DOCSLIB.ORG

A Spectrum of LMX1B Mutations in Nail-Patella Syndrome

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A Spectrum of LMX1B Mutations in Nail-Patella Syndrome ARTICLE A spectrum of LMX1B mutations in Nail-Patella syndrome: New point mutations, deletion, and evidence of mosaicism in unaffected parents Monica Marini, PhD1, Renata Bocciardi, PhD1, Stefania Gimelli, MS2, Marco Di Duca3, Maria T. Divizia, MD1, Anwar Baban, MD1, Harald Gaspar, MD4, Isabella Mammi, MD5, Livia Garavelli, MD6, Roberto Cerone, MD7, Francesco Emma, MD8, Maria F. Bedeschi, MD9, Romano Tenconi, MD10, Alberto Sensi, MD11, Andrea Salmaggi, MD12, Mario Bengala, MD13, Francesca Mari, MD14, Gianluca Colussi, MD15, Krzysztof Szczaluba, MD16, Stylianos E. Antonarakis, MD2, Marco Seri, MD17, Margherita Lerone, MD1, and Roberto Ravazzolo, MD1,18 Purpose: Nail-Patella syndrome (MIM 161200) is a rare autosomal mosaicism in unaffected parents in two cases, which, to our knowledge, dominant disorder characterized by hypoplastic or absent patellae, dys- are the first reported cases of inheritance of a mutated LMX1B allele in trophic nails, dysplasia of the elbows, and iliac horn. In 40% of cases, Nail-Patella syndrome patients from a mosaic parent. Conclusion: The a glomerular defect is present and, less frequently, ocular damage is study of the described case series provides some original observations observed. Inter- and intrafamilial variable expressivity of the clinical in an “old” genetic disorder. Genet Med 2010:12(7):431–439. phenotype is a common finding. Mutations in the human LMX1B gene Key Words: Nail-Patella syndrome, LMX1B gene, mutation, deletion, have been demonstrated to be responsible for Nail-Patella syndrome in mosaicism around 80% of cases. Methods: Standard polymerase chain reaction and sequencing methods were used for mutation and single nucleotide polymorphism identification and control of cloned sequences. Array- ail-Patella syndrome (NPS), or hereditary onycho-osteodys- CGH (Agilent, 244A Kit) was used for detection of deletions. Standard Nplasia (MIM 161200), is a rare autosomal dominant disorder, cloning techniques and the Snapshot method were used for analysis of first reported by Little1 in 1897, characterized by hypoplastic or mosaicism. Results: In this study, we present the results of LMX1B absent patellae, dystrophic nails, dysplasia of the elbows, and iliac screening of 20 Nail-Patella syndrome patients. The molecular defect horn. In the skeletal system, tendons, ligaments, and muscles as ϳ was found in 17 patients. We report five novel mutations and a 2Mb well as bones can be affected.2 Ophthalmologic abnormalities deletion in chromosome 9q encompassing the entire LMX1B gene in a include increased ocular pressure, glaucoma, and subsequent blind- patient with a complex phenotype. We present evidence of somatic ness. The most serious manifestation of NPS is nephropathy that can be found in 40% of patients.2,3 The earliest clinical findings are proteinuria and hematuria. Ten percent of NPS may From the 1Molecular Genetics and Cytogenetics Unit, G. Gaslini Institute, progress to nephrotic syndrome and/or end-stage renal dis- 2 Genova, Italy; Department of Genetic Medicine and Development, Univer- ease. Recent studies suggest that NPS phenotype may be sity Hospitals of Geneva, Geneva, Switzerland; 3Laboratory of Pathophysi- ology of Uremia, G. Gaslini Institute, Genova, Italy; 4Institute of Medical more extensive than previously described including neuro- Genetics, University of Zu¨rich, Schwerzenbach, Switzerland; 5Medical Ge- logic and neurobehavioral aspects.4 netics, ULSS, Venice, Italy; 6Department of Obstetrics and Pediatrics, Clin- Most NPS cases are associated with heterozygous muta- 7 ical Genetics Unit, S. Maria Nuova Hospital, Reggio Emilia, Italy; Depart- tions in the LIM homeobox transcription