University of Nebraska Medical Center DigitalCommons@UNMC

Theses & Dissertations Graduate Studies

Spring 5-7-2016

Secretory Mucin MUC5AC in Gastrointestinal Malignancies

Shiv Ram Krishn University of Nebraska Medical Center

Follow this and additional works at: https://digitalcommons.unmc.edu/etd

Part of the Biochemistry Commons, and the Molecular Biology Commons

Recommended Citation Krishn, Shiv Ram, "Secretory Mucin MUC5AC in Gastrointestinal Malignancies" (2016). Theses & Dissertations. 110. https://digitalcommons.unmc.edu/etd/110

This Dissertation is brought to you for free and open access by the Graduate Studies at DigitalCommons@UNMC. It has been accepted for inclusion in Theses & Dissertations by an authorized administrator of DigitalCommons@UNMC. For more information, please contact [email protected]. Secretory mucin MUC5AC in gastrointestinal

malignancies

by

SHIV RAM KRISHN

A DISSERTATION

Presented to the Faculty of

the University of Nebraska Graduate College

in Partial Fulfillment of the Requirements

for the Degree of Doctor of Philosophy

Biochemistry & Molecular Biology Graduate Program

Under the supervision of Dr. Surinder K. Batra

University of Nebraska Medical Center Omaha, Nebraska

April, 2016

Supervisory Committee:

Dr. Michael A. Hollingsworth, Ph.D. Dr. Vimla Band, Ph.D. Parmender P. Mehta, Ph.D.

Dr. Chittibabu Guda, Ph.D. Dr. Maneesh Jain, Ph.D.

i

Secretory mucin MUC5AC in gastrointestinal malignancies

Shiv Ram Krishn, Ph.D.

University of Nebraska, 2016

Advisor: Dr. Surinder K Batra, Ph.D.

Secretory mucin MUC5AC is an extensively glycosylated high molecular weight protein that forms a polymeric gel layer over the epithelial layers under physiological conditions to protect these surfaces from myriad of insults. MUC5AC is known to be implicated in various

malignancies including pancreatic cancer and colorectal cancer. It is overexpressed in pancreatic cancer compared to no expression in the normal pancreas. However, its functional implications and associated mechanistic basis in pancreatic cancer remain obscure. Therefore, we investigated the role of MUC5AC in initiation and progression of pancreatic cancer. Our study showed that

MUC5AC expression is elevated during pancreatic cancer progression while it was not detected

in the normal pancreas. To elucidate the functional role of MUC5AC in pancreatic cancer, we

performed MUC5AC knockdown studies in pancreatic cancer cell lines (FG/COLO357,

SW1990). Knockdown of MUC5AC decreased pancreatic cancer cell viability, tumorigenicity,

metastasis, angiogenesis, and increased sensitivity to Gemcitabine. We observed that MUC5AC

might impact pancreatic cancer cell growth and metastasis by its interactions with E-Cadherin

and β-Catenin. To further elaborate the functional role of MUC5AC, we developed the KrasG12D;

Pdx1-Cre; Muc5ac-/- mouse model by crossing Muc5ac-/- mice with pancreatic cancer mice

model- KrasG12D; Pdx1-Cre mice. A delay in the onset as well as the progression of pancreatic

cancer was observed in KrasG12D; Pdx1-Cre; Muc5ac-/- mice as compared to the control KrasG12D;

Pdx1-Cre mice.

Further, MUC5AC is not expressed in the normal colon, but it is de novo expressed during early stages and further increases during progression to advanced stages of colorectal malignancy. Despite association of increased MUC5AC levels with conventional and serrated ii

neoplasia pathway of colorectal carcinogenesis, the diagnostic utility of MUC5AC for predicting future colorectal malignancy remained unexploited. Hence, we also explored the diagnostic utility of MUC5AC in conjunction with other differentially expressed mucins and mucin-associated glycans to predict colorectal malignancy. The study findings revealed an improved efficacy of combined MUC2, MUC5AC, and MUC17 expression for differentiating premalignant and/or malignant lesions from benign polyps. Furthermore, we addressed the problem of current non-

availability of specific and sensitive markers to discriminate benign hyperplastic polyps from

sessile serrated and tubular adenomas. We identified a combinatorial panel of mucins and

glycoepitope based molecular markers (CA 19-9/MUC17/MUC5AC) that could discriminate

sessile serrated adenoma/polyps and tubular adenomas from benign hyperplastic polyps with high

sensitivity and specificity.

Overall, our studies demonstrate that MUC5AC plays a key role in onset and progression

of pancreatic cancer. Further, our findings indicate that in conjunction with other differentially

expressed mucins and associated glycans, MUC5AC may significantly improve the early stage

diagnosis of colorectal cancer.

iii

TABLE OF CONTENTS iv

LIST OF FIGURES x

LIST OF TABLES xii

ABBREVIATIONS xiv

ACKNOWLEDGEMENTS xxi iv

TABLE OF CONTENTS

Chapter I: Introduction Pg. No.

A review on MUC5AC: Structure, and role of secretory mucin MUC5AC in benign and

malignant pathologies

1. Introduction 2

2. Genomic organization, domain structure and functions 4

3. Expression and functions of MUC5AC 7

3.1 MUC5AC in physiological conditions 7

3.2 MUC5AC in Benign pathologies 8

3.2.A Allergic Rhinitis 8

3.2.B Chronic Rhinosinusitis 9

3.2.C Otitis media 9

3.2.D Chronic airway diseases 10

3.2.E Barrett’s esophagus 11

3.2.F Helicobacter pylori infections 12

3.2.G Pancreatitis 13

3.2.H Inflammatory bowel disease 13

3.3 MUC5AC and malignant diseases 14

3.3.A Salivary gland carcinomas 15

3.3.B Lung cancer 15

3.3.C Breast cancer 17

3.3.D Gastric cancer 17

3.3.E Gallbladder adenocarcinoma 18

3.3.F Cholangiocarcinoma 19

3.3.G Pancreatic cancer 20 v

3.3.G.a Pancreatic cancer diagnosis 22

3.3.G.b Pancreatic cancer therapy 23

3.3.H Colorectal cancer 24

3.3.I Ovarian cancer 26

3.3.J Cervical cancer 27

3.3.K Prostate cancer 28

3.3.L Urothelial bladder cancer 28

3.3.M Extramammary Paget’s disease 28

3.3.N Pseudomyxoma peritonei 29

4. Functional and mechanistic implications of MUC5AC in cancer 29

5. Muc5ac mice models 31

6. Regulation of MUC5AC expression 35

7. Hypoxia and MUC5AC 36

8. Smoking and MUC5AC 37

9. Conclusions and perspectives 39

References 48

General Hypothesis and objectives 71

Chapter II: Materials and Methods 73

1. Molecular basis of MUC5AC-mediated cell cycle regulation, metastatic properties,

angiogenesis and chemoresistance of pancreatic cancer 74

1.A Immunohistochemistry 74

1.B Cell culture and transfections 75

1.C Immunoblotting 75

1.D Immunofluorescence/Confocal microscopy 76

1.E RNA extraction, RT-PCR, Q-PCR 77 vi

1.F MTT Assay 77

1.G Anchorage independent proliferation assay 78

1.H Apoptosis assay 78

1.I Cell cycle analysis 79

1.J Motility assay 79

1.K Cell adhesion assay 80

1.L Angiogenesis tube formation assay 80

1.M Co-immunoprecipitation 80

1.N Orthotopic implantation 81

1.O Subcellular fractionation 82

1.P Statistical analyses 82

2. Loss of Muc5ac mediated impact on pancreatic cancer progression in KRasG12D; Pdx1-

Cre mouse model 83

2.A Generation of KrasG12D; Pdx1-Cre; Muc5ac-/- mouse model 83

2.B Immunohistochemistry (Mouse tissues) 83

2.C c-DNA isolation and genotyping 84

3. Mucins and associated glycan signatures in colon adenoma-carcinoma sequence:

Prospective pathological implication(s) for early diagnosis of colon cancer 85

3.A Tissue specimens 85

3.B Immunohistochemistry (IHC) 85

3.C Statistical Analysis 86

4. Combinatorial assessment of CA 19-9/MUC17/MUC5AC expression discriminates sessile serrated adenoma/polyps and tubular adenoma from hyperplastic polyps 87

4.A Tissue specimens and patient demographics 87

4.B Immunohistochemistry (IHC) 87 vii

4.C Statistical analysis 88

References 95

Chapter III: Molecular basis of MUC5AC mediated cell cycle regulation, metastatic

properties, angiogenesis and chemoresistance of pancreatic cancer cells 96

1. Synopsis 97

2. Background and rationale 98

3. Results 99

3.A MUC5AC is overexpressed in PC tissues and PC cell lines 99

3.B MUC5AC silencing decreased cell viability, anchorage-independent growth and

induces apoptosis 100

3.C MUC5AC silencing induces G1/S phase cell cycle arrest 101

3.D MUC5AC confers resistance to Gemcitabine in pancreatic cancer cells 101

3.E MUC5AC knockdown reduces cell motility and adhesion to extracellular matrix

proteins 103

3.F MUC5AC exists in a complex with E-Cadherin and β-Catenin 104

3.G Impact of MUC5AC expressing pancreatic cancer cells on endothelial cell viability

and tube formation capacity 105

3.H Inhibition of MUC5AC in pancreatic cancer cells results in decreased tumorigenicity

and metastasis in vivo 106

4. Discussion 106

References 131

Chapter IV: Loss of Muc5ac mediated impact on pancreatic cancer progression in

KRasG12D; Pdx1-Cre mouse model 134

1. Synopsis 135

2. Background and rationale 136 viii

3. Results 137

3.A Breeding strategy and establishment of PDAC mice model with knockout 137

of Muc5ac

3.B Progression of PC in the KrasG12D; Pdx1-Cre; Muc5ac -/- mouse model 137

4. Discussion 139

References 150

Chapter V: Mucins (MUC5AC, MUC2, MUC17) and associated glycans (Tn/STn-MUC1) signatures in colon adenoma-carcinoma sequence: Prospective pathological implication(s) for early diagnosis of colon cancer 153

1. Synopsis 155

2. Background and rationale 156

3. Results 157

3.A Expression of transmembrane mucins 157

3.B Expression of secretory mucins 159

3.C Expression of mucin-associated glycans 160

3.D Multivariate analyses to evaluate biomarker combinations as predictors of

malignancy 162

4. Discussion 163

References 184

Chapter VI: Combinatorial assessment of CA 19-9/MUC17/MUC5AC expression discriminates sessile serrated adenoma/polyp and tubular adenoma from hyperplastic polyps 189

1. Synopsis 190

2. Background and rationale 192

3. Results 193 ix

3.A Expression of mucins and associated glycan expressions in colorectal polyps

Differential expression of mucins and associated glycans among colorectal polyp

subtypes 194

3.B Association of mucins and associated glycan epitopes expression in colorectal polyps

with clinicopathological features 194

3.C Differential expression of mucins and associated glycan epitopes among colorectal

polyp subtypes 195

3.D Mucins and associated glycan epitopes: potential molecular marker(s) for

differentiating colon polyps 196

3.E Combinatorial panels of mucins and associated glycan epitopes for differentiating

colorectal polyp sub-types 197

3.F MUC5AC, MUC17 and CA19.9: a unique biomarker combination for differentiating

polyp subtypes 198

4. Discussion 198

References 219

Chapter VII: Summary and Future directions 223

1. Summary and conclusions 224

2. Future directions 231

References 236

Bibliography of Shiv Ram Krishn 238 x

LIST OF FIGURES

Chapter I Pg. No.

Figure 1.1 Schematic representation of genomic and structural organization of MUC5AC

44

Chapter III

Figure 3.1 Overexpression of secretory mucin MUC5AC in PC tissues and PC cell lines

113-114

Figure 3.2 MUC5AC knockdown decreases cell viability, anchorage independent growth and induces apoptosis 116

Figure 3.3 MUC5AC knockdown induces cell cycle arrest in pancreatic cancer cells 118-119

Figure 3.4 MUC5AC mediated impact on Gemcitabine resistance 122-123

Figure 3.5 MUC5AC mediated impacts on motile properties of pancreatic cancer cells

125-126

Figure 3.6 MUC5AC mediated impact on angiogenesis 128

Figure 3.7 MUC5AC knockdown inhibits in vivo tumorigenicity and reduces metastasis

130

Chapter IV

Figure 4.1 Schematic outline of the breeding strategy adopted for developing the KrasG12D; Pdx1-

Cre; Muc5ac-/- mouse model to investigate the role of Muc5ac during PC progression 143

Figure 4.2 Alterations in the weight and gross histology of pancreas during PC progression in

KrasG12D; Pdx1-Cre; Muc5ac-/- mice model 145

Figure 4.3 Reduced progression of PC in KrasG12D; Pdx1-Cre; Muc5ac-/- mice model 147

Figure 4.4 Muc5ac mediated cellular proliferation enhances PC progression 149 xi

Chapter V

Figure 5.1 Expression analyses of transmembrane mucins (MUC1, MUC4, and MUC17) in colon

disease tissue microarrays 170

Figure 5.2 Expression analyses of secretory mucins (MUC2, MUC5AC, MUC5B and MUC6) in

colon disease tissue array 172

Figure 5.3 Expression analyses of mucin-associated glycans (Tn/STn-MUC1, CA 19-9 and

TAG72 in colon disease tissue array 174

Supplementary Figure 5.1 Heat map for mucin and mucin-associated glycans expression analysis in normal colon, colon inflammation, hyperplastic polyps, adenoma and adenocarcinoma

176

Chapter VI

Figure 6.1 Immunohistochemical expressions of mucins and associated glycan epitopes in

colorectal polyps 207

Figure 6.2 Diagnostic performances of mucins and associated glycan epitopes from univariate

models for discriminating colorectal polyp subtypes 209

Figure 6.3 Diagnostic performances of mucins and associated glycan epitopes in combination for

discriminating colorectal polyp subtypes 211 xii

LIST OF TABLES Pg. No.

Chapter I

Table 1.1: Normal expression of MUC5AC in the human body 45

Table 1.2: Expression of MUC5AC in inflammatory and benign conditions 46

Table 1.3: Expression and associated role of MUC5AC in different malignancies 47

Chapter II

Table 2.1: List of primers used in the study 90

Table 2.2: List of antibodies used in chapter III and chapter IV 91-92

Table 2.3: List of antibodies used in Chapter V and Chapter VI 93

Table 2.4: Demographic and clinicopathological characteristics of patients included in the study

94

Chapter V

Table 5.1: Composite and intensity scores for expression of transmembrane mucins (MUC1,

MUC4, and MUC17) in normal, inflammation, polyp, adenoma and adenocarcinoma tissues of

the colon 177-178

Table 5.2: Composite and intensity scores for expression of secretory mucins (MUC2, MUC5B,

MUC5AC, and MUC6) in tissues corresponding to normal, inflammation, polyp, adenoma and

adenocarcinoma tissues of the colon 179-180

Table 5.3: Composite and intensity scores for expression of mucin-associated glycans (CA 19-9,

TAG72, and Tn/STn on MUC1) in tissues corresponding to normal, inflammation, polyp,

adenoma and adenocarcinoma tissues of the colon 181-182

Table 5.4: Univariate and multivariate analyses: odds of Adenoma/Adenocarcinoma vs.

Hyperplastic polyp 183

Chapter VI xiii

Table 6.1: Expression of mucins and associated glycans (H-Scores) in different colorectal polyp subtypes and corresponding adjacent normal colon 212

Table 6.2: Association of mucins and associated glycans expression with clinicopathological characteristics 213-214

Table 6.3: Univariate logistic regression and ROC curve analysis for mucins and associated glycans as biomarkers to discriminate different colorectal polyps 215-216

Table 6.4: Multivariate logistic regression and ROC curve analysis for mucins and associated glycans as biomarkers to discriminate different colorectal polyps 217

Supplementary Table 6.1: Localization pattern of different mucins and associated glycan epitopes in normal colon and different colorectal polyp subtypes 218

xiv

ABBREVIATIONS

AAH: adenomatous hyperplasia

ACF: aberrant crypt foci

ADCC: antibody dependent cell cytotoxicity

AIP: autoimmune pancreatitis

AKT: v-akt murine thymoma viral oncogene homolog 1

ALI: acute lung injury

ANCC: adjacent normal colon crypt

AP-1: activator protein-1

APC: adenomatous polyposis coli

AR: allergic rhinitis

ATP: adenosine triphosphate

AUC: area under curve

BAC: bronchioloalveolar carcinoma

BE: Barrett’s esophagus

BilIN: biliary intraepithelial neoplasia

BRAF: v-Raf murine sarcoma viral oncogene homolog B

BrdU: bromodeoxyuridine

BTC: biliary tract cancer

CA 19-9: cancer antigen 19-9

CaCC: calcium activate chloride channel

c-AMP: cyclic-adenosine monophosphate

CC: cervical cancer

CCA: cholangiocarcinoma

CD: Crohn’s disease xv

c-DNA: complementary deoxyribose nucleic acid

CF: cystic fibrosis

CI: confidence interval

CIMP: CpG island methylator phenotype

CLC: classical invasive lobular carcinoma

COPD: chronic obstructive pulmonary disease

COX-2: cyclooxygenase-2

CR: clinical remission

CRC: colorectal cancer

CRS: chronic rhinosinusitis

CRSwNP: chronic rhinosinusitis with nasal polyps

CS: cigarette smoke

C-terminal: carboxy-terminal

CS: composite score

DAB: 3:3’-diaminobenzidine

DCC: deleted in colorectal cancer

DNA: deoxyribose nucleic acid

ECRS: eosinophilic chronic rhinosinusitis

EGFR: epidermal growth factor receptor

EI: endoscopic improvement

ELISA: enzyme linked immunosorbent assay

EMPD: extramammary Paget’s disease

EMT: epithelial to mesenchymal transition

ERK: extracellular signal regulated kinase

EUS-FNA: endoscopic ultrasound-guided fine needle aspirations xvi

FAK: focal adhesion kinase

FIT: fecal immunochemical test

FoxA2: forkhead box A2

G and C: guanine and cytosine

GABA: gamma amino butyric acid

GABAAR: gamma-aminobutyric acid type A receptor

GAD67: glutamate decarboxylase 67

GC: gastric cancer

GERD: gastroesophageal reflux disease

GI: gastrointestinal

GMCSF: granulocyte macrophage colony stimulating factor

GNAS: guanine nucleotide binding protein (G Protein) alpha stimulating activity

H&E: hematoxylin and eosin

HPNE: human pancreatic nestin expressing

HPDE: human pancreatic ductal expressing

H. Pylori: helicobacter pylori

H2O2: hydrogen peroxide

H3-K9: histone 3-lysine 9

hCLCA1: human chloride channel accessory 1

HIF1-α: hypoxia inducible factor1-alpha

HLC: histiocytoid carcinoma of the breast

HMOX1: heme oxygenase 1

HNE-TACE: human neutrophil elastase-tumor necrosis factor-α converting enzyme

HP: hyperplastic polyp

HRE: hypoxia response element xvii

H-score: histology score

IBD: inflammatory bowel diseases

ICC-MF: intrahepatic cholangiocarcinoma-mass forming type

IDC: invasive ductal carcinoma

IHC: immunohistochemistry

IL: interleukin

IM: intestinal metaplasia

IPMA: intraductal papillary mucinous adenoma

IPMT: intraductal papillary mucinous tumor

IPN-B: intraductal papillary neoplasm of the bile duct

IRB: institutional review board

IS: intensity score

JNK: c-Jun N-terminal kinase

kb: kilobases

KRAS: Kirsten rat sarcoma viral oncogene

LC: lung cancer

LPS: lipopolysaccharide

LTA: lipoteichoic acid

MAPK: mitogen activated protein kinase

MARCKS: myristoylated alanine-rich protein kinase C substrate

MCN: mucinous cystic neoplasms

MCP-1: monocyte chemoattractant protein-1

MCT: mature cystic teratoma

ME: middle ear

Min: minute xviii

MiR: microRNA

MKP-1: mitogen activated protein kinase phosphatase-1

MLH1: MutL homolog 1

MMP-3: matrix metalloprotease-3

mRNA: messenger RNA

mSDC: mucin rich variant of salivary duct carcinoma

MSI-H: microsatellite instability-high

MSI-L: microsatellite instability-low

MUC: mucin

NF-κB: nuclear factor κB

NP: nano particle

NSCLC: non-small cell lung carcinoma

N-terminal: amino-terminal

OC: ovarian cancer

OM: otitis media

OME: otitis media with effusion

OMT: ovarian mucinous tumors

OR: odds ratio

OVA: ovalbumin

PanIN: pancreatic intraepithelial neoplasia

PC: pancreatic cancer

PCa: prostate cancer

PDAC: pancreatic ductal adenocarcinoma

PDG: pancreatic duct glands

PI3K: phosphoinositide 3-kinase xix

PKA: protein kinase A

PKC: protein kinase C

PLA: proximity ligation assay

PLC: phosphoinositide phospholipase C

PMP: pseudomyxoma peritonei

PPAR-γ: peroxisome proliferator-activated receptor

PTEN: phosphatase and tensin homolog

PTS: proline, threonine, serine

ROC: receiver operating curve

RVA: rectosigmoid villous adenoma

SACL: small adenocarcinoma of the lung

SN: sensitivity

SNARE: soluble NSF attachment protein receptor

SOX2: SRY (sex determining region Y) box 2

SP: specificity

SP-1: specificity protein-1

SPDEF: SAM pointed domain containing ETS transcription factor

SRCA: signet ring cell adenocarcinoma

SSA/P: sessile serrated adenoma/polyp

TA: tubular adenoma

TF: tear film

Tg: transgenic

TGF- α: transforming growth factor-α

TMEM16A: transmembrane protein 16A

TNF-α: tumor necrosis factor-α xx

TPM: total particulate matter

TRAIL: tumor necrosis factor related apoptosis-inducing ligand

TRPV1: transient receptor potential vanilloid subtype 1

TRR: tandem repeat region

TSA: traditional serrated adenoma

TTF-1: thyroid transcription factor-1

UBC: urothelial bladder carcinoma

UC: ulcerative colitis

UDP: uridine diphosphate

UTR: untranslated region

VEGF: vascular endothelial growth factor

VEGFR1: vascular endothelial growth factor receptor 1

VILI: ventilator induce lung injury

VIP: vasoactive intestinal peptide

vWF: von Willebrand factor

WHO: world health organization

WT: wild type xxi

ACKNOWLEDGEMENTS

To begin with, I am grateful in my prayers to the almighty God, for all the blessings and instincts bestowed upon me during these years to accomplish this work.

It is impossible to dream of this journey without the enduring support, guidance, teaching, and encouragement from my mentor, Dr. Surinder K. Batra. He is and will remain a positive influence and an inspiration for the rest of my life. I am extremely thankful to him for constant encouragement to think independently, for the freedom that he gave to explore different scientific ideas, and for all the opportunities provided to me. He groomed me to be a sound professional and it was a lifetime experience to work under his mentorship. I will forever be indebted to him.

I would also like to extend my sincere thanks towards my supervisory committee members namely Dr. Michael A. Hollingsworth, Dr. Vimla Band, Dr. Parmender P. Mehta, Dr.

Chittibabu Guda, and Dr. Maneesh Jain for their suggestions, positive feedback, guidance and encouragement throughout my graduate program. I am thankful to the members of my comprehensive examination committee, Dr. Steve Caplan, Dr. Justin Mott, and Dr. Carol Casey for their inputs on scientific writing and grantsmanship.

I extend my special thanks to Dr. Sukhwinder Kaur for all her advice, discussions, criticisms, and support that helped me in completing these projects. I am also thankful to Dr.

Satyanarayana Rachagani for helping me with most of the animal work which I have carried out in this dissertation.

During the course of my Ph.D., I have had the unique opportunity to be part of some of the life changing moments of my past and present colleagues, memories that I will always cherish. I would like to thank all the past and present members of the Batra lab, specifically Dr.

Moorthy Ponnusamy, Dr. Sushil Kumar, Dr. Parthasarathy Seshacharyulu, Dr. Imayavaramban

Lakshmanan, Dr. Muzafar Macha, Dr. Prakash Kshirsagar, Dr. Shailendra K. Gautam, Dr. Asish xxii

Patel, and Dr. Parama Dey, Dr. Navneet Momi for all the scientific discussions, technical assistance, sharing resources and most importantly friendship which has made this journey a fun filled experience.

I would like to acknowledge and thank Dr. Christopher Evans from Colorado University for providing us with the Muc5ac-/- mice.

I would also like to thank the past and present faculty members and students in the

Department of Biochemistry and Molecular biology. I extend my special thanks to the members of administrative staff Jennifer Pace, Sue Klima, Amy Dodson, Jeanette Gardner, Karen Hankins and Coleen for all the support they have provided during my graduate training. I thank all the members of UNMC core facilities such as FACS facility, confocal facility, DNA sequencing core, and tissue science facility.

Finally, I would like to thank my family for their unconditional support and love in this journey together.

1

Chapter I

Review on MUC5AC

Secretory mucin MUC5AC: molecular analysis, functional, diagnostic, prognostic and therapeutic implications in benign

and malignant diseases

2

1. Introduction

Mucins are a family of large glycoproteins expressed by various epithelial cell types (ducts of

lacrimal glands and eye, salivary glands, the lining of the respiratory, gastrointestinal, urothelial

and reproductive tracts) [1]. All mucins are characterized by the presence of tandem repeat regions (TRR), with a high proportion of proline, threonine and serine residues (called PTS sequences). Mucin genes display high levels of polymorphisms, owing to the variable number of tandem repeats [1]. The serine and threonine residues in the TRR are extensively O-glycosylated that is post-translationally modified, as per the distinct requirements of the epithelia [2]. Mucins have complex biophysical properties owing to the large mass, glycosylations and high ordered structures due to polymerization. Mucins are known to play a central role in the physicochemical protection of the epithelial cell surfaces, configure and maintain the local microenvironment and promote cell survival by impacting overall homeostasis in adverse physiological and pathological conditions [2, 3]. Deregulated mucins function as an important link between inflammation and cancer [4]. In response to external stimuli, mucins communicate signals through multiple domains present in their structure, resulting in coordinated cellular responses that include proliferation,

differentiation, apoptosis, altered cell adhesion and secretion of specialized cellular products [5].

Also, mucin-type oligosaccharides are involved in specific ligand–receptor interactions, confer

hygroscopic properties, might bind various small molecules, proteins and provide stoichiometric

amplification owing to high degree of multivalency for oligosaccharide structures [3].

Importantly, the deregulated expression of mucins and the enzymes that modify them, differential glycosylation, and altered localization implicate in different pathologies including various functional properties of tumor and its microenvironment [4].

To date, 21 different mucin family members have been identified. These have both unique and shared structural features and are classified into two subfamilies-the transmembrane mucins and secreted mucins [1]. Transmembrane mucins (MUC1, MUC3A/B, MUC4, MUC11– 3

13, MUC15–17, MUC20, and MUC21) have hydrophobic plasma membrane spanning domain

and short cytoplasmic tails that associate with proteins in different cellular compartments to

participate in signal transduction [6]. Secreted mucins include gel-forming (MUC2, MUC5AC,

MUC5B, MUC6, and MUC19) and non-gel forming (MUC7) mucins. The gel-forming mucins form a physical barrier as a mucous gel, providing protection to epithelial surfaces of respiratory,

gastrointestinal tracts and ducts lining organs such as liver, breast, pancreas, and kidney [7]. As a

part of defense mechanism to maintain the integrity of epithelial surfaces, secretory mucins are

considered to appear early in metazoan evolution followed by transmembrane mucins [4].

Among gel forming secretory mucins, the MUC6, MUC2, MUC5AC and MUC5B genes evolved from duplication of an MUC11p15 ancestor [8]. For the first time, MUC5AC was

identified as a tracheobronchial mucin gene MUC5 localized to chromosome 11p15 [9, 10].

Numerous genetic clones were then described and thought to encode unique mucins MUC5A,

MUC5B, and MUC5C. However, it was subsequently demonstrated that MUC5A and MUC5C

were identical, and therefore, it was designated to be MUC5AC [11]. Since then, different studies

indicated that polymeric gel forming secretory mucin MUC5AC is expressed in conjunctiva,

middle ear, nasopharynx, lungs, gall bladder and stomach providing protection to respective

epithelial surfaces from different factors under physiological and pathological conditions (Table

1) [12, 13]. In the past decade, the aberrant expression of MUC5AC has extensively been studied

and reported in various benign pathologies (Table 2). These include otitis media [14], chronic

rhinosinusitis [15], chronic obstructive pulmonary diseases [16], Helicobacter pylori infections

[17], inflammatory bowel diseases [18] and pancreatitis [19]. Besides this, evidence from multiple investigations has concluded that alterations in expression, synthesis and secretion of

MUC5AC may have a significant association with the pathogenesis of cancers (Table 3). These include lung cancer (LC) [20], gastric cancer (GC) [21], pancreatic cancer (PC) [22], cholangiocarcinoma (CCA) [23, 24] and colorectal cancer (CRC) [25]. In a quest to alleviate the 4

pathological implications associated with altered expression of MUC5AC in different

pathologies, multiple investigations have focused on the elucidation of factors associated with

regulation of MUC5AC. Studies regarding the impact of different therapeutics targeting these

regulators on the expression of MUC5AC coupled with overall implications on disease

progression have also been conducted [26]. However, lack of mechanistic insights associated with

exact functions of MUC5AC remained inconclusive which have hindered the progress of

successful therapeutic interventions against these pathologies.

This Review, for the first time, provides a comprehensive and updated overview of the genomic organization, structure, expression, regulation, and functional significance of secretory mucin MUC5AC in physiological conditions, as well as during development and progression of different pathologies including malignant conditions. Importantly, it highlights the diagnostic utility and possible implications associated with direct/indirect therapeutic targeting of MUC5AC expression in various pathologies including cancers. Overall, to develop useful therapeutic modalities against different pathologies, a thorough understanding of the role of MUC5AC in diverse contexts necessitates extensive investigations.

2. Genomic organization and domain structure and functions

The cloning of mucin genes and the characterization of their structure and sequence have

presented significant challenges owing to their extended regions of repeated sequence (rich in

nucleotides G and C) and the similarity of the genes [27, 28]. Polymeric gel forming secretory

mucins share a similar gene structure composed of a large central exon and flanking 5’ and 3’

regions [28]. The gel-forming mucin, MUC5AC is a huge multidomain molecule made up of

thousands of amino acid residues; heavily O-glycosylated apoprotein cores; and cysteine-rich N-

and C- terminal domains that permit disulfide-bond mediated oligomerization [29]. MUC5AC

gene is located within a single 400-kb genomic DNA segment in the subtelomeric, 5

recombination-rich region on chromosome 11p15.5, clustered with four other mucin genes in a

sequence MUC6-MUC2-MUC5AC-MUC5B from telomere to centromere (Figure 1.1) [30].

The completely annotated MUC5AC cDNA sequence (~17.5 kb)

(http://www.ncbi.nlm.nih.gov/nuccore/748983075) consists of total 49 exons. The location and sequences of the intron-exon boundaries, intron-exon sizes, and splice junction sequences have previously been elucidated and were recently updated [30]. The ~17.5 kb c-DNA of MUC5AC, encodes a protein of ~5654 residues. The 5’-region of MUC5AC is composed of 30 exons that encode cysteine-rich domains- D1, D2, D’, and D3 (similar to structural domains within von

Willebrand factor (vWF)), and a short domain corresponding to the MUC11p15-type described by Desseyn et al. [31, 32]. The 5’-region also contains a potential 19 amino acid signal sequence and also consists of seven potential N-glycosylation sites [33]. It has been reported that CGLC motifs in 5’-region D-domains of MUC5AC may function in disulfide-linked multimer formation

[31]. Interestingly, the presence of a putative leucine zipper repeat pattern (between residues 273 and 300) in D1-domain of MUC5AC has also been reported. It has been speculated that leucine- zipper motif may be involved in non-covalent homo-oligomerization and multimerization via the

N-termini of MUC5AC dimers [33]. Overall, N-terminus domains form inter- and intra-chain disulfide bonds resulting in assembly of MUC5AC as multimers. Further, the large central exon

(exon 31, ~10.5 kb) in MUC5AC, encompass proline, threonine, and serine-rich tandem repeats

(PTS-TR) and cysteine-rich CysD domains. The four tandem repeat regions (PTS-TR1-TR4) in

MUC5AC consists of 24 nucleotides repeated units that translate into eight-amino acid repeats rich in proline, threonine, and serine. Although the consensus repeat sequence- TTSTTSAP is observed more frequently, other motifs such as GTTPSPVP are also frequently observed [31]. It has been demonstrated that the four TR regions are interspersed by a total of nine CysD domains recently classified as Class-I, Class-II, and Class-III domains [30]. Each of these CysD domains contains ten cysteine residues per 110 amino acids [31]. One putative C-mannosylation consensus 6

sequence is observed in the amino-terminal region of Cys-subdomain [27]. Interestingly, it has

been demonstrated that different individuals may have an extra number of CysD domains in their

central region due to segmental duplications resulting in MUC5AC structural variants [30]. The

TR domains of secretory mucin MUC5AC are known to be heavily O-glycosylated, coupled with

variable levels of sialylation and sulfation. Glycosylation leads to conformational changes and

stiffens the mucin polypeptide resulting in increased volume and formation of the mucin gel

network within mucus. It may also impact the passage of mucin macromolecules through the

secretory pathway along with packaging within secretory granules. Mucin oligosaccharides are

highly heterogeneous. For given mucins and tissues, they vary between species, and within

species, they vary even within tissues. It has been suggested that this structural diversity may

have evolved to cope with diverse and rapidly changing pathogens and other ligands in the

external environment. Further, the 3’ region of MUC5AC is composed of 18 exons, the last one

containing the 3’-untranslated region (UTR). The C-terminus exons encode MUC11p15-type subdomain, A3uD4 subdomain, and cysteine-rich vWF-like domains (D4, B, C, and CK) [34].

Also, it has been reported that C-terminal cysteine-rich part of MUC5AC contains a GDPH (Gly-

Asp-Pro-His) sequence [35]. Interestingly, it has been demonstrated that MUC5AC is cleaved in

its GDPH sequence in the endoplasmic reticulum at a neutral pH, and this process of cleavage is

accelerated by a lower pH [35]. However, the exact biological implications of this cleavage are

still obscure necessitating further investigations. Interestingly, it has been demonstrated that the

C-terminus domains play a major role in MUC5AC dimerization. Studies have also shown that C-

terminal dimerization in endoplasmic reticulum precedes the N-terminal multimerization in Golgi

complex.

It is very likely that other, as-yet-undescribed functionalities reside in these domains; in

particular, these domains may be sites of interaction with other components of mucus that are

essential for barrier organization or innate defense. 7

3. Expression and functions of MUC5AC

3.1 MUC5AC in physiological conditions

The secretory mucin MUC5AC is synthesized under physiological conditions by various epithelial cell surfaces. By forming a polymeric gel, MUC5AC acts as a physicochemical barrier against multiple environmental toxins, allergens, and infectious pathogens forming the first line of defense [12]. In humans, expression of MUC5AC has been reported in the conjunctiva [36], eustachian tube [37] and middle ear epithelium [38], lungs, stomach, gall bladder, and endocervix

[13]. At the ocular surface, the conjunctival goblet cell–derived secretory mucin MUC5AC acts as a component of the tear fluid providing lubrication as well as maintaining hydration of the epithelial surface [39]. The MUC5AC multimeric networks are assumed to trap and clean the debris and pathogens, and to remove the material from the surface of the epithelium [36]. Further,

MUC5AC may also hold eye fluids in place and harbor defense molecules secreted by the lacrimal gland [39]. As a major secretory mucin of the middle ear epithelium, MUC5AC plays a major role in mucosal protection from pathogen invasion, pathogen-mediated damage and their clearance [40]. Importantly, MUC5AC is one of the major airway mucins where it is expressed by the goblet cells [12]. In airways, MUC5AC has been assumed to play a role in mucociliary clearance and contribute to the innate mucosal defense system. However, to date, the exact mechanisms behind these functions are poorly understood [12]. Further, a higher level of

MUC5AC mRNA expression was detected in the stomach at 23 weeks of gestation [41]. Also, in adults MUC5AC remained the major gel-forming mucin consistently transcribed and expressed in both superficial foveolar epithelium of fundic and pyloric regions of the stomach [42]. As a component of the mucus layer covering the gastric mucosa, MUC5AC functions to protect gastric tissues, from the hazardous gastric environment and multiple infectious agents [43, 44].

Expression of MUC5AC by endocervix epithelium has also been demonstrated, however, exact roles it plays during the reproductive process are not known [45]. Frequent expression of 8

MUC5AC has also been shown in the gallbladder [46]. Interestingly, it has been demonstrated that MUC5AC is secreted in bile [47]. Besides all these, a moderate signal of MUC5AC mRNA was detected in primitive intestine both on villi and in crypts at eight weeks of gestation with its inconsistent levels after that. Further, at 12 weeks, MUC5AC mRNAs were observed in the ileum, but not in the colon with no expression of MUC5AC detected in any region of the intestine after 12 weeks [48]. Interestingly, MUC5AC is never detected in adult bowel unless early stages of neoplasia develop [49]. Also, expression of MUC5AC protein had been observed early in embryonic epidermis from day 13 of gestation until seven days after birth, when the surface epidermis became negative, and the reaction restricts to secreting sebum cells [50].

3.2 MUC5AC in Benign pathologies

3.2.A Allergic Rhinitis

Allergic rhinitis (AR) is a chronic inflammatory upper airway disease that results from an immunoglobulin E-mediated allergy associated with nasal inflammation. It negatively impacts patient’s quality of life due to sneezing, rhinorrhea and stuffy nose [51]. The precise pathogenesis of AR remains uncertain. However, it is suggested that it involves goblet cell hyperplasia, mast cell infiltration and lymphocytes disorders [51]. One of the key features of AR is airway inflammation and mucus hypersecretion. Weak to the diffuse expression of MUC5AC in nasopharyngeal mucosa has previously been reported. However, MUC5AC is highly expressed during AR, causing airway obstruction and infection [52]. Different studies have focused on understanding the mechanisms of MUC5AC regulation that may lead to new therapies for the treatment of aberrant mucus production in AR. It has been reported that MUC5AC upregulation during AR may be mediated by upregulation of calcium-activated chloride channel (hCLCA1)

[53, 54], activation of p38MAPK/COX-2 [55], TNF-α and IL-6 mediated NF-κB activation [56], upregulation of IL-17A [57], and upregulation of IL-31 and IL-31RA [58, 59]. These studies 9

provide insight into the pathophysiology and potential targets for the pharmacotherapeutic

prevention and treatment of AR.

3.2.B Chronic Rhinosinusitis

Chronic rhinosinusitis (CRS) defines a group of disorders characterized by persistent

inflammation of the sinonasal tract. It is associated with goblet cell and submucosal gland cell

hyperplasia resulting in mucus production and hypersecretion and defective mucociliary

clearance [60]. The secretory mucin MUC5AC mRNA and protein levels were observed to be

significantly increased and localized to goblet cells of the epithelium in chronic rhinosinusitis

compared with those in normal sinus mucosa [60-62]. These results suggest that up-regulation of

MUC5AC may play important roles in the pathogenesis of sinus hypersecretion in chronic

rhinosinusitis. About primary mechanisms leading to MUC5AC upregulation during CRS, the

synergism of highly upregulated TGF-α with TNF-α through ERK signaling pathway [63],

human neutrophil elastase-tumor necrosis factor-α converting enzyme (HNE-TACE) signaling

pathway [15], and IL-13 mediated goblet cell hyperplasia [64] have been demonstrated. Another

study demonstrated the utility of inhibiting calcium-activated chloride channel named

transmembrane protein 16A (TMEM16A) in chronic rhinosinusitis with nasal polyps (CRSwNP)

as it plays a significant role in increased secretion of MUC5AC during this disease [65]. Further,

Ono et al. in their study concluded that increased expression of MUC5AC could play an

important role in the pathogenesis of eosinophilic chronic rhinosinusitis (ECRS). They assumed

that persistent airway inflammation characterized by infiltrating macrophages, neutrophils, and

their promotive factors, might have an association with increased MUC5AC levels [66].

3.2.C Otitis media

Mucins are important in the mucociliary transport system of the middle ear [67] and Eustachian tube [38]. Mucin overproduction is a hallmark of otitis media (OM). The uncontrolled, excessive

mucus contributes significantly to conductive hearing loss [14]. As a primary innate defense 10

mechanism for the middle ear (ME) epithelium, the secretory mucin MUC5AC is known to play

an important role in the mucociliary clearance of bacterial pathogens [68]. Further, during periods

of inflammation and goblet cell stimulation in patients with otitis media with effusion (OME)

expression of MUC5AC is significantly increased [40]. Also, the post-transcriptionally modified

longer length of MUC5AC mucin also results in the higher viscosity of mucin, leading to

abnormal mucociliary clearance, middle ear fluid stasis and ultimately chronic disease condition

[68]. Not only the properties of post-transcriptionally modified MUC5AC deserve further study

but also the impact of this polymorphism on specific pathogen-host interactions should be

explored. Further, a thorough exploration of factors affecting MUC5AC expression will provide

opportunities to develop novel interventions for the extremely common problem of OM. In this

regard, Moon et al. identified Retinoic acid and hydrocortisone as inducers of MUC5AC and

Triiodothyronine as a suppressor of its expression [69]. Besides this, Escherichia coli

lipopolysaccharides (LPS) endotoxin has also been shown to upregulate the expression of

MUC5AC mRNA during experimental OME in the rat [70]. Further, phosphodiesterase 4B

(PDE4B) mediates ERK-dependent up-regulation of mucin MUC5AC by Streptococcus

pneumoniae by inhibiting cAMP-PKA-dependent MKP-1 pathway [71]. Also, cigarette smoke increases the expression of MUC5AC mRNAs and proteins via EGFR pathway which plays a major role in OME [72].

3.2.D Chronic airway diseases

Chronic airway diseases, such as asthma, cystic fibrosis (CF), and chronic obstructive pulmonary

disease (COPD) are associated with mucous cell metaplasia, resulting in mucus hypersecretory

phenotype [29]. Mucus hypersecretion involves increased expression, production, and release of

mucins [73]. Induction of mucous metaplasia acts as the first line of defense to clear the airway of

toxic substances and cellular debris [12]. However, under chronic conditions the persistent

mucous metaplasia results in obstruction of airways contributing significantly to morbidity and 11

mortality. Baseline levels of gel-forming mucins MUC5AC and MUC5B in the airways are

believed to contribute to the protective barrier function, rheology of airway mucus and perform

the homeostatic roles. MUC5AC has been shown to be the goblet cell mucin and widely used as a

marker for goblet cell metaplasia [74]. It is consistently reported to be induced and upregulated

during airway inflammation in humans and animals [75]. A marked increase in MUC5AC mRNA and protein expression has been observed in goblet cells of the bronchiolar epithelium of asthmatic patients, and patients with COPD when compared to non-diseased airways.

Confounding reports have been published about the expression of MUC5AC in the CF sputum.

Studies indicate that MUC5AC expression is elevated in CF sputum [76], especially following exacerbations [77]. However, some recent studies show that MUC5AC and MUC5B mucins are

present in lower concentrations in CF sputum [78] thus highlighting the challenges inherent in

analyzing CF lung sputum. Interestingly, a significant association of a 6.4-kb variable number tandem repeat region in the MUC5AC gene has been demonstrated with the severity of CF lung disease. This suggests that MUC5AC polymeric mucin gene may be a genetic modifier for CF

lung disease [79]. The past decade has seen significant advances in the understanding of the

pathways associated with regulation of secretory mucin MUC5AC, its production, and synthesis

in the context of airway diseases [73, 80]. These advances have partially answered the questions regarding its role in chronic lung diseases, and benefits associated with its inhibition. By blocking mucus in exacerbations of asthma and COPD may affect morbidity, thus necessitating a focus on inhibition of mucus and MUC5AC in particular as a therapy for chronic airway diseases.

3.2.E Barrett’s esophagus

Barrett's esophagus (BE) is a premalignant condition consisting of mucosa with a metaplastic columnar epithelium [81]. It is associated with gastroesophageal reflux disease (GERD) in which acid, pepsin, and other noxious materials reach the esophageal mucosa and interacts with the luminal aspect of the squamous epithelium [81]. The esophagus under physiological conditions 12

has a protective barrier of the surface-adherent mucus gel barrier. However, expression of mucins

is substantially altered in GERD patients [82]. Among mucins, the secretory mucin MUC5AC is

absent from normal squamous epithelium, while it was ectopically expressed in 100% of Barrett’s

esophagus specimens [82]. It has been demonstrated that MUC5AC expression and secretion during Barrett’s esophagus can be attributed to the conjugated bile acids present in the refluxate

[83]. Functionally, it is assumed that MUC5AC may play a major role in the protection of the

esophageal mucosa against potential damage caused by acids, pepsin, and bile acids present in the

refluxate. Mechanistically, conjugated bile acids transcriptionally induce MUC5AC via activation

of the PI3K–AKT–AP1 pathway [83]. Interestingly, during progression from Barrett’s epithelium

to dysplasia and adenocarcinoma, expression of MUC5AC is significantly decreased [84].

Among the two pathways [adenomatous (type-1) and non-adenomatous (type-2 or

foveolar/hyperplastic type)] speculated for progression of Barrett mucosa through dysplasia to

adenocarcinoma, MUC5AC was more commonly expressed in patients with foveolar-type

dysplasia [85].

3.2.F Helicobacter pylori infections

Helicobacter pylori (H. pylori) are the gram-negative bacterium that colonizes the gastric mucosa

to induce chronic inflammation and intestinal metaplasia (IM) through genetic and epigenetic

changes. Resultant activation of intracellular signaling pathways contributes to gastritis, peptic

ulcers and gastric carcinogenesis [86]. The main mucin that protects the gastric surface epithelium is MUC5AC. H. pylori colonize to the gastric mucosa by its adhesion via BabA and

SabA adhesins to the blood group antigens LeB and Sialyl LeX present on gastric mucin

MUC5AC [87]. Investigations regarding the relationship between H. pylori and altered mucin

expression in gastric mucosa demonstrated that number of MUC5AC expressing cells and its

staining intensity is significantly decreased in H. pylori positive patients [17, 88, 89]. Besides,

MUC5AC expression is significantly reduced in H. pylori infected GC cases compared to non- 13

infected cases [90] suggesting that the reduction of the MUC5AC might be related to gastric carcinogenesis caused by H. pylori and the progression of GC [91]. It has been reported that H. pylori infection may decrease MUC5AC expression via inhibition of key enzyme of mucin synthesis- UDP-galactosyltransferase [92]. Interestingly, a decrease in MUC5AC expression impairs the gastric mucosal barrier, facilitating H. pylori swimming and attaching the epithelium, and contribute to the mucosal injury [17].

3.2.G Pancreatitis

Pancreatitis is inflammation of the pancreas that may progress to necrosis of the pancreas or surrounding fatty tissue. The two main types include acute and chronic pancreatitis [93].

Regarding expression, MUC5AC transcripts were observed to be undetectable in all the cell types of the normal exocrine pancreas and low in obstructive chronic pancreatitis cases adjacent to cancer [94]. In a case of autoimmune pancreatitis (AIP), the atypical cells were tested positive for the MUC5AC overexpression [95]. Guppy et al. highlighted strongest expression of MUC5AC in pancreatitis [96]. Despite the availability of information regarding MUC5AC expression during pancreatitis, the paucity of information regarding its role in pathogenesis warrants further investigation. It has been recently described that conditions of diabetes and chronic pancreatitis result in the formation of pancreatic duct glands (PDGs)- a new compartment of the major pancreatic ducts in humans and mice [97]. Utilizing mice model of diabetes and pancreatitis, it was demonstrated that production of tumor marker Muc5ac is induced in these PDGs along with enhanced BrdU incorporation. It was suggested that pancreatic tumors might originate from these

PDGs, underscoring these structures to be potential targets for PC therapy [97].

3.2.H Inflammatory bowel disease

Ulcerative colitis (UC) and Crohn’s disease (CD) are the two major forms of inflammatory bowel diseases (IBD). Dysfunctional mucus barrier due to changes in mucin secretion implicated by host immune, microbial, genetic or environmental factors is now considered critical to the 14

pathogenesis of IBD [98]. In this context, increased expression of secretory mucin MUC5AC in the ileum of patients with Crohn’s disease (CD) compared to no expression in healthy ileal mucosa has been reported with assumptions that MUC5AC may play a critical role in mucosal protection and wound healing during IBD [99]. In other studies, M1/MUC5AC mucin was detected in the mucus of 70-100% UC cases and was significantly associated with inflammatory activity and goblet cell depletion [100, 101]. Contradicting previous assumptions regarding the role of increased MUC5AC expression in mucosal protection and wound healing during IBD, one study demonstrated a significant association of decrease in MUC5AC expression with endoscopic improvement (EI) and pathologic remission of UC [102]. Further, clinical remission (CR) and EI

were associated with loss of MUC5AC in MUC5AC positive CD patients undergoing

adalimumab therapy suggesting the prospective utility of determining MUC5AC expression in

intestines of CD patients after therapy, as a predictive marker of the flare up and EI [18]. About

mechanisms associated with upregulation of MUC5AC during IBD, one study on Shigella

infection-associated acute IBD, highlighted TNF-α, PKC and ERK1/2 mediated increased

MUC5AC expression thus suggesting the potential therapeutic targets for IBD [103]. Looking at

the availability of only correlative studies regarding the association of MUC5AC with IBD, more

investigations are necessitated to functionally and mechanistically characterize this molecule in

IBD. This will be critical in deciding the appropriate therapeutic approaches against IBD.

3.3 MUC5AC and malignant diseases

Expression of secretory mucin MUC5AC is deregulated in different disease conditions as reviewed above. Also, altered expression levels of MUC5AC have been extensively reported in various malignant conditions. Few studies conducted to functionally characterize this mucin in gastric cancer [21], pancreatic cancer [22], and lung cancer [20] indicate both tumor suppressive as well as oncogenic roles of this mucin, suggesting its context-dependent functions. The mechanistic basis of these functions is still obscure. Here, we have reviewed the available 15

information regarding expression, and any specific roles played by MUC5AC in different

malignant conditions.

3.3.A Salivary gland carcinomas

Immunoreactivity for MUC5AC is poorly detected in excretory ducts of normal salivary glands.

However, their expression has been reported in salivary gland tumors. Immunoreactivity of

MUC5AC was observed in differentiated glandular cells in 73% of mucoepidermoid carcinomas

[104]. The diagnostic utility of MUC5AC as a marker to differentiate different salivary gland

carcinomas types has also been suggested. The combination of MUC3-/MUC5AC+/MUC6-;

MUC3+/MUC5AC-/MUC6-; and MUC3-/MUC5AC-/MUC6- suggested the diagnosis of mucoepidermoid carcinomas, acinic cell adenocarcinoma, and adenoid cystic carcinoma

respectively [105]. In a series of salivary mucoepidermoid carcinomas, it was further shown that

MUC5AC staining can be used to distinguish high-grade mucoepidermoid carcinoma from

squamous cell carcinoma. Additionally, MUC5AC was significantly associated with tumor-

associated lymphoid infiltrates (P<0.05) [106]. In a case of Cystadenoma (a relatively rare benign

epithelial tumor of the salivary glands), the absence of MUC2, MUC5B and MUC5AC along

with expression of MUC1, MUC4 and MUC6 was reported [107]. The mucin-rich variant of

salivary duct carcinoma (mSDC) is highly aggressive and is extremely rare. Interestingly, in a

case of salivary mSDC showing predominantly signet-ring cell features, the signet ring cells were found immunopositive for MUC5AC [108].

3.3.B Lung cancer

Variable expression pattern of MUC5AC has been observed in bronchial epithelium from normal

individuals. MUC5AC is expressed in goblet cells in the normal respiratory mucosa. Earliest

studies reported a reduced expression of MUC5AC in non-small cell carcinomas, regardless of

their histologic subtype [109]. In contrast to these, expression of MUC5AC was shown to be the

most intense in mucinous-type bronchoalveolar carcinomas [110]. In a study conducted to 16

evaluate the expression of the secretory mucins (MUC2, MUC5AC, and MUC6) in 79 surgical

specimens of small adenocarcinoma of the lung (SACL) cases, 7.6% SACL cases showed

MUC5AC expression. No significant correlation was observed between MUC5AC expression

and nodal involvement in SACL [111]. In a study of the progression from adenomatous

hyperplasia (AAH) to adenocarcinoma with mixed subtypes (MX), a significant increase in the

expression of MUC5AC correlated significantly with p53 gene abnormalities, suggesting that the

expression of MUC5AC might be associated with the progression of adenocarcinoma of the lung

[112]. Also, overexpression of MUC5AC gene was significantly associated with postoperative

relapse and lung cancer metastases [113]. In non-small cell lung carcinoma (NSCLC) samples,

expression of MUC5AC was detected in 27% samples with EGFR mutations and 30% samples with wild-type EGFR. However, regardless of EGFR mutation status, expression of MUC5AC in

NSCLC was not associated with overall and relapse-free survival [114]. As NSCLC bearing

sialomucin expression tended to relapse earlier than those without sialomucin [115], hence, Yu et

al. investigated whether the expression of sialomucin in LC is caused by an abnormal glycosylation process or by the expression of a specific mucin gene product. Interestingly, the significantly higher amount of MUC5AC gene expression in adenocarcinomas positively correlated with the expression status of sialomucin (P=0.012) [116]. Further, studies conducted to

test the hypothesis that sialomucin on MUC5AC may contribute to increased metastasis of LC

cells revealed that the patients bearing co-expression of MUC5AC and sLe(x) in tumors had a higher probability of post-operative distant metastasis, and shorter overall survival [117]. Also,

overexpression of secretory mucin MUC5AC in lung tumors of smokers has been associated with

increased probability of postoperative recurrence [113]. Interestingly, investigation of the

reversible and irreversible expression changes in lung epithelium upon smoking cessation

indicated that only partial reversal of MUC5AC on cessation of smoking may account for the

persistent lung cancer risk and/or progression to LC [118]. 17

3.3.C Breast cancer

Secretory mucin MUC5AC is not expressed in normal breast tissues [119], and ductal hyperplasia

of the breast without atypia [120]. However, its immunoreactivity was observed in 5% of signet-

ring cell carcinoma [121], 4-7% invasive carcinoma [120, 122, 123], and 12% of mucinous

carcinoma [123] cases. Interestingly, all invasive carcinomas expressing MUC5AC were

observed to be positive for MUC1 [120]. Additionally, in a study of 1447 cases of invasive breast

carcinoma with a long-term follow-up, 37% of cases expressed MUC5AC with no association with patient outcome [124]. Further, a study conducted to differentiate clinicopathological profiles of histiocytoid carcinoma of the breast (HLC) and classical invasive lobular carcinoma

(CLC), demonstrated MUC5AC expression in 50% of HLC cases compared to none in CLC.

Importantly, the presence of MUC2 and MUC5AC in HLC was significantly associated with shorter disease-free survival time than lobular carcinomas without the expressions of MUC2 and

MUC5AC (p=0.0055 and p=0.0060) [125]. In another study conducted to compare expression of

MUC5AC between the mismatch repair-deficient and mismatch repair-proficient breast cancers revealed no significant difference [126]. About mechanisms associated with expression of

MUC5AC in breast cancer cells, MUC5AC expression was correlated with DNA methylation pattern in breast cancer cell lines. While the promoter of MUC5AC negative cells (MDA-MB-

453) were methylated in the distal region (-3718 to -3670), the MUC5AC positive cells (MCF-7) had low methylation levels. The histone H3-K9 modification was also closely related to

MUC5AC expression [127].

3.3.D Gastric cancer

The normal adult stomach is characterized by strong expression of MUC5AC in the foveolar epithelium [128, 129]. However, the expression rate of MUC5AC is decreased with the loss of tumor differentiation, an increase in the tumor invasion depth, and with an increase in the number of metastatic lymph nodes [128]. An overall reduction in expression of MUC5AC in GC has been 18

reported, with 38-42% of gastric carcinomas expressing MUC5AC [130-132]. Reduction of

MUC5AC immunoreactivity reflects the significant reduction of gastric differentiation, represents

a marker of worse survival probability in GC, and a high-risk subgroup of pTNM stage-I patients

[133]. Interestingly, MUC5AC expression was inversely associated with tumor stage, depth of invasion, lymphovascular invasion, lymph node and liver metastasis [21, 131, 134]. The patients with MUC1+/MUC5AC- antigen staining in gastric carcinoma tissues showed the lowest survival rate in contrast to the patients with MUC1-/MUC5AC+ staining pattern [131]. Further, MUC5AC expression was negative in mucinous gastric carcinomas having a deeper invasion, more frequent lymph node metastasis, more advanced pathologic state, lower survival rates than patients with non-mucinous gastric carcinoma [135]. In eleven retrospective cohort studies comprising 2135 patients conducted to assess the association between MUC5AC expression and overall survival and clinicopathological characteristics revealed that decreased MUC5AC expression was significantly correlated with poor overall survival of GC patients. Moreover, decreased MUC5AC expression was also significantly associated with tumor invasion depth and lymph node metastasis in GC [136].

3.3.E Gallbladder adenocarcinoma

Expression of MUC5AC has been reported in the fetal gallbladder [137]. MUC5AC is weakly

and diffusely expressed at mRNA and protein level in normal gallbladder biliary epithelial cells

and intrahepatic bile ducts [138]. While in adenomas, dysplasias, and carcinomas of gallbladder the expression of MUC5AC was reported to be decreased [139]. In another study, the positive

rate of MUC5AC expression was significantly lower in gallbladder adenocarcinomas than that in

peritumoral tissues (p<0.01), adenomas (p<0.05), and chronic cholecystitis (p<0.01) [140]. The

highly differentiated adenocarcinoma had significantly higher positivity rate of MUC5AC

compared to low differentiated adenocarcinomas [140]. Further, decreased expression of

MUC5AC was significantly associated with decreased overall survival (p=0.017), and was a 19

significant independent prognostic predictor of gallbladder adenocarcinoma [140]. Contrary to

these, expression of MUC5AC was observed in carcinoma cells at deeply invasive sites [46]. A

rare case of minute subserosal adenocarcinoma of the gallbladder which arose in Rokitansky-

Aschoff sinus (RAS) was found to be positive for MUC5AC expression [141]. Interestingly,

MUC5AC was expressed in 86% of mucinous carcinomas of the gallbladder (large and advanced

tumors exhibiting more aggressive behavior than ordinary gallbladder carcinomas) [142].

3.3.F Cholangiocarcinoma

Cholangiocarcinoma (CCA) is a highly malignant epithelial cancer of the biliary tract that

presents with metastatic disease [143]. The cellular and molecular pathogenesis of CCA remains

unclear [143]. Multistep progression of CCA has been suggested from biliary intraepithelial neoplasia (BilIN) and intraductal papillary neoplasm of the bile duct (IPN-B). Among mucins, expression of MUC5AC has been demonstrated in intrahepatic (biliary) intraductal papillary mucinous neoplasia (b-IPMN) [144]. Extensive expression of MUC5AC (>50%) in CCAs have previously been reported [145, 146]. Interestingly, MUC5AC expression was significantly associated with more advanced tumors [146] and poor prognosis [147]. Also, a significant association of the increased expression of MUC5AC with neural invasion (p=0.022) and advanced intrahepatic cholangiocarcinoma (ICC) stage (p=0.008) has been demonstrated for liver fluke-associated ICC [148]. In patients with intrahepatic cholangiocarcinoma mass-forming type

(ICC-MF), following curative intent hepatectomy, the expression of secretory mucin MUC5AC was significantly related to aggressive tumor development, lymph node metastasis and independently predicted poor prognosis [23]. Moreover, MUC5AC expression was significantly more often (p<0.0001) observed in hilar CCAs compared with peripheral CCAs [149].

Early and specific diagnosis may aid in the effective and timely treatment of CCA [143].

Currently, there is no powerful marker for the diagnosis of CCA, which has led to the late

diagnosis and poor patient outcome [143]. Interestingly, determination of serum MUC5AC could 20

discriminate CCA patients from controls with 71% sensitivity and 90% specificity [150].

Investigation of the diagnostic performance of MUC5AC in both bile and serum samples for

differentiating CCA and benign biliary disorders (biliary stones and cholangitis) revealed that

expression of data in terms of serum to bile ratio showed the improved diagnostic performance of

MUC5AC over quantification in serum alone [24]. MUC5AC as a new serum marker for biliary

tract cancer has also been proposed. Significantly greater levels of serum MUC5AC in BTC

patients compared to benign biliary disorders and healthy controls had a significant association

with lymph-node metastasis (P= 0.05) and stage-IVb disease (P=0.047). Interestingly, in patients

who underwent an operation with curative intent, the serum levels of MUC5AC ≥ 14 ng/mL

correlated to poor prognosis (3-year survival rate of 21.5%) in comparison to the patients with

lesser levels of serum MUC5AC (3-year survival rate of 59.3%) [151]. Further, it has been

demonstrated that CA-S27, a novel Lewis-a [Le (a)] associated modification of MUC5AC is

involved in promoting CCA cell growth, adhesion, migration, and invasion. The higher levels of

CA-S27 in the serum of CCA patients was significantly associated with shorter survival and

could differentiate CCA patients from different malignancies and controls with high sensitivity

and negative predictive value [152]. Another study demonstrated that MUC5AC is a core

glycoprotein for the S121 epitope that distinguishes patients with CCA from other pathologies

and normal controls with 89.58% specificity, 87.63% sensitivity, 80.95% positive predictive

value and 93.47% negative predictive value. Further, serum S121 levels were related to poor

patient outcome [153].

3.3.G Pancreatic cancer

Earliest report about the expression of MUC5AC transcripts suggests that it is undetectable in all

cells of normal pancreas tissue and chronic pancreatitis adjacent to PC. However, MUC5AC

transcript expression was observed in the areas of papillary hyperplasia and PC [154]. MUC5AC

mRNA was expressed in 83% of intraductal papillary mucinous tumors (IPMT) versus only 13% 21

of invasive ductal carcinomas (IDC) [155]. All the three subtypes of IPMT (villous dark cell type,

papillary clear cell type, and compact cell type) expressed MUC5AC [155]. Interestingly, patients

expressing MUC5AC mRNA had a significantly better survival compared to the cases with no

MUC5AC expression (p<0.005) [155]. Immunohistochemically, expression of MUC5AC was

observed in 100% of intraductal papillary mucinous adenomas (IPMAs) compared to only

33.33% of benign mucinous cystadenomas of the pancreas [156]. Besides this, expression of

MUC5AC was demonstrated in all the cases of gastric and intestinal type of intraductal papillary mucinous neoplasm (IPMN) [157]. Meta-analysis of 39 studies having 1235 IPMN samples

revealed that expression of Kras and MUC5AC is common in IPMN samples, but not strongly

associated with histologic progression of IPMN to malignancy [158]. Also, pancreatic mucinous

cysts without histologic characteristics of neoplasia and noninvasive mucinous cystic neoplasms

were observed to be expressing MUC5AC [159, 160].

MUC5AC is maximally expressed amongst all the mucins in all the histologically well-

defined precursor ductal lesions of PC called Pancreatic intraepithelial neoplasia (PanIN-1A, -1B,

-2, -3) and PC compared to its rare expression in normal pancreas [161]. Matsuyama et al. examined the differences in mucin expression between normal PanIN lesions and PanINs in

PDACs (PDAC-PanINs). MUC5AC expression was observed in 41%, 65.7% and 36.4% of normal PanIN-1A, PanIN-1B and PanIN-2 specimens respectively. However, it was increased to

80.9%, 75.8% and 78.3% of PDAC PanIN-1A, PanIN-1B and PanIN-2 specimens respectively.

Particularly, significant differences were observed in the frequency of MUC5AC expression between normal and PDAC-PanIN-1A (p<0.0001) and PanIN-2 (p<0.05) lesions [162].

Among pancreatic tumors, expression of MUC5AC was observed in all 100% cases of well-differentiated pancreatic tumors, 96% moderately differentiated and 59% of poorly- differentiated tumors [161]. One study reported the expression of MUC5AC in 73.9% of cancerous regions, 48.7% of the dysplastic regions, and 72% of the hyperplastic regions but not in 22

the normal pancreatic duct. Notably, stromal expression of MUC5AC was observed in 60.9% of

the cancerous regions with no such observation in stromal regions associated with hyperplasia

[111]. Further, expression of MUC5AC was reported in 63.6% of IDC cases of the pancreas.

MUC5AC-negative expression was significantly associated with lymphatic invasion, venous

invasion, lymph node metastasis, and MUC5AC positive patients showed significantly better

survival than MUC5AC-negative patients [163]. Contrary to this, in an important study done on

161 pancreatic tumors, the authors observed and presented a statistically significant association between expression of MUC5AC and shorter survival time of patients after adjusting for different covariates. This association was further strengthened in well to moderately differentiated ductal adenocarcinomas. Authors highlighted that tumor histologies differed in this study compared to

Japanese cohorts and suggested that pancreatic tumor types differ across populations and that interpretation of biomarkers may also vary by pancreatic tumors lineages [164]. Takano et al. classified PDAC samples by metaplastic changes and heterogeneous gastric and intestinal elements. Tissues expressing MUC5AC were classified gastric type PDAC accounting for approximately 25.4% of such cases. Interestingly PDAC with gastric elements were well- differentiated types with the significantly higher rate of lymph node metastasis [165]. In endoscopic ultrasound-guided fine needle aspiration specimens from 114 PDAC patients, expression of MUC5AC was observed in 78.9% cases. Interestingly, advanced stage PDAC patients with MUC5AC expression had a significantly better outcome than those who were

MUC5AC-negative (p=0.002) [166]. Overall, observations from different studies lack clarity regarding the association of MUC5AC to PC patient prognosis as it might be impacted by sample type, population cohort and stage at which samples were collected.

3.3.G.a Pancreatic cancer diagnosis

One of the biggest challenges associated with PC are lack of early stage diagnostic markers. By

the time patient is diagnosed the disease is in its advanced stages or cancer has metastasized to 23

distant locales. In an attempt to find solution to this problem it was demonstrated that analysis of

upregulated MUC1 and MUC5AC mRNA in pancreatic juice is a better diagnostic modality than

that of MUC4 and MUC6 mRNA during the development of high-grade PanIN lesions to IDC

[167]. In the nonneoplastic endoscopic ultrasound-guided fine needle aspirations (EUS-FNA) of

the pancreas MUC5AC was observed to be absent. Interestingly, the MUC1/MUC2/MUC5AC

panel was considered to be the most optimum for the diagnosis of ductal adenocarcinoma [168].

Further, in EUS-FNA specimens, higher specificity of the panel MUC1-/MUC2-/MUC5AC+ and

MUC1-/MUC2+/MUC5AC+ were highlighted to diagnose PC and pancreatic mucinous

neoplasms respectively [169]. In a study conducted on sera of PC patients, MUC5AC was found to be elevated at the protein level (in 35% of the patients) and had the most glycan alterations.

The most frequent elevations involved fucose, the CA 19-9, and terminal mannose. It was suggested that N-glycans, as well as O-glycans, may play important roles in modifying the behaviors of MUC5AC in disease [170]. Hence, identification and functional characterization of

MUC5AC specific glycan alterations during PC are necessitated. In fact detection of glycan variants on MUC5AC utilizing antibody-lectin sandwich microarray method could discriminate benign cystic lesions (serous cystadenomas + pseudocysts) from mucin-producing cystic tumors

(MCN and IPMN) with sensitivity/specificity of 78%/80%. Interestingly, the combination with cyst fluid CA 19-9 improved sensitivity/specificity to 87%/86% [171]. Further, improved biomarker performance by measurement of glycans on specific proteins has been demonstrated

[172]. Interestingly, combined detection of the standard CA 19-9 along with CA 19-9 on

MUC5AC and MUC16 improved the sensitivity of PC detection over CA 19-9 alone in each sample set [172]. Moreover, a serum ELISA has been developed using NPC-1C antibody that detects specific epitopes expressed by tumor-associated MUC5AC in PC but not by normal tissues. This serum test may be a new tool to aid in the improved diagnosis of PC [173].

3.3.G.b Pancreatic cancer therapy 24

Development of resistance to different therapeutic modalities poses the biggest challenge in

targeting this devastating malignancy. In an attempt to therapeutically target PC, a chimeric

immunoglobulin (IgG1) called NPC-1C was developed. NPC-1C recognizes an immunogenic

MUC5AC-related tumor-associated antigen. Interestingly, during pre-clinical characterization of

NPC-1C antibody, it was demonstrated that none of the normal pancreas tissues reveal NPC-1C reactivity while 48% of PC tissues demonstrate its staining. Further, the potential therapeutic utility was highlighted as NPC-1C not only mediated PC cells killing but also impacted two to threefold reduction in CFPAC-1 xenograft tumor growth compared to normal saline and IgG controls [174]. Arlen et al. have established NPC1-C antibody targeting mutated MUC5AC. The chimeric mAbs (NPC-1) targets a variant of MUC5AC. Xenograft studies with transplanted human colon and pancreas tumors revealed the ability of mAb NPC-1 to diminish and in many cases eliminate the growth of established tumor that was expanding in the animals. Also, NPC-1

monoclonal antibody exhibited greater than 40% killing of PC cells [175]. Yamazoe et al.

assessed the possibility of using MUC5AC as a target for immunotherapy of PC. Two peptide

epitopes [MUC5AC-A02-1398 (FLNDAGACV) and MUC5AC-A24-716 (TCQPTCRSL)] elicited cytotoxic T-lymphocytes having specific cytotoxicity against the corresponding HLA-

A*0201- and A*2402-positive target cells [176]. Further, Gold et al. demonstrated high specificity of PAM4 antibody (clivatuzumab) for PDAC in comparison to the normal pancreas,

benign lesions of the pancreas, and cancers originating from other tissues. Interestingly, this

PAM4 antibody specifically reacted with a reactive epitope present within the N-terminal

cysteine-rich subdomain2 (Cys2) of MUC5AC [177, 178]. These studies highlight the clinical

utility of PAM4 antibody for early stage diagnosis and therapy of PC.

3.3.H Colorectal cancer

Expression of MUC5AC has been extensively explored during colon adenoma-carcinoma sequence. Different studies suggest an absence of MUC5AC expression in normal colon. 25

However, MUC5AC is aberrantly expressed in adenomas that are considered to be the precursor

lesions of CRC. Intense overexpression of MUC5AC was a feature of rectosigmoid villous

adenomas (RVAs) with low-grade dysplasia than cases with high-grade dysplasia. It was

suggested that by acting as a specific marker for RVAs, MUC5AC may be useful for the early

detection of RVA recurrences [179]. In another study, MUC5AC was rarely detected in normal colon, while its staining was of low intensity in hyperplastic polyps. MUC5AC immunoreactivity was greatest in larger adenomas of moderate villous histology and dysplasia while it tended to decrease in highly villous polyps and with severe dysplasia [180]. Interestingly, in a larger cohort of colorectal carcinoma samples, expression of MUC5AC was strongly associated with carcinogenic features via the serrated neoplasia pathway, including CIMP positivity, somatic

BRAF p.V600E mutation, mismatch repair deficiency, proximal location, poor differentiation, lymphocytic response and increased T-stage (p<0.001) [181, 182]. Interestingly, on the basis of significantly increased expression of secretory mucin MUC5AC and MUC2 in sporadic MSI-H cancers it was suggested that serrated polyps of the colorectum may represent precursors of MSI-

H cancers [183]. It was further demonstrated that determination of MUC5AC hypomethylation

may be useful to identify serrated neoplasia pathway-related precursor lesions [184]. Besides

precursor lesions of CRC, increased expression of MUC5AC has been observed in 90% of high-

grade dysplasia in UC, 89% of low grade dysplasia in UC, 73% of colitic cancer [185], 34.1% of

colon adenocarcinoma samples, 33% of signet-ring carcinoma of the colorectum [186], 60% of

mucinous carcinoma, and 19% of lymph node metastatic cases [187-189]. On the basis of

observed higher incidence of MUC5AC in UC-associated neoplasms than sporadic tumors, its

utility in the differential diagnosis of UC-associated neoplasms and sporadic ones was also

suggested [185].

Concerning expression of MUC5AC and its impact on prognosis of CRC patients, it has

been reported that absence of MUC5AC can be a prognostic factor for more aggressive colorectal 26

carcinoma [187]. In an interesting study, naturally occurring MUC5AC antibodies were detected

in the sera of 27.3% healthy subjects, 45% patients with polyps, and 60% CRC patients.

Interestingly, MUC5AC antibody positive patients had shorter disease-free survival and overall

survival [190]. Significant correlation of MUC5AC presence with the lack of mismatch repair

protein MLH1 expression (p<0.005) in colorectal carcinomas has also been demonstrated [191].

Besides this, expression of MUC5AC in colorectal adenocarcinoma was significantly correlated

with tumor differentiation, invasion (P<0.01) along with positive correlation to E-Cadherin

expression [189]. Another study on T1-stage colorectal carcinoma patients revealed that

MUC5AC-positive patients had significantly higher incidences of right sided carcinoma

(p=0.005), polypoid growth carcinoma (p=0.009), and mucinous adenocarcinoma (p=0.035) than

in MUC5AC-negative patients [192]. Kesari et al. reported a significant positive correlation of

MUC5AC expression in CRC with tumor grade (p=0.006). The percentage of cases showing

MUC5AC expression increased as the stage of disease progressed from 1 to 4 [25]. Not only in humans, but also in rat colon cancer model (MNNG treatment based), increased Muc5ac expression was observed in typical aberrant crypt foci (ACF) in the colon mucosae underscoring utility of Muc5ac as an early marker of colon carcinogenesis [193, 194].

Not much has been published about mechanisms associated with increased MUC5AC expression during colon carcinogenesis. On the basis of concordant expression of SOX2 with

MUC5AC in serrated polyps, mucinous, signet ring cell carcinomas, it was suggested that SOX2 may play an important role in upregulation of MUC5AC in these pathologies [195]. However, later another study demonstrated that SOX2 expression is not specifically linked to mucinous

CRCs, and MUC5AC is expressed independently of SOX2 in these CRCs [196].

3.3.I Ovarian cancer

Mucins play an important role in early diagnosis, prognosis, and treatment of ovarian cancer

[197]. However, about secretory mucin MUC5AC, the majority of the studies have focused on its 27

expression and diagnostic utility in ovarian carcinoma cases. Among these, one study reported an

absence of MUC5AC in effusion specimens from ovarian serous carcinomas and suggested that

MUC5AC-/WT-1+ immunostain profile may differentiate ovarian serous carcinomas from

pancreatic carcinomas (MUC5AC+/WT-1-) [198]. In another study, a partial positivity of

MUC5AC was reported in a rare case of the mucinous borderline-like tumor arising from a

mature cystic teratoma (MCT) of the ovary [199]. Further, MUC5AC+/MUC1- immunostain

profile was recommended to differentiate ovarian mucinous tumors (OMTs) of the intestinal type

from the different metastatic tumors to the ovary (pancreatic, colorectal, cholangiocarcinoma,

gastric and esophageal carcinoma). Notably, 97.2% cases of OMTs were strongly and uniformly

positive for MUC5AC [200]. An interesting study investigated the factors associated with ovarian

cancer-peritoneal cell interaction [201]. For this, ovarian cancer and mesothelial cells were co-

cultured. Interestingly, an increased expression of secretory mucin MUC5AC was observed in the

co-culture secretome [201]. By this, authors suggested that MUC5AC may be a novel mediator of

ovarian cancer and peritoneal interaction, resulting in ovarian cancer cell invasion and adhesion

to distant sites [201].

3.3.J Cervical cancer

Cervical cancer is the second most common cause of cancer death in women worldwide. The

identification of novel targets for the development of new diagnosis, prognostic, and treatment

strategies merits special attention [202]. A strong expression of MUC5AC has been reported in the normal endocervical epithelium (100%) and neoplastic lesions (73%), while it was diminished in most neoplastic glandular lesions and absent in cases of tubal metaplasia and endometriosis

[203]. Looking at its differential expression, the utility of MUC5AC expression as a marker to distinguish different cervical lesions was suggested. Further, a significant reduction of MUC5AC expression in adenocarcinomas of the cervix compared to the normal endocervical epithelium has 28

been reported. Interestingly, a significant association of its absence to poor survival of patients

was observed [204].

3.3.K Prostate cancer

Expression of MUC5AC in mucosecreting cells of the prostatic urethra has been assumed to be

probable cause for the histogenesis of benign villous tumors and primary mucinous

adenocarcinomas arising from the prostatic urethral epithelium [205]. Contrary to this, the study

by Legrier et al. revealed that very rare cells in the xenograft of a human hormone-dependent

prostate tumor expressed MUC5AC, with no expression in hormone-independent variants [206].

Additionally, different investigations have reported an absence of MUC5AC expression in normal and prostate tumor tissues [119, 207, 208].

3.3.L Urothelial bladder cancer

Urothelial bladder cancer (UBC) is a malignancy of common genitourinary areas [209]. Secretory

mucin MUC5AC expression is usually absent in urothelial cells. However, expression of

MUC5AC has been reported in 11.1% of urothelial bladder carcinomas (UBCs) [209], 100% of

the flat urothelial carcinoma in situ of the bladder with glandular differentiation [210], 43.8% of

UBCs with divergent differentiation [211], 50% of the adenocarcinomas admixed to urothelial

carcinomas, 66.6% of primary pure signet-ring cell adenocarcinoma (SRCA) of the urinary

bladder [212], variable in microcystic urothelial bladder carcinoma [213], and absent in a case of

clear cell adenocarcinoma of the urinary bladder [214]. Interestingly, a significant relationship

between MUC1 and MUC5AC expression (p<0.001) was observed in 83% of UBCs expressing

MUC5AC. Notably, MUC5AC positivity did not correlate with survival of UBC patient [209].

3.3.M Extramammary Paget’s disease

Extramammary Paget's disease (EMPD) is a rare skin cancer of the genital region. In EMPD,

cancer cells (Paget cells) with enlarged nuclei and pale cytoplasm are scattered singly in the

affected epidermis. The Paget cells contain mucin which is never found in normal epidermis 29

[215]. Expression of MUC5AC has been reported previously in the majority cases of EMPD in

the anogenital areas. It was concluded that EMPD in the anogenital areas may arise from ectopic

MUC5AC+ cells originating from Bartholin's or some other unidentified glands [216]. With no

expression of MUC5AC in normal skin cells, expression in all the intraepithelial lesions and loss

in invasive lesions, it was suggested that that loss of MUC5AC may play an important role in the

invasive growth of Paget cells [217]. In contrast, the significantly higher (p<0.01) expression of

MUC5AC in invasive lesions and metastatic lymph nodes compared to in situ lesions has also

been reported. It was concluded that MUC5AC may be a useful marker for identifying high-risk

EMPD cases [218]. Despite all the expressional information, further studies identifying the exact

roles of secretory mucin MUC5AC in EMPD are obscure.

3.3.N Pseudomyxoma peritonei

Pseudomyxoma peritonei (PMP) is the neoplasm of the peritoneum [219]. It originates from

appendicular tumors [219] and is characterized by progressive dissemination of mucinous tumors

and ascites with a distinctive pattern of peritoneal spread. During PMP, increased ectopic

secretion and deposition of MUC5AC along with MUC2 and MUC5B has been observed in the

peritoneal cavity, resulting in major part of the morbidity [220-222]. However, studies regarding the specific role of MUC5AC in the peritoneal spread and the degree of malignant transformation are still missing. Besides this, the mechanisms associated with increased MUC5AC secretion and accumulations in PMP are missing. In a significant revelation, it was shown that activating GNAS mutations result in the induction of MUC5AC in low-grade appendiceal mucinous neoplasms, which can be a cause of PMP [223].

4. Functional and mechanistic implications of MUC5AC in cancer

In a study conducted to understand the functional significance of MUC5AC in PC, it was demonstrated that MUC5AC expression might accelerate the progression of PC by activating the

VEGFR-1 signaling pathway in an autocrine manner. Suppression of MUC5AC resulted in 30

significantly lower adhesion and invasion to extracellular matrix components compared to

controls along with downregulation of genes associated with adhesion and invasion (MMP-3,

integrins and VEGF). Furthermore, production of VEGF and phosphorylation of VEGFR-1 were

significantly reduced on MUC5AC inhibition. There was reduced activation of Erk1/2 and

reduced subcutaneous tumor formation on knockdown of MUC5AC in nude mice. However, the

mechanisms associated with MUC5AC mediated tumor formation in vivo remained obscure

[224]. Furthermore, in an interesting study, it was demonstrated that GLI mediated expression of

MUC5AC modulates E-cadherin/β-catenin regulated PC cell properties [22]. Interestingly, it was

suggested that expression of MUC5AC in the intercellular junctions of pancreatic ductal

adenocarcinoma cells might have inhibited homophilic ligation and stabilization of E-cadherin on

the cell membrane. By these observations, authors suggested that future studies could target

breakdown of the polymerized MUC5AC gel structure mediated restoration of E-cadherin-

mediated intercellular adhesion and may lead to the downregulation of β-catenin signaling,

preventing the migration and invasion of PDA cells [22]. Another study showed that expression

of MUC5AC does not impact in vitro PC cell growth, but it was intimately involved in tumor

growth in vivo. Mechanistically, infiltration of CD45R/B220+ and Gr-1+ cells was observed in

tumor tissues generated by implanting si-MUC5AC cells into mice suggesting that infiltrated

neutrophils might have antitumor effects mediated by antibody-dependent cell cytotoxicity

(ADCC) via phagocytosis, elastase, or superoxide generation. Another possible reason assumed

for the in vivo inhibition of tumorigenicity was a possible association of MUC5AC in immune

suppression and avoidance. However, future studies are needed to investigate the MUC5AC

mediated immunosuppressive mechanisms in human PC. Further, Hoshi et al. observed that

suppression of MUC5AC inhibits in vivo tumor growth due to increased infiltration of neutrophils

resulting in TRAIL-mediated increased apoptosis [225]. Overexpression of MUC5AC is a poor

prognostic marker in LC. In an attempt to functionally characterize MUC5AC in LC, it was 31

demonstrated that MUC5AC was associated with epithelial to mesenchymal transition (EMT) in

LC cells. Besides this, an interaction of MUC5AC with integrin-β4 mediated phosphorylation of

FAK at Y397 residue leading to increased LC cell migration was also reported [20]. Further, to elucidate the mechanisms associated with increased tumorigenicity and metastasis of GC, silencing of MUC5AC was performed in GC cells (SNU216 and AGS). Knockdown of

MUC5AC increased the invasion and migration of SNU216 and AGS cells. Mechanistically

MUC5AC silencing increased Akt phosphorylation, expression of VEGF and matrix metalloproteinase-7, which were blocked by inhibitors of the phosphatidylinositol 3-kinase/Akt pathway [21].

5. Muc5ac mice models

Shekels et al. for the first time reported the MGM gene identified from murine gastric cDNA, to

be a murine homolog of human MUC5AC [226]. The mouse Muc5ac gene was mapped to 215 kb secretory mucin gene cluster on distal chromosome 7 band F5, 69.0 cM from the centromere.

Similar to human homolog it was organized with other mucins as Muc6-Muc2-Muc5ac-Muc5b indicating that they have been well conserved through evolution [227]. The genomic region encoding for Muc5ac was found to be 29 kb, included 49 exons, and predicted to produce a 9 kb

RNA transcript [228]. The size of Muc5ac central exon was estimated to be approximately 6.5 kb

[227]. Regarding orientation, the mucins Muc2, Muc5ac, and Muc5b were arranged in the same direction, while Muc6 in opposite direction. Further investigations indicated that the peptides from different secretory mucins had striking sequence similarities in their N- and C-terminal

regions, and also to pre-pro-von Willebrand factor like domains (D, B, C and C-terminal cystine

knot (CK) domains). However, the Proline/Threonine/Serine-rich central region of different

secretory mucins was specific for mucin-type and species. The 48 nucleotides tandem repeats of

Muc5ac encode a serine and threonine rich consensus sequence of 16 amino acid

(QTSSPNTGKTSTISTT) residues [226]. Expression studies also showed that similar to human 32

MUC5AC, murine Muc5ac was observed most prominently in airways, stomach, and conjunctiva

of mice [226, 229]. Overall, this information laid the foundation for the investigation of Muc5ac

gene regulation and function utilizing the animal models [227]. Multiple studies as mentioned

below have utilized the genetically modified mice models of Muc5ac, to understand the

mechanisms associated with its regulation and functionally characterize this secretory mucin in

pathologies related to different organs.

A study by Hasnain et al. highlighted the role of Muc5ac as a crucial effector molecule during infections of the intestine, besides being a structural component of the mucus barrier. It was demonstrated that IL-13 and IL-4 induced Muc5ac protects from Trichuris muris (T. muris)

infection. The deficiency of Muc5ac (Muc5ac-/-) renders mice more susceptible to chronic T.

muris infection along with a significant delay in the expulsion of other infectious agents such as

Trichinella spiralis and Nippostrongylus brasiliensis from the intestines of infected mice

compared to infected wild-type (WT) mice [230]. Interestingly, Muc5ac-deficient mice infected

with T. muris revealed significantly elevated IFN-γ, increased goblet cell numbers, Muc2 levels,

significantly higher levels of ATP in worms compared to the worms isolated from the infected

WT mice. There was also a slight increase in IFN-γ in uninfected Muc5ac-deficient mice [230].

This suggests that Muc5ac plays an important role in alleviation of inflammatory response thus

playing a protective role. Another study investigated relationship between inflammation, Muc5ac

hypersecretion, and airways obstruction and highlighted the protective role of Muc5ac during

airway pathologies. For this, the Muc5ac transgenic mouse was developed by cloning full-length

Muc5ac cDNA to be overexpressed in murine small and large airways. The resultant Muc5ac

transgenic mice revealed a 17.7 fold increased Muc5ac secretion in bronchoalveolar lavage fluid

and approximately 2-fold increase over the OVA-challenged model compared with WT mice

[228]. There was no compensatory impact on other mucins suggesting independent regulation of these mucins in the absence of disease. Further, there was no evidence of small airways, large 33

airways obstruction suggesting its efficient clearance from airway surfaces [228]. Interestingly,

the increased mucus was handled by increasing the height of the mucus layer, with no change in

its concentration. Moreover, the protective antiviral impact of Muc5ac was uncovered by the

resistance of Muc5ac-Tg mice to PR8/H1N1 influenza in vivo [228]. It was shown that α-2, 3- linked sialic-acid residues on the Muc5ac act as a decoy to bind virus, limiting its access to the

airways epithelial surfaces, thus preventing infection [228]. Interestingly, reduced neutrophilic

response thus limiting the lung tissue damage was observed in Muc5ac-Tg mice exposed to

infection [228]. However, the exact mechanisms addressing the impact of Muc5ac on reduced neutrophil infiltration remained elusive, needing further investigations. This study cautions for careful titration of any future therapeutics designed to reduce Muc5ac production for the purpose

of ameliorating airway obstruction, as this may lead to compromised host defense [228].

Contrary to above mentioned protective roles of Muc5ac, another study provided the evidence of the detrimental role of Muc5ac during Acute lung injury (ALI). For this, the Muc5ac-

/- mice were subjected to ventilator-induced lung injury (VILI) [231]. WT mice exposed to VILI revealed increased Muc5ac transcript and protein levels mediated by transcription factor NF-κB

[231]. Surprisingly, Muc5ac-/- mice exposed to VILI had significantly improved pulmonary gas exchange, significantly reduced pulmonary edema, complete abolishment of Myeloperoxidase

(MPO) levels, attenuated regulation of cytokine, chemokine and chemokine receptor levels

(Cxcl1, Cxcl2 and IL-6 transcripts and proteins), and significantly increased survival than WT littermate controls. The presence of Muc5ac also increased in trafficking of Ly6Ghigh/CD11bhigh

polymorphonuclear (PMN) cells in the pulmonary tissue of WT mice exposed to VILI [231].

Concerning possible mechanisms, it was assumed that by acting as a cytokine ‘‘sponge’’, Muc5ac

may prolong the half-life of these inflammatory cytokines and other inflammatory mediators,

thereby resulting in enhanced lung inflammation and increased neutrophil trafficking. 34

Besides studies delineating the role of Muc5ac in airway pathophysiology its potential

role in the maintenance of ocular homeostasis has also been investigated. In Muc5ac-/- mice model there was a compensatory increase of another secretory mucin-Muc5b at mRNA and protein level along with significant enlargement of mucous cells on the ocular surface [232]. Lack of Muc5ac markedly destabilized the tear film (TF) resulting in qualitative TF insufficiency with the tear volume remaining intact [232]. Besides this, a few Muc5ac-/- developed opacification on their ocular surface (mainly on the cornea) warranting further investigations on the molecular and mechanistic basis of this observation. This study highlighted the therapeutic potential of artificial tear fluid supplemented with Muc5ac to have a beneficial effect on dry eye patient [232].

However, contradicting above mentioned observations, it was reported that loss of Muc5ac does

not produce a dry eye phenotype in mice. They did not observe any obvious changes or defects in

the gross appearance of the cornea or eyelids and concluded that Muc5ac-/- mice are a poor animal

model of the human dry eye disease [36]. The authors suggested that the corneal opacification

noted in the previous study might be a secondary cause relating to infection due to debris or

pathogens and not actually due to the deletion of the Muc5ac gene. Besides this, they did not

observe any qualitative or quantitative changes in goblet cells of conjunctival epithelium in

Muc5ac deficient mice, thus disproving the observations from the previous study [36].

A study from our lab evaluated the stage-specific expression pattern of mucins during PC progression in KrasG12D; Pdx1-Cre (KC) murine PC model and observed a progressive increase in

the expression of secretory mucin Muc5ac in the pancreas of KC mice both at mRNA and protein

level. Muc5ac expressed in the pancreas of KC mice as early as at 10 weeks (fold change 1.2)

compared to none in control LSL-KrasG12D mice [233]. Interestingly, MUC5AC expression progressively increased from 10th week to the 50th week of progression compared to none in the pancreas of age-matched unfloxed LSL-KrasG12D mice [233]. Interestingly, Muc5ac was strongly 35

expressed in the metastatic lesions involving liver, small intestines and lungs at 50 weeks of age

[233].

6. Regulation of MUC5AC expression

Secretory mucin MUC5AC is aberrantly expressed under inflammatory conditions, and multiple

malignancies such as PC, LC, and CRC. A plethora of studies in last decade has investigated the

regulation of MUC5AC expression, in different physiological and pathological contexts. Briefly,

MUC5AC has been shown to be regulated by environmental pollutants (cigarette smoke extracts,

acrolein, ozone), viral mediators (respiratory syncytial virus, rhinovirus), bacterial products (LPS,

LTA, peptidoglycans, flagellin), cytokines (TNF-α, IL-1β, IL-4, IL-6, IL-9, IL-13, IL-17), growth

factors (EGF, TGF-α, RA, thyroid hormones), and proteases (neutrophil elastase) [73, 80]. Recent

studies demonstrated the miRNA-mediated regulation of MUC5AC and utility of their therapeutic targeting for modulation of MUC5AC expression. It has been shown that mucus

overproduction during inflammatory airway diseases can be managed by manipulation of

miRNAs. MUC5AC production by airway epithelial cells stimulated by neutrophil elastase was

downregulated by miR-146a mediated inactivation of JNK and NF-κB signaling [234].

Interestingly, it has been displayed that overexpression of hemeoxygenase-1 (HMOX1),

decreased the expression of miR-378 (Oncomir/Angiomir), reversed miR-378 mediated increased

MUC5AC, vascular endothelial growth factor (VEGF), interleukin-8 (IL-8), and Ang-1 leading to

decreased proliferation, migration, and angiogenic potential of NCI-H292 LC cells both in vitro and in vivo. Thus, this study underscores a prospective therapeutic strategy, to inhibit miR-378-

mediated impact on LC cell growth and metastasis [235]. Another study showed that in IL-13-

stimulated nasal epithelial cells (NECs), mRNA and protein expression levels of MUC5AC could

be significantly decreased by the forced expression of miR-143 [236].

Little is known about the mechanisms associated with atypical expression of MUC5AC in pancreatic tumors. It has been shown that forskolin and vasoactive intestinal peptide (VIP) 36

stimulate adenylyl cyclase and protein kinase A (PKA) pathway to increase MUC5AC antigen

expression and release from SW1990 PC cells [237]. Further, transcription factor SP-1 is involved in basal transcription of the MUC5AC gene [238]. The AP-1 transcription factor is also involved in both basal and PMA induced MUC5AC promoter activation via PKC/ERK and

PKC/JNK pathways [238]. Moreover, epigenetic mechanisms also regulate expression of

MUC5AC in PC cell lines. The distinct CpG methylation status in the distal region of the

MUC5AC promoter was responsible for expression of MUC5AC in different PC cell lines [127].

Also, MUC5AC is a direct transcriptional target of GLI1 in PC cells. GLI1 and GLI2 could activate the promoter of MUC5AC through its conserved CACCC-box like cis-regulatory elements [22]. Further, utilizing pancreatic ductal lineage cells (HPDE and PK-8), it was concluded that mutation of GNAS induces MUC5AC expression in IPMNs through interaction with MAPK and PI3K pathways [239].

7. Hypoxia and MUC5AC

Hypoxia is closely associated with the inflammatory process. Fundamental mechanisms

underlying overproduction of secretory mucin MUC5AC during lung inflammation remained

unknown. Different mucins (MUC1, MUC3, and MUC17) have been known to be induced under

hypoxic conditions associated with different pathologies [240-242]. Hence, multiple studies

investigated hypoxia-mediated MUC5AC expression under conditions of inflammation associated

hypoxia. A consensus-binding motif for transcription factor HIF1-α was observed in the core promoters of all the mammalian MUC5AC orthologs, suggesting the role of hypoxia in the regulation of MUC5AC. It was demonstrated that the -64 bp hypoxia response element (HRE) on

MUC5AC promoter is essential for the response to hypoxia, as mutations of this site virtually abolished the activity of MUC5AC promoter [243]. Under inflammatory conditions, IL-13 and

EGF-mediated induction of HIF1-α binding to Muc5ac promoter resulted in increased transcription of Muc5ac, while a mutation in the binding motif dramatically reduced the Muc5ac 37

promoter activity [75, 244]. Interestingly, Yang et al. demonstrated that human neutrophil

elastase (HNE) induces the generation and activation of HIF-1α, to further activate protein kinase

C (PKC), and subsequently increase the levels of transient receptor potential vanilloid subtype 1

(TRPV1) phosphorylation, resulting in TRPV1 sensitization mediated increase in the production

of MUC5AC and pro-inflammatory cytokines [245]. It has also been shown that increased

secretory mucin MUC5AC expression and production during sinusitis can be reduced either by

increasing the oxygen tension or by modulating the HIF1-α activity [246]. In another study, the

multifunctional or multidirectional action of silver NPs to alleviate allergic asthma by attenuating

MUC5AC hypersecretion was assumed to be mediated via blocking of HIF-1α and Th-2

cytokines [247]. Further, Yu et al. drew attention to cigarette smoke-induced MUC5AC

expression by HIF-1α via EGFR mediated activation of PI3K and ERK signaling pathways in human airway epithelial cells [248]. Overall, these studies underscore that increased MUC5AC mediated pathological implications can be alleviated by therapeutically targeting hypoxia mediator HIF1-α under inflammatory conditions.

8. Smoking and MUC5AC

Earliest report on the association of smoking and MUC5AC expression demonstrated that

cigarette smoke inhalation activates EGFR, resulting in up-regulation of MUC5AC production

[249]. Further investigation elucidated that smoking generated reactive oxygen species (ROS)

activate TNF-α converting enzyme (TACE). TACE caused increased TGF-α shedding, leading to

EGFR phosphorylation mediated MUC5AC induction in human airway epithelial (NCI-H292)

cells [250]. Baginski et al. reported a synergistic impact of cigarette smoke and proinflammatory

inducers like TNF-α, TGF-α, LPS and amphiregulin on MUC5AC hyper-production in airways

[251]. Further, tobacco smoke activates of AP-1 resulting in induction of MUC5AC, independent

of oxygen radical mediated EGFR and JNK activation [252]. Cigarette smoke-induced EGFR and

CLCA1 affects the production of MUC5AC as a part of a single complex signaling pathway 38

[253]. Further, it was demonstrated that inflammatory cytokine IL-13, lung toxicants [cigarette

smoke total particulate matter (TPM), and cigarette smoke constituent-acrolein] increased the

percentage of MUC5AC positive cells and induced a profound effect on cellular differentiation

[254]. An association of MCP-1 expression with increased MUC5AC expression in the airway

epithelium of smokers has been demonstrated. MCP-1 induced expression of MUC5AC by

initiating interaction of its receptor CCR2B with G(q) subunits in caveolae and subsequent PLCβ,

PKC and ERK1/2 activation [255]. Overall, the therapeutic utility of targeting MCP-1 to

attenuate CS-induced mucus hypersecretion in COPD patients was underscored [255]. Yu et al.

reported that NRG1β/ErbB3 signaling via the MAPK and PI3K signal pathways mediates

induction of MUC5AC in CS-exposed airway epithelial cells (16HBE) [256]. Also, cigarette smoke exposed lungs produce growth differentiation factor 15 (GDF15) that activates PI3K pathway to promote MUC5AC production [257]. Cigarette smoke exposure results in increased

SP1 nuclear translocation and binding to MUC5AC promoter region to induce MUC5AC gene

transcription [258]. Interestingly, cigarette smoke causes increased inflammation in middle ear

epithelial cells resulting in increased expression of MUC5AC via EGFR signaling, implicating in

otitis media with effusion [72].

Multiple studies were done with an objective to find ways to alleviate manifestations

associated with increased expression of MUC5AC devised multiple strategies to modulate

cigarette smoke-mediated induction of MUC5AC. To mention a few, Lee et al. observed through

in-vitro and in vivo studies that rebamipide inhibits cigarette smoke-induced TNF-α release and

MUC5AC production [259]. The same group investigated the effect of PPAR-γ agonist

(Rosiglitazone) and observed that these agonists inhibit cigarette smoke-induced MUC5AC

production by upregulating PTEN signaling and downregulating AKT expression [260]. In an

interesting revelation utility of the powerful anti-inflammatory and antioxidant enzyme Heme

oxygenase-1 (HO-1) in attenuation of cigarette smoke-mediated airway mucus hypersecretion in 39

animals and humans was emphasized [261]. Cortijo et al. underscored the clinical efficacy of aclidinium (long-acting muscarinic antagonist) for suppressing cigarette smoke-induced

MUC5AC overexpression in human airway epithelial cells [262]. Interestingly, cigarette smoke significantly modulates expression of GAD67 gene (rate limiting enzyme in GABA synthesis) in small and large airway epithelium of smokers. A significant positive correlation was revealed between GAD67 gene expression and MUC5AC expression. Hence, GAD67 was considered to be a novel therapeutic target to curb manifestations of mucus overproduction due to smoking

[263]. Fu et al. reported that Ly-6 protein (Lynx1) agonists or mimetic could be utilized to attenuate MUC5AC production in CS-induced pathologies, due to its ability to negatively regulate α7nAChR downstream signaling mediated by inhibition of Src activation [264].

9. Conclusions and perspectives

Extensive research efforts in last decade established mucins as one of the clinically relevant molecules. Under physiological conditions, mucin glycoproteins primarily function to provide protection against various ambient stimuli, lubrication and for the establishment of homeostasis at the epithelial surfaces lining the internal organs of the body. Mucins also participate in different diseases including inflammatory, benign and malignant conditions. One such mucin that has been extensively studied in last decade is secretory mucin MUC5AC. MUC5AC has been associated with protection and lubrication to multiple organs such as conjunctiva, lungs, stomach, and endocervix by its property of forming polymeric gels over epithelial surfaces of these organs. It has been assumed that MUC5AC plays a critical role in the innate mucosal defense in these organs along with mucociliary defense in the airways. Lack of appropriate models mimicking the pathological contexts hindered understanding of the exact contextual roles played by MUC5AC.

However, with the advent of genetically engineered mouse models, our understanding of the mechanisms associated with MUC5AC mediated processes are getting refined, but they are far from being clearly elucidated. For an example, despite information about MUC5AC expression in 40

endocervix, nothing is indicated about its role in the reproductive process. Besides, the differences in anatomy and physiology of rodents and humans are also a disadvantage in fully understanding the exact functions and exploiting them to therapeutic benefit.

Much progress has been made to elucidate the major domains, structure and assembly of

MUC5AC. However, not much has been done to understand exact roles of these domains in different contexts. Moreover, information about molecular interacting partners of MUC5AC needs extensive research. It has been assumed that by its cysteine-rich D-domains and vWF-like domains, MUC5AC may interact with other proteins having similar domains. As a component of mucus, through ionic or hydrophobic interactions, it might even interact with other mucins and play an important role in maintaining the stability of mucus. However, this warrants further investigations. Most of the previous studies for identifying mucin-interacting proteins were conducted under conditions that disrupted mucin interactions within mucus. Since MUC5AC is a secretory mucin, therefore it is important to identify its associated molecules without disrupting the mucus gel, thus providing clarity on nature of the MUC5AC barrier, and the interactions holding it together. The knowledge gained will help to devise strategies for better facilitation of pharmaceuticals and gene therapy agents across MUC5AC polymeric gel barrier.

Looking at the aberrant alterations of MUC5AC in multiple pathological states significant efforts were invested to comprehend mechanisms of its regulation, utility as early stage diagnostic marker, prognostic marker, and its functions in different contexts. Substantial strides were made to characterize promoter of MUC5AC and understand the transcriptional, epigenetic mechanisms associated with MUC5AC expression, in cell and tissue-specific manner, and explain how its aberrant expression occurs in inflammatory, benign conditions and carcinogenesis. The biggest challenge that remained was the procurement; processing and absolute quantification of MUC5AC levels in samples from healthy versus diseased states.

Therefore, the lack of current understanding regarding the levels to which altered MUC5AC 41

levels should be titrated has impacted appropriate therapeutic targeting of this mucin, rendering mixed outcomes. Further, some studies recently highlighted post-transcriptional regulation of

MUC5AC mediated by miRNAs in different pathologies providing an underexplored field with a huge promise to explore further.

Another area that demands extensive attention be the characterization of post- translational modifications such as differential glycosylations associated with MUC5AC, specifically during different disease states in comparison to the healthy individuals. The knowledge gained from here can be employed to devise better diagnostic markers and disease- specific therapeutic modalities. Interestingly, extensive efforts are currently being made to utilize

MUC5AC in conjunction with other markers as an early stage diagnostic marker of cholangiocarcinoma and pancreatic ductal adenocarcinoma. Interestingly, recent studies have linked genetic variants of MUC5AC to be involved in predisposition to cystic fibrosis and gastric cancers. Functional variations in MUC5AC owing to variations in domain structure and regulatory regions resulting in different pathologies are also emerging. Interestingly, not much has been investigated concerning aberrant assembly of MUC5AC due to genetic polymorphisms, stress conditions such as hypoxia and smoking, which may predispose individuals to various disease conditions and malignancies.

Contradictory roles of MUC5AC have been demonstrated in different malignancies like gastric cancer and pancreatic cancer. It would be interesting to comprehend how the pathological context and associated microenvironment impacts the various roles played by MUC5AC. Future studies can focus on extensively understanding the mechanisms related to roles played by

MUC5AC in various malignancies. Further, it will be important to take cues from the mechanisms associated with clearance of overexpressed and hypersecreted MUC5AC in airway diseases. These cues could be of help in developing therapeutic strategies for clearance of

MUC5AC in malignancies having overexpression of MUC5AC. Finally, the promise and the 42

driving objective of research on MUC5AC is the opportunity to discover novel diagnostic markers for different cancers and new therapies that can normalize its levels under different pathological conditions. 43

Figure 1.1: Schematic representation of genomic and structural organization of MUC5AC:

MUC5AC gene is located within a single 400-kb genomic DNA segment on chromosome 11 in the subtelomeric locus 11p15.5. On this locus MUC5AC is clustered with four other mucin genes in a sequence MUC6-MUC2-MUC5AC-MUC5B from telomere to centromere. The array indicates direction of transcription (not to scale). MUC6 transcribes in opposite direction to

MUC2, MUC5AC and MUC5B. The genomic DNA of MUC5AC transcribes to ~17.5 kb of

mRNA that is made up of 49 exons. The large central exon is predicted to be exon 31. MUC5AC

mRNA translates to a multidomain protein of ~5654 amino acids. Protein structure of MUC5AC

is broadly divided into N-terminus, Tandem repeat region and C-terminus. The N-terminus is

made up of a 19 amino acid leader peptide and four von Willebrand factor type D domains-D1,

D2, D’ and D3. The D1 domain also contains a leucine zipper pattern. The tandem repeat region

consists of nine CysD domains and four proline, threonine and serine rich tandem repeats (TR1-

TR4). The C-terminus of MUC5AC is made up of D4, B, C (von Willebrand factor type C domain) and CK (cysteine knot domain) domains. D4 domain contains a GDPH putative cleavage site. 44

Figure1.1

45

Table 1.1: Normal expression of MUC5AC in the human body

S. No. Organ epithelium Physiological presence Reference 1 Conjunctiva/ocular surface + [36, 39] 2 Eustachian tube + [37] Middle ear + [38] 3 Salivary glands Poorly detected [104] 4 Nasopharyngeal mucosa + [265] 5 Esophagus - [82] 6 Breast - [119] 7 Lung + [12] 8 Stomach + [42] 9 Gall bladder/ intrahepatic bile ducts + [46, 138] 10 Pancreas - [94] 11 Ileum - [99] 12 Colon - [49] 13 Endocervix + [45] 14 Sebum cells in epidermis + [50] Normal Skin - [217]

15 Prostate - [119] 16 Urothelial cells - [209]

46

Table 1.2: Expression of MUC5AC in inflammatory and benign conditions

S. No. Benign conditions Altered expression Reference 1 Allergic rhinitis Increased [52] 2 Chronic rhinosinusitis Increased [62] 3 Otitis media with effusion Increased [40] 4 Asthma Increased [29] Chronic obstructive 5 Increased [29] pulmonary disease 6 Cystic fibrosis Increased [77] Decreased [78]

7 Barrett's esophagus Increased [82] 8 Helicobacter pylori infection Decreased [88] 9 Pancreatitis Increased [96] 10 Ulcerative colitis Increased [101] 11 Crohn's disease Increased [99]

47

Table 1.3: Expression and associated role of MUC5AC in different malignancies

S. No. Cancer Altered expression Association to cancer Reference 1 Salivary gland carcinoma Increased higher grade tumor [106] Post-operative relapse [113] 2 Lung cancer Increased Post-operative distant metastasis, Shorter [117] survival 3 Breast cancer Increased Shorter disease free survival [125] 4 Gastric cancer Decreased Shorter survival [133] Higher tumor stage, Increased invasion [134-136] 5 Gall bladder cancer Decreased Decreased overall survival [139, 140] 6 Cholangiocarcinoma Increased More advanced tumors [146] Neural invasion [148] Poor prognosis [23, 147] 7 Pancreatic cancer Increased Better survival [155, 163, 166] Shorter survival [164] Lymph node metastasis [165] 8 Colorectal cancer Increased Less aggressive [187] Increased tumor grade [25] Increased invasion [189] 9 Ovarian cancer Increased Increased invasion [201] 10 Cervical cancer Decreased Poor survival [204] 11 Prostate cancer Absent NA [207, 208] 12 Urothelial bladder cancer Increased No correlation with survival [209] 13 Extramammary Paget's disease Increased Invasive lesions and metastatic lymph nodes [218] 14 Pseudomyxoma peritonei Increased NA [221, 222] 48

Reference List

[1] M.A. Hollingsworth and B.J. Swanson, Mucins in cancer: protection and control of the cell surface. Nat. Rev. Cancer 4 (2004) 45-60.

[2] M.A. Macha, S.R. Krishn, R. Jahan, K. Banerjee, S.K. Batra, and M. Jain, Emerging potential of natural products for targeting mucins for therapy against inflammation and cancer. Cancer Treat. Rev. 41 (2015) 277-288.

[3] S. Kaur, S. Kumar, N. Momi, A.R. Sasson, and S.K. Batra, Mucins in pancreatic cancer and its microenvironment. Nat. Rev. Gastroenterol. Hepatol. 10 (2013) 607-620.

[4] D.W. Kufe, Mucins in cancer: function, prognosis and therapy. Nat. Rev. Cancer 9 (2009) 874-885.

[5] S. Rachagani, M.P. Torres, N. Moniaux, and S.K. Batra, Current status of mucins in the diagnosis and therapy of cancer. Biofactors 35 (2009) 509-527.

[6] S. Bafna, S. Kaur, and S.K. Batra, Membrane-bound mucins: the mechanistic basis for alterations in the growth and survival of cancer cells. Oncogene 29 (2010) 2893-2904.

[7] D.J. Thornton, K. Rousseau, and M.A. McGuckin, Structure and function of the polymeric mucins in airways mucus. Annu. Rev. Physiol 70 (2008) 459-486.

[8] J.L. Desseyn, J.P. Aubert, N. Porchet, and A. Laine, Evolution of the large secreted gel- forming mucins. Mol. Biol. Evol. 17 (2000) 1175-1184.

[9] D. Meezaman, P. Charles, E. Daskal, M.H. Polymeropoulos, B.M. Martin, and M.C. Rose, Cloning and analysis of cDNA encoding a major airway glycoprotein, human tracheobronchial mucin (MUC5). J. Biol. Chem. 269 (1994) 12932-12939.

[10] V.C. Nguyen, J.P. Aubert, M.S. Gross, N. Porchet, P. Degand, and J. Frezal, Assignment of human tracheobronchial mucin gene(s) to 11p15 and a tracheobronchial mucin-related sequence to chromosome 13. Hum. Genet. 86 (1990) 167-172.

[11] D. Guyonnet, V, J.P. Audie, V. Debailleul, A. Laine, M.P. Buisine, S. Galiegue- Zouitina, P. Pigny, P. Degand, J.P. Aubert, and N. Porchet, Characterization of the human mucin gene MUC5AC: a consensus cysteine-rich domain for 11p15 mucin genes?. Biochem. J. 305 ( Pt 1) (1995) 211-219.

[12] M.C. Rose and J.A. Voynow, Respiratory tract mucin genes and mucin glycoproteins in health and disease. Physiol Rev. 86 (2006) 245-278.

[13] O.W. Williams, A. Sharafkhaneh, V. Kim, B.F. Dickey, and C.M. Evans, Airway mucus: From production to secretion. Am. J. Respir. Cell Mol. Biol. 34 (2006) 527- 536.

49

[14] S. Val, H.J. Kwon, M.C. Rose, and D. Preciado, Middle Ear Response of Muc5ac and Muc5b Mucins to Nontypeable Haemophilus influenzae. JAMA Otolaryngol. Head Neck Surg. 141 (2015) 997-1005. [15] Q. Luo, Z. Zhang, D. Liu, K. Feng, X. Jin, and J. Zhang, Human neutrophil elastase induces MUC5AC overexpression in chronic rhinosinusitis through tumour necrosis factor-alpha converting enzyme. Acta Otolaryngol.2016) 1-8.

[16] K.C. Kim, Role of epithelial mucins during airway infection. Pulm. Pharmacol. Ther. 25 (2012) 415-419.

[17] Y. Niv, Helicobacter pylori and gastric mucin expression: A systematic review and meta-analysis. World J. Gastroenterol. 21 (2015) 9430-9436.

[18] T. Mizoshita, S. Tanida, H. Tsukamoto, K. Ozeki, T. Katano, H. Nishiwaki, M. Ebi, Y. Mori, E. Kubota, H. Kataoka, T. Kamiya, and T. Joh, Adalimumab Treatment in Biologically Naive Crohn's Disease: Relationship with Ectopic MUC5AC Expression and Endoscopic Improvement. Gastroenterol. Res. Pract. 2014 (2014) 687257.

[19] A. Bobrowski, M. Spitzner, S. Bethge, F. Mueller-Graf, B. Vollmar, and D. Zechner, Risk factors for pancreatic ductal adenocarcinoma specifically stimulate pancreatic duct glands in mice. Am. J. Pathol. 182 (2013) 965-974.

[20] I. Lakshmanan, S. Rachagani, R. Hauke, S.R. Krishn, S. Paknikar, P. Seshacharyulu, S. Karmakar, R.K. Nimmakayala, G. Kaushik, S.L. Johansson, G.B. Carey, M.P. Ponnusamy, S. Kaur, S.K. Batra, and A.K. Ganti, MUC5AC interactions with integrin beta4 enhances the migration of lung cancer cells through FAK signaling. Oncogene(2016).

[21] S.M. Kim, C.H. Kwon, N. Shin, d.Y. Park, H.J. Moon, G.H. Kim, and T.Y. Jeon, Decreased Muc5AC expression is associated with poor prognosis in gastric cancer. Int. J. Cancer 134 (2014) 114-124.

[22] S. Inaguma, K. Kasai, and H. Ikeda, GLI1 facilitates the migration and invasion of pancreatic cancer cells through MUC5AC-mediated attenuation of E-cadherin. Oncogene 30 (2011) 714-723.

[23] T. Abe, H. Amano, F. Shimamoto, M. Hattori, S. Kuroda, T. Kobayashi, H. Tashiro, and H. Ohdan, Prognostic evaluation of mucin-5AC expression in intrahepatic cholangiocarcinoma, mass-forming type, following hepatectomy. Eur. J. Surg. Oncol. 41 (2015) 1515-1521.

[24] E. Danese, O. Ruzzenente, A. Ruzzenente, C. Iacono, F. Bertuzzo, M. Gelati, S. Conci, S. Bendinelli, G. Bonizzato, A. Guglielmi, G.L. Salvagno, G. Lippi, and G.C. Guidi, Assessment of bile and serum mucin5AC in cholangiocarcinoma: diagnostic performance and biologic significance. Surgery 156 (2014) 1218-1224.

[25] M.V. Kesari, V.L. Gaopande, A.R. Joshi, S.V. Babanagare, B.P. Gogate, and A.V. Khadilkar, Immunohistochemical study of MUC1, MUC2 and MUC5AC in colorectal carcinoma and review of literature. Indian J. Gastroenterol. 34 (2015) 63-67.

50

[26] D.R. Curran and L. Cohn, Advances in mucous cell metaplasia: a plug for mucus as a therapeutic focus in chronic airway disease. Am. J. Respir. Cell Mol. Biol. 42 (2010) 268-275.

[27] J.L. Desseyn, J.P. Aubert, N. Porchet, and A. Laine, Evolution of the large secreted gel- forming mucins. Mol. Biol. Evol. 17 (2000) 1175-1184.

[28] D.J. Thornton, K. Rousseau, and M.A. McGuckin, Structure and function of the polymeric mucins in airways mucus. Annu. Rev. Physiol 70 (2008) 459-486.

[29] D.R. Curran and L. Cohn, Advances in mucous cell metaplasia: a plug for mucus as a therapeutic focus in chronic airway disease. Am. J. Respir. Cell Mol. Biol. 42 (2010) 268-275.

[30] X. Guo, S. Zheng, H. Dang, R.G. Pace, J.R. Stonebraker, C.D. Jones, F. Boellmann, G. Yuan, P. Haridass, O. Fedrigo, D.L. Corcoran, M.A. Seibold, S.S. Ranade, M.R. Knowles, W.K. O'Neal, and J.A. Voynow, Genome reference and sequence variation in the large repetitive central exon of human MUC5AC. Am. J. Respir. Cell Mol. Biol. 50 (2014) 223-232.

[31] F. Escande, J.P. Aubert, N. Porchet, and M.P. Buisine, Human mucin gene MUC5AC: organization of its 5'-region and central repetitive region. Biochem. J. 358 (2001) 763- 772.

[32] J.L. Desseyn, M.P. Buisine, N. Porchet, J.P. Aubert, and A. Laine, Genomic organization of the human mucin gene MUC5B. cDNA and genomic sequences upstream of the large central exon. J. Biol. Chem. 273 (1998) 30157-30164.

[33] J.H. van de Bovenkamp, C.M. Hau, G.J. Strous, H.A. Buller, J. Dekker, and A.W. Einerhand, Molecular cloning of human gastric mucin MUC5AC reveals conserved cysteine-rich D-domains and a putative leucine zipper motif. Biochem. Biophys. Res. Commun. 245 (1998) 853-859.

[34] M.P. Buisine, J.L. Desseyn, N. Porchet, P. Degand, A. Laine, and J.P. Aubert, Genomic organization of the 3'-region of the human MUC5AC mucin gene: additional evidence for a common ancestral gene for the 11p15.5 mucin gene family. Biochem. J. 332 ( Pt 3) (1998) 729-738.

[35] M.E. Lidell and G.C. Hansson, Cleavage in the GDPH sequence of the C-terminal cysteine-rich part of the human MUC5AC mucin. Biochem. J. 399 (2006) 121-129.

[36] C.K. Marko, A.S. Tisdale, S. Spurr-Michaud, C. Evans, and I.K. Gipson, The ocular surface phenotype of Muc5ac and Muc5b null mice. Invest Ophthalmol. Vis. Sci. 55 (2014) 291-300.

[37] J. Lin, V. Tsuprun, H. Kawano, M.M. Paparella, Z. Zhang, R. Anway, and S.B. Ho, Characterization of mucins in human middle ear and Eustachian tube. Am. J. Physiol Lung Cell Mol. Physiol 280 (2001) L1157-L1167. 51

[38] J.E. Kerschner, Mucin gene expression in human middle ear epithelium. Laryngoscope 117 (2007) 1666-1676.

[39] I.K. Gipson, Distribution of mucins at the ocular surface. Exp. Eye Res. 78 (2004) 379- 388.

[40] J.E. Kerschner, S. Tripathi, P. Khampang, and B.C. Papsin, MUC5AC expression in human middle ear epithelium of patients with otitis media. Arch. Otolaryngol. Head Neck Surg. 136 (2010) 819-824.

[41] C.J. Reid and A. Harris, Developmental expression of mucin genes in the human gastrointestinal system. Gut 42 (1998) 220-226.

[42] P.R. Hoorens, M. Rinaldi, R.W. Li, B. Goddeeris, E. Claerebout, J. Vercruysse, and P. Geldhof, Genome wide analysis of the bovine mucin genes and their gastrointestinal transcription profile. BMC. Genomics 12 (2011) 140.

[43] S.Y. Nam, N. Kim, C.S. Lee, K.D. Choi, H.S. Lee, H.C. Jung, and I.S. Song, Gastric mucosal protection via enhancement of MUC5AC and MUC6 by geranylgeranylacetone. Dig. Dis. Sci. 50 (2005) 2110-2120.

[44] N. Navabi, M.E. Johansson, S. Raghavan, and S.K. Linden, Helicobacter pylori infection impairs the mucin production rate and turnover in the murine gastric mucosa. Infect. Immun. 81 (2013) 829-837.

[45] I.K. Gipson, S.B. Ho, S.J. Spurr-Michaud, A.S. Tisdale, Q. Zhan, E. Torlakovic, J. Pudney, D.J. Anderson, N.W. Toribara, and J.A. Hill, III, Mucin genes expressed by human female reproductive tract epithelia. Biol. Reprod. 56 (1997) 999-1011.

[46] M. Sasaki, T. Yamato, Y. Nakanuma, S.B. Ho, and Y.S. Kim, Expression of MUC2, MUC5AC and MUC6 apomucins in carcinoma, dysplasia and non-dysplastic epithelia of the gallbladder. Pathol. Int. 49 (1999) 38-44.

[47] A. Vilkin, I. Nudelman, S. Morgenstern, A. Geller, D.Y. Bar, Z. Levi, G. Rodionov, B. Hardy, F. Konikoff, D. Gobbic, and Y. Niv, Gallbladder inflammation is associated with increase in mucin expression and pigmented stone formation. Dig. Dis. Sci. 52 (2007) 1613-1620.

[48] M.P. Buisine, L. Devisme, T.C. Savidge, C. Gespach, B. Gosselin, N. Porchet, and J.P. Aubert, Mucin gene expression in human embryonic and fetal intestine. Gut 43 (1998) 519-524.

[49] M.P. Buisine, J.P. Aubert, W.A. Walker, and T.C. Savidge, Developmental patterns of mucin gene expression in human fetal small intestinal xenografts maintained in severe- combined immunodeficient mice. Pediatr. Res. 53 (2003) 898-904.

[50] V. Ferretti, A. Segal-Eiras, C.G. Barbeito, and M.V. Croce, Muc5ac mucin expression during rat skin development. Eur. J. Histochem. 59 (2015) 2462. 52

[51] H. Lin, C. Zheng, J. Li, C. Yang, and L. Hu, Lentiviral shRNA against KCa3.1 inhibits allergic response in allergic rhinitis and suppresses mast cell activity via PI3K/AKT signaling pathway. Sci. Rep. 5 (2015) 13127.

[52] C. Ji and Y. Guo, [The expression of mucins gene in the human nasal polyps and allergic rhinitis]. Lin. Chung Er. Bi Yan. Hou Tou. Jing. Wai Ke. Za Zhi. 23 (2009) 923-5, 929.

[53] Y.M. Kim, T.B. Won, S.W. Kim, Y.G. Min, C.H. Lee, and C.S. Rhee, Histamine induces MUC5AC expression via a hCLCA1 pathway. Pharmacology 80 (2007) 219- 226.

[54] W. Wu, H. Zhen, Y. Cui, H. Chu, and L. Wang, [Expression and clinical significance of calcium-activated chloride channel and mucins in nasal mucosa with allergic rhinitis]. Lin. Chung Er. Bi Yan. Hou Tou. Jing. Wai Ke. Za Zhi. 24 (2010) 193-5, 199.

[55] Z. Wang, P. Li, Y. Li, Q. Zhang, Q. Qu, and Y. Qi, [A preliminary study on the regulation mechanism of p38MAPK on MUC5AC in allergic rhinitis]. Lin. Chung Er. Bi Yan. Hou Tou. Jing. Wai Ke. Za Zhi. 25 (2011) 943-946. [56] W. Wang and M. Zheng, Mucin 5 subtype AC expression and upregulation in the nasal mucosa of allergic rhinitis rats. Otolaryngol. Head Neck Surg. 147 (2012) 1012-1019.

[57] H. Tang, H. Wang, J. Bai, M. Ding, W. Liu, W. Xia, Q. Luo, G. Xu, H. Li, and J. Fang, Sensitivity of MUC5AC to topical corticosteroid is negatively associated with interleukin-17A in patients with allergic rhinitis. Am. J. Rhinol. Allergy 26 (2012) 359- 364.

[58] W. Liu, R. Luo, Y. Chen, C. Sun, J. Wang, L. Zhou, Y. Li, and L. Deng, Interleukin-31 promotes helper T cell type-2 inflammation in children with allergic rhinitis. Pediatr. Res. 77 (2015) 20-28.

[59] S.A. Shah, H. Ishinaga, B. Hou, M. Okano, and K. Takeuchi, Effects of interleukin-31 on MUC5AC gene expression in nasal allergic inflammation. Pharmacology 91 (2013) 158-164.

[60] D.H. Kim, H.S. Chu, J.Y. Lee, S.J. Hwang, S.H. Lee, and H.M. Lee, Up-regulation of MUC5AC and MUC5B mucin genes in chronic rhinosinusitis. Arch. Otolaryngol. Head Neck Surg. 130 (2004) 747-752.

[61] G.Q. Ding and C.Q. Zheng, The expression of MUC5AC and MUC5B mucin genes in the mucosa of chronic rhinosinusitis and nasal polyposis. Am. J. Rhinol. 21 (2007) 359-366.

[62] Y.J. Mao, H.H. Chen, B. Wang, X. Liu, and G.Y. Xiong, Increased expression of MUC5AC and MUC5B promoting bacterial biofilm formation in chronic rhinosinusitis patients. Auris Nasus Larynx 42 (2015) 294-298.

[63] H. Ishinaga, S.A. Shah, H. Sakaida, and K. Takeuchi, The role of transforming growth factor-alpha on mucin overproduction in eosinophilic chronic rhinosinusitis. Pharmacology 88 (2011) 302-308. 53

[64] J. Jiao, S. Duan, N. Meng, Y. Li, E. Fan, and L. Zhang, Role of IFN-gamma, IL-13, and IL-17 on mucociliary differentiation of nasal epithelial cells in chronic rhinosinusitis with nasal polyps. Clin. Exp. Allergy 46 (2016) 449-460.

[65] Y. Zhang, X. Wang, H. Wang, J. Jiao, Y. Li, E. Fan, L. Zhang, and C. Bachert, TMEM16A-Mediated Mucin Secretion in IL-13-Induced Nasal Epithelial Cells From Chronic Rhinosinusitis Patients. Allergy Asthma Immunol. Res. 7 (2015) 367-375.

[66] N. Ono, T. Kusunoki, and K. Ikeda, Relationships between IL-17A and macrophages or MUC5AC in eosinophilic chronic rhinosinusitis and proposed pathological significance. Allergy Rhinol. (Providence. ) 3 (2012) e50-e54.

[67] J. Lin, V. Tsuprun, H. Kawano, M.M. Paparella, Z. Zhang, R. Anway, and S.B. Ho, Characterization of mucins in human middle ear and Eustachian tube. Am. J. Physiol Lung Cell Mol. Physiol 280 (2001) L1157-L1167.

[68] M.L. Ubell, P. Khampang, and J.E. Kerschner, Mucin gene polymorphisms in otitis media patients. Laryngoscope 120 (2010) 132-138.

[69] S.K. Moon, J.H. Yoo, H.N. Kim, D.J. Lim, and M.H. Chung, Effects of retinoic acid, triiodothyronine and hydrocortisone on mucin and lysozyme expression in cultured human middle ear epithelial cells. Acta Otolaryngol. 120 (2000) 944-949. [70] Y.T. Kim, H.H. Jung, T.O. Ko, and S.J. Kim, Up-regulation of MUC5AC mRNA expression in endotoxin-induced otitis media. Acta Otolaryngol. 121 (2001) 364-370.

[71] J. Lee, K. Komatsu, B.C. Lee, J.H. Lim, H. Jono, H. Xu, H. Kai, Z.J. Zhang, C. Yan, and J.D. Li, Phosphodiesterase 4B mediates extracellular signal-regulated kinase- dependent up-regulation of mucin MUC5AC protein by Streptococcus pneumoniae by inhibiting cAMP-protein kinase A-dependent MKP-1 phosphatase pathway. J. Biol. Chem. 287 (2012) 22799-22811.

[72] J.G. Cho, J.S. Woo, H.M. Lee, H.H. Jung, S.J. Hwang, and S. Chae, Effects of cigarette smoking on mucin production in human middle ear epithelial cells. Int. J. Pediatr. Otorhinolaryngol. 73 (2009) 1447-1451.

[73] J.A. Voynow, S.J. Gendler, and M.C. Rose, Regulation of mucin genes in chronic inflammatory airway diseases. Am. J. Respir. Cell Mol. Biol. 34 (2006) 661-665.

[74] K.C. Kim, Role of epithelial mucins during airway infection. Pulm. Pharmacol. Ther. 25 (2012) 415-419.

[75] C.M. Evans, K. Kim, M.J. Tuvim, and B.F. Dickey, Mucus hypersecretion in asthma: causes and effects. Curr. Opin. Pulm. Med. 15 (2009) 4-11.

[76] S. Kirkham, J.K. Sheehan, D. Knight, P.S. Richardson, and D.J. Thornton, Heterogeneity of airways mucus: variations in the amounts and glycoforms of the major oligomeric mucins MUC5AC and MUC5B. Biochem. J. 361 (2002) 537-546. 54

[77] M.O. Henke, G. John, M. Germann, H. Lindemann, and B.K. Rubin, MUC5AC and MUC5B mucins increase in cystic fibrosis airway secretions during pulmonary exacerbation. Am. J. Respir. Crit Care Med. 175 (2007) 816-821.

[78] M.O. Henke, A. Renner, R.M. Huber, M.C. Seeds, and B.K. Rubin, MUC5AC and MUC5B Mucins Are Decreased in Cystic Fibrosis Airway Secretions. Am. J. Respir. Cell Mol. Biol. 31 (2004) 86-91.

[79] X. Guo, R.G. Pace, J.R. Stonebraker, C.W. Commander, A.T. Dang, M.L. Drumm, A. Harris, F. Zou, D.M. Swallow, F.A. Wright, W.K. O'Neal, and M.R. Knowles, Mucin variable number tandem repeat polymorphisms and severity of cystic fibrosis lung disease: significant association with MUC5AC. PLoS. One. 6 (2011) e25452.

[80] P. Thai, A. Loukoianov, S. Wachi, and R. Wu, Regulation of airway mucin gene expression. Annu. Rev. Physiol 70 (2008) 405-429. [81] Y. Niv and R. Fass, The role of mucin in GERD and its complications. Nat. Rev. Gastroenterol. Hepatol. 9 (2012) 55-59.

[82] J.N. Glickman, P.L. Blount, C.A. Sanchez, D.S. Cowan, V.J. Wongsurawat, B.J. Reid, and R.D. Odze, Mucin core polypeptide expression in the progression of neoplasia in Barrett's esophagus. Hum. Pathol. 37 (2006) 1304-1315.

[83] S. Song, J.C. Byrd, S. Guha, K.F. Liu, D. Koul, and R.S. Bresalier, Induction of MUC5AC mucin by conjugated bile acids in the esophagus involves the phosphatidylinositol 3-kinase/protein kinase C/activator protein-1 pathway. Cancer 117 (2011) 2386-2397.

[84] S.C. Burjonrappa, S. Reddimasu, Z. Nawaz, X. Gao, P. Sharma, and B. Loggie, Mucin expression profile in Barrett's, dysplasia, adenocarcinoma sequence in the esophagus. Indian J. Cancer 44 (2007) 1-5.

[85] I.S. Brown, D.C. Whiteman, and G.Y. Lauwers, Foveolar type dysplasia in Barrett esophagus. Mod. Pathol. 23 (2010) 834-843.

[86] S. Sue, W. Shibata, E. Kameta, T. Sato, Y. Ishii, H. Kaneko, H. Miwa, T. Sasaki, T. Tamura, M. Kondo, and S. Maeda, Intestine-specific homeobox (ISX) induces intestinal metaplasia and cell proliferation to contribute to gastric carcinogenesis. J. Gastroenterol.(2016).

[87] Y. Niv, H. pylori/NSAID--negative peptic ulcer--the mucin theory. Med. Hypotheses 75 (2010) 433-435.

[88] J.S. Park, J.S. Yeom, J.H. Seo, J.Y. Lim, C.H. Park, H.O. Woo, H.S. Youn, J.S. Jun, J.H. Park, G.H. Ko, S.C. Baik, W.K. Lee, M.J. Cho, and K.H. Rhee, Immunohistochemical Expressions of MUC2, MUC5AC, and MUC6 in Normal, Helicobacter pylori Infected and Metaplastic Gastric Mucosa of Children and Adolescents. Helicobacter. 20 (2015) 260-268.

[89] B. Kocer, M. Ulas, Y. Ustundag, S. Erdogan, M. Karabeyoglu, O. Yldrm, B. Unal, O. Cengiz, and A. Soran, A confirmatory report for the close interaction of Helicobacter 55

pylori with gastric epithelial MUC5AC expression. J. Clin. Gastroenterol. 38 (2004) 496-502.

[90] D. Shi, X.M. Qiu, and Y.F. Bao, Effects of Helicobacter pylori infection on MUC5AC protein expression in gastric cancer. Future. Oncol. 9 (2013) 115-120.

[91] D. Shi, X.M. Qiu, and X.J. Yan, The changes in MUC5AC expression in gastric cancer before and after Helicobacter pylori eradication. Clin. Res. Hepatol. Gastroenterol. 38 (2014) 235-240. [92] S. Tanaka, M. Mizuno, T. Maga, F. Yoshinaga, J. Tomoda, J. Nasu, H. Okada, K. Yokota, K. Oguma, Y. Shiratori, and T. Tsuji, H. pylori decreases gastric mucin synthesis via inhibition of galactosyltransferase. Hepatogastroenterology 50 (2003) 1739-1742.

[93] P.A. Banks, D.L. Conwell, and P.P. Toskes, The management of acute and chronic pancreatitis. Gastroenterol. Hepatol. (N. Y. ) 6 (2010) 1-16.

[94] C. Balague, J.P. Audie, N. Porchet, and F.X. Real, In situ hybridization shows distinct patterns of mucin gene expression in normal, benign, and malignant pancreas tissues. Gastroenterology 109 (1995) 953-964.

[95] H. Ohtani, H. Ishida, Y. Ito, T. Yamaguchi, and M. Koizumi, Autoimmune pancreatitis and biliary intraepithelial neoplasia of the common bile duct: a case with diagnostically challenging but pathogenetically significant association. Pathol. Int. 61 (2011) 481-485.

[96] N.J. Guppy, M.E. El-Bahrawy, H.M. Kocher, K. Fritsch, Y.A. Qureshi, R. Poulsom, R.E. Jeffery, N.A. Wright, W.R. Otto, and M.R. Alison, Trefoil factor family peptides in normal and diseased human pancreas. Pancreas 41 (2012) 888-896.

[97] A. Bobrowski, M. Spitzner, S. Bethge, F. Mueller-Graf, B. Vollmar, and D. Zechner, Risk factors for pancreatic ductal adenocarcinoma specifically stimulate pancreatic duct glands in mice. Am. J. Pathol. 182 (2013) 965-974. [98] D. Boltin, T.T. Perets, A. Vilkin, and Y. Niv, Mucin function in inflammatory bowel disease: an update. J. Clin. Gastroenterol. 47 (2013) 106-111.

[99] M.P. Buisine, P. Desreumaux, E. Leteurtre, M.C. Copin, J.F. Colombel, N. Porchet, and J.P. Aubert, Mucin gene expression in intestinal epithelial cells in Crohn's disease. Gut 49 (2001) 544-551.

[100] P. Borralho, A. Vieira, J. Freitas, P. Chaves, and J. Soares, Aberrant gastric apomucin expression in ulcerative colitis and associated neoplasia. J. Crohns. Colitis. 1 (2007) 35-40. [101] M.E. Forgue-Lafitte, B. Fabiani, P.P. Levy, N. Maurin, J.F. Flejou, and J. Bara, Abnormal expression of M1/MUC5AC mucin in distal colon of patients with diverticulitis, ulcerative colitis and cancer. Int. J. Cancer 121 (2007) 1543-1549.

[102] T. Mizoshita, S. Tanida, H. Tsukamoto, K. Ozeki, T. Katano, M. Ebi, Y. Mori, H. Kataoka, T. Kamiya, and T. Joh, Colon Mucosa Exhibits Loss of Ectopic MUC5AC Expression in Patients with Ulcerative Colitis Treated with Oral Tacrolimus. ISRN. Gastroenterol. 2013 (2013) 304894. 56

[103] P. Radhakrishnan, D. Halagowder, and S.N. Devaraj, Altered expression of MUC2 and MUC5AC in response to Shigella infection, an in vivo study. Biochim. Biophys. Acta 1770 (2007) 884-889.

[104] L. Alos, B. Lujan, M. Castillo, A. Nadal, M. Carreras, M. Caballero, B.C. de, and A. Cardesa, Expression of membrane-bound mucins (MUC1 and MUC4) and secreted mucins (MUC2, MUC5AC, MUC5B, MUC6 and MUC7) in mucoepidermoid carcinomas of salivary glands. Am. J. Surg. Pathol. 29 (2005) 806-813.

[105] J.H. Lee, J.H. Lee, A. Kim, I. Kim, and Y.S. Chae, Unique expression of MUC3, MUC5AC and cytokeratins in salivary gland carcinomas. Pathol. Int. 55 (2005) 386- 390.

[106] A. Handra-Luca, G. Lamas, J.C. Bertrand, and P. Fouret, MUC1, MUC2, MUC4, and MUC5AC expression in salivary gland mucoepidermoid carcinoma: diagnostic and prognostic implications. Am. J. Surg. Pathol. 29 (2005) 881-889.

[107] K. Kusafuka, T. Ueno, K. Kurihara, T. Murata, T. Yurikusa, H. Henmi, M. Akane, Y. Ota, and T. Kameya, Cystadenoma of the palate: immunohistochemistry of mucins. Pathol. Int. 58 (2008) 524-528.

[108] K. Kusafuka, M. Maeda, M. Honda, and T. Nakajima, Mucin-rich salivary duct carcinoma with signet-ring cell feature ex pleomorphic adenoma of the submandibular gland: a case report of an unusual histology with immunohistochemical analysis and review of the literature. Med. Mol. Morphol. 45 (2012) 45-52.

[109] A. Lopez-Ferrer, V. Curull, C. Barranco, M. Garrido, J. Lloreta, F.X. Real, and B.C. de, Mucins as differentiation markers in bronchial epithelium. Squamous cell carcinoma and adenocarcinoma display similar expression patterns. Am. J. Respir. Cell Mol. Biol. 24 (2001) 22-29.

[110] M.C. Copin, M.P. Buisine, E. Leteurtre, C.H. Marquette, H. Porte, J.P. Aubert, B. Gosselin, and N. Porchet, Mucinous bronchioloalveolar carcinomas display a specific pattern of mucin gene expression among primary lung adenocarcinomas. Hum. Pathol. 32 (2001) 274-281. [111] N. Nishiumi, Y. Abe, Y. Inoue, H. Hatanaka, K. Inada, H. Kijima, H. Yamazaki, M. Tatematsu, Y. Ueyama, M. Iwasaki, H. Inoue, and M. Nakamura, Use of 11p15 mucins as prognostic factors in small adenocarcinoma of the lung. Clin. Cancer Res. 9 (2003) 5616-5619.

[112] H. Awaya, Y. Takeshima, M. Yamasaki, and K. Inai, Expression of MUC1, MUC2, MUC5AC, and MUC6 in atypical adenomatous hyperplasia, bronchioloalveolar carcinoma, adenocarcinoma with mixed subtypes, and mucinous bronchioloalveolar carcinoma of the lung. Am. J. Clin. Pathol. 121 (2004) 644-653.

[113] C.J. Yu, P.C. Yang, C.T. Shun, Y.C. Lee, S.H. Kuo, and K.T. Luh, Overexpression of MUC5 genes is associated with early post-operative metastasis in non-small-cell lung cancer. Int. J. Cancer 69 (1996) 457-465.

57

[114] K. Wakata, T. Tsuchiya, K. Tomoshige, K. Takagi, N. Yamasaki, K. Matsumoto, T. Miyazaki, A. Nanashima, J.A. Whitsett, Y. Maeda, and T. Nagayasu, A favourable prognostic marker for EGFR mutant non-small cell lung cancer: immunohistochemical analysis of MUC5B. BMJ Open. 5 (2015) e008366.

[115] C.J. Yu, C.T. Shun, P.C. Yang, Y.C. Lee, J.Y. Shew, S.H. Kuo, and K.T. Luh, Sialomucin expression is associated with erbB-2 oncoprotein overexpression, early recurrence, and cancer death in non-small-cell lung cancer. Am. J. Respir. Crit Care Med. 155 (1997) 1419-1427.

[116] C.J. Yu, J.Y. Shew, C.T. Shun, H.T. Lin, S.H. Kuo, K.T. Luh, and P.C. Yang, Quantitative analysis of mRNA encoding MUC1, MUC2, and MUC5AC genes: a correlation between specific mucin gene expression and sialomucin expression in non- small cell lung cancer. Am. J. Respir. Cell Mol. Biol. 18 (1998) 643-652.

[117] C.J. Yu, J.Y. Shih, Y.C. Lee, C.T. Shun, A. Yuan, and P.C. Yang, Sialyl Lewis antigens: association with MUC5AC protein and correlation with post-operative recurrence of non-small cell lung cancer. Lung Cancer 47 (2005) 59-67.

[118] R. Chari, K.M. Lonergan, R.T. Ng, C. MacAulay, W.L. Lam, and S. Lam, Effect of active smoking on the human bronchial epithelium transcriptome. BMC. Genomics 8 (2007) 297.

[119] S. Zhang, H.S. Zhang, C. Cordon-Cardo, G. Ragupathi, and P.O. Livingston, Selection of tumor antigens as targets for immune attack using immunohistochemistry: protein antigens. Clin. Cancer Res. 4 (1998) 2669-2676.

[120] M.B. Pereira, A.J. Dias, C.A. Reis, and F.C. Schmitt, Immunohistochemical study of the expression of MUC5AC and MUC6 in breast carcinomas and adjacent breast tissues. J. Clin. Pathol. 54 (2001) 210-213.

[121] P.G. Chu and L.M. Weiss, Immunohistochemical characterization of signet-ring cell carcinomas of the stomach, breast, and colon. Am. J. Clin. Pathol. 121 (2004) 884-892.

[122] S.I. Do, K. Kim, D.H. Kim, S.W. Chae, Y.L. Park, C.H. Park, and J.H. Sohn, Associations between the Expression of Mucins (MUC1, MUC2, MUC5AC, and MUC6) and Clinicopathologic Parameters of Human Breast Ductal Carcinomas. J. Breast Cancer 16 (2013) 152-158.

[123] S. Matsukita, M. Nomoto, S. Kitajima, S. Tanaka, M. Goto, T. Irimura, Y.S. Kim, E. Sato, and S. Yonezawa, Expression of mucins (MUC1, MUC2, MUC5AC and MUC6) in mucinous carcinoma of the breast: comparison with invasive ductal carcinoma. Histopathology 42 (2003) 26-36.

[124] E.A. Rakha, R.W. Boyce, D. Abd El-Rehim, T. Kurien, A.R. Green, E.C. Paish, J.F. Robertson, and I.O. Ellis, Expression of mucins (MUC1, MUC2, MUC3, MUC4, MUC5AC and MUC6) and their prognostic significance in human breast cancer. Mod. Pathol. 18 (2005) 1295-1304.

58

[125] S. Kasashima, A. Kawashima, Y. Zen, S. Ozaki, M. Kobayashi, A. Tsujibata, and H. Minato, Expression of aberrant mucins in lobular carcinoma with histiocytoid feature of the breast. Virchows Arch. 450 (2007) 397-403.

[126] M.D. Walsh, M.C. Cummings, S.A. Pearson, M. Clendenning, R.J. Walters, B. Nagler, J.L. Hopper, M.A. Jenkins, G.K. Suthers, J. Goldblatt, K. Tucker, M.R. Gattas, J.L. Arnold, S. Parry, F.A. Macrae, M.A. McGuckin, J.P. Young, and D.D. Buchanan, Lynch syndrome-associated breast cancers do not overexpress chromosome 11- encoded mucins. Mod. Pathol. 26 (2013) 944-954.

[127] N. Yamada, Y. Nishida, S. Yokoyama, H. Tsutsumida, I. Houjou, S. Kitamoto, M. Goto, M. Higashi, and S. Yonezawa, Expression of MUC5AC, an early marker of pancreatobiliary cancer, is regulated by DNA methylation in the distal promoter region in cancer cells. J. Hepatobiliary. Pancreat. Sci. 17 (2010) 844-854.

[128] O. Ilhan, U. Han, B. Onal, and S.Y. Celik, Prognostic significance of MUC1, MUC2 and MUC5AC expressions in gastric carcinoma. Turk. J. Gastroenterol. 21 (2010) 345- 352.

[129] J. Pinto-de-Sousa, L. David, C.A. Reis, R. Gomes, L. Silva, and A. Pimenta, Mucins MUC1, MUC2, MUC5AC and MUC6 expression in the evaluation of differentiation and clinico-biological behaviour of gastric carcinoma. Virchows Arch. 440 (2002) 304- 310.

[130] H.S. Lee, H.K. Lee, H.S. Kim, H.K. Yang, Y.I. Kim, and W.H. Kim, MUC1, MUC2, MUC5AC, and MUC6 expressions in gastric carcinomas: their roles as prognostic indicators. Cancer 92 (2001) 1427-1434.

[131] J.Y. Wang, C.T. Chang, J.S. Hsieh, L.W. Lee, T.J. Huang, C.Y. Chai, and S.R. Lin, Role of MUC1 and MUC5AC expressions as prognostic indicators in gastric carcinomas. J. Surg. Oncol. 83 (2003) 253-260.

[132] H.K. Zhang, Q.M. Zhang, T.H. Zhao, Y.Y. Li, and Y.F. Yi, Expression of mucins and E-cadherin in gastric carcinoma and their clinical significance. World J. Gastroenterol. 10 (2004) 3044-3047.

[133] S.E. Baldus, S.P. Monig, V. Arkenau, F.G. Hanisch, P.M. Schneider, J. Thiele, A.H. Holscher, and H.P. Dienes, Correlation of MUC5AC immunoreactivity with histopathological subtypes and prognosis of gastric carcinoma. Ann. Surg. Oncol. 9 (2002) 887-893.

[134] L.J. Xiao, S. Zhao, E.H. Zhao, X. Zheng, W.F. Gou, Y.N. Xing, Y. Takano, and H.C. Zheng, Clinicopathological and prognostic significance of MUC-2, MUC-4 and MUC- 5AC expression in japanese gastric carcinomas. Asian Pac. J. Cancer Prev. 13 (2012) 6447-6453. [135] J.S. Choi, M.A. Kim, H.E. Lee, H.S. Lee, and W.H. Kim, Mucinous gastric carcinomas: clinicopathologic and molecular analyses. Cancer 115 (2009) 3581-3590.

[136] C.T. Zhang, K.C. He, F. Pan, Y. Li, and J. Wu, Prognostic value of Muc5AC in gastric cancer: A meta-analysis. World J. Gastroenterol. 21 (2015) 10453-10460. 59

[137] M.P. Buisine, L. Devisme, P. Degand, M.C. Dieu, B. Gosselin, M.C. Copin, J.P. Aubert, and N. Porchet, Developmental mucin gene expression in the gastroduodenal tract and accessory digestive glands. II. Duodenum and liver, gallbladder, and pancreas. J. Histochem. Cytochem. 48 (2000) 1667-1676.

[138] B. Vandenhaute, M.P. Buisine, V. Debailleul, B. Clement, N. Moniaux, M.C. Dieu, P. Degand, N. Porchet, and J.P. Aubert, Mucin gene expression in biliary epithelial cells. J. Hepatol. 27 (1997) 1057-1066.

[139] H.J. Chang, S.W. Kim, B.L. Lee, E.K. Hong, and W.H. Kim, Phenotypic alterations of mucins and cytokeratins during gallbladder carcinogenesis. Pathol. Int. 54 (2004) 576- 584.

[140] L. Xiong, Z. Yang, L. Yang, J. Liu, and X. Miao, Expressive levels of MUC1 and MUC5AC and their clinicopathologic significances in the benign and malignant lesions of gallbladder. J. Surg. Oncol. 105 (2012) 97-103.

[141] T. Terada, Gallbladder adenocarcinoma arising in Rokitansky-Aschoff sinus. Pathol. Int. 58 (2008) 806-809.

[142] N. Dursun, O.T. Escalona, J.C. Roa, O. Basturk, P. Bagci, A. Cakir, J. Cheng, J. Sarmiento, H. Losada, S.Y. Kong, L. Ducato, M. Goodman, and N.V. Adsay, Mucinous carcinomas of the gallbladder: clinicopathologic analysis of 15 cases identified in 606 carcinomas. Arch. Pathol. Lab Med. 136 (2012) 1347-1358.

[143] Y.A. Ghouri, I. Mian, and B. Blechacz, Cancer review: Cholangiocarcinoma. J. Carcinog. 14 (2015) 1.

[144] B. Yaman, D. Nart, F. Yilmaz, A. Coker, M. Zeytunlu, and M. Kilic, Biliary intraductal papillary mucinous neoplasia: three case reports. Virchows Arch. 454 (2009) 589-594.

[145] A.S. Mall, M.G. Tyler, S.B. Ho, J.E. Krige, D. Kahn, W. Spearman, L. Myer, and D. Govender, The expression of MUC mucin in cholangiocarcinoma. Pathol. Res. Pract. 206 (2010) 805-809. [146] S.Y. Park, S.J. Roh, Y.N. Kim, S.Z. Kim, H.S. Park, K.Y. Jang, M.J. Chung, M.J. Kang, D.G. Lee, and W.S. Moon, Expression of MUC1, MUC2, MUC5AC and MUC6 in cholangiocarcinoma: prognostic impact. Oncol. Rep. 22 (2009) 649-657.

[147] C. Boonla, S. Wongkham, J.K. Sheehan, C. Wongkham, V. Bhudhisawasdi, N. Tepsiri, and C. Pairojkul, Prognostic value of serum MUC5AC mucin in patients with cholangiocarcinoma. Cancer 98 (2003) 1438-1443.

[148] C. Boonla, B. Sripa, P. Thuwajit, U. Cha-On, A. Puapairoj, M. Miwa, and S. Wongkham, MUC1 and MUC5AC mucin expression in liver fluke-associated intrahepatic cholangiocarcinoma. World J. Gastroenterol. 11 (2005) 4939-4946. [149] N. Guedj, Q. Zhan, M. Perigny, P.E. Rautou, F. Degos, J. Belghiti, O. Farges, P. Bedossa, and V. Paradis, Comparative protein expression profiles of hilar and peripheral hepatic cholangiocarcinomas. J. Hepatol. 51 (2009) 93-101.

60

[150] W. Bamrungphon, N. Prempracha, N. Bunchu, S. Rangdaeng, T. Sandhu, S. Srisukho, C. Boonla, and S. Wongkham, A new mucin antibody/enzyme-linked lectin-sandwich assay of serum MUC5AC mucin for the diagnosis of cholangiocarcinoma. Cancer Lett. 247 (2007) 301-308.

[151] A. Ruzzenente, C. Iacono, S. Conci, F. Bertuzzo, G. Salvagno, O. Ruzzenente, T. Campagnaro, A. Valdegamberi, S. Pachera, F. Bagante, and A. Guglielmi, A novel serum marker for biliary tract cancer: diagnostic and prognostic values of quantitative evaluation of serum mucin 5AC (MUC5AC). Surgery 155 (2014) 633-639.

[152] A. Silsirivanit, N. Araki, C. Wongkham, K. Vaeteewoottacharn, C. Pairojkul, K. Kuwahara, Y. Narimatsu, H. Sawaki, H. Narimatsu, S. Okada, N. Sakaguchi, and S. Wongkham, CA-S27: a novel Lewis a associated carbohydrate epitope is diagnostic and prognostic for cholangiocarcinoma. Cancer Sci. 104 (2013) 1278-1284.

[153] A. Silsirivanit, N. Araki, C. Wongkham, C. Pairojkul, Y. Narimatsu, K. Kuwahara, H. Narimatsu, S. Wongkham, and N. Sakaguchi, A novel serum carbohydrate marker on mucin 5AC: values for diagnostic and prognostic indicators for cholangiocarcinoma. Cancer 117 (2011) 3393-3403.

[154] C. Balague, J.P. Audie, N. Porchet, and F.X. Real, In situ hybridization shows distinct patterns of mucin gene expression in normal, benign, and malignant pancreas tissues. Gastroenterology 109 (1995) 953-964.

[155] S. Yonezawa, M. Horinouchi, M. Osako, M. Kubo, S. Takao, Y. Arimura, K. Nagata, S. Tanaka, K. Sakoda, T. Aikou, and E. Sato, Gene expression of gastric type mucin (MUC5AC) in pancreatic tumors: its relationship with the biological behavior of the tumor. Pathol. Int. 49 (1999) 45-54.

[156] A. Handra-Luca, J.F. Flejou, P. Rufat, O. Corcos, J. Belghiti, P. Ruszniewski, C. Degott, P. Bedossa, and A. Couvelard, Human pancreatic mucinous cystadenoma is characterized by distinct mucin, cytokeratin and CD10 expression compared with intraductal papillary-mucinous adenoma. Histopathology 48 (2006) 813-821.

[157] S. Ban, Y. Naitoh, M. Mino-Kenudson, T. Sakurai, M. Kuroda, I. Koyama, G.Y. Lauwers, and M. Shimizu, Intraductal papillary mucinous neoplasm (IPMN) of the pancreas: its histopathologic difference between 2 major types. Am. J. Surg. Pathol. 30 (2006) 1561-1569.

[158] S. Nissim, G.E. Idos, and B. Wu, Genetic markers of malignant transformation in intraductal papillary mucinous neoplasm of the pancreas: a meta-analysis. Pancreas 41 (2012) 1195-1205.

[159] J. Luttges, B. Feyerabend, T. Buchelt, M. Pacena, and G. Kloppel, The mucin profile of noninvasive and invasive mucinous cystic neoplasms of the pancreas. Am. J. Surg. Pathol. 26 (2002) 466-471.

[160] S.N. Nadig, I. Pedrosa, J.D. Goldsmith, M.P. Callery, and C.M. Vollmer, Clinical implications of mucinous nonneoplastic cysts of the pancreas. Pancreas 41 (2012) 441- 446. 61

[161] G.E. Kim, H.I. Bae, H.U. Park, S.F. Kuan, S.C. Crawley, J.J. Ho, and Y.S. Kim, Aberrant expression of MUC5AC and MUC6 gastric mucins and sialyl Tn antigen in intraepithelial neoplasms of the pancreas. Gastroenterology 123 (2002) 1052-1060.

[162] M. Matsuyama, F. Kondo, T. Ishihara, T. Yamaguchi, R. Ito, T. Tsuyuguchi, K. Tawada, and O. Yokosuka, Evaluation of pancreatic intraepithelial neoplasia and mucin expression in normal pancreata. J. Hepatobiliary. Pancreat. Sci. 19 (2012) 242-248.

[163] M. Jinfeng, W. Kimura, I. Hirai, F. Sakurai, T. Moriya, and M. Mizutani, Expression of MUC5AC and MUC6 in invasive ductal carcinoma of the pancreas and relationship with prognosis. Int. J. Gastrointest. Cancer 34 (2003) 9-18.

[164] M. Takikita, S. Altekruse, C.F. Lynch, M.T. Goodman, B.Y. Hernandez, M. Green, W. Cozen, M. Cockburn, S.M. Sibug, M. Topor, C. Zeruto, B. Abedi-Ardekani, M.E. Reichman, and S.M. Hewitt, Associations between selected biomarkers and prognosis in a population-based pancreatic cancer tissue microarray. Cancer Res. 69 (2009) 2950- 2955.

[165] Y. Takano, N. Ohike, T. Tajiri, K. Asonuma, K. Harada, H. Takahashi, and T. Morohoshi, Gastric- and intestinal-type marker expression in invasive ductal adenocarcinoma of the pancreas. Hepatobiliary. Pancreat. Dis. Int. 11 (2012) 424-428.

[166] M. Higashi, S. Yokoyama, T. Yamamoto, Y. Goto, I. Kitazono, T. Hiraki, H. Taguchi, S. Hashimoto, Y. Fukukura, C. Koriyama, Y. Mataki, K. Maemura, H. Shinchi, M. Jain, S.K. Batra, and S. Yonezawa, Mucin expression in endoscopic ultrasound-guided fine-needle aspiration specimens is a useful prognostic factor in pancreatic ductal adenocarcinoma. Pancreas 44 (2015) 728-734.

[167] K. Ohuchida, K. Mizumoto, D. Yamada, K. Fujii, N. Ishikawa, H. Konomi, E. Nagai, K. Yamaguchi, M. Tsuneyoshi, and M. Tanaka, Quantitative analysis of MUC1 and MUC5AC mRNA in pancreatic juice for preoperative diagnosis of pancreatic cancer. Int. J. Cancer 118 (2006) 405-411.

[168] T.A. Giorgadze, H. Peterman, Z.W. Baloch, E.E. Furth, T. Pasha, N. Shiina, P.J. Zhang, and P.K. Gupta, Diagnostic utility of mucin profile in fine-needle aspiration specimens of the pancreas: an immunohistochemical study with surgical pathology correlation. Cancer 108 (2006) 186-197.

[169] Y. Wang, J. Gao, Z. Li, Z. Jin, Y. Gong, and X. Man, Diagnostic value of mucins (MUC1, MUC2 and MUC5AC) expression profile in endoscopic ultrasound-guided fine-needle aspiration specimens of the pancreas. Int. J. Cancer 121 (2007) 2716-2722.

[170] T. Yue, I.J. Goldstein, M.A. Hollingsworth, K. Kaul, R.E. Brand, and B.B. Haab, The prevalence and nature of glycan alterations on specific proteins in pancreatic cancer patients revealed using antibody-lectin sandwich arrays. Mol. Cell Proteomics. 8 (2009) 1697-1707.

[171] B.B. Haab, A. Porter, T. Yue, L. Li, J. Scheiman, M.A. Anderson, D. Barnes, C.M. Schmidt, Z. Feng, and D.M. Simeone, Glycosylation variants of mucins and 62

CEACAMs as candidate biomarkers for the diagnosis of pancreatic cystic neoplasms. Ann. Surg. 251 (2010) 937-945.

[172] T. Yue, K.A. Maupin, B. Fallon, L. Li, K. Partyka, M.A. Anderson, D.E. Brenner, K. Kaul, H. Zeh, A.J. Moser, D.M. Simeone, Z. Feng, R.E. Brand, and B.B. Haab, Enhanced discrimination of malignant from benign pancreatic disease by measuring the CA 19-9 antigen on specific protein carriers. PLoS. One. 6 (2011) e29180.

[173] J. Luka, P.M. Arlen, and A. Bristol, Development of a serum biomarker assay that differentiates tumor-associated MUC5AC (NPC-1C ANTIGEN) from normal MUC5AC. J. Biomed. Biotechnol. 2011 (2011) 934757.

[174] S.P. Patel, A. Bristol, O. Saric, X.P. Wang, A. Dubeykovskiy, P.M. Arlen, and M.A. Morse, Anti-tumor activity of a novel monoclonal antibody, NPC-1C, optimized for recognition of tumor antigen MUC5AC variant in preclinical models. Cancer Immunol. Immunother. 62 (2013) 1011-1019.

[175] M. Arlen, X. Wang, J. Luka, R. Gupta, O. Saric, and P.M. Arlen, The use of specific monoclonal antibodies to target immunogenic tumor membrane proteins in patients with recurrent pancreatic and colon cancer. Curr. Drug Deliv. 9 (2012) 52-56.

[176] S. Yamazoe, H. Tanaka, T. Iwauchi, M. Yoshii, G. Ito, R. Amano, N. Yamada, T. Sawada, M. Ohira, and K. Hirakawa, Identification of HLA-A*. Pancreas 40 (2011) 896-904.

[177] D.V. Gold, G. Newsome, D. Liu, and D.M. Goldenberg, Mapping PAM4 (clivatuzumab), a monoclonal antibody in clinical trials for early detection and therapy of pancreatic ductal adenocarcinoma, to MUC5AC mucin. Mol. Cancer 12 (2013) 143.

[178] D. Liu, C.H. Chang, D.V. Gold, and D.M. Goldenberg, Identification of PAM4 (clivatuzumab)-reactive epitope on MUC5AC: a promising biomarker and therapeutic target for pancreatic cancer. Oncotarget. 6 (2015) 4274-4285.

[179] M.P. Buisine, A. Janin, V. Maunoury, J.P. Audie, M.P. Delescaut, M.C. Copin, J.F. Colombel, P. Degand, J.P. Aubert, and N. Porchet, Aberrant expression of a human mucin gene (MUC5AC) in rectosigmoid villous adenoma. Gastroenterology 110 (1996) 84-91.

[180] A.E. Bartman, S.J. Sanderson, S.L. Ewing, G.A. Niehans, C.L. Wiehr, M.K. Evans, and S.B. Ho, Aberrant expression of MUC5AC and MUC6 gastric mucin genes in colorectal polyps. Int. J. Cancer 80 (1999) 210-218.

[181] F. Renaud, A. Vincent, C. Mariette, M. Crepin, L. Stechly, S. Truant, M.C. Copin, N. Porchet, E. Leteurtre, S. Van, I, and M.P. Buisine, MUC5AC hypomethylation is a predictor of microsatellite instability independently of clinical factors associated with colorectal cancer. Int. J. Cancer 136 (2015) 2811-2821.

[182] M.D. Walsh, M. Clendenning, E. Williamson, S.A. Pearson, R.J. Walters, B. Nagler, D. Packenas, A.K. Win, J.L. Hopper, M.A. Jenkins, A.M. Haydon, C. Rosty, D.R. English, G.G. Giles, M.A. McGuckin, J.P. Young, and D.D. Buchanan, Expression of 63

MUC2, MUC5AC, MUC5B, and MUC6 mucins in colorectal cancers and their association with the CpG island methylator phenotype. Mod. Pathol. 26 (2013) 1642- 1656.

[183] A.E. Biemer-Huttmann, M.D. Walsh, M.A. McGuckin, L.A. Simms, J. Young, B.A. Leggett, and J.R. Jass, Mucin core protein expression in colorectal cancers with high levels of microsatellite instability indicates a novel pathway of morphogenesis. Clin. Cancer Res. 6 (2000) 1909-1916. [184] F. Renaud, C. Mariette, A. Vincent, A. Wacrenier, V. Maunoury, J. Leclerc, L. Coppin, M. Crepin, S. Van, I, E. Leteurtre, and M.P. Buisine, The serrated neoplasia pathway of colorectal tumors: Identification of MUC5AC hypomethylation as an early marker of polyps with malignant potential. Int. J. Cancer 138 (2016) 1472-1481.

[185] N. Tatsumi, R. Kushima, M. Vieth, K. Mukaisho, R. Kakinoki, H. Okabe, F. Borchard, M. Stolte, T. Okanoue, and T. Hattori, Cytokeratin 7/20 and mucin core protein expression in ulcerative colitis-associated colorectal neoplasms. Virchows Arch. 448 (2006) 756-762.

[186] T. Terada, An immunohistochemical study of primary signet-ring cell carcinoma of the stomach and colorectum: II. Expression of MUC1, MUC2, MUC5AC, and MUC6 in normal mucosa and in 42 cases. Int. J. Clin. Exp. Pathol. 6 (2013) 613-621.

[187] B. Kocer, A. Soran, S. Erdogan, M. Karabeyoglu, O. Yildirim, A. Eroglu, B. Bozkurt, and O. Cengiz, Expression of MUC5AC in colorectal carcinoma and relationship with prognosis. Pathol. Int. 52 (2002) 470-477.

[188] M. Melis, J. Hernandez, E.M. Siegel, J.M. McLoughlin, Q.P. Ly, R.M. Nair, J.M. Lewis, E.H. Jensen, M.D. Alvarado, D. Coppola, S. Eschrich, G.C. Bloom, T.J. Yeatman, and D. Shibata, Gene expression profiling of colorectal mucinous adenocarcinomas. Dis. Colon Rectum 53 (2010) 936-943.

[189] X.W. Yu, W. Rong, F.L. Xu, G.Y. Xu, Y.R. Sun, and M.Y. Feng, [Expression and clinical significance of Mucin and E-cadherin in colorectal tumors]. Ai. Zheng. 26 (2007) 1204-1210.

[190] B. Kocer, J. McKolanis, and A. Soran, Humoral immune response to MUC5AC in patients with colorectal polyps and colorectal carcinoma. BMC. Gastroenterol. 6 (2006) 4.

[191] L. Losi, A. Scarselli, P. Benatti, L.M. Ponz de, L. Roncucci, M. Pedroni, F. Borghi, I. Lamberti, G. Rossi, M. Marino, G. Ponti, G. Zangardi, M. Menigatti, and G.C. Di, Relationship between MUC5AC and altered expression of MLH1 protein in mucinous and non-mucinous colorectal carcinomas. Pathol. Res. Pract. 200 (2004) 371-377.

[192] T. Nishida, Y. Egashira, H. Akutagawa, M. Fujii, K. Uchiyama, Y. Shibayama, and Y. Hirose, Predictors of lymph node metastasis in T1 colorectal carcinoma: an immunophenotypic analysis of 265 patients. Dis. Colon Rectum 57 (2014) 905-915.

64

[193] J. Bara, M.E. Forgue-Lafitte, N. Maurin, J.F. Flejou, and A. Zimber, Abnormal expression of gastric mucin in human and rat aberrant crypt foci during colon carcinogenesis. Tumour. Biol. 24 (2003) 109-115.

[194] T.C. Che, S. Francois, S. Bouchet, A. Chapel, and M.E. Forgue-Lafitte, Early lesions induced in rat colon epithelium by N-methyl-N'-nitro-N-nitrosoguanidine. Tissue Cell 42 (2010) 190-194.

[195] E.T. Park, J.R. Gum, S. Kakar, S.W. Kwon, G. Deng, and Y.S. Kim, Aberrant expression of SOX2 upregulates MUC5AC gastric foveolar mucin in mucinous cancers of the colorectum and related lesions. Int. J. Cancer 122 (2008) 1253-1260.

[196] L. Raghoebir, K. Biermann, M.B. Kempen, H.J. Dubbink, W.N. Dinjens, R. Hersmus, L.H. Looijenga, M.J. Bruno, D. Tibboel, R.J. Rottier, and R. Smits, Aberrant SOX2 expression in colorectal cancers does not correlate with mucinous differentiation and gastric mucin MUC5AC expression. Virchows Arch. 465 (2014) 395-400.

[197] A.P. Singh, S. Senapati, M.P. Ponnusamy, M. Jain, S.M. Lele, J.S. Davis, S. Remmenga, and S.K. Batra, Clinical potential of mucins in diagnosis, prognosis, and therapy of ovarian cancer. Lancet Oncol. 9 (2008) 1076-1085.

[198] L. Han, V. Pansare, M. Al-Abbadi, M. Husain, and J. Feng, Combination of MUC5ac and WT-1 immunohistochemistry is useful in distinguishing pancreatic ductal carcinoma from ovarian serous carcinoma in effusion cytology. Diagn. Cytopathol. 38 (2010) 333-336.

[199] S. Nakatsuka, T. Wakimoto, K. Ozaki, T. Nagano, H. Kimura, K. Nakajo, and K. Ito, Mucinous borderline-like tumor of the gastrointestinal type arising from mature cystic teratoma of the ovary and its immunohistochemical cytokeratin and mucin phenotype. J. Obstet. Gynaecol. Res. 38 (2012) 471-475.

[200] J. Wang and M.A. El-Bahrawy, Expression profile of mucins in ovarian mucinous tumors: distinguishing primary ovarian from metastatic tumors. Int. J. Gynecol. Pathol. 33 (2014) 166-175.

[201] N. Musrap, G.S. Karagiannis, P. Saraon, I. Batruch, C. Smith, and E.P. Diamandis, Proteomic analysis of cancer and mesothelial cells reveals an increase in Mucin 5AC during ovarian cancer and peritoneal interaction. J. Proteomics. 103 (2014) 204-215.

[202] O. Peralta-Zaragoza, V.H. Bermudez-Morales, C. Perez-Plasencia, J. Salazar-Leon, C. Gomez-Ceron, and V. Madrid-Marina, Targeted treatments for cervical cancer: a review. Onco. Targets. Ther. 5 (2012) 315-328.

[203] L. Riethdorf, J.T. O'Connell, S. Riethdorf, A. Cviko, and C.P. Crum, Differential expression of MUC2 and MUC5AC in benign and malignant glandular lesions of the cervix uteri. Virchows Arch. 437 (2000) 365-371.

[204] A. Mitsuhashi, K. Yamazawa, Y. Nagai, N. Tanaka, H. Matsui, and S. Sekiya, Correlation between MUC5AC expression and the prognosis of patients with adenocarcinoma of the uterine cervix. Ann. Surg. Oncol. 11 (2004) 40-44. 65

[205] N. Daher, J. Gonzales, R. Gautier, and J. Bara, Evidence of mucin M1 antigens in seminal plasma and normal cells of human prostatic urethra in relation to embryonic development and tumors. Prostate 16 (1990) 57-69.

[206] M.E. Legrier, P.G. de, K. Boye, F. Arvelo, J.G. Judde, J.J. Fontaine, J. Bara, and M.F. Poupon, Mucinous differentiation features associated with hormonal escape in a human prostate cancer xenograft. Br. J. Cancer 90 (2004) 720-727.

[207] P.J. Cozzi, J. Wang, W. Delprado, A.C. Perkins, B.J. Allen, P.J. Russell, and Y. Li, MUC1, MUC2, MUC4, MUC5AC and MUC6 expression in the progression of prostate cancer. Clin. Exp. Metastasis 22 (2005) 565-573.

[208] S. Zhang, H.S. Zhang, V.E. Reuter, S.F. Slovin, H.I. Scher, and P.O. Livingston, Expression of potential target antigens for immunotherapy on primary and metastatic prostate cancers. Clin. Cancer Res. 4 (1998) 295-302. [209] S. Stojnev, A. Ristic-Petrovic, L.J. Velickovic, M. Krstic, D. Bogdanovic, d.T. Khanh, A. Ristic, I. Conic, and V. Stefanovic, Prognostic significance of mucin expression in urothelial bladder cancer. Int. J. Clin. Exp. Pathol. 7 (2014) 4945-4958.

[210] A. Lopez-Beltran, R.E. Jimenez, R. Montironi, C. Patriarca, A. Blanca, C.L. Menendez, F. Algaba, and L. Cheng, Flat urothelial carcinoma in situ of the bladder with glandular differentiation. Hum. Pathol. 42 (2011) 1653-1659.

[211] E. Kunze, B. Francksen, and H. Schulz, Expression of MUC5AC apomucin in transitional cell carcinomas of the urinary bladder and its possible role in the development of mucus-secreting adenocarcinomas. Virchows Arch. 439 (2001) 609- 615.

[212] T. Terada, Primary pure signet-ring cell adenocarcinoma of the urinary bladder: a report of three cases with an immunohistochemical study. Med. Oncol. 29 (2012) 2866- 2869.

[213] B.A. Lopez, R. Montironi, and L. Cheng, Microcystic urothelial carcinoma: morphology, immunohistochemistry and clinical behaviour. Histopathology 64 (2014) 872-879.

[214] T. Terada, An autopsy case of clear cell adenocarcinoma of the urinary bladder. Appl. Immunohistochem. Mol. Morphol. 21 (2013) 371-375.

[215] R.F. Smith, B.H. Stern, and A.A. Smith, Mucin immunohistochemistry in the diagnosis and mapping of extramammary Paget's disease. J. Cell Mol. Med. 12 (2008) 1605- 1610.

[216] S.F. Kuan, A.G. Montag, J. Hart, T. Krausz, and W. Recant, Differential expression of mucin genes in mammary and extramammary Paget's disease. Am. J. Surg. Pathol. 25 (2001) 1469-1477. 66

[217] N. Yoshii, S. Kitajima, S. Yonezawa, S. Matsukita, M. Setoyama, and T. Kanzaki, Expression of mucin core proteins in extramammary Paget's disease. Pathol. Int. 52 (2002) 390-399.

[218] H. Hata, R. Abe, D. Hoshina, N. Saito, E. Homma, S. Aoyagi, and H. Shimizu, MUC5AC expression correlates with invasiveness and progression of extramammary Paget's disease. J. Eur. Acad. Dermatol. Venereol. 28 (2014) 727-732.

[219] D. Julien, G. Francesco, R. Pascal, B. Naoual, P. Guillaume, I. Sylvie, G. Olivier, and S. Andrea, FDG-PET/ceCT is useful to predict recurrence of Pseudomyxoma peritonei. Eur. J. Nucl. Med. Mol. Imaging2016).

[220] J.T. O'Connell, C.M. Hacker, and S.H. Barsky, MUC2 is a molecular marker for pseudomyxoma peritonei. Mod. Pathol. 15 (2002) 958-972.

[221] A.S. Mall, N. Chirwa, D. Govender, Z. Lotz, M. Tyler, J. Rodrigues, D. Kahn, and P. Goldberg, MUC2, MUC5AC and MUC5B in the mucus of a patient with pseudomyxoma peritonei: biochemical and immunohistochemical study. Pathol. Int. 57 (2007) 537-547.

[222] A. Amini, S. Masoumi-Moghaddam, A. Ehteda, and D.L. Morris, Secreted mucins in pseudomyxoma peritonei: pathophysiological significance and potential therapeutic prospects. Orphanet. J. Rare. Dis. 9 (2014) 71. [223] G. Nishikawa, S. Sekine, R. Ogawa, A. Matsubara, T. Mori, H. Taniguchi, R. Kushima, N. Hiraoka, K. Tsuta, H. Tsuda, and Y. Kanai, Frequent GNAS mutations in low-grade appendiceal mucinous neoplasms. Br. J. Cancer 108 (2013) 951-958.

[224] S. Yamazoe, H. Tanaka, T. Sawada, R. Amano, N. Yamada, M. Ohira, and K. Hirakawa, RNA interference suppression of mucin 5AC (MUC5AC) reduces the adhesive and invasive capacity of human pancreatic cancer cells. J. Exp. Clin. Cancer Res. 29 (2010) 53.

[225] H. Hoshi, T. Sawada, M. Uchida, H. Iijima, K. Kimura, K. Hirakawa, and H. Wanibuchi, MUC5AC protects pancreatic cancer cells from TRAIL-induced death pathways. Int. J. Oncol. 42 (2013) 887-893.

[226] L.L. Shekels, C. Lyftogt, M. Kieliszewski, J.D. Filie, C.A. Kozak, and S.B. Ho, Mouse gastric mucin: cloning and chromosomal localization. Biochem. J. 311 ( Pt 3) (1995) 775-785.

[227] F. Escande, N. Porchet, A. Bernigaud, D. Petitprez, J.P. Aubert, and M.P. Buisine, The mouse secreted gel-forming mucin gene cluster. Biochim. Biophys. Acta 1676 (2004) 240-250.

[228] C. Ehre, E.N. Worthington, R.M. Liesman, B.R. Grubb, D. Barbier, W.K. O'Neal, J.M. Sallenave, R.J. Pickles, and R.C. Boucher, Overexpressing mouse model demonstrates the protective role of Muc5ac in the lungs. Proc. Natl. Acad. Sci. U. S. A 109 (2012) 16528-16533.

67

[229] M.G. Roy, M. Rahmani, J.R. Hernandez, S.N. Alexander, C. Ehre, S.B. Ho, and C.M. Evans, Mucin production during prenatal and postnatal murine lung development. Am. J. Respir. Cell Mol. Biol. 44 (2011) 755-760.

[230] S.Z. Hasnain, C.M. Evans, M. Roy, A.L. Gallagher, K.N. Kindrachuk, L. Barron, B.F. Dickey, M.S. Wilson, T.A. Wynn, R.K. Grencis, and D.J. Thornton, Muc5ac: a critical component mediating the rejection of enteric nematodes. J. Exp. Med. 208 (2011) 893- 900.

[231] M. Koeppen, E.N. McNamee, K.S. Brodsky, C.M. Aherne, M. Faigle, G.P. Downey, S.P. Colgan, C.M. Evans, D.A. Schwartz, and H.K. Eltzschig, Detrimental role of the airway mucin Muc5ac during ventilator-induced lung injury. Mucosal. Immunol. 6 (2013) 762-775.

[232] A.M. Floyd, X. Zhou, C. Evans, O.J. Rompala, L. Zhu, M. Wang, and Y. Chen, Mucin deficiency causes functional and structural changes of the ocular surface. PLoS. One. 7 (2012) e50704.

[233] S. Rachagani, M.P. Torres, S. Kumar, D. Haridas, M. Baine, M.A. Macha, S. Kaur, M.P. Ponnusamy, P. Dey, P. Seshacharyulu, S.L. Johansson, M. Jain, K.U. Wagner, and S.K. Batra, Mucin (Muc) expression during pancreatic cancer progression in spontaneous mouse model: potential implications for diagnosis and therapy. J. Hematol. Oncol. 5 (2012) 68.

[234] T. Zhong, J.M. Perelman, V.P. Kolosov, and X.D. Zhou, MiR-146a negatively regulates neutrophil elastase-induced MUC5AC secretion from 16HBE human bronchial epithelial cells. Mol. Cell Biochem. 358 (2011) 249-255.

[235] K. Skrzypek, M. Tertil, S. Golda, M. Ciesla, K. Weglarczyk, G. Collet, A. Guichard, M. Kozakowska, J. Boczkowski, H. Was, T. Gil, J. Kuzdzal, L. Muchova, L. Vitek, A. Loboda, A. Jozkowicz, C. Kieda, and J. Dulak, Interplay between heme oxygenase-1 and miR-378 affects non-small cell lung carcinoma growth, vascularization, and metastasis. Antioxid. Redox. Signal. 19 (2013) 644-660.

[236] Y. Teng, R. Zhang, C. Liu, L. Zhou, H. Wang, W. Zhuang, Y. Huang, and Z. Hong, miR-143 inhibits interleukin-13-induced inflammatory cytokine and mucus production in nasal epithelial cells from allergic rhinitis patients by targeting IL13Ralpha1. Biochem. Biophys. Res. Commun. 457 (2015) 58-64.

[237] J.J. Ho, S. Crawley, P.L. Pan, E.R. Farrelly, and Y.S. Kim, Secretion of MUC5AC mucin from pancreatic cancer cells in response to forskolin and VIP. Biochem. Biophys. Res. Commun. 294 (2002) 680-686.

[238] S. Kato, R. Hokari, S. Crawley, J. Gum, D.H. Ahn, J.W. Kim, S.W. Kwon, S. Miura, C.B. Basbaum, and Y.S. Kim, MUC5AC mucin gene regulation in pancreatic cancer cells. Int. J. Oncol. 29 (2006) 33-40.

[239] H. Komatsu, E. Tanji, N. Sakata, T. Aoki, F. Motoi, T. Naitoh, Y. Katayose, S. Egawa, M. Unno, and T. Furukawa, A GNAS mutation found in pancreatic intraductal 68

papillary mucinous neoplasms induces drastic alterations of gene expression profiles with upregulation of mucin genes. PLoS. One. 9 (2014) e87875.

[240] S. Kitamoto, S. Yokoyama, M. Higashi, N. Yamada, S. Matsubara, S. Takao, S.K. Batra, and S. Yonezawa, Expression of MUC17 is regulated by HIF1alpha-mediated hypoxic responses and requires a methylation-free hypoxia responsible element in pancreatic cancer. PLoS. One. 7 (2012) e44108.

[241] S. Aubert, V. Fauquette, B. Hemon, R. Lepoivre, N. Briez, D. Bernard, S. Van, I, X. Leroy, and M. Perrais, MUC1, a new hypoxia inducible factor target gene, is an actor in clear renal cell carcinoma tumor progression. Cancer Res. 69 (2009) 5707-5715.

[242] N.A. Louis, K.E. Hamilton, G. Canny, L.L. Shekels, S.B. Ho, and S.P. Colgan, Selective induction of mucin-3 by hypoxia in intestinal epithelia. J. Cell Biochem. 99 (2006) 1616-1627.

[243] X. Zhou, J. Tu, Q. Li, V.P. Kolosov, and J.M. Perelman, Hypoxia induces mucin expression and secretion in human bronchial epithelial cells. Transl. Res. 160 (2012) 419-427.

[244] H.W. Young, O.W. Williams, D. Chandra, L.K. Bellinghausen, G. Perez, A. Suarez, M.J. Tuvim, M.G. Roy, S.N. Alexander, S.J. Moghaddam, R. Adachi, M.R. Blackburn, B.F. Dickey, and C.M. Evans, Central role of Muc5ac expression in mucous metaplasia and its regulation by conserved 5' elements. Am. J. Respir. Cell Mol. Biol. 37 (2007) 273-290.

[245] J. Yang, H.M. Yu, X.D. Zhou, V.P. Kolosov, and J.M. Perelman, Study on TRPV1- mediated mechanism for the hypersecretion of mucus in respiratory inflammation. Mol. Immunol. 53 (2013) 161-171.

[246] Y.J. Kim, H.J. Cho, W.C. Shin, H.A. Song, J.H. Yoon, and C.H. Kim, Hypoxia- mediated mechanism of MUC5AC production in human nasal epithelia and its implication in rhinosinusitis. PLoS. One. 9 (2014) e98136.

[247] S. Jang, J.W. Park, H.R. Cha, S.Y. Jung, J.E. Lee, S.S. Jung, J.O. Kim, S.Y. Kim, C.S. Lee, and H.S. Park, Silver nanoparticles modify VEGF signaling pathway and mucus hypersecretion in allergic airway inflammation. Int. J. Nanomedicine. 7 (2012) 1329- 1343.

[248] H. Yu, Q. Li, V.P. Kolosov, J.M. Perelman, and X. Zhou, Regulation of cigarette smoke-mediated mucin expression by hypoxia-inducible factor-1alpha via epidermal growth factor receptor-mediated signaling pathways. J. Appl. Toxicol. 32 (2012) 282- 292.

[249] K. Takeyama, B. Jung, J.J. Shim, P.R. Burgel, T. Dao-Pick, I.F. Ueki, U. Protin, P. Kroschel, and J.A. Nadel, Activation of epidermal growth factor receptors is responsible for mucin synthesis induced by cigarette smoke. Am. J. Physiol Lung Cell Mol. Physiol 280 (2001) L165-L172.

69

[250] M.X. Shao, T. Nakanaga, and J.A. Nadel, Cigarette smoke induces MUC5AC mucin overproduction via tumor necrosis factor-alpha-converting enzyme in human airway epithelial (NCI-H292) cells. Am. J. Physiol Lung Cell Mol. Physiol 287 (2004) L420- L427.

[251] T.K. Baginski, K. Dabbagh, C. Satjawatcharaphong, and D.C. Swinney, Cigarette smoke synergistically enhances respiratory mucin induction by proinflammatory stimuli. Am. J. Respir. Cell Mol. Biol. 35 (2006) 165-174.

[252] E. Gensch, M. Gallup, A. Sucher, D. Li, A. Gebremichael, H. Lemjabbar, A. Mengistab, V. Dasari, J. Hotchkiss, J. Harkema, and C. Basbaum, Tobacco smoke control of mucin production in lung cells requires oxygen radicals AP-1 and JNK. J. Biol. Chem. 279 (2004) 39085-39093.

[253] A.E. Hegab, T. Sakamoto, A. Nomura, Y. Ishii, Y. Morishima, T. Iizuka, T. Kiwamoto, Y. Matsuno, S. Homma, and K. Sekizawa, Niflumic acid and AG-1478 reduce cigarette smoke-induced mucin synthesis: the role of hCLCA1. Chest 131 (2007) 1149-1156.

[254] L.E. Haswell, K. Hewitt, D. Thorne, A. Richter, and M.D. Gaca, Cigarette smoke total particulate matter increases mucous secreting cell numbers in vitro: a potential model of goblet cell hyperplasia. Toxicol. In Vitro 24 (2010) 981-987.

[255] M.E. Monzon, R.M. Forteza, and S.M. Casalino-Matsuda, MCP-1/CCR2B-dependent loop upregulates MUC5AC and MUC5B in human airway epithelium. Am. J. Physiol Lung Cell Mol. Physiol 300 (2011) L204-L215.

[256] H. Yu, Q. Li, V.P. Kolosov, J.M. Perelman, and X. Zhou, Regulation of cigarette smoke-induced mucin expression by neuregulin1beta/ErbB3 signalling in human airway epithelial cells. Basic Clin. Pharmacol. Toxicol. 109 (2011) 63-72.

[257] Q. Wu, D. Jiang, and H.W. Chu, Cigarette smoke induces growth differentiation factor 15 production in human lung epithelial cells: implication in mucin over-expression. Innate. Immun. 18 (2012) 617-626.

[258] Y.P. Di, J. Zhao, and R. Harper, Cigarette smoke induces MUC5AC protein expression through the activation of Sp1. J. Biol. Chem. 287 (2012) 27948-27958.

[259] S.Y. Lee, E.J. Kang, G.Y. Hur, K.H. Jung, H.C. Jung, S.Y. Lee, J.H. Kim, C. Shin, K.H. In, K.H. Kang, S.H. Yoo, and J.J. Shim, The inhibitory effects of rebamipide on cigarette smoke-induced airway mucin production. Respir. Med. 100 (2006) 503-511. [260] S.Y. Lee, E.J. Kang, G.Y. Hur, K.H. Jung, H.C. Jung, S.Y. Lee, J.H. Kim, C. Shin, K.H. In, K.H. Kang, S.H. Yoo, and J.J. Shim, Peroxisome proliferator-activated receptor-gamma inhibits cigarette smoke solution-induced mucin production in human airway epithelial (NCI-H292) cells. Am. J. Physiol Lung Cell Mol. Physiol 291 (2006) L84-L90.

[261] A. Almolki, A. Guenegou, S. Golda, L. Boyer, M. Benallaoua, N. Amara, R. Bachoual, C. Martin, F. Rannou, S. Lanone, J. Dulak, P.R. Burgel, J. El-Benna, B. Leynaert, M. Aubier, and J. Boczkowski, Heme oxygenase-1 prevents airway mucus hypersecretion induced by cigarette smoke in rodents and humans. Am. J. Pathol. 173 (2008) 981-992. 70

[262] J. Cortijo, M. Mata, J. Milara, E. Donet, A. Gavalda, M. Miralpeix, and E.J. Morcillo, Aclidinium inhibits cholinergic and tobacco smoke-induced MUC5AC in human airways. Eur. Respir. J. 37 (2011) 244-254.

[263] G. Wang, R. Wang, B. Ferris, J. Salit, Y. Strulovici-Barel, N.R. Hackett, and R.G. Crystal, Smoking-mediated up-regulation of GAD67 expression in the human airway epithelium. Respir. Res. 11 (2010) 150.

[264] X.W. Fu, S.S. Rekow, and E.R. Spindel, The ly-6 protein, lynx1, is an endogenous inhibitor of nicotinic signaling in airway epithelium. Am. J. Physiol Lung Cell Mol. Physiol 303 (2012) L661-L668.

[265] M.N. Elsheikh and M.E. Mahfouz, Up-regulation of MUC5AC and MUC5B mucin genes in nasopharyngeal respiratory mucosa and selective up-regulation of MUC5B in middle ear in pediatric otitis media with effusion. Laryngoscope 116 (2006) 365-369.

71

General Hypothesis and Objectives

A multitude of studies has now recognized that mucins that constitute the mucous barrier are

intimately involved in the process of carcinogenesis. Cancer cells express aberrant forms and

amounts of mucins that contribute to the tumor properties in several ways. Mucins act as tumor

promoters or tumor suppressors and are identified as diagnostic, prognostic markers along with

attractive therapeutic targets in cancer. Among tumor associated mucins, exhaustive research

efforts from our group and others have elucidated the role of mucins MUC1, MUC4, MUC16 in

pancreatic cancer and MUC2, MUC4, MUC17 in colorectal cancer. In addition to these, secretory

mucin MUC5AC has also been implicated to play a significant role in different cancers including

pancreatic and colorectal cancer. It seems that MUC5AC might also have redundant functions

similar to other mucins that are simultaneously expressed by a cancer cell. However, the absence

of MUC5AC in normal pancreas and colon, its overexpression in inflammatory conditions of

pancreas and colon, expression in early stage precursor lesions of both pancreas and colon,

overexpression in pancreatic adenocarcinoma, colorectal cancer, and its secretory nature supports

that MUC5AC has unique functions different from other mucins implicated in pancreatic and

colon cancer.

As discussed in the introductory chapter, unlike transmembrane mucins like MUC1,

MUC4, MUC16 that contain hydrophobic transmembrane domain in their structure, secretory

mucin MUC5AC lacks a transmembrane domain and forms large polymeric gels over cell surface

by forming disulfide bonds between cysteine residues of N- and C-terminal domains. This

structural variation between mucin molecules results in varied functions due to interactions with

diverse protein molecules. Therefore, considering the unique attributes of secretory mucin

MUC5AC, I decided to explore its role in pancreatic cancer by using various pancreatic cancer cell lines and mouse models. Further, I have investigated the diagnostic utility of MUC5AC in 72

conjunction with other mucins and associated glyco-epitopes to differentiate precursor lesions of colorectal cancer and for early stage prediction of colorectal malignancy.

Genetically engineered mouse model of pancreatic cancer (KrasG12D; Pdx1-Cre) that closely mimics the histopathology of human pancreatic cancer, have been extensively useful in last decade to comprehend and elucidate the mechanisms involved in the initiation and progression of this malignancy. Hence in my dissertation, I have utilized the KrasG12D; Pdx1-Cre

mouse model along with Muc5ac knockout mice model to understand the role of MUC5AC in

pancreatic cancer.

Overall, the following objectives were proposed:

1. Elucidate the MUC5AC mediated functions and associated mechanisms in pancreatic cancer

2. Explore the role of MUC5AC using KrasG12D; Pdx1-Cre and KrasG12D; Pdx1-Cre; Muc5ac-/-

pancreatic cancer mouse models

3. Expression analysis of MUC5AC in conjunction with other mucins and associated glycans in

colon adenoma-carcinoma sequence for their utility to predict colorectal cancer

4. Explore the utility of MUC5AC in combination with other mucins and associated glyco- epitopes for discriminating the premalignant lesions of serrated neoplasia pathway and conventional pathway from benign hyperplastic polyps

73

Chapter II: Materials and Methods

1. Molecular basis of MUC5AC mediated cell cycle regulation, metastatic properties,

angiogenesis and chemoresistance of pancreatic cancer

2: Loss of Muc5ac mediated impact on pancreatic cancer progression in KRasG12D; Pdx1-Cre mouse model

3: Mucins and associated glycans signatures in colon adenoma-carcinoma sequence: Prospective pathological implication(s) for early diagnosis of colon cancer

4: Combinatorial assessment of CA 19-9/MUC17/MUC5AC expression discriminates sessile serrated adenoma/polyp and tubular adenoma from hyperplastic polyps

74

1. Molecular basis of MUC5AC mediated cell cycle regulation, metastatic properties, angiogenesis and chemoresistance of pancreatic cancer

1.A Immunohistochemistry

Formalin-fixed paraffin embedded (FFPE) PDAC samples having adjacent normal pancreatic

tissues obtained during Whipple procedure were utilized to investigate the expression of secretory

mucin MUC5AC during pancreatic cancer. For this, tissues were baked overnight at 56°C,

deparaffinized with xylene, and rehydrated with graded alcohols (5 min each). Endogenous

peroxidase activity in tissues was quenched by incubation with a Methanolic solution of 3%

H2O2 for one hour. For antigen retrieval, slides were boiled in 0.05M citrate buffer (pH 6.0,

95°C) for 15 min and then blocked with 2.5% horse serum (ImmPRESS Universal antibody kit;

Vector Laboratories, Burlingame, CA) for 3 hours. Next, tissues were incubated with the anti-

MUC5AC antibody (Abcam ab3649, 45M1, 1µg/ml) overnight at 4°C. The sections were then washed with PBST, and incubated with anti-rabbit/anti-mouse secondary antibody (ImmPRESS

Universal antibody kit; Vector Laboratories) for 30 min and color was developed using substrate chromogen-3, 3’-diaminobenzidine solution (DAB substrate kit; Vector Laboratories). The positive expression was indicated by a reddish brown precipitate. The slides were counterstained with Harris hematoxylin, dehydrated in graded ethanol, xylene, and mounted with Permount

(Vector Laboratories). All the stained slides were reviewed, confirmed for diagnosis, evaluated, scored by a pathologist (Dr. Yuri Sheinin at UNMC), and the representative photographs were taken. The intensity of MUC5AC staining was scored on a scale of 0–3 (0-negative, 1-weak, 2- moderate, 3-intense staining) to give intensity scores (IS). For a given intensity, the percentage of cells positive for MUC5AC expression within a given lesion was also scored on a scale of 0-1 (0:

0% cells staining, 1: 100% cells staining). The IS and corresponding score for the percentage of immunoreactive cells were then multiplied to obtain a histology score (HS), representing overall expression ranging from 0-3. A section was considered “positive” for MUC5AC expression if HS 75

was greater than >0.01. Accordingly, tissues were also classified as being “Positive” or

“Negative” for MUC5AC expression.

1.B Cell culture and transfections

The metastatic fast growing (FG) variant of COLO357 pancreatic cancer cells (FG/COLO357)

[1] and SW1990 cells were previously purchased in our lab from the American type culture

collection (ATCC) for the study. These cells were cultured in DMEM supplemented with 10%

fetal bovine serum and antibiotics (100 μg/mL penicillin and 100 μg/mL streptomycin). The

cultures were incubated at 37°C in a mixture of 5% carbon dioxide, 95% oxygen in a humidified

atmosphere, and maintained for no longer than 12 weeks after recovery from frozen stocks. The

endogenous expression of MUC5AC was stably knocked down using three different MUC5AC

shRNA constructs (pSUPER.retro.puro-shMUC5AC) Table 2.1. For this, MUC5AC shRNA and

scramble vectors were transfected into Phoenix cells [2] using Lipofectamine 2000TM (Invitrogen,

Carlsbad, CA, USA). Transfected Phoenix cells culture generate high yields of virion-containing

supernatant that was collected and filtered 48-hours post-transfection. Simultaneously,

FG/COLO357 and SW1990 parental cells were plated in a 24-well cell culture Petri dish at a seeding density of 2.5x104 cells per well and grown to 70% confluency. Before retroviral

infection FG/COLO357 and SW1990 cells were maintained in serum-free growth medium for 6 hours. The filtered viral supernatant was then used to infect the FG/COLO357 and SW1990 cells with the addition of 4 µg/mL polybrene. Clones transduced with MUC5AC shRNA constructs were selected and maintained using the antibiotic puromycin (4μg/ml) in 10% DMEM medium to obtain stably transfected cells.

1.C Immunoblotting

For protein analysis, 2×106 of FG-Scr/Sh5AC and SW-Scr/Sh5AC cells were plated on a 100 mm

cell culture Petri dishes in complete growth medium. After 48 hours of incubation, cells were

processed for protein extraction using radioimmunoprecipitation assay buffer containing protease 76

and phosphatase inhibitors followed by western blotting using standard procedures. Similar

procedure was employed for protein extraction after treatment of cells mentioned above with

1µM Gemcitabine for 48 hours, and HMEC-1 cells treated with conditioned media from

MUC5AC expressing and knockdown cells for 48 hours. Protein concentrations were determined using a Bio-Rad D/C protein estimation kit. For MUC5AC, the proteins (40µg) were resolved by electrophoresis on a 2% SDS-agarose gel under reducing conditions. For β-actin, XIAP, GAPDH,

β-Catenin, SP1, CD133, CD24, ESA, SOX2, and OCT3/4 10% SDS-PAGE and for Cyt-c, BCL2,

BAD, Cleaved-Caspase-3, Cleaved-Caspase-9, and SHH 15% SDS-PAGE were performed under similar conditions. Resolved proteins were transferred onto the polyvinylidene difluoride (PVDF) membrane and blocked in 5% non-fat milk in phosphate-buffered saline (PBS) for 2 hours. The blots were then incubated with respective antibodies overnight at 4°C (Table 2.2), followed by

4X10 min washes in TBST (50 mM Tris –HCl, pH 7.4, 150 mM NaCl and 0.05% Tween-20).

Further, the membranes were incubated in Horseradish peroxidase-conjugated secondary antibodies (Amersham Biosciences, Buckinghamshire, UK) (diluted at 1:2000 in PBS with 3% non-fat milk) for 1 hour at room temperature, followed by four washes in TBST. The blots were then processed with ECL chemiluminescence kit (Amersham Biosciences), and the signal was detected by exposing the processed blots to X-ray films (Biomax Films, Kodak, NY, USA).

1.D Immunofluorescence/Confocal microscopy

Expression and localization of MUC5AC protein were observed using confocal laser scan microscopy. For this, 10×103 cells were plated on coverslips and grown for 48 hours. After

washing with Hank’s buffered salt solution (HBSS) (pH=7.4), the cells were fixed in ice-cold

methanol at −20°C for 2 min and blocked with 10% goat serum containing 0.05% Tween-20 for 1

hour followed by incubation with specific antibodies overnight at 4°C. Cells were then washed

and incubated with FITC-conjugated goat antimouse/rabbit secondary antibodies for 60 min.

After that, the coverslips were mounted on glass slides with antifade Vectashield mounting 77

medium (Vector Laboratories, Burlingame, CA, USA). Immunostaining was observed under a

Zeiss (Carl Zeiss Microimaging, Thornwood, NY) confocal laser scanning microscope, and

representative photographs were captured digitally using the 510 LSM software.

1.E RNA extraction, RT-PCR, Q-PCR

Total RNA was isolated from cell lines using the QIAGEN RNeasy Mini kit (QIAGEN, Valencia,

CA, USA) respectively, according to the manufacturer’s protocol. The mRNA isolated was converted to cDNA using oligo-dT primers and was used (1:5 diluted) to determine the expression of MUC5AC mRNA by PCR using specific primers (Table 2.1). Quantitative real- time PCR was performed on Roche Light Cycler 480 system (Roche Diagnostics, Mannheim,

Germany). For PCR, 10 μl reactions [5 μl 2x SBYR green Master Mix, 3.2 μl of autoclaved nuclease free water, 1 μl diluted RT product (1:5) and 0.4 μl each of forward and reverse primer

(5 pmol) (Table 2.1)] were performed in triplicate along with non-template controls (NTCs) for each assay under the same conditions. The cycling conditions were comprised of 95°C for 10min, followed by 40 cycles of 95°C for 15 s and 58°C for 1min. Gene expression levels were normalized to the level of β-actin expression used as a control.

1.F MTT Assay

Cell viability was determined using 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide assay as described previously. In brief, FG-Scr/Sh5AC and SW-Scr/Sh5AC cells were seeded into 96-well microplate at a density of 5x103 cells per well, in complete growth medium

containing 10% FBS. After 24 hours, the culture media was aspirated and replaced with growth

medium containing 1% FBS. Every 24 hours, cells were incubated with 10 μl of 3-(4, 5-

dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (5 mg/ml in PBS) solution added to each

well for 3 hours, and then the absorbance was read at 560 nm with a reference wavelength of 670

nm using microplate reader. Readings were taken for 6 days. 78

For analyzing impact of Gemcitabine on FG-Scr/Sh5AC and SW-Scr/Sh5AC cells were seeded into 96-well microplate at a density of 10x103 cells per well, in complete growth medium

containing 10% FBS. The pharmacy at the Lied Transplant Center at UNMC, kindly provided the

injectable solution of Gemcitabine, GEMZARH (Eli Lilly Company, Indianapolis, IN). After 48

hours, cells were treated with different concentrations of Gemcitabine and incubated at 37°C for

48 hours. Untreated cells were considered as controls. After 48 hours, cells were incubated with

10 μl of 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (5 mg/ml in PBS)

solution added to each well for 3 hours, and then the absorbance was read at 560 nm with a reference wavelength of 670 nm using microplate reader. The half maximal inhibitory

concentration (IC-50) of Gemcitabine was determined in each cell line from interpolating values in the graph (% Cytotoxicity vs. Gemcitabine Concentration).

For analyzing the impact of MUC5AC on endothelial cell viability, HMEC-1 cells were seeded into 96-well microplate at a density of 5x103 cells per well, in complete growth medium containing 10% FBS. After 48 hours, cells were treated with conditioned media from MUC5AC expressing and knockdown cells and incubated at 37°C for 48 hours. After 48 hours, cells were incubated with 10 μl of 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (5 mg/ml in PBS) solution added to each well for 3 hours, and then the absorbance was read at 560 nm with a reference wavelength of 670 nm using microplate reader.

1.G Anchorage independent proliferation assay

For anchorage-independent proliferation assay, 2.5x103 FG-Scr/Sh5AC cells suspended in 0.35%

noble agar were plated as top layer, over a layer of 0.5% noble agar, in a six well multidish. Cells

were incubated at 37°C for 3 weeks and provided with complete growth medium two times a

week. After 21 days, colonies formed were visualized under microscope, photographed and

counted.

1.H Apoptosis assay 79

Apoptosis was measured by using the Annexin-V Fluos staining kit (Roche Diagnostics,

Indianapolis, IN, USA).For this, FG-Scr/Sh5AC and SW-Scr/Sh5AC cells were plated at a

density of 1X106 cells in 60 mm cell culture Petri dishes for 48 hours at 37°C. After 48 hours, the

cells were washed with PBS (3x) and then made serum-free for next 48 hours.

In another experiment, the cells were treated with 1µM Gemcitabine for 48 hours and the

induction of apoptosis and necrosis was measured by staining the cells with Annexin-V and

propidium iodide solution, followed by fluorescence-activated cell sorting analysis (FACS).

1.I Cell cycle analysis

FG-Scr/Sh5AC and SW-Scr/Sh5AC cells were plated at density of 1x106 cells in 60 mm cell culture Petri dishes. Next day, for in vitro synchronization in G0 phase, the cells were properly

washed with PBS, and maintained in serum-deprived medium for 48 hours [3]. The cells were

then released from the block by replacing with complete culture medium. Post 48 hours of

release, the cells were collected and fixed in 1 ml of 70% ethanol for 45 minutes at 4°C and

centrifuged to decant ethanol. The cell pellets were washed once with PBS and then resuspended

in 1 ml of Telford’s reagent [4]. After incubating at 4°C for 1 hour, the total DNA content was

analyzed using the fluorescence-activated cell sorting method.

1.J Motility assay

For motility assays, 1×106 cells suspended in 2 ml serum-free medium were plated in the top chamber of polyethylene terephthalate membrane inserts (six-well inserts; pore size 8 µm; Becton

Dickinson, Franklin Lakes, NJ, USA). To provide chemotactic drive, two ml of 10% serum- containing medium was added to the lower chamber of the well and the cells were allowed to migrate for 24 hours. After removing the non-migrated cells from the upper side of the membrane, the migrated cells on the lower side of the membrane were stained with a Diff-Quick cell stain kit (Dade-Behring Inc, Newark, DE 19714, USA). They were then photographed in 10 random fields of view at 10X magnification. Cell numbers were counted and expressed as the 80

average number of cells/field of view. The experiments were repeated three times and data were

represented as the average of the three independent experiments with the standard error of the mean.

1.K Cell adhesion assay

For cell adhesion assays, Matrigel-coated 96 well plates (BD BiocoatTM, Bedford, MA, USA)

were utilized. A single-cell suspension of FG-Scr/Sh5AC cells and SW-Scr/Sh5AC (1×104 cells) in 100 μl of full growth medium was added to each well. Cells were allowed to adhere for 120 min at 37˚C. The cells were subsequently washed with PBS to remove nonadherent cells. The

adhered cells were stained with 50μl of 0.5% crystal violet (Sigma-Aldrich Corp., St Louis, MO,

USA) in 20% methanol for 30 min. The cells were then washed with deionized water and were lysed in 50 μl of 30% acetic acid. Cell adhesion was calculated by measuring the absorbance of the eluted dye at 570 nm using a microplate reader.

1.L Angiogenesis tube formation assay

For angiogenesis assay, FG-Scr/Sh5AC and SW-Scr/Sh5AC (1X106 cells) were plated in 6 well

multi plates. Next day the complete growth media was replaced by SF media and cells were

incubated for 48 hours at 37°C and the cell culture supernatant was collected. Before assay,

endothelial cells (HMEC-1) were incubated in SF media for three hours, trypsinized, resuspended

in conditioned medium mentioned above and 20X103 cells/ well were plated in triplicate on 96-

well Matrigel-coated plates. The assay plate was incubated at 37°C overnight and endothelial

tubes thus formed were examined, and pictures were taken using a light microscope. The

quantitative analysis of a total number of endothelial tube junctions formed and percentage

vessels area was done by Angiotool software (national cancer institute, USA).

1.M Co-immunoprecipitation

For Co-immunoprecipitation study, FG/COLO357 and SW1990 cells were grown to confluency,

and then lysed in non-denaturing lysis buffer [20mM Tris-HCl pH 8.0, 137mM NaCl, 2mM 81

ethylenediaminetetraacetic acid (EDTA), 1% Nonidet P-40 (NP-40), 1mM NaF, 1mM sodium orthovanadate (Na3VO4), 1mM PMSF, aprotinin 5mg/ml, leupeptin 5mg/ml and containing 1%

Triton X-100] for 25–35 min at 4°C. For pre-cleaning, the processed lysates were incubated with protein A+G Sepharose beads (Sigma-Aldrich Corp., St Louis, MO, USA) for 4 hours at 4°C on a rotator. Total protein concentration in pre-cleared lysates were quantified and equal amounts of total protein (500 µg) in 500µl volumes of non-denaturing lysis buffer were then incubated overnight with anti-MUC5AC/β-Catenin/E-Cadherin/Src antibodies or with respective IgG at 4°C on a rotator. The protein-antibody complexes were incubated with protein A+G Sepharose beads on a rotator for 4 hours at 4°C. The pulled-down Immunocomplexes were washed with the lysis buffer (3X) followed by two wash with PBS. The immunoprecipitates and input were electrophoretically resolved and immunoblotted with anti-MUC5AC/β-Catenin/E-Cadherin/Src antibodies.

1.N Orthotopic implantation

To examine the effect of MUC5AC knockdown in vivo, subconfluent cultures of FG-Scr/Sh5AC cells (>95% viable) were resuspended in PBS at a concentration of 5x105 cells/50 µl, and

orthotopically implanted in the pancreas of immunodeficient mice as per the established protocol

[5] (8 per group; purchased from the Animal Production Area of the National Cancer Institute-

Frederick Cancer Research and Development Center, Frederick, MD, USA). The mice were maintained in accordance with the Institutional Animal Care and Use Committee guidelines. All mice were sacrificed after 50 days of implantation, and the presence of metastatic lesions to distant organs (liver, spleen, lung, mesenteric lymph nodes, and on the peritoneal wall) was

determined by thorough gross inspection and histological analysis. Pancreatic tumors were

excised, weighed, measured, formalin fixed, paraffin embedded and were later sectioned into

0.5µm thick sections. A part of the tumor tissue was also frozen for RNA and protein analysis.

The experiment was repeated twice. 82

1.O Subcellular fractionation

For the cytoplasmic and nuclear extracts, the cells were rinsed with ice-cold PBS, collected and incubated on ice for 1 hour in cytoplasmic-extraction buffer [10 mM HEPES (pH 7.4), 10 mM

KCl, 0.2% NP-40, 0.1 mM EDTA, 10% glycerol, 1.5 mM MgCl2, supplemented with protease inhibitor cocktail, 1 mM DTT, 1 mM PMSF, 5 mM Na3VO4, and 5mM NaF]. Cells were lysed

using a 25 Gauge needle every 20 min. Cells were then centrifuged at 16000Xg and the

supernatant was collected as the cytoplasmic extract. The remaining pellet was thoroughly

washed with PBS 3 times followed by incubation with the nuclear extraction buffer [20 mM

HEPES (pH 7.6), 420 mM NaCl, 1 mM EDTA, 20% glycerol, 1.5 mM MgCl2, 1 mM DTT, 1 mM PMSF, 5 mM Na3VO4, 5 mM NaF] for 1 hour, sonicated at 60% amplitude for 10s,

subjected to centrifugation and supernatant was collected as a nuclear extract.

1.P Statistical analyses

Statistical significance for in vitro functional assays mentioned above was evaluated with the

student t-test. All the experiments were performed in triplicates. For in vivo experiments mean

tumor weights were compared between groups using a two-tailed independent sample student’s t-

test. A p-value of <0.05 was considered statistically significant. 83

2. Loss of Muc5ac mediated impact on pancreatic cancer progression in KRasG12D; Pdx1-

Cre mouse model

2.A Generation of KrasG12D; Pdx1-Cre; Muc5ac-/- mouse model

The C57BL/6 Muc5ac-/- mice were obtained from Dr. Christopher Evans at the University of

Colorado. The Pdx1-Cre and Muc5ac-/- mice and the LSL-KrasG12D and Muc5ac-/- mice previously

available in our lab were crossed to generate F1 progeny. The F1 progeny was genotyped for

Kras, Pdx1-Cre and Muc5ac-/- using specific primers for all three genes by Polymerase chain reaction (PCR) to obtain the final genotype Pdx1-Cre; Muc5ac-/- and LSL-KrasG12D; Muc5ac-/-.

The F1 progeny were then further crossed to remove the LSL cassette in order to activate

KrasG12D and obtain the F2 progeny having the genotype KrasG12D; Pdx1-Cre; Muc5ac-/- in the pancreas of the mouse. Hence, animals positive for KrasG12D; Pdx1-Cre; Muc5ac-/- expressed the mutated KrasG12D in the pancreas where Muc5ac is knocked out. The KrasG12D; Pdx1-Cre;

Muc5ac-/- animals (positive for both Kras and Pdx1-Cre in the absence of Muc5ac) and KrasG12D;

Pdx1-Cre animals (carrying wild type Muc5ac) were euthanized at 10, 20, 30, 40 and 50 weeks of

age (three animals/group/time point). Throughout the experiment, animals were provided with

food and water ad libitum and subjected to a 12-hour dark/light cycle. Animal studies were performed in accordance with the U.S. Public Health Service "Guidelines for the Care and Use of

Laboratory Animals" under an approved protocol by the University of Nebraska Medical Center

Institutional Animal Care and Use Committee (IACUC).

2.B Immunohistochemistry (Mouse tissues)

-/- The KrasG12D; Pdx1-Cre; Muc5ac (n=3) animals were sacrificed at 10, 20, 30, 40, and 50 weeks of age. A portion of the pancreas from these mice was fixed in 10% formalin (Fisher

Scientific, Fair Lawn, NJ, USA). The fixed tissues were then embedded in paraffin and serial

tissue sections (5 μm thick) were cut from the UNMC tissue core facility. The sections were

deparaffinized using Xylene (Fisher Scientific, Fair Lawn, NJ, USA) and dehydrated using 84

diluted alcohol gradually. Subsequently, the sections were stained with hematoxylin and

eosin (H&E) stains and examined under a light microscope. In addition to H&E, the slides

were processed for immunostaining as described previously. All stained slides were evaluated by a pathologist under a Nikon E400 Light Microscope and representative

photographs were taken.

2.C c-DNA isolation and genotyping

Genotyping was performed on the DNA isolated from the clipped tails from mice. The tails were

clipped at 10-14 days of mice age and DNA isolation was performed using the standard protocol

(Maxwell 16 mouse tail DNA purification kit, Promega, Madison, WI, USA). The genotyping of

Kras, Pdx-1-Cre, Muc5ac-/-, was performed by PCR using the primer sequences mentioned in

Table 2.1. 85

3. Mucins and associated glycan signatures in colon adenoma-carcinoma sequence:

prospective pathological implication(s) for early diagnosis of colon cancer

3.A Tissue specimens

Colon tissue arrays (Cat# CO809a) having normal (9), inflamed (10), hyperplastic polyp (10),

adenomas including villous, tubulovillous, tubular and serrated subtypes (30), and adenocarcinoma (16) samples were obtained from US Biomax, Rockville, MD.

3.B Immunohistochemistry (IHC)

Immunohistochemistry (IHC) was performed on the colon tissue arrays listed above. The colon

disease arrays were baked overnight at 56°C, followed by deparaffinization with xylene and

rehydration with graded alcohols (5 min each). Tissues were incubated with a methanolic solution

of 3% H2O2 for quenching endogenous peroxidase activity, followed by heat induced antigen retrieval with 0.05M citrate buffer (pH 6.0, 95°C) for 15 min. Sections were then blocked with

2.5% horse serum (ImmPRESS Universal antibody kit; Vector Laboratories, Burlingame, CA) for

3 hr. The tissue samples were incubated overnight at 4°C with well characterized and specific anti-mucin and anti-mucin associated glycans antibodies listed in (Table 2.3). Next, the tissue arrays were washed and incubated with anti-rabbit/anti-mouse secondary antibody (ImmPRESS

Universal antibody kit; Vector Laboratories) for 30 min. The color was developed by adding substrate chromogen, 3, 3’-diaminobenzidine solution (DAB substrate kit; Vector Laboratories).

A reddish brown precipitate indicated positive expression. The slides were counterstained with

Harris hematoxylin, dehydrated in graded ethanol followed by xylene and mounted with

Permount (Vector Laboratories). Each tissue core in the array was reviewed, confirmed for diagnosis, and evaluated by a pathologist (Dr. Sonny L. Johansson at UNMC) to determine the staining score. The intensity of staining for each of the markers was scored on a scale of 0–3 (0- negative, 1-weak, 2-moderate, 3-intense staining) to give intensity scores (IS). The percentage of cells positive for mucin or glycan within a given lesion was scored on a scale of 1–4 as follows: 86

1: 0–25%; 2: 26–50%; 3: 51–75%; and 4: 76–100% cells positive. The staining intensity scores

and scores corresponding to the percentage of immunoreactive cells were then multiplied to

obtain a composite score (CS) representing overall expression ranging from 0-12. CS was further

categorized as 0: negative, 1-3: weak, 4-6: mild, 7-9: moderate, and 10-12: strong expression. A section was considered ‘‘positive’’ for a particular marker if the CS was ≥1.

3.C Statistical Analysis

For statistical analysis, each spot on the array was considered as an individual sample. CS and IS values were compared with the Kruskal-Wallis test and Wilcoxon test for pairwise comparisons.

No adjustments were made for multiple comparisons. Further, multivariate logistic regression

method was used to evaluate marker combinations as predictors of hyperplastic polyps vs.

adenoma/adenocarcinoma combined as well as two additional models comparing polyps vs.

adenoma and polyps vs. adenocarcinoma separately. For each of the multivariate models, full

models were fit, including marker (MUC17, MUC2, MUC4, MUC5AC, and Tn/STn-MUC1)

composite scores as continuous variables. This model allows us to evaluate the effect of a single

marker on outcome while adjusting for all the other markers. Reduced models were also

considered utilizing backward variable selection with α set at 0.10 for variable inclusion in the

model. Firth’s penalized maximum likelihood estimation was used to reduce bias in the parameter

estimates because separability occurred in some of the multivariate models. P-values <0.05 were

considered to be statistically significant. All statistical analyses were performed using SAS

software Version 9.3 (SAS Institute Inc., Cary, NC).

87

4. Combinatorial assessment of CA 19-9/MUC17/MUC5AC expression discriminates sessile

serrated adenoma/polyps and tubular adenoma from hyperplastic polyps

4.A Tissue specimens and patient demographics

After institutional review board approval (IRB#167-15-EP), formalin fixed paraffin-embedded tissue specimens of hyperplastic polyps (n=33), sessile serrated polyps/adenomas (n=39) and tubular adenomas (TA) (n=36) were obtained from the Department of Pathology at University of

Nebraska Medical center (UNMC). Available H&E slides were examined initially by a pathologist (Dr. Yuri Sheinin at UNMC) to recheck the original histological diagnosis. All the selected polyps fulfilled current diagnostic criteria, and had sufficient available tissue for immunohistochemical (IHC) analyses.

Demographic data were retrieved from available hospital records. The clinical and

endoscopic findings of the patients and their polyps are summarized in (Table 2.4). There were

no significant differences with regard to age, sex ratio, ethnicity, site of polyp, family history of

colon cancer, tobacco consumption, polyp size, and prior or subsequent colonoscopies. TA were

the most common polyp type diagnosed followed by SSA/P’s and HP’s (Table 2.4).

4.B Immunohistochemistry (IHC)

IHC was performed on the polyps following a standardized protocol [6]. After overnight baking

at 56°C, tissue sections were deparaffinized with xylene (10 min, 4X), rehydrated with graded

alcohols (5 min each wash). Endogenous peroxidase activity was quenched by incubation in a

methanolic solution of 3% H2O2 (30 min). Antigens were retrieved by boiling tissue sections in

0.05M citrate buffer (pH 6.0, 95°C, 15 min), and blocked with 2.5% horse serum (ImmPRESS

Universal antibody kit; Vector Laboratories, Burlingame, CA) for one hour. Tissues sections were then incubated with well characterized anti-mucin and anti-mucin associated glycan epitopes specific antibodies overnight at 4°C (Table 2.3). Next, the sections were washed with

PBS-T (10 min, 4X), incubated with Horseradish peroxidase-conjugated anti-rabbit/anti-mouse 88

secondary antibody (ImmPRESS Universal antibody kit; Vector Laboratories) (30 min), washed

with PBS-T (10 min, 4X), developed for colorimetric detection by 3.3’ diaminobenzidine kit

(Vector Laboratories, Burlingame, CA, USA) and counterstained with hematoxylin. Tissues were

dehydrated (graded alcohol and xylene), dried, mounted with Permount, and evaluated by the

pathologist (Dr. Yuri Sheinin at UNMC) to investigate the staining scores corresponding to the

pathologic lesions as well as adjacent normal areas.

The intensity of staining for each of the markers was scored on a scale of 0–3 (0- negative, 1-weak, 2-moderate, 3-intense staining) to give intensity scores (IS). For a given intensity, the percentage of cells positive for mucin or associated glycan epitopes within a given lesion was also scored on a scale of 0-1 (0: no cells staining, 1: 100% cells positively stained).

The staining intensity Scores and corresponding score for the percentage of immunoreactive cells were then multiplied to obtain a histology Score (H-Score), representing overall expression ranging from 0-3. The respective tissue specimens were further classified by H-score as having- no reactivity H-score=0, focal reactivity (H-score >0 but ≤0.1), mild reactivity (H-score >0.1 but

≤1), moderate reactivity (H-score >1.0 but ≤2.0) and strong reactivity (H-score >2.0). Further, differential immunohistochemical localization pattern of mucin and associated glycan epitopes expression within colon crypts was also considered for analysis.

4.C Statistical analysis

Patient characteristics for each polyp subtype were compared using chi-square or Fisher’s exact test for categorical variables and ANOVA or Kruskal-Wallis test for continuous variables. H- score for each polyp subgroup were compared using Kruskal-Wallis test and Wilcoxon signed rank test for pairwise comparisons. Wilcoxon signed rank test was used to compare H-Score of polyp subtypes and the respective adjacent normal controls. Adjustments for multiple comparisons were made using Bonferroni’s method. H-score was also categorized into reactivity groups and these were compared by polyp subtype using Chi-square test. Localization pattern of 89

secretory mucin MUC5AC in HP and SSA/Ps crypts was compared using Chi-square test. 90

Table 2.1 List of the primers used in the study

Gene Primer

K006F-5’-CCT TTA CAA GCG CAC GCA GAC TGTAGA-3’ Kras (mouse) genotyping K005R-5’-AGCTAG CCA CCATGGCTTGAG TAA GTC TGC A-3’ F-5’-CTGGACTACATCTTGAGTTGC -3’ Pdx1;Cre (mouse) genotyping R-5’-GGTGTACGGTCAGTAAATTTG -3’

F- 5’-GTTTCCACAAAGCACAACCAAAC-3’

Muc5ac (mouse) genotyping R- 5’-TAGGGCCAGGCTAAGAGAAACC-3’

F: 5’-CTCAGGAATGACGCTTGGACATGG-3’

MUC5AC human (qPCR) R: 5’-GGCTGAGGTAGGAGTGAGGTTCTT-3’

F: 5’-TGATTCTGCCCTCCTCCTTCTG-3’

VEGF-A human (qPCR) R: 5’-TGATTCTGCCCTCCTCCTTCTG-3’

F: 5’-PO4- GATCCCCGGACGGTGCTTGACGACATTTCAAGAGAATGTCGTCAA GCACCGTCCTTTTTA-3’

MUC5AC shRNA-1 R: 5’-PO4- AGCTTAAAAAGGACGGTGCTTGACGACATTCTCTTGAAATGTCGT CAAGCACCGTCCGGG-3’

F: 5’-PO4- GATCCCCCGTTTGACGGGAAGCAATATTCAAGAGATATTGCTTCC CGTCAAACGTTTTTA-3’ MUC5AC shRNA-2 R: 5’-PO4- AGCTTAAAAACGTTTGACGGGAAGCAATATCTCTTGAATATTGCT TCCCGTCAAACGGGG-3’

F: 5’-PO4- GATCCCCGGACAAAGTGGTTCGACGTTTCAAGAGAACGTCGAACC ACTTTGTCCTTTTTA-3’ MUC5AC shRNA-3 R: 5’-PO4- AGCTTAAAAAGGACAAAGTGGTTCGACGTTCTCTTGAAACGTCGA ACCACTTTGTCCGGG-3’ 91

Table 2.2: List of antibodies and respective dilutions used in chapter III and IV

S.no. Parameter Source Catalogue # Dilutions Enriched 1. MUC5AC (CLH2) Dr. Hollingsworth Hybridoma 1:400 supernatant 2. MUC5AC (45M1) Abcam ab3649 1:400

3. β-Actin Sigma A5316 1:10000

4. p27 Cell signaling #3686 1:1000

5. p21 Santa Cruz Sc-6246 1:200

6. Cyclin-D1 Cell signaling #2922 1:1000

7. Cyclin-E Abcam ab7959 1:200

8. Cytochrome-c Cell signaling #4280 1:1000

9. BCl2 Santa Cruz Sc-492 1:200

10. XIAP Cell signaling #2045 1:1000

11. BAD Cell signaling #9292 1:1000

12. Cleaved-Caspase3 Cell signaling #9664 1:1000

13. Cleaved-Caspase9 Cell signaling #9509 1:1000

14. GAPDH Cell signaling #5174 1:1000

15. CD133 Abcam Ab19898 1:1000

16. CD24 Santa Cruz Sc-11406 1:1000

17. ESA Cell signaling #2626S 1:1000

18. SHH Santa Cruz Sc-9024 1:1000

19. SOX2 Santa Cruz Sc-20088 1:1000 92

20. OCT3/4 Santa Cruz Sc-5279 1:500

Enriched hybridoma 21. E-Cadherin Dr. Keith Johnson 1:50 supernatant

22. Integrins Cell signaling #4749 1:1000

23. SRC Santa Cruz Sc-19 1:200

24. p-SRC Cell signaling #2101 1:1000

25. β-Catenin Sigma C2206 1:100

26. pAKT(Ser473) Cell Signaling #4060 1:1000

27. pERK1/2 Santa Cruz Sc-81492 1:200

28. pFAK(Y397) Cell signaling 3283 1:1000

29. Ki67 Abcam 15580 15580 1:300 93

Table 2.3 List of antibodies and respective dilutions used in Chapter V and Chapter VI

S.no. Parameter Antibody Dilutions

1. MUC1 HMFG2 1:5

2. MUC4 8G7 1:2000

3. MUC17 SN-1132 1:150

EPR6145 4. MUC2 1:500 (Abcam)

5. MUC5B 19.4E (Abcam) 1:300

45M1 6. MUC5AC 1:300 (Abcam)

7. MUC6 CLH5 1:100

8. CA 19-9 NS19.9 1:100

9. TAG72 CC49 1:1000

10. Tn/STn on MUC1 5E5 1:300

94

Table 2.4: Demographic and clinicopathological characteristics of patients included in the study

HP SSA/P TA p-value (n=33) (n=39) (n=36) Female 17 (61%) 22 (59%) 18 (56%) Gender Male 11 (39%) 15 (41%) 14 (44%) 0.93 N/A 5 2 4 Median Age 59 (50-91) 60 (28-77) 61 (47-84) 0.9 (Range) African 6 (23%) 2 (6%) 3 (11%) American Caucasian 20 (77%) 30 (91%) 24 (86%) Ethnicity Hispanic 0 0 1 (4%) 0.19 Asian 0 1 (3%) 0 N/A 7 6 8 Cecum 0 4 (11%) 4 (13%) 0.2 Polyp site Ascending 2 (8%) 10 (27%) 10 (31%)

Transverse 1 (4%) 6 (16%) 6 (19%)

Descending 4 (15%) 5 (14%) 3 (9%)

Sigmoid 10 (38%) 7 (19%) 4 (13%)

Rectum 9 (35%) 5 (14%) 5 (15%)

N/A 7 2 4

No 18 (72%) 29 (83%) 27 (87%) Family History of colon Yes 7 (28%) 6 (17%) 4 (13%) 0.34 cancer N/A 8 4 5 No 6 (23%) 13 (37%) 10 (32%) Tobacco Yes 20 (77%) 22 (63%) 21 (68%) 0.5 N/A 7 4 5 0.101 0.088 Polyp size (cm3) Mean (SD) 0.048 (0.084) 0.41 (0.168) (0.174) Number of polyps Median (range) 2 (1-7) 2 (1-7) 3 (1-7) 0.018 Number of precancerous Median (range) 1 (0-6) 2.5 (1-4) 3 (1-7) <0.0001 polyps Prior or subsequent colonoscopies Median (range) 1 (1-3) 3 (0-5) 1 (0-3) 0.28 with polyps

Abbreviations: HP, Hyperplastic polyps; SSA/Ps, Sessile serrated adenoma/Polyps; TA, Tubular adenoma; SD, Standard deviation 95

Reference List

[1] M.P. Vezeridis, G.N. Tzanakakis, P.A. Meitner, C.M. Doremus, L.M. Tibbetts, and P. Calabresi, In vivo selection of a highly metastatic cell line from a human pancreatic carcinoma in the nude mouse. Cancer 69 (1992) 2060-2063.

[2] S. Swift, J. Lorens, P. Achacoso, and G.P. Nolan, Rapid production of retroviruses for efficient gene delivery to mammalian cells using 293T cell-based systems. Curr. Protoc. Immunol. Chapter 10 (2001) Unit.

[3] T.J. Langan and R.C. Chou, Synchronization of mammalian cell cultures by serum deprivation. Methods Mol. Biol. 761 (2011) 75-83.

[4] W.G. Telford, L.E. King, and P.J. Fraker, Evaluation of glucocorticoid-induced DNA fragmentation in mouse thymocytes by flow cytometry. Cell Prolif. 24 (1991) 447-459.

[5] W. Qiu and G.H. Su, Development of orthotopic pancreatic tumor mouse models. Methods Mol. Biol. 980 (2013) 215-223. 96

Chapter III

Molecular basis of MUC5AC mediated cell cycle regulation, metastatic properties, angiogenesis and chemoresistance of

pancreatic cancer

97

1. Synopsis

Pancreatic ductal adenocarcinoma is one of the deadliest solid malignancies. Despite extensive

research efforts, the prognosis of this malignancy remains grim mainly due to diagnosis at

advanced stages when cancer have metastasized to distant organs. Pancreatic cancers very often

develop resistance to chemotherapy. Surgical resection offers the only chance of cure if detected

early. Hence, identification of newer molecules that can be targeted is essential for improving

overall prognosis of this lethal malignancy. Mucins are heavy weight glycoproteins that are

known to play a critical role in initiation and progression of the pancreatic cancer. In this context,

secretory mucin MUC5AC is overexpressed in pancreatic cancer while it is not detected in the

normal pancreas. Association of MUC5AC with poor prognosis of pancreatic cancer has also

been demonstrated. Few in vitro studies have highlighted the role of MUC5AC in increased migration and adhesion of pancreatic cancer cells. However, the elucidation of underlying mechanisms remained elusive. Therefore, in this study, we developed MUC5AC knockdown

pancreatic cancer cell lines and observed that loss of MUC5AC results in decreased cell viability,

increased apoptosis, reduced migration, negatively impacts angiogenesis and increased the

sensitivity of pancreatic cancer cells to Gemcitabine. Further, in vivo tumor formation and

metastasis to distant organs was also decreased in an orthotopic mouse model on knockdown of

MUC5AC. Interestingly, we observed that decrease in MUC5AC results in decreased expression

of cell cycle regulatory proteins, loss of integrin expression, increased E-Cadherin expression

thus impacting pancreatic cancer cell growth and metastasis. Moreover, we observed greater

enrichment of stem cell population on the treatment of MUC5AC expressing pancreatic cancer

cells with Gemcitabine. Further, we observed that MUC5AC by physically interacting with E-

Cadherin and β-Catenin may impact pancreatic cancer cell growth and metastasis. Altogether, our

findings demonstrate that MUC5AC significantly contributes towards pancreatic cancer

progression. 98

2. Background and Rationale

Pancreatic cancer (PC) is one of the most lethal cancers known to affect the mankind [1]. As per the estimates of American cancer society, approximately 53,070 new cases of PC and 41,780

deaths are expected in 2016 [3]. PC is projected to become the second leading cause of cancer-

related deaths by 2030 [2]. Continuous research efforts over the past few decades have

culminated into a slight upturn of 5 year survival rate for PC from <6% to ~8% [3]. However, the

overall prognosis of this malignancy still remains grim [1]. This dismal prognosis is primarily

attributed to the asymptomatic nature of this malignancy and diagnosis at locally advanced or

metastatic stage of disease [4]. In addition, PC remains a therapeutic challenge. Surgery is the

only curative option with some success for local disease [5]. Chemo-radiation and Gemcitabine

are the available treatment options for metastatic pancreatic cancer. However, the intrinsic and

acquired chemoresistance limits the benefits [6]. Since the progress made in improving the life expectancy of PC patients have not made significant strides, further investigation is required to develop a much more comprehensive understanding of this complex disease.

Mucins are high molecular weight glycoproteins, primarily associated with protection, repair and survival of the epithelial cell surface during conditions of physicochemical and biological insults [7, 8]. Expression of aberrant forms and amounts of mucins has been implicated

in initiation, progression and poor prognosis of PC [7-10]. By virtue of deregulated expression of

mucin core proteins, differential glycosylation and unique domains, mucins are implicated in

enhanced tumorigenicity, invasiveness, metastasis, drug resistance and control of the tumor

microenvironment [10]. Hence, mucins have been identified as useful diagnostic, prognostic

markers and therapeutic targets in PC [9].

Secretory mucin MUC5AC has been associated with multiple inflammatory benign conditions [11]. Aberrantly increased expression of MUC5AC and its association with poor prognosis has been reported in different cancers including lung cancer [12], cholangiocarcinoma 99

[13] and colorectal cancer [14]. During global gene expression analysis MUC5AC appeared among the top differentially expressed genes in PC when compared with normal pancreas [15].

We and others have recently shown that MUC5AC is not detected in normal pancreas, while it is overexpressed in PC and the expression increases as the cancer progresses from the precursor lesions [Pancreatic Intraepithelial Neoplasia (PanIN)] to metastatic PC [16, 17]. Interestingly, few in vitro and in vivo studies revealed oncogenic role of MUC5AC. MUC5AC was associated with

increased adhesion and invasion to extracellular matrix proteins and in vivo tumor growth [18,

19]. However, conclusive mechanistic basis of these observations remained elusive. Realizing the

significance of MUC5AC in various malignancies, its overexpression in PC and functional

studies highlighting its oncogenic role, we were intrigued to extensively investigate the

MUC5AC mediated functional roles and mechanistic basis in PC.

3. Results

3.A MUC5AC is overexpressed in PC tissues and PC cell lines

In our immunohistochemical analysis on pancreatic adenocarcinoma tissues procured during

Whipple procedure on pancreatic cancer patients, we observed a significantly increased

expression (p<0.001) of MUC5AC in pancreatic adenocarcinoma cases (HS Mean±SE,

0.93±0.14) compared to no expression of this mucin in adjacent normal pancreas (HS Mean±SE,

0±0) (Figure 3.1A.a,b and Figure 3.1B). Increased expression of MUC5AC was observed in

79.4% pancreatic adenocarcinoma cases compared to none of the normal pancreas. Overall, these results suggest that MUC5AC is overexpressed in PC cases.

Looking at the differential expression of MUC5AC in pancreatic adenocarcinoma tissues, we further investigated expression of MUC5AC in different PC cell lines. Very high expression of MUC5AC mRNA was observed by q-PCR in different PC cell lines (T3M4, ASPC-1, BXPC3,

FG/COLO357, COLO357, SW1990, SU86.86 and HUPT3) relative to the normal pancreas cells

(HPNE) (Figure 3.1C). Similar to the transcript levels, at protein level, MUC5AC expression 100

was not observed in normal pancreatic cells (HPNE), while its increased expression was observed in different PC cells (ASPC1, BXPC3, COLO357, SW1990, and T3M4) (Figure 3.1D). All other

PC cells tested were observed to be negative for MUC5AC protein expression (CD18/HPAF,

CAPAN1, MiaPaCA, Panc-1) (Figure 3.1D). Additionally, to delineate the exact subcellular localization of MUC5AC, we also performed immunofluorescence studies on BXPC3,

FG/COLO357, and SW1990 cells. A granular staining pattern of MUC5AC expression was observed in the cytoplasmic compartments as well as it was also observed to be at intercellular junctions (Figure 3.1E).

Further, to functionally characterize the MUC5AC mediated implications in PC and further explore the associated mechanistic basis, we performed stable knockdown of MUC5AC expression in two PC cell lines (FG/COLO357, and SW1990), which endogenously overexpressed MUC5AC. Knockdown of MUC5AC in PC cells was validated by western blot analysis. We observed a reduction in MUC5AC expression, at protein level in knockdown cells

(FG-Sh5AC and SW-Sh5AC) compared to the respective scramble control cells (FG-Scr, SW-

Scr) (Figure 3.1F).

3.B MUC5AC silencing decreased cell viability, anchorage-independent growth and induces apoptosis

To analyze the effect of MUC5AC knockdown on PC cell viability, we performed MTT assay under reduced serum (1%) conditions. In this assay, we observed moderately reduced viability of the PC cells on knockdown of MUC5AC (FG/COLO357, p<0.05; SW1990, p<0.01) compared to the scramble controls (Figure 3.2A). To further analyze the impact of MUC5AC knockdown on anchorage-independent growth we performed soft agar assay and observed significant reduction

(p<0.001) in number of colonies formed on knockdown of MUC5AC in FG/COLO357 PC cells

(Figure 3.2B), suggesting that secretory mucin MUC5AC assists in anchorage-independent growth of PC cells. Next, to investigate that whether reduced viability and anchorage independent 101

growth of PC cells in absence of MUC5AC is mediated by increased apoptosis, we performed apoptosis assay (Annexin-V, PI staining) under conditions of serum starvation. We observed that there was a significant increase (p<0.05) in FG/COLO357 PC cell apoptosis on inhibition of

MUC5AC expression (Figure 3.2C). Overall, the results from these experiments suggest that

MUC5AC plays a role in increased viability of PC cells.

3.C MUC5AC silencing induces G1/S phase cell cycle arrest

To further investigate the mechanism underlying the reduced viability of PC cells following

MUC5AC knockdown, we performed cell cycle assessment of the MUC5AC knockdown cells by

fluorescence activated cell sorting analysis. Interestingly, on inhibition of MUC5AC expression

there was a significant increase in the percentage of cells in G1-phase and a significant decrease

in the percentage of cells in S-phase (13%, p<0.05; 19%, p<0.001) in FG/COLO357 and SW1990

PC cells respectively compared to the scramble control cells. (Figure 3.3A and B). The effect of

MUC5AC knockdown on delayed G1/S progression prompted us to examine the expression of

key regulators of the G1/S phase cell cycle transition. We observed a significant upregulation of cell cycle inhibitor protein p27, and downregulation of Cyclin-D1 and Cyclin-E cell cycle

regulatory proteins on knockdown of MUC5AC compared to the scramble control cells (Figure

3.3 C). These observations suggest that by impacting cell cycle regulatory proteins MUC5AC may impact the PC cell growth and anti-apoptosis effects.

3.D MUC5AC confers resistance to Gemcitabine in pancreatic cancer cells

Looking at MUC5AC mediated anti-apoptotic and cell cycle effects, we next investigated the

anti-proliferative impact of current standard chemotherapeutic drug Gemcitabine after inhibition of MUC5AC expression in FG/COLO357 PC cells. For this we used a range of effective concentrations of Gemcitabine in MTT assay that can inhibit the proliferation of PC cells. The

results from MTT assay indicated that the control FG-Scr cells were less sensitive to the anti-

proliferative effects of Gemcitabine as compared to MUC5AC knockdown cells. The values of 102

the half maximal inhibitory concentration (IC-50) obtained for FG-Scr cells were higher than the values for MUC5AC knockdown cells (Figure 3.4A). This observation suggested that the downregulation of MUC5AC in FG/COLO357 cells was accompanied by an enhanced sensitivity of PC cells to Gemcitabine compared to MUC5AC expressing control cells. Further, we observed

a dose dependent, significant reduction (p<0.001) in viability of the PC cells by MTT assay on

MUC5AC Knockdown after 48 hours of Gemcitabine treatment (Figure 3.4B). As previously

described, we observed anti-apoptotic function of MUC5AC in PC cells in response to serum

starvation. Therefore, to further determine the function of MUC5AC in the development of

resistance to Gemcitabine in PC cells, we assessed the effect of MUC5AC down-regulation on

Gemcitabine-induced apoptosis in PC cells. To analyze the apoptotic index, the scramble control

and MUC5AC knockdown cells were treated with Gemcitabine for 48 hours. The Gemcitabine

treatment was directly associated with significant increase in percentage of cells undergoing

apoptosis (p<0.05) and necrosis (p<0.05) on MUC5AC knockdown compared to the scramble

control cells (Figure 3.4C).

To further elucidate the mechanistic basis of MUC5AC mediated anti-apoptotic effects

on Gemcitabine treatment, we investigated the levels of different apoptotic mediators in the intrinsic pathway. For this we prepared cytosolic extracts from scramble control and MUC5AC knockdown PC cells after 48 hours of treatment with Gemcitabine. By immunoblotting, we observed high levels of Cyt-c, higher expression of apoptotic mediator BAD, Cleaved-Caspase-9,

Cleaved-Caspase-3 along with reduced levels of anti-apoptotic protein XIAP and BCl2 in the cytosolic extracts from MUC5AC knockdown cells treated with Gemcitabine for 48 hours compare with the scramble control cells treated with Gemcitabine for 48 hours (Figure 3.4D).

This suggested Gemcitabine mediated significant induction of apoptosis in the absence of

MUC5AC. 103

Looking at the previous reports suggesting the reactivation of WNT/β-Catenin pathways in Gemcitabine-resistant cancer cells. WNT/β-Catenin signaling has been demonstrated to coordinate the stemness and cancer stem cell states. Also, GLI1 mediated increased expression of

MUC5AC results in nuclear accumulation of β-Catenin. Therefore, we hypothesized that on

Gemcitabine treatment MUC5AC mediates nuclear translocation of β-Catenin resulting in resistance of PC cells by enrichment of stem cell markers. Interestingly, we observed that in

MUC5AC knockdown cells treated with Gemcitabine there was a significant reduction in nuclear translocation of β-Catenin (Figure 3.4E). Further analysis of stem cell markers revealed significant reduction in expression of stem cell markers ESA, SHH, SOX2 and OCT3/4 in

MUC5AC knockdown cells on treatment with Gemcitabine (Figure 3.4F). Overall, on basis of

our results, we conclude that MUC5AC mediated Gemcitabine resistance in PC cells might be

mediated by β-Catenin mediated enrichment of stemness.

3.E MUC5AC knockdown reduces cell motility and adhesion to extracellular matrix

proteins

MUC5AC has been shown to be associated with increased metastasis of lung cancer cells.

Therefore, we investigated whether inhibition of MUC5AC expression in PC cells would impact

their motility and metastasis. For this, we examined the motility of MUC5AC knockdown cells in

comparison to control cells (FG-Scr) utilizing Boyden chamber assay. MUC5AC knockdown

cells demonstrated a significant reduction in the migration capability (p<0.0001) compared with

the scramble control cells (Figure 3.5A).

By virtue of being a secretory mucin, on its secretion from PC cells MUC5AC may

modulate cell-ECM interactions. Therefore, we investigated whether overexpression of

MUC5AC in PC cells may impact PC cell-ECM interactions. For this binding affinity of FG-

Scr/Sh5AC and SW-Scr/Sh5AC PC cells to Matrigel was examined. MUC5AC expressing

control cells (FG-Scr, SW-Scr) demonstrated significantly higher (p<0.05, p<0.001 respectively) 104

adherence to Matrigel in comparison to MUC5AC knockdown cells (Figure 3.5B). This suggests that overexpression of MUC5AC in PC cells plays an important role in tumor progression by modulating tumor cell-matrix interactions.

Next, we investigated the probable mechanistic basis of MUC5AC mediated increased motility and adherence to matrigel in PC cells. For this, we investigated the expression of cell

adhesion markers on inhibition of MUC5AC expression. Interestingly, we observed a significant

increase in expression of E-Cadherin levels on knockdown of MUC5AC (Figure 3.5C). Further,

integrins are the cell adhesion receptors that have been demonstrated to regulate initiation,

progression and metastasis of tumors. Study conducted on lung cancer cells has also highlighted

MUC5AC mediated impact on integrins protein expression. Therefore, we investigated MUC5AC

mediated impact on integrin expression in PC cells. We observed a significant reduction in the

expression of αV- and β5-integrins on knockdown of MUC5AC in comparison to the scramble

control cells (Figure 3.5C). As downstream mediators of integrin signaling, we investigated

phosphorylation of Src and observed that phosphorylation of Src at Y-416 is reduced on

knockdown of MUC5AC in comparison to the scramble control cells (Figure 3.5C). Overall, our

study suggests that MUC5AC may impact motility of PC cells by impacting expression of E-

Cadherin and integrin signaling cascades.

3.F MUC5AC exists in a complex with E-Cadherin and β-Catenin

Colocalization of MUC5AC with E-Cadherin results in loss of E-Cadherin function. Besides this,

it has been reported that MUC5AC alters PC cell-cell adhesion and migration by modulating E-

Cadherin and β-Catenin localization. Based on these reports we hypothesized that MUC5AC may

interact with E-Cadherin/β-Catenin complex to modulate their function. To explore interactions

between MUC5AC and E-Cadherin, we pulled down MUC5AC and probed with anti-E-Cadherin

and β-Catenin antibodies. MUC5AC was found to be immunoprecipitated with E-Cadherin and β-

Catenin as indicated by immunoprecipitation assays (Figure 3.5D). We further confirmed the co- 105

localization of MUC5AC and E-Cadherin by confocal analysis. We could observe the

colocalization of MUC5AC and E-Cadherin at intercellular junctions (Figure 3.5E). Looking at

MUC5AC interactions with E-Cadherin, we suggest that by interfering with assembly of E-

Cadherin adherens junction, MUC5AC might facilitate β-Catenin nuclear translocation and thus impact the PC cell growth and metastasis.

3.G Impact of MUC5AC on endothelial cell viability and tube formation capacity

Previous studies have shown that in presence of MUC5AC, increased VEGF-A secretion may interact with VEGFR-1 in autocrine manner to impact PC cell growth. In this study, we also observed a reduction in relative VEGF-A mRNA levels by q-PCR on knockdown of MUC5AC in

PC cells (Figure 3.6A). Therefore, we hypothesized that angiogenic factors released in the presence of MUC5AC may impact endothelial cell viability and contribute to the endothelial cell tube formation. To test this hypothesis, the HMEC-1 endothelial cells were cultured in conditioned media from MUC5AC expressing and knockdown PC cells. In MTT assay, a significant decrease (p<0.05) in the viability of HMEC-1 cells cultured with conditioned media

from MUC5AC knockdown cells was observed compared to the HMEC-1 cells cultured with

conditioned media from scramble control cells (Figure 3.6B). Further, the HMEC-1 cells grown

on Matrigel in the presence of conditioned media from MUC5AC knockdown PC cells had a

significant reduction in a total number of endothelial tube junctions (p<0.005) (Figure 3.6C, D)

and vessels percentage area (p<0.005) compared to the endothelial cells grown in conditioned media from the scramble control PC cells (Figure 3.6C, E). We further analyzed the signaling

mechanisms associated with these observations. HMEC-1 cells treated with conditioned media

from MUC5AC knockdown PC cells revealed a reduced phosphorylation of cell survival

associated protein AKT (Ser-473) and phosphorylation of the protein associated with increased

motility-FAK (Y-397) (Figure 3.6F). Further, there was no impact on phosphorylation of Erk1/2. 106

Overall, these results suggest that MUC5AC mediated increased release of VEGF-A may impact tumor angiogenesis.

3.H Inhibition of MUC5AC in pancreatic cancer cells results in decreased tumorigenicity

and metastasis in vivo

To examine the effect of MUC5AC knockdown on pancreatic tumor growth and metastasis in

vivo, we orthotopically implanted FG-Scr/Sh5AC PC cells into the pancreas of the nude mice.

The animals were sacrificed 50 days post-implantation. The primary pancreatic tumors were

observed in all the mice implanted with FG-Scr/Sh5AC PC cells. Interestingly, there was a

significant reduction (p=0.03) in pancreatic tumor weight of FG-Sh5AC mice group (Mean±SE,

303±74.3 mg) compared to FG-Scr group (Mean±SE, 801±195.5 mg) (Figure 3.7A). In support

of increased tumor weight we could observe a significantly high number of Ki67 expressing

nuclei in tumors from MUC5AC expressing PC cells in comparison to the tumors from

MUC5AC knockdown cells (Figure 3.7B). Further, in our examination of the peritoneum,

intestine, diaphragm, liver, lung, ovary, and mesenteric lymph nodes for the presence of

metastatic lesions, we observed metastatic lesions in greater number of the FG-Scr mice group

compared to the FG-Sh5AC mice group (Figure 3.7C). These results suggest that MUC5AC

profoundly impacts in vivo tumor growth and metastasis of the PC cells to the distant organs.

4. Discussion

PC remains the most lethal malignancy with five year survival <8% [1]. Therefore, multiple

research studies have continuously focused on identifying and validating different molecules for

the early diagnosis and treatment of PC. Despite all these efforts, PC remains to be a devastating

disease. This highlights the lacunae in our understanding of the biological and molecular

processes involved in the initiation and progression of this deadly malignancy. This necessitates

functional characterization of pancreatic tumor associated proteins to develop a more in-depth

understanding of the various signaling pathways deregulated in PC. The knowledge gained can be 107

employed to devise efficient early stage diagnostic markers, prognostic markers and targeted therapies for PC.

Mucins are universally recognized to be deregulated in cancer and have been identified as biomarkers or molecular targets for the treatment of PC [9]. Interestingly, secretory mucin

MUC5AC was observed to be the top most differentially expressed genes in PC when compared to the normal pancreas [15]. MUC5AC is not expressed in normal pancreas while its de novo

expression is observed as early as PanIN-1 lesions to further increase during the progression of

pancreatic ductal adenocarcinoma [16]. Overexpression of MUC5AC has been associated with poor prognosis of PC patients [20]. Few in vitro, in vivo studies also highlighted the role of

MUC5AC in pancreatic tumor growth and metastasis [18, 19]. However, the conclusive

mechanistic basis remained obscure. In light of these observations, we proposed that MUC5AC

might have a significant role during the progression of PC. We sought to functionally characterize

this mucin in PC and explore the underlying mechanisms with an objective to contribute towards

better understanding of the disease and developing therapeutic modalities.

Concordant to previous studies [16], our immunohistochemical analysis done on pancreatic cancer samples from whipple procedure revealed that MUC5AC is absent in the normal pancreas,

while its expression is significantly increased in PC. Perineural invasion (PNI) is one of most

characteristic feature of PC. PNI indicates aggressive behavior of pancreatic tumor and correlates

with poor prognosis of PC patients [21]. Interestingly, one of the most interesting observations

that we could make was an increased expression of secretory mucin MUC5AC in the areas of

PNI. These observations suggest that overexpressed MUC5AC may play an important role in the

progression of PC.

Mucins have been associated with PC cell growth, motility, invasion, angiogenesis and

chemoresistance [7]. MUC5AC has been shown to modulate lung cancer cell growth, motility

and chemoresistance properties [22]. Hence, for functional characterization of MUC5AC, we 108

identified endogenously MUC5AC expressing PC cell lines (FG/COLO357 and SW1990) and

performed knockdown of MUC5AC. Assays conducted using these cell line models demonstrated

that MUC5AC is a critical player in facilitating PC cell proliferation, migration, angiogenesis,

and chemoresistance. Decreased expression of MUC5AC resulted in the impaired viability of PC

cells, significantly decreased anchorage-independent growth, and increased apoptosis. Regulation

of cell cycle is extensively deregulated in cancer impacting cancer cell proliferation and tumor

growth [23]. Hence, the impact of MUC5AC on cell proliferation was further validated by cell cycle analysis assay. Interestingly, we observed that MUC5AC is associated with significantly

faster progression of the PC cells through G1/S phase of the cell cycle. Aberrant expression of

G1/S phase cyclins and especially cyclin D and cyclin E is involved in different types of cancer

and results in tumor formation [24]. Mechanistically, we observed increased expression of cell

cycle inhibitor p27 and decreased expression of G1/S phase regulatory proteins Cyclin-D1 and

Cyclin-E on knockdown of MUC5AC.

One of the biggest problems associated with PC is early stage metastasis to distant locations. As MUC5AC is expressed at early stages of PC, we wanted to explore whether overexpressed MUC5AC can impact migration and adhesive properties to extracellular matrix proteins. In this study, we observed a significant reduction in the migratory potential of PC cells on knockdown of MUC5AC. Cancer cell and extracellular matrix interactions play a vital role in

progression and metastasis of cancer [25]. Interestingly, MUC5AC positive cells revealed a significantly higher tendency to adhere to Matrigel, advocating the role of MUC5AC in the

metastatic process. Increasing evidences suggest that epithelial-mesenchymal transition (EMT) is

associated with pancreatic cancer metastasis and drug resistance [26]. Interestingly, there was an increased expression of epithelial marker E-Cadherin on knockdown of MUC5AC. As a recent study highlighted the role of MUC5AC in regulating expression of integrins in lung cancer [22] , hence we investigated the impact of MUC5AC on the expression of integrins. We observed a 109

downregulation of αV-, β5-integrins on knockdown of MUC5AC. As β5-integrin is known to mediate its effects through Src-FAK signaling [27], we further investigated the impact of

MUC5AC knockdown on phosphorylation of Src kinase. Interestingly, knockdown of MUC5AC decreases phosphorylation of Src-(Y416). It has been speculated that that MUC5AC may impact localization of E-Cadherin to cell membrane [28] and by colocalizing with E-Cadherin,

MUC5AC and MUC1 modulate E-Cadherin function [29]. In light of these observations, we tested the hypothesis that MUC5AC may physically interact with E-Cadherin. Interestingly, in our immunoprecipitation experiment, we observed that in PC, MUC5AC interacts and co-localize with E-Cadherin. Interestingly, we could also observe an interaction of MUC5AC with β-Catenin and Src. WNT/β-Catenin signaling is associated with initiation and progression of the PC [30].

Overall, Looking at these observations, we assume that by its interactions with E-Cadherin

MUC5AC may interfere with its assembly resulting in increased nuclear translocation of β-

Catenin to the nucleas thereby impacting PC cell growth and metastasis.

Furthermore, angiogenesis is one of the most important factor associated with growth and

metastasis of pancreatic cancer [31]. Previous studies showed MUC5AC mediates PC cell growth

by its impact on phosphorylation of VEGFR-1 [18]. Therefore, we further explored whether

MUC5AC impacts expression of angiogenic factors and impact angiogenesis process in paracrine

manner. We observed that knockdown of MUC5AC decreases mRNA levels of VEGF-A, and

significantly decreased the endothelial cell viability and tube formation capacity quantified as

percentage vessels area and a total number of junctions formed. From these observations, we

assumed that MUC5AC assist metastasis of PC cells through increased angiogenesis. This led us

to further investigate the impact of MUC5AC on metastasis in vivo. Hence, we utilized an

orthotopic model of PC [32]. As expected, we observed a significantly high pancreatic tumor

size/weight and number of metastases to distant organs in mice orthotopically injected with 110

MUC5AC expressing cells. In conclusion, using various biochemical assays we report for the first time a novel cell cycle regulatory and metastasis-related role of MUC5AC in PC.

It has been speculated that polymeric gel forming secretory mucins MUC5AC may form a gel like layer over cell surface and hinder the effective targeting of therapeutics. In a recent study from our lab, it was shown that MUC5AC plays a critical role in cisplatin resistance of lung cancer cells [22]. Looking at our observations of MUC5AC mediated anti-apoptotic impact, impact on expression of integrins, we hypothesized that MUC5AC may play an important role in resisting the anti-proliferative impact of chemotherapeutic drug-Gemcitabine. Interestingly, we observed that decreased expression of MUC5AC sensitizes PC cells to Gemcitabine. There was a significant increase in apoptosis and necrosis in Gemcitabine-treated MUC5AC knockdown PC cells. Mechanistically, we observed increased expression of apoptotic mediators Cyt-c, BAD, cleaved caspase-3 and cleaved caspase-9 in cytoplasmic extracts form MUC5AC knockdown PC cells. Reactivation of Wnt/β-Catenin signaling in Gemcitabine-resistant cancer-cells has previously been demonstrated [33]. WNT/β-Catenin signaling coordinates cancer stem cell state

[34]. Increased MUC5AC expression mediates nuclear accumulation of β-Catenin in the nucleus

[28]. Therefore, we tested the hypothesis that MUC5AC mediated increased nuclear translocation of β-Catenin may enrich the stem cell population in Gemcitabine-resistant PC cells. Interestingly, we observed a drastic decrease in nuclear translocation of β-Catenin in Gemcitabine treated

MUC5AC knockdown cells. Further evaluation of stem cell markers revealed a significant reduction in expression of ESA, SHH, SOX2 and OCT3/4 in Gemcitabine-treated MUC5AC knockdown PC cells. Overall, from our study we conclude that MUC5AC may mediate chemoresistance by impacting expression of integrins and enrichment of stem cell population in

β-Catenin dependent manner.

In totality, secretory mucin MUC5AC plays a critical role in the progression of PC and can be an important therapeutic target for PC. 111

Figure 3.1: Overexpression of secretory mucin MUC5AC in PC tissues and PC cell lines. (A)

Immunohistochemical (IHC) analysis of MUC5AC expression in paraffin embedded sections of the pancreatic cancer tissues (n=34) from whipple procedure using anti-MUC5AC Mab 45M1.

Representative images for MUC5AC expression in tumor adjacent normal pancreas (a) pancreatic

ductal adenocarcinoma (b) at magnification 10X. Yellow arrow denotes normal duct in normal

pancreas with no expression of MUC5AC while in adenocarcinoma it highlights the increased expression of MUC5AC in tumor tissue. (B) Box plots showing distribution of H-Score for

MUC5AC expression in pancreatic cancer cases compared to the adjacent normal pancreas.

Significantly increased expression of MUC5AC (p<0.002) was observed in pancreatic cancer tissues with a mean H-score of 0.93 (range 0-3) as compared with the histologically normal pancreatic tissues with a mean H-Score of 0. (C) Expression of MUC5AC relative to its expression in normal pancreatic cell line HPNE was determined in a panel of PC cell lines at mRNA level by q-PCR. β-actin was used for normalization in q-PCR analysis. (D) Expression of

MUC5AC was determined at protein level by western blotting utilizing 2% SDS-Agarose gel.

Expression of MUC5AC was not detected in normal pancreatic cell lines human pancreatic nestin expressing (HPNE) and human pancreatic ductal epithelial (HPDE). Differential expression of

MUC5AC was observed in PC cells. Expression of MUC5AC in A549 cells was utilized as a positive control. β-actin was used as loading control for western blot analysis. (E) Localization of

MUC5AC expression in BXPC-3, SW1990 and FG/COLO357 PC cells was determined by confocal microscopy. The cells were grown at low density on sterilized coverslips, washed, and fixed with methanol, and permeabilized before incubation with antibodies against MUC5AC

(45M1). Fluorescence signals from each cell type were acquired by confocal microscopy.

MUC5AC (green) was detected by using a fluorescein-conjugated secondary antibody. The yellow arrow indicates cytoplasmic, granular and intercellular localization of MUC5AC expression in these cells. (F) Silencing of MUC5AC expression in FG/COLO357 and SW1990 112

PC cells. Cells were infected with retroviruses carrying short hairpin RNAs (ShRNAs) against

MUC5AC in pSUPER.retro.puro vector or with scrambled sequence containing vector used as control. Transfected cells were selected using Puromycin antibiotic and positive clones were tested for MUC5AC expression using 2% SDS-Agarose gel. Significant decrease in expression of

MUC5AC protein was observed in cells stably transfected with different MUC5AC ShRNAs targeting at different sites of MUC5AC mRNA. β-actin was used as the loading control. 113

Figure 3.1

Adenocarcinoma A Normal a b

B P<0.002

114

Figure 3.1 Contd…

MUC5AC expression in Pancreatic cancer C cells (qPCR) D

500 Relative mRNA ( log foldchange) 1 T3M4 CD18 HPNE QGP1 HUPT3 ASPC1 BXPC3 PANC1 SW1990 SU86.86 CAPAN1 COLO357 MIAPACA PANC10.05 F E FG/COLO357 DAPI MUC5AC DAPI/MUC5AC/DIC DAPI/MUC5AC/DIC FG/COLO357 SW1990 1 2 1 2 3 - - - - - BxPC3 cr S Sh5AC Scr Sh5AC Sh5AC Sh5AC Sh5AC

MUC5AC MUC5AC SW1990

β-ACTIN β-ACTIN FG/COLO357

115

Figure 3.2: MUC5AC knockdown decreases cell viability, anchorage independent growth and induces apoptosis in PC cells. (A) Results from MTT assay (Day 1-6) showing that knockdown of MUC5AC in FG/COLO357 and SW1990 cells reduced viability of PC cells in comparison with scramble control cells. (B) Impact of MUC5AC on anchorage-independent growth was analyzed by soft agar assay. Statistical analysis revealed a significant reduction of anchorage-independent colony formation (*p<0.001) on knockdown of MUC5AC in

FG/COLO357 cells. (C) Annexin-V and propidium iodide staining analysis by flow cytometry to identify apoptosis in FG-Scr/Sh5AC cells. For this, FG-Scr/Sh5AC cells were plated at a density

of 1X106 cells in 60 mm cell culture Petri dishes for 48 hours at 37°C. After 48 hours, the cells

were washed with PBS (3x) and then made serum-free for next 48 hours. The induction of

apoptosis was measured by staining the cells with Annexin-V and propidium iodide solution,

followed by fluorescence-activated cell sorting analysis (FACS). The statistical analysis showed

significantly increased percentage of PC cells undergoing apoptosis on knockdown of MUC5AC

expression (*p<0.05). 116

Figure 3.2

A SW1990 Cells FG/COLO357 cells *P<0.05 110 *P<0.01 100 100 * * * 90 * * * * 90 * Scr * Scr 80 80 * * Sh5AC-1 * Sh5AC-1 70 Sh5AC-2 70 Sh5AC-2 60 60 Cell Viability of (% Control) Cell Viability of (% Control) 50 50 1 2 3 4 5 6 1 2 3 4 5 6 FG/Colo357/ Soft Agar assay FG-Scr FG-Sh5AC-1 FG-Sh5AC-2 20 B *p<0.001 15 10 * * 5 No. of Colonies 0 Scr Sh5AC-1 Sh5AC-2

C FG-Scr FG-Sh5AC-2 30 FG/COLO357-Apoptosis Assay 25 * * *p<0.05 20 Scr 15 Sh5AC-1 Sh5AC-2 10 5 % Apoptotic cells Apoptotic % 0 Scr Sh5AC-1Sh5AC-2 117

Figure 3.3 MUC5AC knockdown induces cell cycle arrest in PC cells. (A, B) FG/COLO357,

SW1990 knockdown and scramble control cells were synchronized by serum starvation for cell cycle analysis. After synchronization, cells were stained with propidium iodide (PI) and analyzed by flow cytometry to evaluate the number of cells in different phases of the cell cycle. PC cells are significantly accumulated in G1 phase of cell cycle and progress slowly through S phase on knockdown of MUC5AC when compared to the scramble control cells. (C) A total of 40 µg protein from FG-Scr/Sh5AC, SW-Scr/Sh5AC cells was resolved by SDS-Agarose (for

MUC5AC) and SDS–PAGE, followed by immunoblotting for the expression of MUC5AC, p21, p27, Cyclin-D1, and Cyclin-E. Increased expression of cell cycle inhibitor p27 and decreased expression of cell cycle regulatory proteins Cyclin-D1 and Cyclin-E is observed on knockdown of MUC5AC in comparison to the scramble control cells. β-actin was used as a loading control.

118

Figure 3.3

A FG-Scr FG-Sh5AC FG/COLO357-Cell Cycle Analysis 80 *P<0.05 70 * * 60 Scr 50 Sh5AC-1 40 * Sh5AC-2 % Cells % 30 20 10 0 G1 S G2/M Cell cycle phase

SW1990-Cell Cycle Analysis B SW-Scr SW-Sh5AC 70 *p<0.001 60 * 50 40 * SCR Cells

% 30 Sh5AC-2 20 10 0 G1 S G2/M cell cycle phase

119

Figure 3.3 Contd…

C

FG/COLO357 SW1990 1 2 3 1 2 - - - - - cr S Scr Sh5AC Sh5AC Sh5AC Sh5AC Sh5AC

MUC5AC MUC5AC

p21 p27

p27 Cyclin- D1 Cyclin-D1 Cyclin- E

Cyclin-E β-Actin

Actin

120

Figure 3.4 MUC5AC mediated impact on Gemcitabine resistance. (A) Table showing the

reduced IC-50 of Gemcitabine on MUC5AC knockdown in PC cells compared to the scramble

control cells. (B) Anti-proliferative effects induced by Gemcitabine treatment on FG-Scr/Sh5AC

PC cells in full growth medium. The PC cells were untreated (assay control) or treated with

indicated Gemcitabine concentrations (0, 50, 100, 200, 400, 800, 1600 nM) for 48 hours. The cell

proliferation was evaluated by MTT assay. A significant dose dependent reduction in viability of

PC cells (p<0.001) was observed on Gemcitabine treatment to MUC5AC knockdown cells in

comparison to scramble control cells. (C) FG-Scr/Sh5AC cells were plated in 10 cm petridishes

and treated with 1 µM Gemcitabine for 48 hours. The cells were then stained with PI and

Annexin-V and percentage of cells undergoing apoptosis and necrosis was analysed by FACS.

The results are expressed as the percentage (Mean±SE) of the apoptotic and necrotic cells for FG

-sh5AC cells compared with FG-Scr cells after treating with 1 µM Gemcitabine for 48 hours.

Gemcitabine treatment resulted in significantly higher percentage of apoptosis (p<0.05) and

necrosis (p<0.001) in PC cells with MUC5AC knockdown. (D) Intrinsic apoptotic pathway was

assessed in FG-Scr/Sh5AC cells in response to Gemcitabine treatment. For this cells were treated

with 1 µM Gemcitabine for 48 hours, followed by cytosolic extract preparation as described in

materials and methods section. A total of 50 µg protein from each cytosolic extract was resolved

by SDS–PAGE (15%), followed by immunoblotting with anti-Cyt-c, BCl2, XIAP, BAD, Cleaved

Caspase-3, Cleaved Caspase-9 and GAPDH (loading control) antibodies. (E) FG-Scr/Sh5AC

cells were treated with 1 µM Gemcitabine for 48 hours and were lysed to prepare whole cell

extract (WCE), nuclear extract (NE) and cytosolic extract (CE) and immunoblotted with anti-β-

Catenin antibody. Expression of SP1 and GAPDH was done to investigate the purity of nuclear

fraction and cytosolic fraction respectively. Nuclear translocation of β-Catenin is reduced in

MUC5AC knockdown PC cells compared to the scramble control cells on treatment with

Gemcitabine. (F) Impact of Gemcitabine treatment on enrichment of stem-cell markers in 121

MUC5AC expressing and knockdown cells. Untreated control cells and cells treated with 1µM

Gemcitabine for 48 hours were lysed to prepare lysates that were further immunoblotted with the indicated antibodies. Significant reduction in expression of ESA, SHH, SOX2 and OCT3/4 was observed in MUC5AC knockdown cells in comparison to the scramble control cells on treatment with Gemcitabine. 122

Figure 3.4

A B 120 *P<0.001 IC50 in nM 100 FG-Scr FG-Sh5AC-1 FG-Scr (48 h) 1263.377 80 FG-Sh5AC-2 60 * ** * * FG-Sh5AC-1 (48h) 612.0536 40 * * * * * 20 *

FG-Sh5AC-2 (48 h) 439.1729 Cell viability (% of control) 0 0 50 100 200 400 800 1600 [Gemcitabine nM]

C 48 Hr Gemcitabine Treatment 48 Hr Gemcitabine Treatment *P<0.05 70 *P<0.05 25 60 * 20 * 50 15 40 FG-Scr FG-Scr 30 FG-Sh5AC-2 10 FG-Sh5AC-2 20

% Apoptotic cells Apoptotic % 5 10 % Necrotic cells 0 0 Untreated 1 µM Gem Untreated 1 µM Gem

123

Figure 3.4 Contd…

FG/COLO357-Gem (1µM)

D E WCE CE NE FG/COLO357 Scr Sh5AC Scr Scr Scr Gem (1 µM) + + Sh5AC Sh5AC Sh5AC β-Catenin IB: Cyt-c (12kDa) GAPDH

IB: BCL2 SP-1

FG/COLO357 IB: XIAP (55kDa) F Scr Sh5AC Scr Sh5AC IB: BAD (12kDa) Gem (1 µM) - - + + IB: CD133 (95 kDa) IB: CD24 (35 kDa)

IB: Cleaved-Caspase-3 IB: ESA (35 kDa) (17/19 kDa) IB: SHH (19 kDa) IB: Cleaved Caspase-9 (37 kDa) IB: SOX2 (35 kDa)

GAPDH IB: OCT3/4 (53 kDa)

IB: ACTB (42 kDa)

124

Figure 3.5: MUC5AC mediated impacts on motile properties of pancreatic cancer cells. (A)

Boyden chamber assay to assess the migration of PC cells. The FG-Scr/Sh5AC cells (1X106)

were plated on boyden chamber in serum free conditions and were allowed to migrate under

chemotactic drive. The migration of MUC5AC knockdown cells was observed to be significantly

reduced (*p<0.0001) in comparison to the scramble control cells. (B) Cell-adhesion assay to

evaluate MUC5AC mediated impacts on PC cell and extracellular matrix interaction. For this a

single-cell suspension of FG-Scr/Sh5AC cells and SW-Scr/Sh5AC (1×104 cells) in 100 μl of full growth medium was added to each well. After 2 incubation at 37˚C, the nonadherent cells were washed with PBS and the adhered cells were stained with 50μl of 0.5% crystal violet in 20% methanol for 30 min. The cells were then washed with deionized water and were lysed in 50 μl of

30% acetic acid. Cell adhesion was calculated by measuring the absorbance of the eluted dye at

570 nm using a microplate reader. In the absence of MUC5AC there was a significant reduction

(FG/COLO357, p<0.05; SW1990, p<0.001) in adhesion of PC cells to the Matrigel in comparison

to the control cells. (C) Cell lysates were prepared from FG/COLO357 scramble and MUC5AC

knockdown cells to perform immunoblot analysis of various proteins associated with migration

and adhesion of PC cells. Upon knockdown of MUC5AC the expression of integrins αV, β3, β5

and phosphorylation of Src (Y416) were decreased while expression of cell-cell adhesion marker

E-Cadherin was increased as compared with scramble control cells. β-actin was immunoblotted

as loading control. (D) Immunoprecipitation assay to investigate the proteins interacting with

MUC5AC demonstrated that MUC5AC strongly interacts with E-Cadherin along with β-Catenin and Src. (E) Colocalization of MUC5AC and E-Cadherin in PC cells as detected by

immunofluorescence. Fluorescence signals from each scan were acquired sequentially. MUC5AC

(green) was detected by using a Alexa-fluor 488 secondary antibody; E-Cadherin was identified

with Alexa-fluor 648 secondary antibody (red). Dual-merge of MUC5AC/E-Cadherin (green and red) showed colocalization. 125

Figure 3.5

A FG-Scr FG-Sh5AC-1 FG-Sh5AC-2 a b c

C FG/COLO357 Sh5AC Scr

FG/COLO357-Boyden Chamber Assay E-Cadherin 160 140 P<0.0001 αv-integrin 120 100 Scr β3-integrin field 80 Sh5AC-1 60 Sh5AC-2 40 β5-integrin * *

Avg. Avg. # of motie cells/ 20 0 α5-integrin Scr Sh5AC-1 Sh5AC-2 B β4-integrin Adhesion assay on matrigel * P<0.05 120 **P<0.001 p-Src (Y416) 100 80 * 60 ** ** Src 40 20 β-actin (% (% of control) 0 Adhesion Adhesion to matrigel

126

Figure 3.5 contd…

D E FG/COLO357 E-Cadherin MUC5AC DAPI IgG Input IP: MUC5AC

IB: E-Cadherin (130 kDa)

IB: β-Catenin (100 kDa)

IB: SRC( 60kDa) HC (55 kDA) DIC MERGE

127

Figure 3.6 MUC5AC mediated impact on angiogenesis. (A) Q-PCR assessment of VEGF-A mRNA in MUC5AC overexpressing and knock down cells. Levels of VEGF-A mRNA

determined by q-PCR were downregulated on knockdown of MUC5AC in SW1990 pancreatic

cancer cells. (B) HMEC-1 endothelial cell viability as determined by MTT assay, was

significantly high (p<0.05) on treatment with conditioned media from PC cells expressing

MUC5AC in comparison to the HMEC-1 cells treated with conditioned media from the PC cells having knockdown of MUC5AC expression. (C) Higher number of endothelial tubes were observed by tube formation assay done by plating HMEC-1 endothelial cells suspended in conditioned media from FG-Scr/Sh5AC (a, b) and SW-Scr/Sh5AC (c, d) cells on Matrigel coated plates. (D) A significantly higher number of endothelial tube junctions (p<0.005) were formed in

HMEC-1 endothelial cells on treatment with conditioned media FG-Scr/Sh5AC and SW1990-

Scr/Sh5AC. (E) HMEC-1 endothelial cells have significantly higher percentage of vessels area

(p<0.005) on treatment with conditioned media from FG-Scr/Sh5AC and SW1990-Scr/Sh5AC cells. (F) On treatment with conditioned media from MUC5AC knockdown pancreatic cancer cells, there was decreased phosphorylation of AKT (S473) and FAK (Y397) in HMEC-1 endothelial cells compared to controls. 128

Figure 3.6

A B HMEC1-SCR5AC-CM C Scr-CM Sh5AC-CM 1.4 SW-SCR HMEC1-SH5AC-CM a b SW-SH2 1.2 0.9 0.8 *P<0.05 1 0.7 * 1 0.8 0.6 * - 0.5 0.6

0.4 HMEC 0.4 0.3 c d Relative mRNA Relative mRNA levels (565nm/670nm)] 0.2 0.2 0.1

0 Cell Viability [Opticaldensity 0 MUC5AC VEGF-A 24 HR 48 HR D HMEC1 E Vessels % Area F 350 Total no. of Junctions **p<0.005 **p<0.005 ** 20 ** ** 300 ** 18 16 250 14 200 12 pAKT(Ser473) 10 150 8 pFAK (Y397) 100 6 Vessels % Vessels % Area 4 Total no. of Juctions 50 2 0 0 pERK1/2

β-ACTIN 129

Figure 3.7: MUC5AC knock down inhibits in vivo tumorigenicity and reduces metastasis.

(A) Box plot showing the distribution of the tumor weight (mg) from mice injected with FG-

Scr/Sh5AC PC cells. Error bars represent SE for n=7 mice in each group. There was a significant

reduction in pancreatic tumor weight (p<0.05) on knockdown of MUC5AC compared to the

tumors formed by scramble control cells. (B) Immunohistochemistry of MUC5AC expressing

cells and Ki67 in pancreatic tumor sections obtained from the mice orthotopically injected with

FG-Scr/Sh5AC PC cells. Reduced nuclear expression of Ki67 was observed in mice tumor

sections from MUC5AC knockdown cell compared to the control. (C) Immunohistochemistry

utilizing anti-MUC5AC antibody (45M1) revealed presence of MUC5AC expressing cells at

metastatic sites (Liver, Diaphragm and Peritoneum). 130

Figure 3.7

A B

1400 10X 40X * *p<0.05 1200 Scr - 1000 FG 800 MUC5AC Ki67

600 10X 40X

Tumor Weight (mg) Weight Tumor 400

200 Sh5AC - 0 FG FG-Scr FG-Sh5AC MUC5AC Ki67

C Liver Met Diaphragm Met

Peritoneal Met

131

Reference List

[1] M. Hidalgo, New insights into pancreatic cancer biology. Ann. Oncol. 23 Suppl 10 (2012) x135-x138.

[2] L. Rahib, B.D. Smith, R. Aizenberg, A.B. Rosenzweig, J.M. Fleshman, and L.M. Matrisian, Projecting cancer incidence and deaths to 2030: the unexpected burden of thyroid, liver, and pancreas cancers in the United States. Cancer Res. 74 (2014) 2913-2921.

[3] R.L. Siegel, K.D. Miller, and A. Jemal, Cancer statistics, 2016. CA Cancer J. Clin. 66 (2016) 7-30.

[4] A. Teague, K.H. Lim, and A. Wang-Gillam, Advanced pancreatic adenocarcinoma: a review of current treatment strategies and developing therapies. Ther. Adv. Med. Oncol. 7 (2015) 68-84.

[5] T. Hackert and M.W. Buchler, Pancreatic cancer: advances in treatment, results and limitations. Dig. Dis. 31 (2013) 51-56.

[6] R. Warsame and A. Grothey, Treatment options for advanced pancreatic cancer: a review. Expert. Rev. Anticancer Ther. 12 (2012) 1327-1336.

[7] M.A. Hollingsworth and B.J. Swanson, Mucins in cancer: protection and control of the cell surface. Nat. Rev. Cancer 4 (2004) 45-60.

[8] D.W. Kufe, Mucins in cancer: function, prognosis and therapy. Nat. Rev. Cancer 9 (2009) 874-885.

[9] M.P. Torres, S. Chakraborty, J. Souchek, and S.K. Batra, Mucin-based targeted pancreatic cancer therapy. Curr. Pharm. Des 18 (2012) 2472-2481.

[10] S. Kaur, S. Kumar, N. Momi, A.R. Sasson, and S.K. Batra, Mucins in pancreatic cancer and its microenvironment. Nat. Rev. Gastroenterol. Hepatol. 10 (2013) 607-620.

[11] M.C. Rose and J.A. Voynow, Respiratory tract mucin genes and mucin glycoproteins in health and disease. Physiol Rev. 86 (2006) 245-278.

[12] C.J. Yu, J.Y. Shih, Y.C. Lee, C.T. Shun, A. Yuan, and P.C. Yang, Sialyl Lewis antigens: association with MUC5AC protein and correlation with post-operative recurrence of non- small cell lung cancer. Lung Cancer 47 (2005) 59-67.

[13] C. Boonla, S. Wongkham, J.K. Sheehan, C. Wongkham, V. Bhudhisawasdi, N. Tepsiri, and C. Pairojkul, Prognostic value of serum MUC5AC mucin in patients with cholangiocarcinoma. Cancer 98 (2003) 1438-1443.

[14] X.W. Yu, W. Rong, F.L. Xu, G.Y. Xu, Y.R. Sun, and M.Y. Feng, [Expression and clinical significance of Mucin and E-cadherin in colorectal tumors]. Ai. Zheng. 26 (2007) 1204- 1210.

132

[15] C.A. Iacobuzio-Donahue, R. Ashfaq, A. Maitra, N.V. Adsay, G.L. Shen-Ong, K. Berg, M.A. Hollingsworth, J.L. Cameron, C.J. Yeo, S.E. Kern, M. Goggins, and R.H. Hruban, Highly expressed genes in pancreatic ductal adenocarcinomas: a comprehensive characterization and comparison of the transcription profiles obtained from three major technologies. Cancer Res. 63 (2003) 8614-8622.

[16] G.E. Kim, H.I. Bae, H.U. Park, S.F. Kuan, S.C. Crawley, J.J. Ho, and Y.S. Kim, Aberrant expression of MUC5AC and MUC6 gastric mucins and sialyl Tn antigen in intraepithelial neoplasms of the pancreas. Gastroenterology 123 (2002) 1052-1060.

[17] N. Remmers, J.M. Anderson, E.M. Linde, D.J. DiMaio, A.J. Lazenby, H.H. Wandall, U. Mandel, H. Clausen, F. Yu, and M.A. Hollingsworth, Aberrant expression of mucin core proteins and o-linked glycans associated with progression of pancreatic cancer. Clin. Cancer Res. 19 (2013) 1981-1993.

[18] S. Yamazoe, H. Tanaka, T. Sawada, R. Amano, N. Yamada, M. Ohira, and K. Hirakawa, RNA interference suppression of mucin 5AC (MUC5AC) reduces the adhesive and invasive capacity of human pancreatic cancer cells. J. Exp. Clin. Cancer Res. 29 (2010) 53.

[19] H. Hoshi, T. Sawada, M. Uchida, H. Saito, H. Iijima, M. Toda-Agetsuma, T. Wada, S. Yamazoe, H. Tanaka, K. Kimura, A. Kakehashi, M. Wei, K. Hirakawa, and H. Wanibuchi, Tumor-associated MUC5AC stimulates in vivo tumorigenicity of human pancreatic cancer. Int. J. Oncol. 38 (2011) 619-627.

[20] M. Takikita, S. Altekruse, C.F. Lynch, M.T. Goodman, B.Y. Hernandez, M. Green, W. Cozen, M. Cockburn, S.M. Sibug, M. Topor, C. Zeruto, B. Abedi-Ardekani, M.E. Reichman, and S.M. Hewitt, Associations between selected biomarkers and prognosis in a population-based pancreatic cancer tissue microarray. Cancer Res. 69 (2009) 2950-2955.

[21] A.A. Bapat, G. Hostetter, D.D. Von Hoff, and H. Han, Perineural invasion and associated pain in pancreatic cancer. Nat. Rev. Cancer 11 (2011) 695-707.

[22] I. Lakshmanan, S. Rachagani, R. Hauke, S.R. Krishn, S. Paknikar, P. Seshacharyulu, S. Karmakar, R.K. Nimmakayala, G. Kaushik, S.L. Johansson, G.B. Carey, M.P. Ponnusamy, S. Kaur, S.K. Batra, and A.K. Ganti, MUC5AC interactions with integrin beta4 enhances the migration of lung cancer cells through FAK signaling. Oncogene(2016).

[23] S. Diaz-Moralli, M. Tarrado-Castellarnau, A. Miranda, and M. Cascante, Targeting cell cycle regulation in cancer therapy. Pharmacol. Ther. 138 (2013) 255-271.

[24] M. Stamatakos, V. Palla, I. Karaiskos, K. Xiromeritis, I. Alexiou, I. Pateras, and K. Kontzoglou, Cell cyclins: triggering elements of cancer or not?. World J. Surg. Oncol. 8 (2010) 111. [25] G. Bendas and L. Borsig, Cancer cell adhesion and metastasis: selectins, integrins, and the inhibitory potential of heparins. Int. J. Cell Biol. 2012 (2012) 676731.

[26] J.J. Pan and M.H. Yang, The role of epithelial-mesenchymal transition in pancreatic cancer. J. Gastrointest. Oncol. 2 (2011) 151-156.

133

[27] W. Guo and F.G. Giancotti, Integrin signalling during tumour progression. Nat. Rev. Mol. Cell Biol. 5 (2004) 816-826.

[28] S. Inaguma, K. Kasai, and H. Ikeda, GLI1 facilitates the migration and invasion of pancreatic cancer cells through MUC5AC-mediated attenuation of E-cadherin. Oncogene 30 (2011) 714-723.

[29] S. Truant, E. Bruyneel, V. Gouyer, W.O. De, F.R. Pruvot, M. Mareel, and G. Huet, Requirement of both mucins and proteoglycans in cell-cell dissociation and invasiveness of colon carcinoma HT-29 cells. Int. J. Cancer 104 (2003) 683-694.

[30] Y. Zhang, J.P. Morris, W. Yan, H.K. Schofield, A. Gurney, D.M. Simeone, S.E. Millar, T. Hoey, M. Hebrok, and M.M. Pasca di, Canonical wnt signaling is required for pancreatic carcinogenesis. Cancer Res. 73 (2013) 4909-4922.

[31] M. Korc, Pathways for aberrant angiogenesis in pancreatic cancer. Mol. Cancer 2 (2003) 8.

[32] W. Qiu and G.H. Su, Development of orthotopic pancreatic tumor mouse models. Methods Mol. Biol. 980 (2013) 215-223.

[33] J. Cui, W. Jiang, S. Wang, L. Wang, and K. Xie, Role of Wnt/beta-catenin signaling in drug resistance of pancreatic cancer. Curr. Pharm. Des 18 (2012) 2464-2471.

[34] T. Reya and H. Clevers, Wnt signalling in stem cells and cancer. Nature 434 (2005) 843- 850.

134

Chapter IV

Loss of Muc5ac Expression in the; KrasG12D; Pdx1-Cre;

Muc5ac-/- mouse model delays onset and progression of

pancreatic cancer 135

1. Synopsis

MUC5AC is a gel forming secretory mucin that has been shown to be overexpressed in different types of cancers such as cholangiocarcinoma, colorectal cancer, and lung cancer including pancreatic cancer (PC). Previously published reports and studies on rapid autopsy samples from our group have shown that MUC5AC is aberrantly overexpressed in pancreatic intraepithelial lesions (PanINs), in primary pancreatic tumor tissues, and in the metastatic tissues from different sites. Further, its association with poor prognosis of PC patients has also been shown. Owing to the suitability of genetically engineered mouse models (GEMMs) of PC to study initiation and progression of this malignancy and to obtain further insight and elucidate the oncogenic role of

MUC5AC in PC, we utilized a very well characterized KrasG12D; Pdx1-Cre (KC) PC mouse model for our studies. This model revealed expression of Muc5ac along with other mucins (Muc1 and Muc4) during the progression of PC. We acquired the Muc5ac-/- mice and crossed them with the KC mice to finally obtain the KrasG12D; Pdx1-Cre; Muc5ac-/- (KCMuc5ac-/-) mice along with

KrasG12D; Pdx1-Cre; Muc5ac+/+ (KCMuc5ac+/+) as control mice. We observed that there was no significant difference in the total number of PanIN lesions formed during the progression of PC.

However, delayed onset and progression of PC was evident from the fact that the KCMuc5ac-/-

mice had less incidence of PanIN-I (p<0.01) and PanIN-2 lesions at 10 weeks of age in

comparison to KCMuc5ac+/+ control mice at 10 weeks of age. Moreover, progression from 20 weeks to 30 weeks of age revealed a very low incidence and significantly low number of high- grade PanINs (PanIN-3 lesions) in KCMuc5ac-/- mice compared to the KCMuc5ac+/+ mice.

Interestingly, KCMuc5ac-/- mice had significantly less number of Ki-67 stained nuclei in

pancreatic ductal cells compared to KCMuc5ac+/+ mice, suggesting an impact of Muc5ac on

pancreatic duct epithelial cell proliferation. We also observed less number of secondary

metastatic lesions at 50 weeks of age in KCMuc5ac-/- mice in comparison to the KCMuc5ac+/+

mice. These observations suggest that in the absence of Muc5ac expression, onset and 136

progression of PC is delayed. Hence, our results indicate that Muc5ac plays a critical role in the progression of PC.

2. Background and rationale

Pancreatic ductal adenocarcinoma (PDAC) is the most lethal cancer, and the fourth leading cause

of cancer-related deaths in the US [1]. Successive accumulation of mutations in key oncogenes

and tumor suppressor genes during disease progression makes PDAC a complex, heterogeneous

and genetically unstable disease [2]. Due to its asymptomatic nature, early metastatic spread, lack

of sensitive and specific biomarkers to detect early, therapeutic resistance, and frequent

recurrence the survival rate and prognosis of this malignancy remains dismal [3].

Emerging studies have highlighted the role of mucins in PDAC pathogenesis [4, 5]. In a physiological setting, mucins primarily protect the epithelial cell surfaces from environmental insults by forming a physical barrier. However, under adverse conditions, by virtue of their altered expression, glycosylation patterns, and unique domains mucins are conferred oncogenic roles [6]. Hence, mucins have been identified as novel targets for diagnostic, prognostic and therapeutic purposes [5, 7].

Secretory mucin MUC5AC is aberrantly expressed in different benign disease conditions such as inflammatory bowel diseases [8], pancreatitis [9] and gastrointestinal malignancies such as gastric cancer [10], colorectal cancer [11], gall bladder cancer [12] and cholangiocarcinoma

[13] including PC [14]. Different studies have highlighted the utility of MUC5AC in early stage diagnosis of malignancies [15-17]. Secretory mucin MUC5AC is not expressed in normal pancreas while we have shown that it is significantly overexpressed during the progression of

PDAC. Further, an association of increased MUC5AC levels with poor prognosis of PC patients has also been suggested [18]. Further, our in vitro studies suggest a critical role of MUC5AC in

PC cell growth, metastasis, angiogenesis and chemoresistance making it a clinically relevant molecule. 137

Hence, to further my studies for understanding the oncogenic role of MUC5AC, I utilized

the genetically engineered mouse model (GEMM) that closely mimics the pathology of human

PC [19]. These models have proved their utility for (a) identifying key players that contribute

towards the complexity of the disease, (b) procuring early stage pancreatic tissue and serum

samples that are very challenging to obtain from human PC patients and (c) as preclinical models

to identify potential therapeutic drugs or regimens. Concordant with human PC, The KrasG12D;

Pdx1-Cre (KC) mice model of PC, reveals a progressive increase in the expression of mucins both at mRNA and protein levels (Muc1, Muc4 and Muc5ac) during the progression of PDAC

[20]. However, it is still unknown whether increased expression of Muc5ac has a role to play during initiation and progression of PC. Therefore, looking at the critical role of MUC5AC in PC,

I utilized the Muc5ac knockout mice and the KC mice as control for delineating in vivo role of

Muc5ac in PC.

3. Results

3.A Breeding strategy and establishment of PDAC mice model with knockout of Muc5ac

To explore the role of MUC5AC in PC the Muc5ac-/-; KrasG12D; Pdx1-Cre (KCMuc5ac-/-) mouse

model was developed by breeding Muc5ac-/- mice with LSL-KrasG12D and Pdx1-Cre mice (Figure

4.1). The KCMuc5ac-/- animals (mice that were positive for both KrasG12D and Pdx1-Cre and

negative for Muc5ac) and age matched littermate control KCMuc5ac+/+ animals (mice that were positive for KrasG12D, Pdx1-Cre and Muc5ac) were euthanized at 10, 20, 30, 40 and 50 weeks of age (N=3 for each time point) and the individual pancreas were resected and weighed.

3.B Progression of PC in the KrasG12D; Pdx1-Cre; Muc5ac -/- mouse model

The average weight of the pancreas isolated from the KCMuc5ac+/+ animals was found to be higher than the pancreas of age-matched KCMuc5ac-/- mice (Figure 4.2A). The difference

between weights of the pancreas was not statistically significant between two groups up to 40

weeks of progression. However, at 50 weeks of age the weight of pancreas of KCMuc5ac+/+ was 138

significantly high (p<0.01) in comparison to the pancreas of KCMuc5ac-/- mice (Figure 4.2A).

These observations suggest significant histological alterations associated with loss of Muc5ac

expression during late stages of the mouse PC progression. Further, to analyze the impact of

Muc5ac knockout on overall histopathology of mice pancreas the pancreatic tissue sections

isolated from the KCMuc5ac+/+ and KCMuc5ac-/- mice were stained with hematoxylin and eosin

(H&E) and observed by a pathologist (Figure 4.2C). As per the observations made by pathologist, there was a sequential decrease in overall percentage of normal pancreas in

KCMuc5ac+/+ mice from 10 to 50 week of progression, compared to the KCMuc5ac-/- mice

(Figure 4.2B, C). Interestingly, percentage of the normal pancreas were significantly high

(p<0.05) in pancreas of KCMuc5ac-/- mice compared to KCMuc5ac+/+ mice at 50 weeks of PC

progression (Figure 4.2B, C). This suggests that the loss of Muc5ac during PC progression may

slow down the onset and advancement of pancreatic malignancy. However, this observation

needs further validation in larger number of mice per group.

To further evaluate the degree of delay between the initiation and progression of PC in

the KCMuc5ac-/- mice and KCMuc5ac+/+ mice, we evaluated the number of PanINs/frame/time

point/mouse model. We observed an approximately 50% increase in average number of PanIN-1 lesions, no change in average number of PanIN-2 lesions and approximately 50% reduction in incidence of PanIN-3 lesions in KCMuc5ac-/- mice in comparison to KCMuc5ac+/+ mice (Figure

4.3A). Further analysis of respective PanIN lesions types during PC progression from 10 to 50th

week revealed that during initial stages (10th week), loss of Muc5ac delays onset of PC, as evident

by less formation of PanIN-1 (p<0.01) and PanIN-2 lesions (Figure 4.3B, C). During further

advancement from 20th to 50th week, we observed slowed PC progression in KCMuc5ac-/- mice evident by increased number of PanIN-1, PanIN-2 lesions and significantly lower number of

PanIN-3 lesions (at 40th week) compared to control KCMuc5ac+/+ mice (Figure 4.3B, C, D). 139

Hence these observations, substantiate the delay in the onset and further progression of PC as observed in KCMuc5ac-/- mice in comparison to the KCMuc5ac+/+ mice.

Further to evaluate whether reduced onset and progression of PC in KCMuc5ac-/- mice is

due to reduced proliferation, we estimated Ki-67 positive nuclei in pancreatic tissues from

KCMuc5ac+/+ and KCMuc5ac-/- (10th and 50th week) by immunohistochemical staining. Ki-67

protein is a marker of cellular proliferation. In our observation and quantitative analysis, we

observed that pancreas of KCMuc5ac-/- mice had significantly reduced number of Ki-67 positive

nuclei both at 10th (p<0.01) and 50th week (p<0.005) (Figure 4.4A, C). Interestingly Muc5ac expressing ducts revealed higher proliferative index indicated by simultaneous expression of

Muc5ac and nuclear Ki-67 in ductal epithelial cells (Figure 4.3B). This suggests that Muc5ac is critical for increased proliferation of PC cells during sequential progression of this malignancy.

4. Discussion

PC is currently the fourth leading cause of cancer-related deaths in the US, and is expected to be

the second most common cause of death by 2030 [1, 21]. As per American Cancer society,

53,070 new cases of pancreatic ductal adenocarcinoma are estimated in 2016, with a shocking

41,780 deaths [22]. Despite all the efforts in last decade, the five-year survival rate after diagnosis

of PC lingered around six months. The main reasons being the diagnosis at advanced stages,

when the patient already have metastasis to distant organs and available treatments remain

palliative, along with development of resistance to existing therapeutic strategies [3]. Hence, it

becomes clearer that further in-depth investigations are warranted to identify effective early

diagnostic markers and therapeutic targets.

In this context, we and others have previously shown overexpression of secretory mucin

MUC5AC during the progression of PC. MUC5AC has been associated with increased metastasis

and poor prognosis in PC [14, 18]. The utility of secretory mucin MUC5AC as an early stage

biomarker for detection of PC has also been underscored recently [17]. Functionally, increased 140

MUC5AC levels in lung cancer have been associated with increased proliferation and migration

[23]. Further, few in vitro studies demonstrated MUC5AC mediated impact on migration of PC cells [14]. However, none of these studies could systematically elaborate on role of MUC5AC and related mechanisms in PC progression. Therefore, further studies are required to elucidate the exact roles of MUC5AC and associated mechanisms in PC.

Some of the recent advances in PC have been possible by employing genetically engineered mouse models of exocrine pancreatic neoplasia. These preclinical models mimic the genetic alterations, pathologic changes ranging from PanINs to fully invasive and metastatic disease as implicated in the progression of PC [24] making them the best tool to investigate early stage diagnostic markers, chemoprevention strategies, different anti-cancer therapeutic approaches, and to understand the molecular mechanisms underlying PC progression with an objective to improve PC prognosis [25]. Therefore, to identify the potential role of MUC5AC in

PC, we utilized a well characterized KC mouse model of PC progression that mimics human PC

[19]. In humans expression of MUC5AC is absent in normal pancreas while its de novo expression has been observed as early as PanIN-1 lesions. Similarly, in KC mice model expression of Muc5ac was observed as early as 10 weeks of age in PanIN-1 lesions suggesting that Muc5ac expression is an early event in PC progression. Further, expression of Muc5ac in complete spectrum of PanINs, primary tumor and invasive lesions underscored suitability of this model for investigating role of Muc5ac during PC progression [20].

Previous studies have shown that murine Muc5ac has 76.3% and 62.5% sequence homology in its

N-terminus and C-terminus respectively with human homolog of secretory mucin MUC5AC [26].

The expression pattern in murine Muc5ac matches to that of human homolog with the most prominent expression observed in airways and gastric mucosa [26]. Therefore, to better understand the role of MUC5AC in physiological and pathological conditions, homozygous

Muc5ac-deficient mice were produced by targeted deletion of exon-1 [27]. Muc5ac deficient 141

mice developed normally except for inconsistent dry eye phenotype [28] and slightly increased levels of IFN-γ levels [29]. Further, utility of Muc1-null PDA mouse to fully elucidate the oncogenic role of MUC1 has previously been demonstrated [30]. Hence, to further dissect the role of Muc5ac in PC, we generated KCMuc5ac-/- mice, by breeding Muc5ac-/- mice [27] with

KrasG12D; Pdx-1 Cre mouse model of PC [19]. As my first observation we found a consistent decrease in pancreas weight at all-time points in KCMuc5ac-/- mice compared to KCMuc5ac+/+ mice. On further investigation high percentage of the normal pancreas were observed during the progression of PC in KCMuc5ac-/- mice compared to KCMuc5ac+/+ mice. This suggested of less tumor burden and more stable disease on the loss of Muc5ac. In my observation, I did not observe any significant difference in total number of PanIN-lesions from KCMuc5ac+/+ and KCMuc5ac-/- mice. However, on individual analysis of PanIN lesions, I observed significantly reduced number of PanIN-1 and PanIN-2 lesions at the 10th week of age, that were increased in number at 20th,

30th, 40th, and 50th week of age. Further, significantly decreased number of high-grade PanIN-3 lesions at 20th, 30th, 40th and 50th weeks of age in KCMuc5ac-/- mice was also observed.

Interestingly, we observed a significant reduction in the number of nuclei staining positive for Ki-

67 in KCMuc5ac-/- mice pancreas highlighting its role in proliferation. Therefore, from this study,

I provide the first evidence that Kras mutation mediated upregulation of Muc5ac during PC, plays a critical role in the onset and progression of PC, and loss of Muc5ac may provide survival benefit. Further studies are warranted to investigate the Muc5ac mediated in vivo roles and associated mechanisms in PC.

142

Fig. 4.1 Schematic outline of the breeding strategy utilized for developing the KRasG12D;

Pdx1-Cre; Muc5ac-/- mouse model to investigate the role of Muc5ac during pancreatic

cancer progression. Unfloxed LSL-KRasG12D and Pdx1-Cre mice were crossed with Muc5ac-/-

mice respectively to obtain the F1 progeny having LSL-KrasG12D; Muc5ac-/- and Pdx1-Cre;

Muc5ac-/- genotype. The F1 progeny were further crossed with each other to obtain the KrasG12D;

Pdx1-Cre; Muc5ac-/- pancreatic cancer mouse model along with the KrasG12D; Pdx1Cre;

Muc5ac+/+ control mice. The F2 progeny were then euthanized at the 10th, 20th, 30th, 40th and 50th

weeks of age to analyze pancreatic cancer progression in the absence of Muc5ac expression

compared to controls. 143

Figure 4.1

x x

LSL-KrasG12D Muc5ac-/- Muc5ac-/- Pdx-1-Cre

x

LSL-KrasG12D; Muc5ac-/- Pdx-1-Cre; Muc5ac-/- (F1) (F1)

KrasG12D; Muc5ac-/-;Pdx-1-Cre KrasG12D; Pdx-1-Cre

Sacrifice 10th Wk 20th Wk 30th Wk 40th Wk 50th Wk

144

Figure 4.2 Alterations in the weight and gross histology of pancreas during PC progression in KrasG12D; Pdx1-Cre; Muc5ac-/- mice model: (A) Comparison of average weight of the pancreas obtained from KrasG12D; Pdx1-Cre; Muc5ac+/+, and KrasG12D; Pdx1-Cre; Muc5ac-/- PC mice model (n=3 in each group) at different time points (*p-value<0.01). (B) Comparison of the percentage of normal pancreas as per the pathologist evaluation between KrasG12D; Pdx1-Cre;

Muc5ac+/+ and KrasG12D; Pdx1-Cre; Muc5ac-/- PC mice model at different time points (*p- value<0.04). (C) Histopathology of H&E stained pancreatic tissues from KrasG12D; Pdx1-Cre;

Muc5ac-/- mice and KrasG12D; Pdx1-Cre; Muc5ac+/+ mice demonstrating normal pancreas, PanIN

lesions and adenocarcinoma in pancreas at 10th, 20th, 30th, 40th, and 50th weeks (C6-C10) of

progression. The KrasG12D; Pdx1-Cre; Muc5ac-/- mice showed higher percentage of normal pancreas, delayed onset of PanIN lesions and overall delayed progression of PC (C6-C10)

compared to KrasG12D; Pdx1-Cre; Muc5ac+/+ mice (C1-C5). 145

Figure 4.2

KCMuc5ac+/+ KCMuc5ac+/+ A KCMuc5ac-/- B 1000 100 KCMuc5ac-/- p<0.01 * 90 * p<0.04 80 750 * 70 60 * 500 50 40

Pancreas Weight (mg) 30 250

% % Normal Pancreas 20 10 0 0 10 20 30 40 50 10 20 30 40 50 Weeks Weeks C 10 Wk 20 Wk 30 Wk 40 Wk 50 Wk 1 2 3 4 5 +/+ KCMuc5ac - / - 6 7 8 9 10 KCMuc5ac

146

Figure 4.3 Reduced progression of PC in KrasG12D; Pdx1-Cre; Muc5ac-/- mice model: (A)

Number of PanIN-1, PanIN-2 and PanIN-3 lesions observed per field, during progression of PC from 10th to 50th weeks of age in KrasG12D; Pdx1-Cre; Muc5ac-/- mice compared to KrasG12D;

Pdx1-Cre; Muc5ac+/+ mice. No significant difference was observed in total count of PanIN-1,

PanIN-2 and PanIN-3 during progression from 10th week to 50th week. (B) Number of PanIN-1 lesions observed per field, during progression of PC from 10th to 50th weeks of age in KrasG12D;

Pdx1-Cre; Muc5ac-/- mice compared to KrasG12D; Pdx1-Cre; Muc5ac+/+ mice. Number of PanIN-1

lesions observed at 10th week of progression were significantly less (p<0.01) in KrasG12D; Pdx1-

Cre; Muc5ac-/- mice compared to KrasG12D; Pdx1-Cre; Muc5ac+/+ mice. No significant difference

was observed in PanIN-1 counts during later stages of progression. (C) Number of PanIN-2

lesions observed per field, during progression of PC from 10th to 50th weeks of age in KrasG12D;

Pdx1-Cre; Muc5ac-/- mice compared to KrasG12D; Pdx1-Cre; Muc5ac+/+ mice. Less number of

PanIN-2 were observed during 10th week while the difference remained negligible at later stages of progression. (D) Number of PanIN-3 lesions observed per field, during progression of PC from

10th to 50th weeks of age in KrasG12D; Pdx1-Cre; Muc5ac-/- mice compared to KrasG12D;Pdx1-

Cre;Muc5ac+/+mice. Less Number of advanced PanIN-3 lesions were observed in KrasG12D; Pdx1-

Cre; Muc5ac-/- mice compared to the KrasG12D; Pdx1-Cre; Muc5ac+/+ mice from 20th to 50th week

of pancreatic cancer progression. 147

Figure 4.3

A 8 KCMuc5ac+/+ B KCMuc5ac+/+ 7 7 KCMuc5ac-/- KCMuc5ac-/- 6 *p<0.01 6 5 5 1/field 4 - 4 3 3 * 2 2 # of PanIN cancer progression cancer 1 1

# per field during pancreatic pancreatic # during field per 0 0 PanIN1 PanIN2 PanIN3 10 20 30 40 50 Weeks

KCMuc5ac+/+ KCMuc5ac+/+ C D 4.5 10 KCMuc5ac-/- 4 KCMuc5ac-/- 9 *p<0.01 8 3.5 7 3 3/Field 2/Field - - 6 2.5 5 2 * 4 1.5 3 1 # of PanIN

# of PanIN 2 1 0.5 0 0 10 20 30 40 50 10 20 30 40 50 Weeks Weeks 148

Figure 4.4 Muc5ac mediated cellular proliferation enhances PC progression: (A) Representative

micrographs (40X) showing Ki-67 staining performed on pancreatic tissue sections, from KrasG12D; Pdx1-

Cre; Muc5ac+/+ and KrasG12D; Pdx1-Cre; Muc5ac-/- mice at 10th week and 50th week. (B) Representative

micrograph (40X) demonstrating simultaneous expression of Muc5ac and Ki-67 in a pancreatic duct. (C)

Quantification of number of Ki-67 positive nuclei observed per field, during progression of PC in 10th and

50th weeks of age in KrasG12D; Pdx1-Cre; Muc5ac-/- mice in comparison to KrasG12D; Pdx1-Cre; Muc5ac+/+

mice. 149

Figure 4.4

A KCMuc5ac+/+ KCMuc5ac-/-

C KCMuc5ac+/+

10 Week KCMuc5ac-/-

140 **p<0.005 120 100 80 *p<0.01 60 0 Week 5 0 67 positive nuclei - 40 20 # of Ki B 0 MUC5AC Ki-67 10 50 Weeks Week th 50 150

Reference List

[1] M. Hidalgo, New insights into pancreatic cancer biology. Ann. Oncol. 23 Suppl 10 (2012) x135-x138.

[2] C.A. Iacobuzio-Donahue, V.E. Velculescu, C.L. Wolfgang, and R.H. Hruban, Genetic basis of pancreas cancer development and progression: insights from whole-exome and whole- genome sequencing. Clin. Cancer Res. 18 (2012) 4257-4265.

[3] D.P. Ryan, T.S. Hong, and N. Bardeesy, Pancreatic adenocarcinoma. N. Engl. J. Med. 371 (2014) 1039-1049.

[4] S. Kaur, S. Kumar, N. Momi, A.R. Sasson, and S.K. Batra, Mucins in pancreatic cancer and its microenvironment. Nat. Rev. Gastroenterol. Hepatol. 10 (2013) 607-620.

[5] M.P. Torres, S. Chakraborty, J. Souchek, and S.K. Batra, Mucin-based targeted pancreatic cancer therapy. Curr. Pharm. Des 18 (2012) 2472-2481.

[6] M.A. Hollingsworth and B.J. Swanson, Mucins in cancer: protection and control of the cell surface. Nat. Rev. Cancer 4 (2004) 45-60.

[7] D.W. Kufe, Mucins in cancer: function, prognosis and therapy. Nat. Rev. Cancer 9 (2009) 874-885.

[8] M.E. Forgue-Lafitte, B. Fabiani, P.P. Levy, N. Maurin, J.F. Flejou, and J. Bara, Abnormal expression of M1/MUC5AC mucin in distal colon of patients with diverticulitis, ulcerative colitis and cancer. Int. J. Cancer 121 (2007) 1543-1549.

[9] A. Bobrowski, M. Spitzner, S. Bethge, F. Mueller-Graf, B. Vollmar, and D. Zechner, Risk factors for pancreatic ductal adenocarcinoma specifically stimulate pancreatic duct glands in mice. Am. J. Pathol. 182 (2013) 965-974.

[10] C.T. Zhang, K.C. He, F. Pan, Y. Li, and J. Wu, Prognostic value of Muc5AC in gastric cancer: A meta-analysis. World J. Gastroenterol. 21 (2015) 10453-10460.

[11] M.V. Kesari, V.L. Gaopande, A.R. Joshi, S.V. Babanagare, B.P. Gogate, and A.V. Khadilkar, Immunohistochemical study of MUC1, MUC2 and MUC5AC in colorectal carcinoma and review of literature. Indian J. Gastroenterol. 34 (2015) 63-67.

[12] L. Xiong, Z. Yang, L. Yang, J. Liu, and X. Miao, Expressive levels of MUC1 and MUC5AC and their clinicopathologic significances in the benign and malignant lesions of gallbladder. J. Surg. Oncol. 105 (2012) 97-103.

[13] T. Abe, H. Amano, F. Shimamoto, M. Hattori, S. Kuroda, T. Kobayashi, H. Tashiro, and H. Ohdan, Prognostic evaluation of mucin-5AC expression in intrahepatic cholangiocarcinoma, mass-forming type, following hepatectomy. Eur. J. Surg. Oncol. 41 (2015) 1515-1521.

151

[14] S. Inaguma, K. Kasai, and H. Ikeda, GLI1 facilitates the migration and invasion of pancreatic cancer cells through MUC5AC-mediated attenuation of E-cadherin. Oncogene 30 (2011) 714-723.

[15] A. Ruzzenente, C. Iacono, S. Conci, F. Bertuzzo, G. Salvagno, O. Ruzzenente, T. Campagnaro, A. Valdegamberi, S. Pachera, F. Bagante, and A. Guglielmi, A novel serum marker for biliary tract cancer: diagnostic and prognostic values of quantitative evaluation of serum mucin 5AC (MUC5AC). Surgery 155 (2014) 633-639.

[16] A. Silsirivanit, N. Araki, C. Wongkham, C. Pairojkul, Y. Narimatsu, K. Kuwahara, H. Narimatsu, S. Wongkham, and N. Sakaguchi, A novel serum carbohydrate marker on mucin 5AC: values for diagnostic and prognostic indicators for cholangiocarcinoma. Cancer 117 (2011) 3393-3403.

[17] D. Liu, C.H. Chang, D.V. Gold, and D.M. Goldenberg, Identification of PAM4 (clivatuzumab)-reactive epitope on MUC5AC: a promising biomarker and therapeutic target for pancreatic cancer. Oncotarget. 6 (2015) 4274-4285.

[18] M. Takikita, S. Altekruse, C.F. Lynch, M.T. Goodman, B.Y. Hernandez, M. Green, W. Cozen, M. Cockburn, S.M. Sibug, M. Topor, C. Zeruto, B. Abedi-Ardekani, M.E. Reichman, and S.M. Hewitt, Associations between selected biomarkers and prognosis in a population-based pancreatic cancer tissue microarray. Cancer Res. 69 (2009) 2950-2955.

[19] S.R. Hingorani, E.F. Petricoin, A. Maitra, V. Rajapakse, C. King, M.A. Jacobetz, S. Ross, T.P. Conrads, T.D. Veenstra, B.A. Hitt, Y. Kawaguchi, D. Johann, L.A. Liotta, H.C. Crawford, M.E. Putt, T. Jacks, C.V. Wright, R.H. Hruban, A.M. Lowy, and D.A. Tuveson, Preinvasive and invasive ductal pancreatic cancer and its early detection in the mouse. Cancer Cell 4 (2003) 437-450.

[20] S. Rachagani, M.P. Torres, S. Kumar, D. Haridas, M. Baine, M.A. Macha, S. Kaur, M.P. Ponnusamy, P. Dey, P. Seshacharyulu, S.L. Johansson, M. Jain, K.U. Wagner, and S.K. Batra, Mucin (Muc) expression during pancreatic cancer progression in spontaneous mouse model: potential implications for diagnosis and therapy. J. Hematol. Oncol. 5 (2012) 68.

[21] L. Rahib, B.D. Smith, R. Aizenberg, A.B. Rosenzweig, J.M. Fleshman, and L.M. Matrisian, Projecting cancer incidence and deaths to 2030: the unexpected burden of thyroid, liver, and pancreas cancers in the United States. Cancer Res. 74 (2014) 2913-2921.

[22] R.L. Siegel, K.D. Miller, and A. Jemal, Cancer statistics, 2016. CA Cancer J. Clin. 66 (2016) 7-30.

[23] I. Lakshmanan, S. Rachagani, R. Hauke, S.R. Krishn, S. Paknikar, P. Seshacharyulu, S. Karmakar, R.K. Nimmakayala, G. Kaushik, S.L. Johansson, G.B. Carey, M.P. Ponnusamy, S. Kaur, S.K. Batra, and A.K. Ganti, MUC5AC interactions with integrin beta4 enhances the migration of lung cancer cells through FAK signaling. Oncogene(2016).

[24] M. Herreros-Villanueva, E. Hijona, A. Cosme, and L. Bujanda, Mouse models of pancreatic cancer. World J. Gastroenterol. 18 (2012) 1286-1294.

152

[25] C.B. Westphalen and K.P. Olive, Genetically engineered mouse models of pancreatic cancer. Cancer J. 18 (2012) 502-510.

[26] F. Escande, N. Porchet, A. Bernigaud, D. Petitprez, J.P. Aubert, and M.P. Buisine, The mouse secreted gel-forming mucin gene cluster. Biochim. Biophys. Acta 1676 (2004) 240- 250.

[27] S.Z. Hasnain, C.M. Evans, M. Roy, A.L. Gallagher, K.N. Kindrachuk, L. Barron, B.F. Dickey, M.S. Wilson, T.A. