_exp4 F07_exp4 H05_exp4 F08_exp4 G12_exp4 F10_exp4 H05_exp3 G05_exp4 G08_exp4 C01_exp4 E03_exp4 A05_exp4 G09_exp4 D08_exp4 E07_exp4 D04_exp4 E02_exp4 C07_exp2 H01_exp2 A08_exp2 A12_exp2 B10_exp2 E02_exp2 D07_exp2 H05_exp2 E03_exp2 D09_exp2 F08_exp2 C08_exp2 D06_exp2 G05_exp2 E05_exp3 G06_exp3 D02_exp1 A04_exp1 D10_exp1 A02_exp1 G05_exp1 H03_exp1 F04_exp3 B10_exp1 D08_exp1 E06_exp2 H07_exp2 E01_exp3 C10_exp2 G10_exp2 A02_exp2 D04_exp2 F12_exp2 D03_exp2 E01_exp2 C08_exp3 E05_exp4 G12_exp2 D08_exp2 H06_exp2 D11_exp4 B06_exp4 E11_exp4 A03_exp2 H07_exp4 F10_exp3 H02_exp4 D11_exp3 C05_exp4 F02_exp4 G07_exp3 C04_exp3 E04_exp3 A03_exp3 E06_exp3 B08_exp3 C11_exp3 F05_exp3 E08_exp3 B02_exp3 F09_exp3 E11_exp1 H07_exp1 H01_exp1 A03_exp1 E03_exp1 E05_exp1 G08_exp1 H08_exp1 B11_exp1 B05_exp1 A07_exp1 D09_exp1 D06_exp1 A08_exp1 F05_exp1 D12_exp1 E07_exp3 H06_exp3 G11_exp3 A01_exp1 D09_exp3 H01_exp3 C11_exp1 H04_exp1 E01_exp1 F01_exp1 E10_exp1 F09_exp1 G11_exp1 F04_exp1 G10_exp1 E02_exp1 G03_exp1 G09_exp1 H02_exp1 C09_exp1 F12_exp1 A06_exp1 C02_exp1 E09_exp1 D03_exp1 F10_exp1 E06_exp1 E07_exp1 F03_exp1 F11_exp1 H05_exp1 D06_exp3 C05_exp3 D02_exp3 G02_exp3 B11_exp3 G03_exp3 C07_exp3 H03_exp3 A11_exp3 A12_exp3 F06_exp4 G04_exp4 H07_exp3 F05_exp4 E06_exp4 E09_exp4 H08_exp4 B01_exp1 B03_exp1 D05_exp1 B09_exp2 E09_exp2 B12_exp2 A04_exp2 D01_exp2 E04_exp2 E08_exp2 B01_exp2 G02_exp2 A01_exp2 E12_exp2 E10_exp2 D02_exp2 B06_exp2 B11_exp2 G06_exp2 C04_exp2 F10_exp2 A06_exp2 C12_exp2 D10_exp2 C11_exp2 H04_exp2 C03_exp2 B04_exp2 D05_exp2 F05_exp2 A10_exp2 G11_exp2 A11_exp2 G09_exp2 H03_exp2 F04_exp2 G04_exp2 C09_exp2 F09_exp2 D12_exp2 E05_exp2 E11_exp2 B07_exp2 B08_exp2 A07_exp2 F02_exp2 C10_exp4 D03_exp4 C11_exp4 E01_exp4 B04_exp3 C12_exp4 H03_exp4 D02_exp4 H06_exp4 E10_exp4 F01_exp4 C02_exp4 E08_exp4 G06_exp4 C08_exp4 A09_exp3 C04_exp4 B04_exp1 C08_exp1 B12_exp3 E11_exp3 A06_exp3 E02_exp3 C10_exp3 F03_exp4 G10_exp3 E03_exp3 E09_exp3 C01_exp3 F12_exp3 C06_exp3 D10_exp4 D07_exp3 G08_exp3 Ffar1 Ube2l6 AW112010 Ifit1bl1 Abcg2 A2ml1 Cd177 Papss2 Sct Scgn Gpr119 Figure 6 Gcg Isl1 Gip Arx Ghrl Tmem184c Abcc8 Pax6 Cck Slc6a19 Slc35g1 Rbp2 annot_row RF130 RF113 RF117 RF124 RFVCT132 RFVCT133 RFVCT116 RFVCT129 Nkx2-2

Endocrine Lmx1a Tph1 5-HT progenitors Ngn3 Rfx6 Arx Isl1 Enteroendocrine Pax6 Peptides

Figure 7 Legend to Supplementary Figures

Figure S1: Expression of Rfx6, 5-HT and GIP in adult mouse duodenum. (A-B) Immunofluorescence staining for Rfx6 (green) and 5-HT (red). (C) Immunofluorescence staining for Rfx6 (green) and GIP (red). Arrows point to enteroendocrine cells expressing Rfx6 at different levels. Scale bars:50 µM.

Figure S2: Loss of Rfx6 in the adult intestine strongly impairs enteroendocrine cell differentiation except serotonin expressing cells. RT-qPCR experiments to determine the expression of selected genes in controls (black) and Rfx6ΔAdInt (grey) mice in the small and large intestine. Analysis were performed 8 days (A, n=4 animals per group) or one month (B, n=3 animals per group) after Rfx6 deletion. Statistics, Mann Whitney (A) or unpaired t-test (B). Relative mRNA levels are represented as 2-DCt means ± SD; *** p≤0.001, ** p≤0.01, * p≤0.05, ns: not significant.

Figure S3: Rfx6 deletion in the adult intestine does not lead to any perturbation of the crypt/villus morphogenesis, differentiation of Paneth, goblet cells or enterocytes. Set of pictures representing the jejunum (columns 1-2) and colon (columns 3-4) of controls (columns 1&3) and Rfx6ΔAdInt (columns 2&4). (Row A) Haematoxylin and Eosine staining (HE). (Row B) Alcian blue staining of acidic mucins. (Row C) Periodic Acid Schiff staining of mucins.

Figure S4: Histological and FACS analysis of endocrine cells in small intestine organoids of Neurog3eYFP/+ mice. (A-G) Fluorescent confocal microscope pictures of small intestine organoids co- labeled (whole-mount) with eYFP (Green) and Neurog3 or ChgA (Red), depicting expression of eYFP reporter in endocrine progenitor cells (Neurog3-positive) and maintenance in their differentiated progeny (ChgA-positive). Yellow arrows point to co-labeled cells. Scale bar: 25 µM. (H-I) Typical FACS profile depicting purification of eYFP+ cells from duodenal (H) and jejunal (I) Neurog3eYFP/+ organoids. SSC: (Side Scater).

Figure S5: (A) Uniform Manifold Approximation and Projection (UMAP) representing the 8 cell clusters and their markers. The 290 single enteroendocrine cells (eYFP+ sorted from Neurog3 - eYFP small intestine organoids) were clustered based on the expression of 830 biologically variable genes. EC: Enterochromaffin cells; PE:Peptidergic enteroendocrine cells; P1-P4: Progenitor cell populations. (B) Increased expression of several EC genes upon Rfx6 deletion. RNA-Seq analysis of adult ileum of Rfx6DAdint ( grey boxes) and control (black boxes) mice, 3 months after tamoxifen treatment. Data shown are a selection of genes found strongly enriched in the EC branch in single cell transcriptomic of wild-type enteroendocrine cells. n=3-4 animals were analyzed per group; ***; adjusted p-value ≤0.001. Figure S6: Expression of selected genes along cell trajectories during enteroendocrine cells differentiation from progenitors to enterochromaffin and peptidergic enteroendocrine branches. Diffusion map, built from the log-expression of 830 biologically variables genes, was used to reconstruct the cell trajectory. Expression (normalized counts) of some genes enriched in the enterochromaffin branch (A-H) in the peptidergic branch (I-P) and of a selection of transcription factors (Q-X). P: progenitors; EC: enterochromaffin cells, PE:peptidergic enteroendocrine cells. Rfx6/5-HT Rfx6/5-HT A B Rfx6-

Rfx6+ Rfx6++ Rfx6+

Rfx6++ Rfx6++

Rfx6/GIP

C Rfx6++

Rfx6++

Figure S1 A

Rfx6 Gip Tph1 Neurog3 0.0020 ns ns 0.12 0.04 ns ns 0.006 * * * * * * * * * * * ns 0.0015 0.03 0.08 0.004 Ct ) Ct ) Ct ) Ct ) 0.0010 0.02 2e( - 2e( - 2e( - 0.04 2e( - 0.002 0.0005 0.01

0.0000 0.00 0.00 0.000 Duo Jej Ileum Colon Duo Jej Ileum Colon Duo Jej Ileum Colon Duo Jej Ileum Colon

Pax4 Arx Nkx2.2 Lmx1a

0.0020 0.0006 * * * * 0.005 0.0015 ns ns ns ns ns * * * * ns * ns 0.0015 0.004 0.0004 0.0010 Ct ) Ct ) 0.003 Ct ) 0.0010 Ct ) 2e( - 2e( -

2e( - 0.002 0.0002 2e( - 0.0005 0.0005 0.001

0.0000 0.0000 0.000 0.0000 Duo Jej Ileum Colon Duo Jej Ileum Colon Duo Jej Ileum Colon Duo Jej Ileum Colon B Cck Sct Gip Gcg

0.06 0.08 0.15 0.03

0.06 0.04 0.10 0.02

Ct) Ct )

Ct)

Ct) 0.04

2e(- 2e( -

2e(- 0.02 2e(- 0.05 0.01 0.02 *

ns ns **** ** 0.00 ** 0.00 0.00 * 0.00 Jejunum Colon Jejunum Colon Jejunum Colon Jejunum Colon

Tph1 Sst Nts Pyy

0.10 0.020 0.04 0.04 * 0.08 0.015 0.03 0.03 0.06 Ct ) Ct ) Ct )

Ct ) * 0.010 0.02 0.02

2e( - 0.04 2e( - 2e( - 2e( - 0.01 *** 0.01 0.02 0.005 * ns *** ** * 0.00 0.000 0.00 0.00 Jejunum Colon Jejunum Colon Jejunum Colon Jejunum Colon

Ghrl Gast Neurog3 Arx 0.006 0.00010 0.004 0.000015 ** ns 0.00008 0.003 0.004 0.000010

Ct ) 0.00006 Ct ) Ct ) Ct ) 0.002 2e( -

2e( - 0.00004 2e( - 2e( - 0.000005 0.002 0.001 ns 0.00002 * ** * ** ** 0.000 0.000000 0.000 0.00000 Jejunum Colon Jejunum Colon Jejunum Colon Jejunum Colon

Pax4 Pax6 NeuroD1 ChgA

0.003 0.0025 0.08 0.00025 ns ** * 0.0020 0.00020 0.06 0.002 Ct )

0.0015 Ct ) 0.00015 Ct ) Ct ) 0.04 ns 2e( - 2e( -

2e( - 0.0010

2e( - 0.00010 0.001 ns ns 0.02 0.00005 0.0005

0.000 0.00000 ** ** 0.0000 0.00 Jejunum Colon Jejunum Colon Jejunum Colon Jejunum Colon

Controls Rfx6 ΔAdInt

Figure S2 Jejunum Colon Control Rfx6ΔAdInt Control Rfx6ΔAdInt A1 A2 A3 A4 H&E

B1 B2 B3 B4 lcian Blue A

C1 C2 C3 C4

Figure S3 Neurog3 eYFP Merge A B C /+ eYFP ChgA eYFP Merge D E F Neurog3

G duodenum H jejunum

1.4% 1.1%

Figure S4 A

EC EC-early Hormones: Tph1, Vgf, Tac1 (High) Hormones: Tph1,Tac1 TF: Lmx1a, Lhx1, Mnx1, Glis3, Atf6, Fev TF: Lmx1a, Lhx1, Hoxb4, Pax4 Nupr1, Znfx1, NeuroD1, Bex2, Rfx6 Znfx1, NeuroD1, Rfx6 GPCRs: Olfr558, Olfr78 GPCRs: Adgrg4/GPR112 Others: ChgA, ChgB, Ddc, Ucn3, Reg4, Ddc, Others: ChgB, Scn3a, Scg3, Papa2, Ddc Scn3a, Scg3, Afp, Vim, Trpa1, Amigo2, Tpbg, Cacna1d, Rbp3, Ptrpe, Slc18a2, Cwh43 Papa2, Fxyd6, Slc6a18, Slc18a2, Cplx1, Cwh43

● ● ●●● ● ●●● ● ●● ● ● ● ●● ●● P1 Secretory progenitors ● ● ● ● ● ●● ● ● ● ● ● Hes1, Guca2a, Agr2, Defa17, Lyz1, ● ● ● ● Cldn15, Spink4, Itln1, Muc2, Tff3, Reg4 ●●● ● ● ●●● ●● ●● ● ●● ● ● ● ● ●● ●●●● ●● ●● ● ● ● ● ● ● ● ● ●●● ● ●● ●● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● P4 Progenitors -EC biased ● ● ●● ● ● ● ●●● ● ● ● ● ● ● ● ● ● ●● P2 Endocrine progenitors TF: Pax4, NeuroD1, NeuroD2, Runx1t1 ● ● ● ● ● Neurog3, Rfx6 ● ●● ●●● ●●● ● TF: Pax4, Neurog3, Rfx6, Hes6 ●● ● ● ●● ● ● ● Others: Cacna1d, Igalsl, Mettl2, Sept3 ● ● ● ● ● ● ● ● ● Others: Mfng, Rpl12, Fmo4, Ces2g, ●● ●● Pbld1, Tff3, Gstm3, Tem171 Pgm2l1 ● ● ● ● ●● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●●● ● ● ● ● ● ● ●●●● ● ● ●● ●● ● ● PE ● ●● ● ●● ● ● ●● ● ● ● ●●● ● Hormones:Gcg, Cck, Gip, Ghrl, Sst, Sct ● P3 Progenitors-PE biased ● ● ●● ● TF: Isl1, Etv1, Pax6, Pdx1, NeuroD1,Rfx6 ● ● ●●● ● ● ● ● ● ● TF: Arx, Pax4, Eya2, NeuroD1, Neurog3, Rfx6 GPCRs:Adgr4 (GPR112), Ffar1, Ffar4 (GPR120) ●●● ● ● ● Sstr5, GalR1, GPR119 ● ● ●● ●● Others: Ppp1r14a, Rps14, Rpl23, Mfng, ● ●●● ●● : Scg2, Scg3, Scgn, ChgB (low) ●● ●● ● ● Megf11 Others ● ● ● ● ● Rbp4, Rpb2, Rgs4, Abcc8, Slc6a19, Fabp5 ● ● ●●● ● ● ● ● ● ●●●●●● ●●●● PE-early ●● Hormones: Ghrl TF: Arx, Pax4, Isl1, NeuroD1, Rfx6 Scgn, lect2, Pbl1, Enpp1, Kif5c Cdkn1a controls Others: Scgn,Rfx6 Lect2, delta Pbl1, Enpp1, adult Kif5c int Cdkn1a

EC markers normalisé_selection B 10 *** 8

*** 6 *** *** *** *** *** 4 *** *** Fold Change 2

Atf6VimAfp ChgbTph1 Reg4 Glis3 Trpa1Mnx1 Tac1Ucn3Lhx1Mnx1 Cwh43 Lmx1a Olfr78Scn3a Hoxb4 Olfr558 Slc18a2 Amigo2

Figure S5 Vim Diffusion map − Scn3a Diffusion map − Tpbg Diffusion map − Trpa1

● norm counts ● umap − Pax4 norm counts ● ●●● umap − Pax4 ● umap − Pax4 norm counts ● ●● ●●● ●●● ●● ●●● ● ●●● umap − Pax4 norm counts ● ●●● ● 126 17

126 + ●●● + 17 ●● ● ● 126 + 17 ● ● ● ● ● ●● ● ● ● ●● ● ● ● ● ● ● ● ● 126 17 ● ● ● ● ● ● ● ●● + ● ● ● ● ●● ●● ● ● ● ● ● ● ● A ● ● ● ● ● ● ● B ● ● C ● ● ● ● ● D ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● PE ● PE 0.15 ● ● ● ● ● 0.15 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● 0.15 ● ● ● ● ●● ●● ● ● ● ● ●● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ●● 0.15 ● PE ● ● ●● ● ● ● ● ● ● ● ● ● ● Tpbg● Trpa1 Vim Scn3a ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ●● ● ● ● PE ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ●● ●● ● ● ● ● ● ● ● 124 ● ● ● ● 8 ●● ● ●● ●● ● ● ● ● ● ● ● ● ● ●● ● ● 124 ● ● ● ●● 8 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ●●● ● ●● ● ● ●● ● ●● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● 124 ● ● ● ● ● ● ● ● ● ● ● ● 8 ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ●● ● ● ● ● ● ● ●● ● ● ● ● ● ●● ● ●● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 124 ● ● ● ●● 8 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● 122 ● 3 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● 122 ● ● ● ● 3 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● umap2 ● ● ● ● ● ● ● ● ● ● 122 ● 3 ● ● umap2 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● umap2 ● ● ● ● ● ● ● ● ● ● ● ●● ●● ● ● ● ● ● ● 122 ● ● ● ● 3 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● umap2 ● ● ● ● ● ● ● 0.10 ● ● ●

● 0.10 ● ● ● ● ● ● ● ● ● ● ● ● ● 0.10 ● ● ● ● ● ● ● 0.10 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ●● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ●●● ● ● ● ● ● ● ●● ●● ● ● ● ● ● ● ● ● ● ● 120 ● 1 ●● ● ● ● ● ● ● ● ● ● ● ● ● ● 120 ● ● ● 1 ● ● ● ● ● ● ● ● ● ● ● ●●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ●● ● ● ● 120 ● ● ● ● ● 1 ● ● ●●● ● ● ● ● ● ●● ●●● ● ● ● ● ● ● ● ● ● ● ● ● ●●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●●● ● 120 ● ● 1 ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ●●●● ● ● ● ● ● ● ● ● ● ●● ●●● ● ● ● ● ●● ● ● ●● ● ● ●● ●● ● ● ●● ●●●● ● ● ● ● ● ● ● ●● ● ● ● ●● ● ● ● ● ● ● ● ●●●● 0 ●● ● 0 ● 118 ● ● 118 ● ● ● ● 0 ● ● 118 ● 0 118

0.05 ●

● 122 124 126 128 130 132 0.05 0.05 0.05 ● ● ● 122 124 126 128 130 132 ● ● ● ● ● ● ● ● ● 122 124 126 128 130 132 ● ● ● ● ● ● ● umap1 - 122 124 126 128 130 132 ● ● umap1 - ● ● ●● ● ● ● ●● ●● umap1 - ● ● ●● ●● ●●● ● ●● ● ● ● ● umap1 - ● ●● ●● ● ● ●●● ● ●● ● ● ●● ● ● ●● ● ●●●●●● ● ● ● ●● ● ● ●● ● ● ●●●● ● ● ●● ● ●●●● ● ●●●● ● ● ● ●●●● ● ● ●●●●● ● ● ●●●●● ● ● ● ●●●●● ●●●●● ●● ● ● ●●●● ● ● DC2 ● ● ●●● ● ● ● ● ● DC2 ●● ● ●●●● ● ● DC2 ●● ● ● ● ● ● ●● ● ●●● ● ● ● ●● ● ● ● ● ●●●●●●●● ● ●●●● ● ● ● ● ● ●●●●●●●●●● ●●●● ● ● ● ● ●● ●● ●● ●● ● ● ●● ●● ● ●●●●●●●●●● ●●●● ● ● ● ● ● ●● ●●●● ● ● ●● ●● ● ● ● ●●● ● ●● ●● ● ● ●● ● ● ● ● ●● ●● ● ● ● ● ● ●●● ●●●●●●●●● ●●●●●●●●● ●● ● ● ●●● ● ●● ●● ● ● ●● ● ● ●● ● ●●● ●● ● ● ● ● ● ●●● ●●●●●●●●● ●●●●●●●●● ●● ● ●● ●●● ● ● ●● ● ● ● ● ● ●●●●● ●●●● ●●●● ●●●● ● ● ● ● ● ●● ●●●●●●●●● ● ●● ● ●● ●●● ● ● ●● ● ● ● ● ● ●●●●● ●●●●● ● 0.00 0.00 ●● ● ● ● ● ● ●●●● ● ● ●● ●● ●● ● ● ●●●●● ●● ● ● ●●●●●●●●● ● ● ●● ●● ●● ● ● ●●●●● ●● 0.00 ● ● ● ● ●●● ● ● ● ● ●●●●●●●●●●●●● 0.00 ●●●● ● ●●● ● ● ● ● ● ●●●●●●●● ●●●●● ●●● ●● ● ● ●●●● ●●● ● ● ● ● ● ●●●●●●●● ●●●●● ●● ● ● ●● ● ● ●● ● ●●●●●●● Component 2 ●● ● ●● ● ●●●●●●● ● ●●●● ●●● ●● ● ●●● ● ● ● ●●●● ● ●●● ●● ● ●●● ● ● ● ●●●● ● ● ● ●●● ●●●● ●● ● ● ●●● ●●●● ●● ●●●●●● ● ●●● ●●●●●● ● ●●● ●● ● ●●● ● ●● ● ●●●● ● ●●●●●● ●● ●●●●●● ● ● ● ●● ●●● ● ● ●● ●● ● ●●● ● ● ● ● ● ● ● ● ● ● ● ●● ●● ● ● ● ●

Component 2 ● Component 2 Component 2 Component 2 ● ● ● ●● ● ● ● ● ● ●● ● ● ● −0.05 ● ● ● ● ●

−0.05 ● −0.05 ●

● EC EC −0.05 ● ● ● ● EC ● ● ● ●● ● ● ● ●● ● ● ● EC ●● ●● ● ● ● ● ● ● ● ● ● ● ● ●● ●● ● ● ●● ● ●● ● ● ●● ● ● ● ●● ● ● ● ● ●● ● ● −0.10 ●● ● ●● −0.10 ● ● −0.10 ● ● ● ● P P −0.10 ● ● ● ● ● ● P ●● ● ● ● P ● ● ● ● ● ● ● ●● ● ●● ● ●●●●● ●● ●●●●● ●● ● ●●●●● ● ●●● ● ●●●● −0.15 −0.15 −0.15 −0.15 −0.05 0.00 0.05 0.10 −0.05 0.00 0.05 0.10 −0.05 0.00 0.05 0.10 −0.05 0.00 0.05 0.10 DC1 Component 1 Component 1 ComponentDC1 1 Component 1 ComponentDC1 1

Glis3 Atf6 Mnx1 Lhx1

● umap − Pax4 norm counts ● ● umap − Pax4 norm counts umap − Pax4 norm counts ●●● ●●● ● ●●● ● ●● ●● umap − Pax4 norm counts ● ●●● 126 + 17 ●● ● ●●● ● ● 126 + 17 ● ● ●●●

● 126 17 ● ● ●● ● ● + ● 126 17 ● ● ● ● ● ● ● ● + ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ●● ●● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ●● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● PE ●● ● ● ●● ●●● PE ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ●● ● ● ● ● ● 0.15 ● ● PE ● ● ● 0.15 ● ● ● ● ● ● PE ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ●● ●● ● ● ● ● ● 0.15 ● ● ● ● ● ● 124 ● ● ● ●● 8 G ● ● ● ● ● ● ● ● ● ● ● ● ● 0.15 ● ● ● ● ● ● ● ● ● ● ● ●● ● ●● ●● ● ● ● ●● ● ●● ●● ● ● ● ● 124 ● ● ● ●● 8 H ● ● ● ● Atf6 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● F ● ●● ● ● ● ●● ● ● ● ● ● Mnx1 ● ● ● ● ● ● ● ●● ● ●● ●● ● ● ● ●● ● ● ● ● ●● ● ● ● ● ● ● ● ● Glis3124 ● ● ● ●● 8 ● ● ● ● ● ● Lhx1●● ● ●● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 124 ● ● ● ●● 8 ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● E ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●●

● 122 ● ● ● ● ● ● ● ● ● ● ● 3 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 122 ● ● ● ● ● ● ● ● ● ● ● ● ● ● 3 ● ● ● ●

umap2 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● umap2 ● ● ● ● ● ● ● 122 ● ● ● ● 3 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 122 ● ● ● ● 3 ● ● ● ● ● ● ● ● ● ●

umap2 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● umap2 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 0.10 ● ● ● ● ● ● ● ●● ● ● ● ● ● ● 0.10 ● ● ● ● ● ● ● ● ● ● ● ●● ●● ● ● ● ● ● ● ● ●● ● ● 0.10 ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ●● ● 0.10 ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● 120 ● ● ● ● ● 1 ●●● ● ● ● ● ● ● ● ●● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 120 ● 1 ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ●● ● ● ● ● ● ● ● ● ● ● ●●● ● ● ● ● ● ●●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●●● ● ● ● 120 ● ● ● ● ● 1 ● ● ● ●●● ● ● ● ● ● ● ● ● 120 ● ● ● 1 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ●●● ● ● ●● ● ● ● ●●●● ● ● ●● ●●● ● ● ● ● ●● ●● ● ● ●● ● ●●●● ● ● ● ● ●● ● ● ●● ● ● ● ● ● ●●●● ● ●● ● ● ●●●● ●● ● ● ● ● ●● ● ● ● 0 ● ● 118 ● 0 ● ● ● ● ● ● 118 0 ● ● ● 118 0 ● 118 122 124 126 128 130 132 122 124 126 128 130 132

0.05 ● ● 0.05 ● ●

0.05 ● ● ● 122 124 126 128 130 132 ● ● ● ● 0.05 ● ● ● umap1 - ● 122 124 126 128 130 132 ● ● ● umap1 - ● ● ● ● ●● ●● ●● ● ● ● umap1 - ●● ●● ● ● ●● ● ● umap1 - ● ● ● ●● ●● ● ● ● ● ● ● ●● ● ● ●●● ●● ● ● ●● ● ●● ● ● ●● ● ● ● ●●●● ● ● ● ● ● ●●●● ● ● ●● ● ● ●●● ●●●●●●●● ● ● ●●●●● ● ●●●●● ● ● ● ● ●●●● ● ● ●● ● ● ● ●● ●●●●● ●●●● ●● ● ● ●● ● ● ● ●● ● ●●●●● ● ● ●●●●●●●●●● ●●● ●● ● ● ●●●●●● ● ●●●● ● ● ● ● ●●●●●●●●● ● ●● ● ● ● ● ●● ●● ●●●● ●● ● ● ● ●●● ● ●● ●● ● ● ●● ● ●● ●● ●● ●● ● ● ●● ●● ● ● ● ●●● ● ●● ●● ● ●● ●● ● ● ●●●●●● ● ●●●● ● ● ● ● ● ●● ● ●● ●●● ● ● ●● ● ● ● ●● ● ●●●●● ●●●● ● ● ●● ●● ● ● ● ● ● ●●● ●●●●●●●●● ●●●●●●●●● ● ●● ● ●● ●●● ● ● ●● ● ● ●● ●●●●●●●● ●●●●●●●● ● ● ●● ●●●● ● ● ●● ●● ● ●●●●● ●● ● ● ● ●● ●● ● ●●●●●●●● ●● ●●●●● ● ●●●● ●●● ● ● ● ● ● ●●● ●●●●●●●●● ● ●●●● ●● ●●● ● ● ● ● ● ●●●● ● ●●●●●● ● ● ● ●● ● ●●● ●● ● ● ● ● ● ●●● ●●●●●●●●● ●●●●●●●●● ● ● ● ●● ● 0.00 ● ●● ●●●●●●● ● ● ●●●● ● ● ● ● ● ● ● ●●●● ● ● ● ●● ● ●●● 0.00 ● ● ●●●●●● ●● ● ● 0.00 ●● ● ● ● ●●●●●●●●● ● ●● ●● ● ● ●● ●● ● ● ●●● ● ● ●● ● ● ● ●● ●●●●● ● ●● ● ● ● 0.00 ● ● ●●●●●●● ● ● Component 2 ● ● ●● ● ●●● ● ● Component 2 ● ●● Component 2 ●● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● Component 2 ●● ●●●●●● ● ●●●● ●● ●●●●●● ● ● ●●●● ● ●● ● ●●● ●● ● ●●●● ●● ●●●●●● ●●● ● ●●●●●● ●●● ● ●● ● ●●●● ● ● ●● ● ● ● ● ● ●● ● ● ●● ● ●● ●● ●● ● ●●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ●● ● ● ● ● ● Component 2 ● ● Component 2 ● ● Component 2 ● ● EC Component 2 ● EC ● ● ● ● −0.05 ● −0.05 ● ● ● EC ● −0.05 ● ● EC ● ● ● ● −0.05 ● ●● ● ●● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ●● ●● ●● ● ● ● ● ●● ●● ● ● ● ● ● ● ● ● ●● ●● ● ●● ●● ●● ●●

−0.10 ● −0.10 ● ● ● P −0.10 ● P ● ● P ● −0.10 ● P ● ● ● ● ●● ● ● ● ● ●● ●● ● ● ● ● ●● ● ●●●●● ●●●●● ●● ●●● ● ● ●●●● ●●●● −0.15 −0.15 −0.15 −0.15 −0.05 0.00 0.05 0.10 −0.05 0.00 0.05 0.10 −0.05 0.00 0.05 0.10 −0.05 0.00 0.05 0.10 ComponentComponent 1 1 ComponentComponent 1 1 ComponentComponent 1 1 ComponentComponent 1 1

Sct Ghrl Diffusion map − Abcc8 Scgn

● ● ●● ● ● norm counts ● ●●● umap − Pax4 norm counts ●● ●● umap − Pax4 ● ●● umap − Pax4 norm counts ● ●● ●●● ● ●●●● ●● ● ● ●●● umap − Pax4 norm counts ● ● 126 17

126 + ● + 17 ● ●● ● 126 + 17 ● ● ● ● ● ● ●● ● ● ●● ● ● ● ● ● ● ● ● 126 17 ● ● ● ● ● ● ●● + ● ● ● ● ●● PE ● ● ● ● ● ● ● ● ● ● ● ● ● ● I ● ● ● ● ● ● ● J 0.15 ● ● K ● ● ● L ● ● ● ● ● ● ● ● ● 0.15 ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 0.15 PE ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● PE ●● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 0.15 ● ●● ●● ● ●● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● Ghrl ● ● ● ●● Sct ●● ● ● ● ●● Abcc8● ● ● Scgn● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ●● ●● ● ● ● ● ● ● ●● ●● ●● ● ● ● ● 124 ● ● ● ●● 8 PE ● ● ● ● ● ● ● ● ● ●● 124 ● ● ● ●● 8 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ●●● ● ●● ● ● ●● ● ●● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 124 ● ● ● ● ● ● ● ● ● ● ● ● ● 8 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ●● ● ● ● ● ● ●● ● ●● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 124 ● ● ● ●● 8 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● 122 ● 3 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● 122 ● ● ● ● 3 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● umap2 ● ● ● ● ● ● ● ● ● ● 122 ● 3 ● ● umap2 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● umap2 ● ● ● ● ● ● ● 0.10 ● ● ● ● ● ● ● ● 122 ● 3 ● ● ● 0.10 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 0.10 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● umap2 ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 0.10 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ●● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ●●● ● ● ● ● ● ● ●● ●● ● ● ● ● ● ● ● ● ● ● 120 ● 1 ●● ● ● ● ● ● ● ● ● ● ● ● ● ● 120 ● ● ● 1 ● ● ● ● ● ● ● ● ● ● ● ●●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ●● ● ● ● ● 120 ● ● ● ● ● 1 ● ● ●●● ● ● ● ● ● ●● ●●● ● ● ● ● ● ● ● ● ● ● ● ● ●●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●●● ● ● 120 ● ● 1 ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ●●●● ● ● ● ● ● ● ● ● ● ●● ●●● ● ● ● ●● ● ●● ● ● ● ●● ● ●● ● ● ● ● ●●●● ● ● ● ● ● ● ● ●● ● ● ● ● ● ●● ● ● ● ● ● ●●●● ● 0 ● ●● ● 0 ● 118 ● 118 ● ● ● 0 118 0.05 ● ● ● ● 0.05 0.05 ● ● ● 0 ● ● 122 124 126 128 130 132 118 ● ● ● ● 0.05 ● ● ● 122 124 126 128 130 132 ●● ●● ● ● ● ●● ●● ●● 122 124 126 128 130 132 ●● ●● ● ● ●● ● ● umap1 - ● 122 124 126 128 130 132 umap1 - ● ● ●●● ● ● ● umap1 - ● ● ● ● ●● ● ● ● ● ● ● ● ● ● umap1 - ●● ● ● ●● ● ●●●●● ● ● ●● ● ● ●●● ● ● ● ●●●●●● ● ● ● ●●●● ● ● ● ●●●● ● ● ●● ● ● ●● ● ●●●● ● ●●●●● ●●●●●● ●● ● ● ●●●●● ● ● ● ●●●●●●● ● ● ●● ● ●●●● ●● ● ●● ●● ● ●●●● ● ● ● ● DC2 ●● ● ● ● ●● ● ●●● ●● ●●●●●●●● ● ●●●● ● ● ● ● ● ● ● ●● ●● ●● ● ● ●● ●● ● ●●●●●●●●● ● ●●●● ● ● ● ●●●●● ●●●●●● ● ● ● ● ● ● ●●●●● ● ●● ●● ● ●● ● ●● ●● ● ● ● ● ● ●●● ●●●●●●●●● ●●●●●●●●● ● ● ● ●●●●● ●● ● ●● ●● ● ● ●● ●● ● ●●●● ● ● ● ● ●● ● ●●● ●● ● ● ●● ● ● ●●● ●●●●●●●● ●●●●●●●●● ●●●● ●●●● ● ● ● ● ● ●●● ●●●●●●●●● ● ●●● ● ●● ●● ● ● ●● ● ● ●● ●●●●●●●● ●●●●●●●●● ●● ●● ●● ●● ● ● ●● ●● ● ● ● ●● ● ● ● ● ●●● 0.00 ● ● ●●●●●● ●● ● ● ●●● ● ● ● ● ● ●● ● ● ●●● ●●●● ● ● ● ● ● ● ●●●●●●●●● ● ●●● ●● ● ● ●●● ● 0.00 ●●●● ● ●●● ● ● ● ● ● ●●●●●●●● ●●●● ● ●● ● ●● ●●●● ● ●●● ●● ●●● ●●●●●●●●●●● ●●●● 0.00 ● ● ●●●●●●● ● ● ● ●● ●● ● ● ● ● ● ● ●● ● ● ●●● ● Component 2 ●● ●● ● ● ●●●●●● ● ●● ● ●● ●●●●● ● ● ●● ● ● ●● ● ● ●● 0.00 ●● ●● ● ● ●●●●●●●●● ● Component 2 ●● ● ●●● ●● ● ●● ● ● ●●●● ● ● ● ● ● ● ●●● ● Component 2 ●● ●●●● ● ●●● ●●●● ●● ● ● ● ●●●● ● ●●● ●●●● ● ●●● ● ● ● ●●●● ● ● ●●● ● ●●●●● ● ●●● ● ● ●● ●● ● ●●● ● ● ● ● ●●● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● Component 2 Component 2 ● Component 2 Component 2 ● ● ● ● ● ● ● ● ● ●● ● −0.05 ● ● −0.05 ● ● EC ● ● ● ● ● −0.05 ● ● ●● ● ● ● ● EC −0.05 ● ● ●● ●● EC ● ● ● ● EC ● ● ● ● ● ● ● ● ●● ● ● ●● ● ●● ●● ● ●● ● ● ●● ● ●● ● ● ● ● ● ● ● ●● ● ● ● −0.10 ● ●● −0.10 ● ●● ●●● −0.10 ● ● P ● ● ● −0.10 ● ●● P ●● ● P ● ● ● ● ● P ● ● ●● ● ●● ● ● ●●●●● ● ● ●●●●● ● ●●●●● ●●● ● ● ●●●● −0.15 −0.15 −0.15 −0.15 −0.05 0.00 0.05 0.10 −0.05 0.00 0.05 0.10 −0.05 0.00 0.05 0.10 −0.05 0.00 0.05 0.10 ComponentComponent 1 1 ComponentComponent 1 1 ComponentDC1 1 ComponentComponent 1 1

Isl1 Arx Pax6 Etv1

umap − Pax4 norm counts ● umap − Pax4 norm counts ● ● umap − Pax4 norm counts ● ●● norm counts ●● ●● ● umap − Pax4 ● 126 + 17 ● ● ●●● ●●●● ● ●●● 126 17 ● ●●● + ● 126 17 ● + ● ● ● ●●● ● ●● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● 126 17 ● ● ● ● ● ● ● ● ● ● + ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ●● ●● ● ● ● ●● ●●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ●● PE ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ●●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ●● ●● ● ● ● ●● ● ●● ●● ● ● ● 124 ● ● ● 8 ● ● ● 0.15 ● 0.15 ● ● Arx ● ● ● ● ● ● ● ● PE ● ● ● 0.15 ● ● ● ● ● ● ● ● ● ● ● ● O ●● ● ● ● ● ● ● Pax6 ● ● ● PE ● ● ● ● ● ● ●● ● ● ● ● ● ● ●● ● ● ● 0.15 ● ● ● ● ● ● ● ● 124 ● ● ● ●● 8 ● ● ● ● ● ● ● P ●● ●● ● Isl1 ● ● ● ●● Etv1 ● ●● ● ● ● ● ● ● ● ● ● 124 ● ● ● ●● 8 ●● ● N ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● PE ● ● ● ● ● ● ● ● ●● ● ● ●● ● ● ● ●● ● ● ● ●● ● ● ● ● ● ● ● ● 124 ● ● ● ●● 8 ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● M ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 122 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 3 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● umap2 ● ● ● ● ● ● ●

122 ● ● ● ● ● ● 3 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 122 ● ● ● ● 3 ● ● ● ● ● ● ● ● ● ● ● ● ●

umap2 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● umap2 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 122 ● ● ● ● 3 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● umap2 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ●● ●● ●● ●● ● ● 0.10 ● ● ● ● ● ● ● ● ● ● ● ● 0.10 ● ● ● ● ● ● 0.10 ● ● ● ● ● ● ● ● ● ● ● ●●● ● ● ● ● ● ● ● ●● ●● ● 0.10 ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 120 ● ● ● ● ● 1 ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ●●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●●● ● ● ● 120 ● ● ● ● ● 1 ● ● ● ● ● ● ●●● ● ● ● ● ● ● ● ● ● ●● ●● 120 ● ● ● ● ● 1 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ●●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● 120 ● ● 1 ● ● ● ● ● ● ●●●● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ●● ● ● ●● ●●● ● ● ● ● ●●●● ● ● ●● ● ●● ● ● ● ●●●● ●● ● ● ●● ● ● ●● ● ●● ● ● ● ●●●● 0 ● ●● ● 118 ● ●● ● ● 0 ● 118 ● 0 ● ● ● ● ● ● 118 ● 0 122 124 126 128 130 132 118 122 124 126 128 130 132 0.05 ● ● 122 124 126 128 130 132

● 0.05 ● ● 0.05 ● 0.05 ● ● umap1 - ● ● ● ● ● ● ● ● ● ● umap1 - 122 124 126 128 130 132 ● ● ● ● ● ● umap1 - ●● ●● ●● ●●●●● ●●●●● ● ●● umap1 - ● ● ● ● ● ●● ● ● ●● ● ● ● ● ● ●●●● ● ● ●● ● ● ●● ●● ● ● ●● ●● ● ● ●● ●●●●● ● ● ● ● ●●●● ● ● ● ● ●●●● ● ● ● ● ●●●● ● ● ●● ●● ●●●● ●● ● ●●●●● ● ● ●●●●● ● ● ●●●●● ● ● ● ●●●●●● ● ●●●● ● ● ● ● ● ●● ● ●● ● ●● ● ●● ● ●● ● ●● ● ●● ● ●● ● ●● ● ● ● ●● ● ●● ● ● ●● ●● ● ●●●●●●●● ● ●●●● ● ● ● ● ●●●●●●●● ● ●●●● ● ● ● ●●●●●●●● ● ●●●● ● ● ● ●● ● ●●● ●● ● ● ● ● ● ●●● ●●●●●●●●● ●●●●●●●●● ● ● ● ● ●●●●● ● ● ●● ●● ● ● ● ●●●●● ●● ● ●● ●● ● ● ● ●●● ● ●● ● ●● ●● ● ●●●● ●●● ● ● ● ● ● ●●● ●●●●●●●●● ● ●● ● ●●● ●● ● ● ●● ● ● ●●● ●●●●●●●● ●●●●●●●●● ●●● ● ● ●● ● ● ●● ● ● ●● ●●●●●●●● ●●●●●●●●● ●● ● ●● ●●● ● ● ●● ● ● ●● ●●●●●●●● ●●●●●●●● 0.00 ● ● ●●●●● ● ● ●● ● ●● ● ● ● ● ●● ● ● ●● ● ●●● ●● ● ● ●●●●● ● ●●●● ●●● ● ● ● ● ● ●●● ●●●●●●●●● ● ●●●● ● ●●● ● ● ● ● ●● ● ●●●●●●●● ●●●● ● ●●●● ● ●●● ● ● ● ● ●● ● ●●●●●● ● ●●● ● 0.00 ● ● ●●●●●● ● ● ●● ● ● ● ● ● ● ● 0.00 ● ● ●● ● 0.00 ● ● Component 2 ● ●●●●● ● ● ● ● ●●●● ● ●●● ●● ● ●●● ● ●●● ●● ● ● ● ●●● ● ●●● ●● ● ● ●●●●●●● ● ● Component 2 ● Component 2 ●●●● ●● ● ● ●●● ● ● ● ●●● Component 2 ● ● ●●● ●●●● ●●●●●● ●●●●●● ● ●●●●●● ● ●●● ● ●●●● ● ●● ● ●● ● ●● ●●● ● ●●●●●● ●●●●●● ● ● ● ●● ● ● ●● ●● ● ● ● ● ●● ● ● ●● ● ● ●● ●● ●● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● Component 2 ● Component 2 ● ● Component 2 ● ● ● ● ● ● ● ● Component 2 ● ● −0.05 ● ● ● ● EC ● ● ● ● ● ●● −0.05 ● ● ● ● ● ● −0.05 EC ● −0.05 ● ● ● ● ● ●● EC ●● ● ● EC ● ● ● ● ● ● ● ●● ● ● ● ● ●● ●● ●● ●● ● ● ● ●● ● ● ●● ● ●● ● ● ●● ●● ● −0.10 ●● ●● ●● ●● ● −0.10 ● ●● ●●

P −0.10 P ●● −0.10 ●● ●● ● ● P ● ● ●● ● P ● ● ●●● ● ● ● ●●●● ●●● ● ● ●●●● ●●● ●●● ●●●● ●●●● −0.15 −0.15 −0.15 −0.05 0.00 0.05 0.10 −0.15 −0.05 0.00 0.05 0.10 −0.05 0.00 0.05 0.10 −0.05 0.00 0.05 0.10 Component 1 Component 1 Component 1 Component 1 ComponentComponent 1 1 ComponentComponent 1 1

Rfx6 Neurog3 Pax4 Nkx2.2

● umap − Pax4 norm counts ● ● umap − Pax4 norm counts umap − Pax4 norm counts umap − Pax4 norm counts ●●● ● ●● ●● ●● ●● ● ●● ●● 126 17 ●● ●●●● ● ●● + ● 126 + 17 ●●● ● ● 126 + 17

126 17 ● ● ● + ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ●● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 0.15 ● ● PE ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 0.15 ● ● ● ● ● ●● ●●● ● ● ● ● ● ●● ●●● ● ● ● ● ● ● ● ● ● ● ●● ● ●● ●● ● ● ● ● ● ● ● ● ● ● ● ● 124 ● ● 8 ● 0.15 ●● ● ● ●● ●●● PE ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 0.15 Pax4 ● ● Nkx2-2 Neurog3● Rfx6 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ●● ●● ● ● ● ● ● ● ● ● ●● ● ●● ●● ● ● ● ● ● 124 ● ● 8 124 ● ● 8 PE ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 124 ● ● ● ● ● ● 8 ● ● ● ● ●● ● ● ● PE ● ● ● ● ● ●● ● ● ●● ● ● ● ● ● ● ● ● ● ● Q ●● ● R ● ●● ● ● ● S ● ● ● ● ● ● ● T ● ● ●● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ●● ● ● ● ●● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ●● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ●● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ●

● ● 122 3 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● umap2 ● ● ● ● ● ● ● ● ● ● ● 122 ● ● ● ● 3 ● ● ● ● 122 ● ● ● ● 3 ● ● ● ● ● ● ● ● ● ● ● ● 122 ● ● ● ● 3 ● ● ● ● ● ● ● ● ● ● ● ● umap2 ● ● ● ● ● ● umap2 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● umap2 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ●● ● ● ● ● ● ● ● ● ●● ● ● ● ● 0.10 ● ● ● ● ● ● ● ●● 0.10 ● ● ● ●● ● ● ● ● ● ● ● ●

0.10 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●●● ● ● ● ● ● ● ● ● ● ● ● ●● ●● ● 0.10 ● ● ● ● ● ● ●● ●● ● ● ● ● ● ● ● ● 120 ● ● ● ● ● 1 ● ● ● ● ●● ●● ● ● ● ● ● ● ● ●●● ● ● ● ● ● ● ● ● ● ●●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● 120 ● ● ● ● ● 1 ● ● ●●● ● 120 ● ● ● ● ● 1 ●● ● ● ● ● ● ● ● ● ● ● ● 120 ● ● ● ● ● 1 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ●●● ● ● ● ●● ●●● ● ● ●● ●●● ● ● ●● ● ● ● ●●●● ● ● ● ● ● ●● ● ● ● ●● ● ● ● ●● ● ● ●●●● ● ●●●● ● ●● ● ● ●●●● ●● ● ●● ● ●● ● ● ● ●● ● ● ● ● ● ● 0 ● ● ● 118 ● 0 ● 0 118 ● 118 0 ● ● 118 ● ● ● ● 122 124 126 128 130 132 122 124 126 128 130 132 122 124 126 128 130 132 0.05 ● 0.05 ● 122 124 126 128 130 132 ● ● 0.05 ● ● ● umap1 ● ● ● ● ● 0.05 ● ● - ● ● ● umap1 - ● ● ● umap1 - ● umap1 - ● ●● ● ● ●● ●●●●● ●● ● ● ●● ● ● ●●● ● ● ●● ● ● ● ● ● ●● ● ● ●●● ● ●● ● ● ●●● ●●● ● ● ●● ● ● ● ●●●● ● ● ●● ● ● ●● ● ● ●●●● ● ● ●●●●●●●● ● ● ●●●●● ● ● ● ● ●●●● ● ● ●●●●● ● ● ● ● ●● ● ●● ●●●●● ●●●● ●● ● ● ●●●●● ● ● ●●●●● ●●●● ●● ● ● ●●● ●●●●●●● ●●● ● ● ● ●●●●●● ● ●●●● ● ● ● ● ●● ● ●● ● ●● ● ●●●●●● ● ●●●● ● ● ● ● ● ●● ●● ● ●●● ●● ● ● ●● ● ● ●● ● ●● ● ● ●● ●● ● ●●●●●●●● ● ●●●● ● ● ● ● ●● ●● ●● ●● ● ● ●● ●● ● ●● ● ●● ●●● ● ● ●● ● ● ● ●● ● ●●●● ●●● ●● ● ●●● ●● ● ● ● ● ● ●●● ●●●●●●●●● ●●●●●●●●● ● ● ●●●●●● ●● ● ●● ●● ● ● ● ●● ●● ● ● ● ● ● ●●● ●●●●●●●●● ●●●●●●●●● ● ●●● ● ●● ●●● ●●● ●● ●●● ●●●●●●●●●●● ●●●● ● ●●●● ●●● ● ● ● ● ● ●●●●●●●●●●●●●● ●●● ● ●● ●● ● ● ●● ● ● ●●● ●●●●●●●● ●●●●●●●●● ●●●● ●●● ● ● ● ● ● ●●● ●●●●●●●●● ● ● ● ● ● ●● ● ● 0.00 ● ● ● ● ● ●● ●●●●● ● 0.00 ● ● ● ●●●●●●●●● ● ●●● ● ● ● ● ●● ● ●●●● ●● ● ● ●●●●●●●●● ● 0.00 ●● ●● ●● ● ●●●●●●●●● ● ●●● ●● ● ● ● ● ● ● ●●●●●●●● ● ● ●● ● 0.00 ● ● ●●●●●● ● ● Component 2 ● ● Component 2 ●● ●● ● ● ● ●●● ● ●● Component 2 ●● ● ● ●● ● ● ●● ● ● ●●● ● ● ● ● ●●●● ● ●●●●●● Component 2 ● ● ●●● ● ●●●● ● ● ● ● ●●●● ● ●●●●●● ●●●● ● ●●●●● ●●● ● ●●●● ● ●●● ● ●● ● ●● ●●● ● ●● ● ● ● ● ● ● ●● ●●● ● ● ●● ● ●● ●● ● ● ● ● ●● ● ● ●● ●● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● EC ● ● ● ● ● ● ● ● −0.05 ● −0.05 ● ● −0.05 ● ● ● EC ● ● ● ● −0.05 ● ●● EC ●● ● ● ● ● EC Component 2 ● Component 2 ● ● Component 2 ● ● ● ● ● ● ● ● ● Component 2 ●● ●● ●● ● ● ●● ● ● ● ● ●● ● ● ● ● ●● ● ● ● ● ●● ●● ●● ●● ●● P ● ● −0.10 ●

−0.10 ● −0.10 ● ● ● ● P −0.10 ● ● ●● P ● ● ● ● P ● ● ● ● ●● ●● ● ●● ● ● ● ●● ●●●●● ●●●●● ●●● ●●●● ● ● ●●●● ● −0.15 −0.15 −0.15 −0.15 −0.05 0.00 0.05 0.10 −0.05 0.00 0.05 0.10 −0.05 0.00 0.05 0.10 −0.05 0.00 0.05 0.10 ComponentComponent 1 1 ComponentComponent 1 1 ComponentComponent 1 1 ComponentComponent 1 1 Insm1 Neurod1 Mlxipl Sox9

● umap − Pax4 norm counts ● ● ●●● ● umap − Pax4 norm counts ●● ● ● ●● umap − Pax4 norm counts ●●● 126 + 17 ●● ● ●● ● ●● ●●● ● ● ●● 126 17 ● ●● ●●● + ● ● ● ●● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● 126 17 ● ● ● + ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ●● norm counts ● ● ● ● ● ● ● ● ● ● ● ● ● ● umap − Pax4 ● ● ● ● ●● ●●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● 0.15 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ●● ●● ● ● ● ● ●● ● ● ● ●● ● ● ● ● ● 124 ● ● ● ●● 8 ● ● ●● ● 0.15 Insm1 Sox9● PE ● ● ● ● ● PE ● ● ● ● ● ● ● ● ● ● 0.15 ● ● ● ● ● ● ● ● ● 0.15 ● ● ● ● ● ● ● ● ● ● ● ● ● 126 17 ● ● ● ● ● W ● ● ● ●● ●● ● Mlxipl● ● ● ● ●● ● ●● ● ● + ● ● ● ● 124 ● ● ● 8 ● ● ● ●● PE ● ● ● ● ● ● ● ● ● ● ● X ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ●● ● ● V ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ●● ● ●● ●● ● ● ● ● ● ●● ● ● ● ● ● ● ● ●● ●● 124 ● ● ● ●● 8 ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● U ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● PE ● ● ● ● ● ● ● ● ● ● NeuroD1● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ●● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 122 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 3 ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● umap2 ● ●● ● ●● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 124 ● ● ● 8 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 122 3 ●● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ●● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● umap2 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● 122 ● ● ● ● 3 ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ●

umap2 ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 0.10 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ●● ●● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 0.10 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 0.10 ● ● ● 0.10 ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 120 ● 1 ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ●● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 122 3 ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● 120 ● ● ● ● ● 1 ● ● ● ● ● ● ● ● ● ● ● ● ● umap2 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ●● ● ●● ●●● ● ● ● ● 120 ● ● ● ● ● 1 ●●●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ●● ● ● ● ● ● ●● ● ● ● ●● ● ● ● ●● ●● ●●●● 0 ● ● ● ● 118 ● ● ● ●● ●●● ● ● ● ● ●● ● ● ● ● ● ● ● ●

120 ● 1 ● ● ● ● ● ● ● ● 0 ● ● ● 118 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● 122 124 126 128 130 132 ● ● 0 ● ● 118

● 0.05 ● ● ●● ● ● 122 124 126 128 130 132 0.05 ● ● ●●●● ● ● ●● umap1 0.05 ● ●

● 0.05 - ● ● ● ● ● ● ● ● ● ● ● ● 122 124 126 128 130 132 ●● ● ● ● ●●● ● umap1 - ●●● ● ● ● ●● ●● 0 ● ● ●● 118 ● ● ● ●● umap1 - ● ● ● ● ● ● ●● ●● ●● ● ● ●● ● ●● ● ● ● ● ● ● ● ● ● 122 124 126 128 130 132 ● ● ●●● ● ● ● ●● ● ● ● ●●●●●●● ● ● ●●● ● ● ●● ● ●●●● ● ● ● ●●●● ● ● ●●●● ●● ●●●●●●● ● ● ●● ●● ●●●● ●● ● ● ●●●●● ● ● ●● ● ● ● ● ● umap1 - ●●● ● ● ●●●●●● ● ●● ● ● ● ● ● ● ●● ●●●●● ●● ● ● ● ● ● ●● ● ●● ● ● ● ● ● ● ● ● ● ●● ●● ● ●●● ●● ● ● ● ●●●● ●●●●●●● ●●● ● ● ● ● ●● ●● ●● ●● ● ● ●● ●● ● ●●●●●●●● ● ●●●● ● ● ● ● ● ●● ● ●● ●● ● ● ● ● ●● ● ● ● ●●● ● ●● ●● ● ●●● ●● ● ● ● ● ● ●● ●● ● ● ● ● ● ●●● ●●●●●●●●● ●●●●●●●●● ● ● ● ● ●●●●● ● ●● ●● ● ●●● ● ●● ●●●● ● ● ● ●●● ●● ●●●●●●●●●●●●●●● ●●●● ● ●● ● ●● ●● ● ● ● ● ●● ● ● ● ●●● ●●●● ●●●● ● ● ● ● ● ●●● ●●●●●●●●● ● ●● ● ●●● ●● ● ● ●● ● ● ●●● ●●●●●●●● ●●●●●●●●● ● ●● ● ● ● ● ●● ●●●●● ● ● ● ●● ●● ● ● ● ●●● ●● ●●●●●●●●●●●●●●● 0.00 ●● ●● ● ● ●●●●●●●●● ● ●●●● ● ● ● ● ● ● ●● ● ●●●●● ● 0.00 ● ● ●●●●●●●●● ●●● ● ● ● ● ● ●●●● ● ●● ● ● ●● ●●●●● ● ●● ●● ● ● ● ● ● ● ● ● ● 0.00 ● ●● ●●●●●●● ● ● ●● ●●●● ● Component 2 ●● ●● ● ● ●●● ● ● 0.00 ● ●● ●●●●●●● ● Component 2 ●● ●● ● ● ●●● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ●●● Component 2 ●● ●● Component 2 ● ● ●● ● ● ● ●●●● ●● ● ● ●●●● ● ● ● ●●●●●● ● ●●● ●●●● ●● ●●●●● ●● ● ●●● ● ●●●● ●● ● ●●●●●● ●● ●●● ● ● ● ● ● ● ● ●● ●●● ● ● ● ● ●● ●● ● ● ● ● ● ●● ● ● ●● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ●● ● ● ●

● Component 2 ● ● ● −0.05 ● ● ● −0.05 ● ● ● ● ● ● ● ● ●● −0.05 ● ● ● −0.05 ● EC ● EC ● ● ●● EC Component 2 ● ● ● ● ● ● ● ● Component 2 ● ● ● ●● EC ● ●● ●● ● ● ● ● ● ● ●● ● ● ● ●● ● ●● ● Component 2 ●● ● ●● ● ●● ●●●

● ● −0.10 −0.10 ● ● ● ● ● ●● ● −0.10 ●● ● −0.10 ●● P ● ● P ● ● ● P ● ●● ● ●● ● ● ● ● ●● ●●●●● P ●● ●●●●● ●●●●● ● ●● ● ● ●●●● −0.15 −0.15 −0.15 −0.15 −0.05 0.00 0.05 0.10 −0.05 0.00 0.05 0.10 −0.05 0.00 0.05 0.10 −0.05 0.00 0.05 0.10 Component 1 Component 1 ComponentComponent 1 1 ComponentComponent 1 1 ComponentComponent 1 1

Figure S6 Table S1 : List of genes differentially regulated in Rfx6-/- small intestines (E18.5) compared to controls ordered by Fold Change.

PROBEID SYMBOL ENSEMBL FC logFC adj.P.Val A_55_P2022399 Ghrl ENSMUSG00000064177 -75,484509 -6,2381087 0,00026229 A_52_P313098 Gip ENSMUSG00000014351 -44,925049 -5,4894482 5,2023E-05 A_51_P406253 Gcg ENSMUSG00000000394 -40,746075 -5,3485892 0,00177988 A_51_P485756 Nts ENSMUSG00000019890 -40,33744 -5,3340476 0,00122242 A_51_P406253 Gcg ENSMUSG00000000394 -39,381694 -5,2994533 0,00186244 A_51_P262489 Sst ENSMUSG00000004366 -36,463889 -5,1883965 9,8044E-05 A_55_P1977431 Cck ENSMUSG00000032532 -31,0958 -4,9586478 3,1697E-05 A_51_P329811 Reg1 ENSMUSG00000059654 -7,1986674 -2,8477299 0,04216538 A_51_P169671 Reg3b ENSMUSG00000071356 -4,3332588 -2,1154524 0,02631709 A_51_P339331 Nkx6-3 ENSMUSG00000063672 -4,0095198 -2,0034295 0,02293633 A_66_P114856 Iapp ENSMUSG00000041681 -3,9320287 -1,9752738 0,00626899 A_51_P279437 Mfsd2a ENSMUSG00000028655 -3,3760772 -1,7553479 0,02556563 A_51_P201174 Lipf ENSMUSG00000024768 -3,3742822 -1,7545807 0,00263998 A_55_P2318584 Aqp8 ENSMUSG00000030762 -3,302674 -1,7236346 0,01497154 A_55_P1977870 Adgrg4 ENSMUSG00000053852 -3,1760201 -1,6672201 0,00504327 A_55_P2078955 Aqp8 ENSMUSG00000030762 -3,0333614 -1,6009174 0,03189236 A_55_P2137527 Fam183b ENSMUSG00000049154 -3,0088463 -1,5892104 0,00930337 A_51_P386648 Glod5 ENSMUSG00000031163 -2,9049079 -1,5384924 0,02321987 A_51_P354165 Apcs ENSMUSG00000026542 -2,7702427 -1,4700124 0,01413518 A_51_P234359 Sct ENSMUSG00000038580 -2,7591229 -1,4642097 0,00250618 A_52_P682382 Scd1 ENSMUSG00000037071 -2,732296 -1,4501138 0,01030149 A_55_P1960735 Gdf15 ENSMUSG00000038508 -2,5060096 -1,325392 0,02589974 A_51_P140429 Zg16 ENSMUSG00000049350 -2,4353519 -1,2841302 0,03108253 A_55_P2037343 H2-Q10 ENSMUSG00000067235 -2,396848 -1,2611384 0,00606705 A_52_P93837 Mme ENSMUSG00000027820 -2,3534454 -1,2347744 0,00506677 A_52_P2710 Nat8f5 ENSMUSG00000079494 -2,3261527 -1,2179458 0,0182736 A_66_P113268 Mme ENSMUSG00000027820 -2,2955369 -1,1988316 0,00981939 A_51_P178828 Mbl2 ENSMUSG00000024863 -2,2668058 -1,1806608 0,04973895 A_51_P184949 F12 ENSMUSG00000021492 -2,2568923 -1,1743376 0,01565519 A_51_P435844 Nr2e3 ENSMUSG00000032292 -2,2523929 -1,1714585 0,00503359 A_51_P348433 Rasal1 ENSMUSG00000029602 -2,241379 -1,1643866 0,01300096 A_51_P171075 Csf2 ENSMUSG00000018916 -2,2226345 -1,1522707 0,03302415 A_52_P116006 Gda ENSMUSG00000058624 -2,2011218 -1,138239 0,00031726 A_55_P1992490 Scg2 ENSMUSG00000050711 -2,1721945 -1,1191533 0,02974838 A_55_P2151556 C8g ENSMUSG00000015083 -2,1346667 -1,0940109 0,00804797 A_55_P2106803 Bglap2 ENSMUSG00000074486 -2,1281571 -1,0896047 0,01370113 A_52_P469502 Cda ENSMUSG00000028755 -2,1262816 -1,0883327 0,01370113 A_55_P2295731 Plut ENSMUSG00000092570 -2,1221075 -1,0854978 0,04483414 A_52_P614777 Sucnr1 ENSMUSG00000027762 -2,1180165 -1,0827138 0,00909768 A_52_P251699 Prodh2 ENSMUSG00000036892 -2,0909962 -1,0641905 0,04100098 A_51_P436469 Mfsd4b1 ENSMUSG00000038522 -2,0785111 -1,0555505 0,00250618 A_55_P2086507 Bglap3 ENSMUSG00000074489 -2,0591377 -1,0420403 0,03523517 A_51_P171075 Csf2 ENSMUSG00000018916 -2,0214572 -1,0153957 0,02134747 A_66_P121502 Gm5485 ENSMUSG00000110573 -2,0083426 -1,0060054 0,02873614 A_55_P2007601 Sftpd ENSMUSG00000021795 5,0962491 2,3494358 0,04917561 A_55_P1967196 Lamb3 ENSMUSG00000026639 5,09987527 2,35046196 0,03857843 A_55_P2038106 Cst8 ENSMUSG00000027442 5,18353876 2,37393735 0,00108811 A_51_P467346 Muc1 ENSMUSG00000042784 5,19462372 2,37701925 0,04163419 A_55_P1953341 Wfdc2 ENSMUSG00000017723 5,52715709 2,46653762 0,01659201 A_55_P2011101 Gsdmc3 ENSMUSG00000055827 5,70056688 2,51110539 0,00731298 A_55_P2086128 Fa2h ENSMUSG00000033579 5,78005362 2,53108288 0,03090509 A_66_P140525 A630076J17Rik ENSMUSG00000094613 5,85428192 2,54949222 0,0273367 A_55_P2029013 Bpifb5 ENSMUSG00000038572 6,03648259 2,59370815 0,01211322 A_55_P2011096 Gsdma2 ENSMUSG00000017211 6,24050438 2,64166264 0,05569268 A_55_P2152009 Tesc ENSMUSG00000029359 6,45666111 2,69078831 0,05252465 A_55_P2180536 Gsdma3 ENSMUSG00000064224 6,63306324 2,72967528 0,04659754 A_51_P481159 Cbr3 ENSMUSG00000022947 6,78648793 2,76266516 0,02183443 A_52_P300445 Atp4a ENSMUSG00000005553 7,93053958 2,98741903 0,0289267 A_51_P112223 Gsta4 ENSMUSG00000032348 8,63766946 3,11064211 0,04818498 A_55_P2141093 Eya2 ENSMUSG00000017897 9,58559215 3,26086756 0,02730943 A_55_P2084797 Aff3 ENSMUSG00000037138 9,80442937 3,29343367 0,05973508 A_51_P419226 S100a14 ENSMUSG00000042306 10,3760775 3,37518926 0,02791007 A_55_P2071064 Fer1l4 ENSMUSG00000013338 11,1681271 3,48131536 0,04949349 A_51_P455647 Car2 ENSMUSG00000027562 12,4790969 3,64144163 0,05204289 A_55_P2033795 Fabp6 ENSMUSG00000020405 17,617722 4,13895549 0,021917 A_51_P267700 Gkn3 ENSMUSG00000030048 18,0303827 4,17235812 0,05581994 A_51_P480602 Tff2 ENSMUSG00000024028 21,6714139 4,43772137 0,01992652 A_51_P253897 Psca ENSMUSG00000022598 22,509566 4,49246634 0,05141492 A_51_P343517 Ly6d ENSMUSG00000034634 27,0619351 4,7581931 0,04404195 A_55_P2083874 Vsig1 ENSMUSG00000031430 28,9187215 4,85393187 0,02683283 A_55_P2017929 Clu ENSMUSG00000022037 30,1276544 4,91301645 0,021917 A_51_P440985 Fgf15 ENSMUSG00000031073 38,5099098 5,26715784 0,05250896 A_55_P1968488 Gif ENSMUSG00000024682 40,7194598 5,34764652 0,03038961 A_55_P2011097 Gsdma2 ENSMUSG00000017211 41,1823943 5,3639558 0,03602119 A_55_P1959909 Atp4b ENSMUSG00000031449 42,9323448 5,42399306 0,00361371 A_51_P353895 Sult1c2 ENSMUSG00000023122 53,763044 5,74854292 0,057824 A_51_P480861 Pga5 ENSMUSG00000024738 56,7316419 5,82608171 0,02435333 A_55_P2122429 Cym ENSMUSG00000046213 58,8998859 5,88019293 0,00843429 A_51_P216679 Anxa10 ENSMUSG00000031635 67,0676035 6,06754415 0,04551496 A_55_P2113160 Mal ENSMUSG00000027375 83,6861246 6,38691653 0,04404195 A_55_P2046563 Cym ENSMUSG00000046213 103,483339 6,69325471 0,00843867 A_55_P2007457 Muc5b ENSMUSG00000066108 158,260517 7,30615757 0,0558688 A_55_P2072095 Dpcr1 ENSMUSG00000073408 202,678511 7,66304932 0,04660241 A_55_P1957797 Bpifb1 ENSMUSG00000027485 412,409935 8,68793528 0,021917 A_55_P2021585 Tff1 ENSMUSG00000024032 634,582522 9,30966398 0,01211322 A_51_P113906 Gkn2 ENSMUSG00000030049 1033,23801 10,0129569 0,04361703

Table S2 : List of genes differentially regulated in Rfx6DEndo small intestines (E18.5) compared to controls ordered by Fold Change.

PROBEID SYMBOL ENSEMBL FC logFC adj.P.Val A_52_P313098 Gip ENSMUSG00000014351 -3,23 -1,69 0,0050 A_55_P2022399 Ghrl ENSMUSG00000064177 -2,65 -1,41 0,0360 A_51_P262489 Sst ENSMUSG00000004366 -2,34 -1,23 0,0065 A_51_P262489 Sst ENSMUSG00000004366 -2,33 -1,22 0,0054 A_51_P262489 Sst ENSMUSG00000004366 -2,3 -1,20 0,0048 A_51_P262489 Sst ENSMUSG00000004366 -2,26 -1,18 0,0048 A_51_P262489 Sst ENSMUSG00000004366 -2,25 -1,17 0,0048 A_51_P262489 Sst ENSMUSG00000004366 -2,25 -1,17 0,0048 A_51_P262489 Sst ENSMUSG00000004366 -2,24 -1,17 0,0057 A_51_P262489 Sst ENSMUSG00000004366 -2,24 -1,16 0,0050 A_51_P485756 Nts ENSMUSG00000019890 -2,22 -1,15 0,0048 A_51_P262489 Sst ENSMUSG00000004366 -2,21 -1,14 0,0050 A_51_P262489 Sst ENSMUSG00000004366 -2,19 -1,13 0,0054 A_51_P406253 Gcg ENSMUSG00000000394 -1,96 -0,97 0,0078 A_51_P406253 Gcg ENSMUSG00000000394 -1,95 -0,97 0,0174 A_51_P406253 Gcg ENSMUSG00000000394 -1,95 -0,96 0,0087 A_51_P406253 Gcg ENSMUSG00000000394 -1,94 -0,95 0,0077 A_51_P406253 Gcg ENSMUSG00000000394 -1,92 -0,94 0,0066 A_51_P406253 Gcg ENSMUSG00000000394 -1,92 -0,94 0,0050 A_51_P406253 Gcg ENSMUSG00000000394 -1,92 -0,94 0,0092 A_51_P406253 Gcg ENSMUSG00000000394 -1,92 -0,94 0,0057 A_51_P406253 Gcg ENSMUSG00000000394 -1,9 -0,93 0,0071 A_51_P406253 Gcg ENSMUSG00000000394 -1,89 -0,92 0,0140 A_55_P1977431 Cck ENSMUSG00000032532 -1,68 -0,75 0,0059 A_52_P366462 Pyy ENSMUSG00000017311 -1,35 -0,44 0,0071 A_55_P1977870 Adgrg4 ENSMUSG00000053852 -1,32 -0,40 0,0360 A_55_P2106801 Bglap3 ENSMUSG00000074489 -1,32 -0,40 0,0451 A_51_P234359 Sct ENSMUSG00000038580 -1,25 -0,32 0,0048 A_55_P1992490 Scg2 ENSMUSG00000050711 -1,25 -0,32 0,0481 A_52_P440962 Cdc73 ENSMUSG00000026361 -1,21 -0,27 0,0420 A_55_P1979814 Abcc8 ENSMUSG00000040136 -1,14 -0,19 0,0396 A_55_P1968723 Noct ENSMUSG00000023087 -1,12 -0,17 0,0256 A_55_P2106175 Gch1 ENSMUSG00000037580 -1,12 -0,16 0,0360 A_51_P492410 Pmvk ENSMUSG00000027952 -1,08 -0,12 0,0261 A_55_P1959748 Asns ENSMUSG00000029752 -1,06 -0,09 0,0235 A_55_P2052185 Lamtor1 ENSMUSG00000030842 -1,04 -0,06 0,0420 A_51_P401958 Taldo1 ENSMUSG00000025503 -1,04 -0,05 0,0451 A_51_P136355 Gng11 ENSMUSG00000032766 -1,02 -0,04 0,0451 A_66_P111430 2410006H16Rik ENSMUSG00000086841 1,06 0,08 0,0087 A_55_P1955289 Slc18b1 ENSMUSG00000037455 1,06 0,09 0,0420 A_55_P1961127 H19 ENSMUSG00000000031 1,07 0,10 0,0078 A_55_P1962334 Trim71 ENSMUSG00000079259 1,07 0,10 0,0451 A_66_P100765 Dao ENSMUSG00000042096 1,15 0,21 0,0297 A_55_P2182187 Neurog3 ENSMUSG00000044312 1,16 0,22 0,0420

Table S3 : List of 50 genes downregulated or upregulated in the ileum of Rfx6ΔAdInt mice 1week after tamoxifen treatment ordered by fold change.

Fold Adjusted Gene Description Change pvalue Gip gastric inhibitory polypeptide -26,34 1,65E-57 Gcg glucagon -10,54 9,69E-41 Isl1 ISL1 transcription factor, LIM/homeodomain -7,78 5,15E-20 Ghrl ghrelin -7,37 3,13E-18 Cck cholecystokinin -6,84 9,13E-31 Igkv3-4 immunoglobulin kappa variable 3-4 -4,95 2,21E-14 Pax6 paired box gene 6 -2,96 2,16E-08 Sst somatostatin -2,87 6,14E-21 Iapp islet amyloid polypeptide -2,86 5,42E-04 Accn5 amiloride-sensitive cation channel 5, intestinal -2,77 5,40E-04 Gpr119 G-protein coupled receptor 119 -2,74 1,15E-03 Dnahc9 dynein, axonemal, heavy chain 9 -2,72 1,55E-05 Gfra3 glial cell line derived neurotrophic factor family receptor alpha 3 -2,70 1,18E-08 Afp alpha fetoprotein -2,69 2,79E-04 Gck glucokinase -2,67 1,54E-03 Dmrt3 doublesex and mab-3 related transcription factor 3 -2,52 7,08E-03 Avpr1b arginine vasopressin receptor 1B -2,40 7,82E-03 Pyy peptide YY -2,39 1,64E-02 Insl5 insulin-like 5 -2,39 1,58E-02 Arx aristaless related homeobox -2,32 2,31E-02 Dbpht2 DNA binding protein with his-thr domain -2,30 2,66E-02 1700086L19Rik RIKEN cDNA 1700086L19 gene -2,30 1,67E-02 Sstr5 somatostatin receptor 5 -2,28 3,29E-03 Ppy pancreatic polypeptide -2,25 2,72E-02 Slc6a14 solute carrier family 6 (neurotransmitter transporter), member 14 -2,21 2,72E-02 Abcc8 ATP-binding cassette, sub-family C (CFTR/MRP), member 8 -2,21 2,57E-12 Pkhd1 polycystic kidney and hepatic disease 1 -2,16 3,79E-06 Klra17 killer cell lectin-like receptor, subfamily A, member 17 -2,05 3,76E-02 Slc37a2 solute carrier family 37 (glycerol-3-phosphate transporter), member 2 -1,97 3,00E-03 Myl7 myosin, light polypeptide 7, regulatory -1,94 1,27E-05 Gsdmc3 gasdermin C3 -1,89 3,85E-02 Ido1 indoleamine 2,3-dioxygenase 1 -1,75 3,14E-02 Gm14446 predicted gene 14446 -1,75 3,07E-02 Vwa5b2 von Willebrand factor A domain containing 5B2 -1,74 3,00E-03 Gpr112 G protein-coupled receptor 112 -1,73 3,23E-02 Ces1e carboxylesterase 1E -1,72 2,09E-05 Ces2a carboxylesterase 2A -1,71 3,75E-02 1700024P16Rik RIKEN cDNA 1700024P16 gene -1,70 2,31E-03 Sct secretin -1,69 8,33E-04 Scd2 stearoyl-Coenzyme A desaturase 2 -1,63 3,29E-03 B430010I23Rik RIKEN cDNA B430010I23 gene -1,62 1,50E-02 Mboat1 membrane bound O-acyltransferase domain containing 1 -1,62 2,91E-02 Usp2 ubiquitin specific peptidase 2 -1,61 4,37E-03 Tppp tubulin polymerization promoting protein -1,57 5,00E-02 Clca6 chloride channel calcium activated 6 -1,49 1,64E-02 Pla2g5 phospholipase A2, group V -1,47 2,39E-02 Elovl6 ELOVL family member 6, elongation of long chain fatty acids (yeast) -1,45 8,73E-03 Lgals3 lectin, galactose binding, soluble 3 -1,44 4,71E-02 Ppa1 pyrophosphatase (inorganic) 1 -1,43 3,76E-02 Emp1 epithelial membrane protein 1 -1,43 4,26E-02

Fold Adjusted Gene Description Change pvalue Fbp1 fructose bisphosphatase 1 3,43 6,27E-29 Cyp2u1 cytochrome P450, family 2, subfamily u, polypeptide 1 3,22 6,2005E-20 Ighv6-6 immunoglobulin heavy variable 6-6 3,18 1,0237E-08 AU019990 expressed sequence AU019990 3,10 3,3812E-05 Acta1 actin, alpha 1, skeletal muscle 3,09 4,6209E-09 BC064078 cDNA sequence BC064078 3,07 6,2005E-20 Sis sucrase isomaltase (alpha-glucosidase) 2,92 3,7524E-12 Stxbp5l syntaxin binding protein 5-like 2,82 7,8641E-18 4930534D22Rik RIKEN cDNA 4930534D22 gene 2,64 0,00054239 Vpreb3 pre-B lymphocyte gene 3 2,38 0,01163342 Pbx4 pre B cell leukemia homeobox 4 2,33 3,238E-12 Htra4 HtrA serine peptidase 4 2,26 0,02664362 Haao 3-hydroxyanthranilate 3,4-dioxygenase 2,24 0,03723637 Srpk3 serine/arginine-rich protein specific kinase 3 2,21 0,02964923 AC073553.3 2,20 0,04762137 Gpr174 G protein-coupled receptor 174 2,17 0,03144558 Kcnj15 potassium inwardly-rectifying channel, subfamily J, member 15 2,13 0,01522934 P2ry10 purinergic receptor P2Y, G-protein coupled 10 2,12 0,02526936 Cd180 CD180 antigen 2,11 0,03854448 Ccl20 chemokine (C-C motif) ligand 20 2,10 0,02309404 Trib3 tribbles homolog 3 (Drosophila) 2,09 4,0135E-05 Rhoh ras homolog gene family, member H 2,09 0,01782172 Tnfrsf13b tumor necrosis factor receptor superfamily, member 13b 2,03 0,00035548 Plk5 polo-like kinase 5 (Drosophila) 2,01 0,04783656 Lpar2 lysophosphatidic acid receptor 2 2,01 6,2681E-05 BC035044 cDNA sequence BC035044 1,95 0,03963007 Esr1 estrogen receptor 1 (alpha) 1,93 9,9826E-09 Grap GRB2-related adaptor protein 1,92 0,04540655 Cilp cartilage intermediate layer protein, nucleotide pyrophosphohydrolase 1,91 0,01740723 Gm9817 predicted gene 9817 1,88 0,00011082 Acaa1b acetyl-Coenzyme A acyltransferase 1B 1,88 0,01583983 Gm20548 predicted gene 20548 1,79 0,02626167 Renbp renin binding protein 1,76 8,9005E-07 Gpnmb glycoprotein (transmembrane) nmb 1,76 0,0131627 Plek pleckstrin 1,74 0,03227236 Gm600 predicted gene 600 1,73 0,02877538 Trpc1 transient receptor potential cation channel, subfamily C, member 1 1,72 0,00253675 Edn2 endothelin 2 1,70 3,1569E-05 9930012K11Rik RIKEN cDNA 9930012K11 gene 1,67 0,00114728 Lmx1a LIM homeobox transcription factor 1 alpha 1,65 0,0149602 AI662270 expressed sequence AI662270 1,62 0,0364951 Gls glutaminase 1,62 8,7334E-07 Irf4 interferon regulatory factor 4 1,61 0,00607867 Tnfrsf12a tumor necrosis factor receptor superfamily, member 12a 1,60 0,00700273 Slc2a5 solute carrier family 2 (facilitated glucose transporter), member 5 1,59 0,04699071 Olfr165 olfactory receptor 165 1,58 0,02351688 Basp1 brain abundant, membrane attached signal protein 1 1,58 0,00858582 Abi3 ABI gene family, member 3 1,54 5,9403E-05 Tph1 tryptophan hydroxylase 1 1,53 0,01740723 Klhl24 kelch-like 24 (Drosophila) 1,47 0,00076498

Table S4 : List of 50 genes downregulated or upregulated in the ileum of Rfx6ΔAdInt mice 3 months after tamoxifen treatment ordered by fold change.

Fold Adjusted Gene Description Change pvalue Gcg glucagon -129,77 6,058E-160 Nts neurotensin -121,16 2,4E-176 Pyy peptide YY -82,71 3,768E-134 Gip gastric inhibitory polypeptide -13,49 1,4763E-30 Ghrl ghrelin -10,04 6,6772E-23 Isl1 ISL1 transcription factor, LIM/homeodomain -6,13 1,4006E-18 Krt84 keratin 84 -4,79 1,6919E-13 Accn5 amiloride-sensitive cation channel 5, intestinal -4,32 7,8949E-08 antigen p97 (melanoma associated) identified by monoclonal antibodies Mfi2 133.2 and 96.5 -4,06 2,5388E-07 Tgtp1 T cell specific GTPase 1 -4,05 5,2701E-11 Socs1 suppressor of cytokine signaling 1 -3,90 8,0882E-18 Abca13 ATP-binding cassette, sub-family A (ABC1), member 13 -3,86 1,6314E-08 Ifng interferon gamma -3,79 5,1582E-07 1600029D21Rik RIKEN cDNA 1600029D21 gene -3,78 1,1869E-06 Il21 interleukin 21 -3,75 4,7795E-07 Casr calcium-sensing receptor -3,74 1,8091E-06 Arx aristaless related homeobox -3,67 2,7067E-06 Pax6 paired box gene 6 -3,54 1,0697E-09 1700086L19Rik RIKEN cDNA 1700086L19 gene -3,38 1,3829E-05 Pkhd1 polycystic kidney and hepatic disease 1 -3,31 1,5627E-11 Gm4841 predicted gene 4841 -3,31 1,3492E-07 Gm3395 predicted gene 3395 -3,31 2,313E-06 Il17f interleukin 17F -3,27 2,2522E-05 Cxcl10 chemokine (C-X-C motif) ligand 10 -3,13 2,4777E-09 Cd274 CD274 antigen -3,13 3,1664E-29 Gm12250 predicted gene 12250 -3,11 1,0728E-06 Gm14446 predicted gene 14446 -3,03 5,9757E-05 Gbp6 guanylate binding protein 6 -3,03 5,4747E-06 Igtp interferon gamma induced GTPase -2,97 7,6642E-05 Gpr119 G-protein coupled receptor 119 -2,97 0,00010571 Ceacam10 carcinoembryonic antigen-related cell adhesion molecule 10 -2,96 8,6441E-06 Dbpht2 DNA binding protein with his-thr domain -2,95 3,266E-05 Cd177 CD177 antigen -2,92 1,2648E-06 Iigp1 interferon inducible GTPase 1 -2,91 1,1201E-06 Gm11992 predicted gene 11992 -2,86 4,4399E-06 Tnfrsf8 tumor necrosis factor receptor superfamily, member 8 -2,84 1,3887E-05 Avpr1b arginine vasopressin receptor 1B -2,81 0,00033941 Gbp10 guanylate-binding protein 10 -2,78 0,00043342 Irgm2 immunity-related GTPase family M member 2 -2,78 4,0049E-05 Nlrp10 NLR family, pyrin domain containing 10 -2,75 0,00011862 Tgtp2 T cell specific GTPase 2 -2,74 4,2146E-06 Gbp2 guanylate binding protein 2 -2,73 1,4334E-13 Nlrc5 NLR family, CARD domain containing 5 -2,71 4,0459E-06 1700011H14Rik RIKEN cDNA 1700011H14 gene -2,70 1,7583E-07 BC023105 cDNA sequence BC023105 -2,67 0,00019345 Upp1 uridine phosphorylase 1 -2,66 0,00071069 Il18bp interleukin 18 binding protein -2,64 4,7555E-07 1110032F04Rik RIKEN cDNA 1110032F04 gene -2,63 0,00020918 Ccl5 chemokine (C-C motif) ligand 5 -2,63 0,0001625 Stat1 signal transducer and activator of transcription 1 -2,61 2,8837E-09

Adjusted Gene Description Fold Change pvalue Slc2a2 solute carrier family 2 (facilitated glucose transporter), member 2 11,56 5,99E-42 Dmp1 dentin matrix protein 1 8,48 1,11E-19 Apoa4 apolipoprotein A-IV 7,79 1,52E-34 Stxbp5l syntaxin binding protein 5-like 7,40 4,60E-60 Rab30 RAB30, member RAS oncogene family 5,61 8,26E-63 Clec1b C-type lectin domain family 1, member b 5,37 8,21E-16 Fbp1 fructose bisphosphatase 1 5,14 6,65E-14 Sis sucrase isomaltase (alpha-glucosidase) 4,94 4,26E-38 Cyp2u1 cytochrome P450, family 2, subfamily u, polypeptide 1 4,70 1,28E-29 1500035N22Rik RIKEN cDNA 1500035N22 gene 4,46 2,18E-10 Mmp9 matrix metallopeptidase 9 4,24 9,07E-20 Gpnmb glycoprotein (transmembrane) nmb 4,16 2,05E-11 Gm13373 predicted gene 13373 3,90 4,22E-08 Gm15665 predicted gene 15665 3,89 1,78E-07 Gm10680 predicted gene 10680 3,84 6,61E-07 Cwh43 cell wall biogenesis 43 C-terminal homolog (S. cerevisiae) 3,58 1,54E-07 Esr1 estrogen receptor 1 (alpha) 3,51 2,91E-56 Gm9817 predicted gene 9817 3,51 1,19E-17 4930534D22Rik RIKEN cDNA 4930534D22 gene 3,50 4,31E-07 Nt5e 5' nucleotidase, ecto 3,49 1,71E-11 Rdh7 retinol dehydrogenase 7 3,39 1,59E-07 Olfr558 olfactory receptor 558 3,38 6,90E-21 Gm9994 predicted gene 9994 3,33 1,99E-06 Slc38a11 solute carrier family 38, member 11 3,32 7,59E-08 Galr1 galanin receptor 1 3,27 1,71E-09 Apoc3 apolipoprotein C-III 3,21 2,94E-16 Chgb chromogranin B 3,21 9,64E-25 Tph1 tryptophan hydroxylase 1 3,20 9,56E-14 Creb3l3 cAMP responsive element binding protein 3-like 3 3,16 1,05E-29 Ccl24 chemokine (C-C motif) ligand 24 3,13 2,08E-06 Lmx1a LIM homeobox transcription factor 1 alpha 3,03 4,10E-11 Chga chromogranin A 2,92 1,23E-51 Enpp7 ectonucleotide pyrophosphatase/phosphodiesterase 7 2,91 2,01E-04 Col4a3 collagen, type IV, alpha 3 2,89 5,30E-18 Cyp1a1 cytochrome P450, family 1, subfamily a, polypeptide 1 2,89 5,73E-05 Kcnk16 potassium channel, subfamily K, member 16 2,88 2,62E-04 Hmgcs2 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2 2,88 2,19E-04 Rbp2 retinol binding protein 2, cellular 2,85 9,07E-20 Cd209b CD209b antigen 2,81 2,99E-05 Utp14b UTP14, U3 small nucleolar ribonucleoprotein, homolog B (yeast) 2,81 3,31E-16 Reg4 regenerating islet-derived family, member 4 2,78 6,12E-06 Dao D-amino acid oxidase 2,74 1,00E-22 Gabrb2 gamma-aminobutyric acid (GABA) A receptor, subunit beta 2 2,73 2,17E-04 Inhba inhibin beta-A 2,72 3,55E-07 Olfr78 olfactory receptor 78 2,71 1,43E-04 Leap2 liver-expressed antimicrobial peptide 2 2,70 1,03E-06 Mlxipl MLX interacting protein-like 2,70 2,72E-26 6430710C18Rik RIKEN cDNA 6430710C18 gene 2,69 1,71E-07 Npl N-acetylneuraminate pyruvate lyase 2,69 4,04E-15 Gsdma gasdermin A 2,69 1,81E-07 Pax4 paired box gene 4 2,67 1,11E-04