factor 1 beta gene ment of Pediatrics, G. Gaslini Institute, University of Genova, Genova, Italy; 2 8Department of Nephrology and Urology, Division of Nephrology and (LMX1B, MIM 602575), a member of the LIM-homeodo- Dialysis, Bambino Gesu` Children’s Hospital and Research Institute, Rome, main family of transcription factors, that play a vital role Italy; 9Clinical Genetics Unit, Fondazione IRCCS, Ospedale Maggiore Poli- during embryo development by determining body pattern in clinico, Mangiagalli e Regina Elena, Milano, Italy; 10Department of Pediat- vertebrates and invertebrates. 11 rics, Clinical Genetics Unit, University of Padova, Padova, Italy; Depart- 5 12 The LMX1B gene is mapped on chromosome 9q34.1. It ment of Medical Genetics, University of Ferrara, Ferrara, Italy; Department of ϳ Clinical Neurosciences, C. Besta Neurology Institute, Milan, Italy; 13Laboratory consists of eight exons spanning a region of 82 kb of genomic of Medicine, Azienda Ospedaliera Universitaria Policlinico Tor Vergata, Rome, DNA and encodes about 372 amino acid residues of protein.2 Italy; 14Medical Genetics, University of Siena, Siena, Italy; 15Division of Ne- The protein contains two zinc-binding LIM domains at the 16 phrology, Niguarda Ca’ Granda Hospital, Milan, Italy; Department of Medical 2 NH2-terminus and a DNA-binding homeodomain. Genetics, National Research Institute of Mother and Child, Warsaw, Poland; 6 17Medical Genetics, Policlinico Sant’Orsola Malpighi, University of Bologna, During embryo development, LMX1B plays multiple roles. Bologna, Italy; and 18Department of Pediatrics and CEBR, University of Genoa, It is expressed in the dorsal mesenchyme of the limb bud, is Genoa, Italy. responsible for the dorsal-ventral patterning, and is essential for Roberto Ravazzolo, Laboratory of Molecular Genetics, G. Gaslini Institute, the differentiation of metanephric precursor cells into podocytes Largo G. Gaslini 5, 16147 Genova, Italy. E-mail: [email protected]. and, possibly, for the maintenance of the differentiated status. Disclosure: The authors declare no conflicts of interest. Moreover, LMX1B expression has also been shown during the development of the central nervous system and seems to be Submitted for publication July 21, 2009. essential for the development of serotonergic neurons. In accor- Accepted for publication April 8, 2010. dance with the expression pattern, knock-out mice for targeted Published online ahead of print June 7, 2010. inactivation of Lmx1b showed a strongly resembling phenotype DOI: 10.1097/GIM.0b013e3181e21afa for NPS with absent nails and patellae and characteristic ultra- Genetics IN Medicine • Volume 12, Number 7, July 2010 431 Marini et al. Genetics IN Medicine • Volume 12, Number 7, July 2010 structural changes of the glomerular basement membrane in the Cycle Sequencing Kit (Applied Biosystems) according to the kidneys.7 provided protocol and run on a 3130xl Genetic Analyzer (Ap- The incidence of the disease is estimated as 1 in 50,000 plied Biosytems). live births, with high penetrance and an extremely variable clinical presentation both within and among families. LMX1B reported mutations include a wide spectrum of substitutions, Mosaicism analysis small insertions/deletions and splice site mutations, concen- After observing the presence of a low intensity mutated trated within the functional domains of the protein: LIM nucleotide in the sequencing electropherogram, PCR prod- domains (LIM-A 44%, LIM-B 38%) and the homeodomain ucts of the LMX1B exon 4 obtained from the mosaic parent (18%).2,8 The most frequently recurring mutations have been of patients 4 and 19 were subcloned using the TOPO-TA found in the homeodomain (R198X, R200Q, R208X, A213P, cloning Kit (Invitrogen, Carlsbad, CA) to verify the presence and R223X), which comprises nearly 30% of all known of two different alleles. Ten colonies were selected for each LMX1B mutations. amplimer and grown overnight in Luria-Bertani medium. So far, no evidence for locus heterogeneity has been re- Plasmids were then recovered with the IllustraTM ported. Recently, for the first time, deletions affecting the whole plasmid LMX1B gene or part of it were reported. Two deletions of the Prep Mini Spin Kit (GE Healthcare, Chalfont St. Giles, UK) whole gene and another affecting exons 3 to 8 were identified in according to the provided protocol. Plasmid DNA was se- a series of eight unrelated families with classical features of quenced by using the M13 Forward and Reverse vector primers included in the TOPO-TA cloning kit (Invitrogen) NPS.9 and the Big Dye Terminator Cycle Sequencing Kit (Applied Although it is possible that apparently negative cases actually Biosystems) as already described. The Snapshot method was carry mutations affecting regulatory regions essential for gene used according to the instructions provided by the purchasing expression either at the 5Ј end of the gene, or within introns, or company (Applied Biosystems). in the 3Ј untranslated regions, no such mutations have been so far reported as unequivocally causative. No correlation in the range of severity of NPS symptoms has been reported among patients with missense, nonsense, frame- shift, or splice mutations and those with large deletions of most Table 1 List of primers used for PCR amplification of or all the gene, strongly supporting haploinsufficiency for intronic SNPs in the LMX1B gene LMX1B as the mechanism underlying NPS.2,9 We describe here the results of LMX1B screening in a Oligo Cluster A series of NPS patients. Besides mutations already reported in Forward oligo rs34458206 the literature, we describe five previously unreported muta- tions and a deletion in chromosome 9q that includes the GGCAGACGGACTGCGCCAA rs349116246 entire LMX1B gene in a patient with a more complex phe- Reverse oligo rs2235057 notype. We describe somatic mosaicism in unaffected par-
Load more

Recommended publications
  • 1 Evidence for Gliadin Antibodies As Causative Agents in Schizophrenia
    1 Evidence for gliadin antibodies as causative agents in schizophrenia. C.J.Carter PolygenicPathways, 20 Upper Maze Hill, Saint-Leonard’s on Sea, East Sussex, TN37 0LG [email protected] Tel: 0044 (0)1424 422201 I have no fax Abstract Antibodies to gliadin, a component of gluten, have frequently been reported in schizophrenia patients, and in some cases remission has been noted following the instigation of a gluten free diet. Gliadin is a highly immunogenic protein, and B cell epitopes along its entire immunogenic length are homologous to the products of numerous proteins relevant to schizophrenia (p = 0.012 to 3e-25). These include members of the DISC1 interactome, of glutamate, dopamine and neuregulin signalling networks, and of pathways involved in plasticity, dendritic growth or myelination. Antibodies to gliadin are likely to cross react with these key proteins, as has already been observed with synapsin 1 and calreticulin. Gliadin may thus be a causative agent in schizophrenia, under certain genetic and immunological conditions, producing its effects via antibody mediated knockdown of multiple proteins relevant to the disease process. Because of such homology, an autoimmune response may be sustained by the human antigens that resemble gliadin itself, a scenario supported by many reports of immune activation both in the brain and in lymphocytes in schizophrenia. Gluten free diets and removal of such antibodies may be of therapeutic benefit in certain cases of schizophrenia. 2 Introduction A number of studies from China, Norway, and the USA have reported the presence of gliadin antibodies in schizophrenia 1-5. Gliadin is a component of gluten, intolerance to which is implicated in coeliac disease 6.
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • LMX1B Gene LIM Homeobox Transcription Factor 1 Beta
    LMX1B gene LIM homeobox transcription factor 1 beta Normal Function The LMX1B gene provides instructions for producing a protein that attaches (binds) to specific regions of DNA and regulates the activity of other genes. On the basis of this role, the LMX1B protein is called a transcription factor. The LMX1B protein appears to be particularly important during early embryonic development of the limbs, kidneys, and eyes. Health Conditions Related to Genetic Changes Nail-patella syndrome At least 145 mutations in the LMX1B gene have been found to cause nail-patella syndrome. Most mutations result in the production of an abnormally short, nonfunctional version of the LMX1B protein or change a single protein building block (amino acid). Mutations that substitute one amino acid for another amino acid reduce or eliminate the protein's ability to bind to DNA, disrupting the regulation of other genes during early development. Deletions of the entire LMX1B gene or large portions of the gene have also been shown to cause nail patella syndrome. It is unclear exactly how mutations in the LMX1B gene lead to the signs and symptoms of nail-patella syndrome. Other Names for This Gene • LIM homeo box transcription factor 1, beta • LIM homeobox transcription factor 1, beta • LMX1.2 • LMX1B_HUMAN • MGC138325 • MGC142051 • NPS1 Reprinted from MedlinePlus Genetics (https://medlineplus.gov/genetics/) 1 Additional Information & Resources Tests Listed in the Genetic Testing Registry • Tests of LMX1B (https://www.ncbi.nlm.nih.gov/gtr/all/tests/?term=4010[geneid])
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Phox2a Defines a Developmental Origin of the Anterolateral System in Mice And
    bioRxiv preprint doi: https://doi.org/10.1101/2020.06.10.144659; this version posted June 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Title: Phox2a defines a developmental origin of the anterolateral system in mice and 2 humans 3 4 Authors: R. Brian Roome1,2, Farin B. Bourojeni1,2, Bishakha Mona3, Shima Rastegar- 5 Pouyani1,2, Raphael Blain4, Annie Dumouchel1, Charleen Salesse1, W. Scott Thompson1, 6 Megan Brookbank1, Yorick Gitton4, Lino Tessarollo5, Martyn Goulding6, Jane E. 7 Johnson3,7, Marie Kmita1,9, Alain Chédotal4 and Artur Kania1,2,8,9,#,* 8 9 Affiliations : 10 1Institut de Recherches Cliniques de Montréal (IRCM), Montréal, QC, H2W 1R7, 11 Canada 12 2Integrated Program in Neuroscience, McGill University, Montréal, QC, H3A 2B4, 13 Canada 14 3Department of Neuroscience, UT Southwestern Medical Center, Dallas, TX, 75390, 15 United States 16 4Sorbonne Université, INSERM, CNRS, Institut de la Vision, 17 Rue Moreau, Paris, 17 75012, France 18 5Neural Development Section, Mouse Cancer Genetics Program, National Cancer 19 Institute, Frederick, MD, 21702, United States 20 6Molecular Neurobiology Laboratory, The Salk Institute for Biological Studies, La Jolla, 21 CA, 92037, United States 22 7Department of Pharmacology, UT Southwestern Medical Center, Dallas, TX, 75390, 23 United States 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.06.10.144659; this version posted June 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
    [Show full text]
  • Rbpj-Dependent and -Independent Notch2 Signaling Regulates
    RBPJ-DEPENDENT AND -INDEPENDENT NOTCH2 SIGNALING REGULATES CILIARY BODY DEVELOPMENT IN THE MOUSE EYE By Yi Zhou B.S., Tsinghua University, 2010 Submitted to the graduate degree program in Anatomy and Cell Biology and the Graduate Faculty of the University of Kansas in partial fulfillment of the requirements for the degree of Doctor of Philosophy. ________________________________ Ting Xie, Ph.D., Co-Chair ________________________________ William Kinsey, Ph.D., Co-Chair ________________________________ Dale Abrahamson, Ph.D. ________________________________ Peter Smith, Ph.D. ________________________________ Jerry Workman, Ph.D. Date Defended: Jan 6th, 2016 The Dissertation Committee for Yi Zhou certifies that this is the approved version of the following dissertation: RBPJ-DEPENDENT AND -INDEPENDENT NOTCH2 SIGNALING REGULATES CILIARY BODY DEVELOPMENT IN THE MOUSE EYE ________________________________ Ting Xie, Ph.D., Co-Chair ________________________________ William Kinsey, Ph.D., Co-Chair Date Approved: Jan 15th, 2016 ii ABSTRACT The ciliary body (CB) is a two-layered structure in the anterior eye, which is composed of the pigmented outer ciliary epithelium (OCE) and the non-pigmented inner ciliary epithelium (ICE). It is responsible for aqueous humor secretion and lens accommodation. Despite the important roles in maintaining normal eye functions, its development still remains poorly understood. The Notch signaling pathway is an evolutionarily conserved pathway that has diverse functions during tissue development and homeostasis. Canonical Notch signaling is mediated through the recombination signal binding protein for immunoglobulin kappa J region (RBPJ)-dependent transcription activation and repression. In this study, I have demonstrated that Notch2 and RBPJ are important regulators of CB development by conditionally deleting them in the developing CB.
    [Show full text]
  • A Transcription Factor Code Defines Nine Sensory Interneuron Subtypes in the Mechanosensory Area of the Spinal Cord
    A Transcription Factor Code Defines Nine Sensory Interneuron Subtypes in the Mechanosensory Area of the Spinal Cord Marta Garcia Del Barrio1, Steeve Bourane1, Katja Grossmann1, Roland Schu¨ le2, Stefan Britsch3,4, Dennis D.M. O’Leary1, Martyn Goulding1* 1 Molecular Neurobiology Laboratory, The Salk Institute for Biological Studies, La Jolla, California, United States of America, 2 Urologische Klinik/Frauenklinik und Zentrale Klinische Forschung, Klinikum der Universita¨t Freiburg, Freiburg, Germany, 3 Department of Medical Genetics, Max-Delbru¨ck-Center for Molecular Medicine, Berlin-Buch, Germany, 4 Institute for Molecular and Cellular Anatomy Ulm University, Ulm, Germany Abstract Interneurons in the dorsal spinal cord process and relay innocuous and nociceptive somatosensory information from cutaneous receptors that sense touch, temperature and pain. These neurons display a well-defined organization with respect to their afferent innervation. Nociceptive afferents innervate lamina I and II, while cutaneous mechanosensory afferents primarily innervate sensory interneurons that are located in lamina III–IV. In this study, we outline a combinatorial transcription factor code that defines nine different inhibitory and excitatory interneuron populations in laminae III–IV of the postnatal cord. This transcription factor code reveals a high degree of molecular diversity in the neurons that make up laminae III–IV, and it lays the foundation for systematically analyzing and manipulating these different neuronal populations to assess their function. In addition, we find that many of the transcription factors that are expressed in the dorsal spinal cord at early postnatal times continue to be expressed in the adult, raising questions about their function in mature neurons and opening the door to their genetic manipulation in adult animals.
    [Show full text]
  • Hereditary Hearing Impairment with Cutaneous Abnormalities
    G C A T T A C G G C A T genes Review Hereditary Hearing Impairment with Cutaneous Abnormalities Tung-Lin Lee 1 , Pei-Hsuan Lin 2,3, Pei-Lung Chen 3,4,5,6 , Jin-Bon Hong 4,7,* and Chen-Chi Wu 2,3,5,8,* 1 Department of Medical Education, National Taiwan University Hospital, Taipei City 100, Taiwan; [email protected] 2 Department of Otolaryngology, National Taiwan University Hospital, Taipei 11556, Taiwan; [email protected] 3 Graduate Institute of Clinical Medicine, National Taiwan University College of Medicine, Taipei City 100, Taiwan; [email protected] 4 Graduate Institute of Medical Genomics and Proteomics, National Taiwan University College of Medicine, Taipei City 100, Taiwan 5 Department of Medical Genetics, National Taiwan University Hospital, Taipei 10041, Taiwan 6 Department of Internal Medicine, National Taiwan University Hospital, Taipei 10041, Taiwan 7 Department of Dermatology, National Taiwan University Hospital, Taipei City 100, Taiwan 8 Department of Medical Research, National Taiwan University Biomedical Park Hospital, Hsinchu City 300, Taiwan * Correspondence: [email protected] (J.-B.H.); [email protected] (C.-C.W.) Abstract: Syndromic hereditary hearing impairment (HHI) is a clinically and etiologically diverse condition that has a profound influence on affected individuals and their families. As cutaneous findings are more apparent than hearing-related symptoms to clinicians and, more importantly, to caregivers of affected infants and young individuals, establishing a correlation map of skin manifestations and their underlying genetic causes is key to early identification and diagnosis of syndromic HHI. In this article, we performed a comprehensive PubMed database search on syndromic HHI with cutaneous abnormalities, and reviewed a total of 260 relevant publications.
    [Show full text]
  • Isolation and Growth Factor Inducibility of the Xenopus Laevis Lmx1b Gene
    Int. J. Dev. Biol. 47: 253-262 (2003) Original Article Isolation and growth factor inducibility of the Xenopus laevis Lmx1b gene CAROLINE E. HALDIN, SARJIT NIJJAR1, KARINE MASSÉ, MARK W. BARNETT2 and ELIZABETH A. JONES* Cell and Molecular Development Group, Department of Biological Sciences, Warwick University, Coventry, U.K., 1School of Biosciences, University of Birmingham, U.K. 2Department of Anatomy, University of Edinburgh Medical School, University of Edinburgh, U.K. ABSTRACT This paper reports the cloning of the full length Xenopus laevis Lmx1b gene, Xlmx1b. Xlmx1b is a LIM homeodomain protein with high conservation to homologues identified in human, mouse, hamster and chick. In situ hybridisation and RT-PCR analysis showed that Xlmx1b has a specific temporal expression pattern which can be separated into three main spatial domains. An Xlmx1b probe hybridized to regions of the nervous system from stage 13 onwards; these regions included the placodes and otic vesicles, the eye and specific sets of neurons. Sectioning of in situ hybridised embryos confirmed the location of transcripts as discreet regions of staining in ventro- lateral regions of the neural tube. From stage 27, transcripts could be detected in the capsule of pronephric glomus. Finally, transcripts were detected by Northern blot analysis in the developing fore and hind limbs. Xlmx1b transcripts were also detected by Northern blot analysis in eye, brain, muscle and mesonephros tissue in metamorphosing tadpoles. RT-PCR analysis showed that zygotic expression of Xlmx1b is initiated at stage 10.5 and the temporal sequence of Xlmx1b expression is identical in both neural and presumptive pronephros regions. The effects of the growth factors activin A, retinoic acid (RA) and basic fibroblast growth factor (bFGF) on the regulation of Xlmx1b were also studied.
    [Show full text]
  • Molecular Regulation in Dopaminergic Neuron Development
    International Journal of Molecular Sciences Review Molecular Regulation in Dopaminergic Neuron Development. Cues to Unveil Molecular Pathogenesis and Pharmacological Targets of Neurodegeneration Floriana Volpicelli 1 , Carla Perrone-Capano 1,2 , Gian Carlo Bellenchi 2,3, Luca Colucci-D’Amato 4,* and Umberto di Porzio 2 1 Department of Pharmacy, University of Naples Federico II, 80131 Naples, Italy; fl[email protected] (F.V.); [email protected] (C.P.C.) 2 Institute of Genetics and Biophysics “Adriano Buzzati Traverso”, CNR, 80131 Rome, Italy; [email protected] (G.C.B.); [email protected] (U.d.P.) 3 Department of Systems Medicine, University of Rome Tor Vergata, 00133 Rome, Italy 4 Department of Environmental, Biological and Pharmaceutical Sciences and Technologies, University of Campania “Luigi Vanvitelli”, 81100 Caserta, Italy * Correspondence: [email protected]; Tel.: +39-0823-274577 Received: 28 April 2020; Accepted: 1 June 2020; Published: 3 June 2020 Abstract: The relatively few dopaminergic neurons in the mammalian brain are mostly located in the midbrain and regulate many important neural functions, including motor integration, cognition, emotive behaviors and reward. Therefore, alteration of their function or degeneration leads to severe neurological and neuropsychiatric diseases. Unraveling the mechanisms of midbrain dopaminergic (mDA) phenotype induction and maturation and elucidating the role of the gene network involved in the development and maintenance of these neurons is of pivotal importance to rescue or substitute these cells in order to restore dopaminergic functions. Recently, in addition to morphogens and transcription factors, microRNAs have been identified as critical players to confer mDA identity. The elucidation of the gene network involved in mDA neuron development and function will be crucial to identify early changes of mDA neurons that occur in pre-symptomatic pathological conditions, such as Parkinson’s disease.
    [Show full text]
  • Lmx1a and Lmx1b Function Cooperatively to Regulate Proliferation, Specification, and Differentiation of Midbrain Dopaminergic Progenitors
    The Journal of Neuroscience, August 31, 2011 • 31(35):12413–12425 • 12413 Development/Plasticity/Repair Lmx1a and Lmx1b Function Cooperatively to Regulate Proliferation, Specification, and Differentiation of Midbrain Dopaminergic Progenitors Carol H. Yan,1* Martin Levesque,1* Suzanne Claxton,1 Randy L. Johnson,2 and Siew-Lan Ang1 1Department of Developmental Neurobiology, National Institute for Medical Research, The Ridgeway, London NW7 1AA, United Kingdom, and 2Department of Molecular Genetics, University of Texas M. D. Anderson Cancer Centre, Houston, Texas 77030 LIM homeodomain transcription factors, Lmx1a and Lmx1b, are required for the development of midbrain dopaminergic (mDA) neurons. Lmx1b is required for the specification and maintenance of mDA neurons, primarily due to its role in isthmic organizer development that is essential for the induction of mDA neurons. Here, we conditionally deleted Lmx1b in the ventral neural tube using ShhCre and found that Lmx1b conditional mutant mouse embryos show no defect in the development and maintenance of mDA neurons. In addition, Dreher (Lmx1a mutant) embryos display only a moderate reduction in the number of mDA neurons, suggesting that the related family member Lmx1b might compensate for Lmx1a function. We therefore generated Lmx1a and Lmx1b double mutants. Severe loss of mDA neurons occurred in Lmx1adr/dr;ShhCre/ϩ;Lmx1bf/f double mutants due to essential roles for Lmx1a and Lmx1b in regulating the proliferation and neuronal commitment of mDA progenitors through the expression of Wnt1 and Ngn2, respectively. Lmx1a and Lmx1b also negatively regulate Hes1 expression and consequently cell cycle exit through activation of p27 Kip1 expression. In addition, Lmx1a and Lmx1b also regulate the expression of floor plate genes such as Corin and Slit2 and specification of postmitotic mDA neurons.
    [Show full text]
  • Continuously Active Transcriptional Programs Are Required to Build Expansive Serotonergic Axon Architectures
    CONTINUOUSLY ACTIVE TRANSCRIPTIONAL PROGRAMS ARE REQUIRED TO BUILD EXPANSIVE SEROTONERGIC AXON ARCHITECTURES By LAUREN JANINE DONOVAN Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Dissertation Advisor: Evan S. Deneris Department of Neurosciences CASE WESTERN RESERVE UNIVERSITY January 2020 CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES We hereby approve the thesis/dissertation of Lauren Janine Donovan candidate for the degree of Doctor of Philosophy*. Committee Chair Jerry Silver, Ph.D. Committee Member Evan Deneris, Ph.D. Committee Member Heather Broihier, Ph.D. Committee Member Ron Conlon, Ph.D. Committee Member Pola Philippidou, Ph.D. Date of Defense August 29th, 2019 *We also certify that written approval has been obtained for any proprietary material contained therein. ii TABLE OF CONTENTS List of Figures……………………………………………………………………….….vii Abstract………………………………………….………………………………..….…1 CHAPTER 1. INTRODUCTION………………………………………………...……..3 GENERAL INTRODUCTION TO SEROTONIN………………………………….….4 Serotonin: Discovery and function………………………….……………...4 Serotonin Biosynthesis…………………………..…………………………..6 Manipulation of the serotonin system in humans……………………….6 Human mutations in 5-HT related genes………………………………….9 SEROTONIN NEURON NEUROGENESIS……………..………………………….11 5-HT neuron specification……………..………………………………...…11 Development of 5-HT neurons……………..………………………………13 NEUROANATOMY……………..……………………………………………………..13 Cytoarchitecture ……………..………………………………………………13 Adult Ascending 5-HT axon projection system ………………………..14
    [Show full text]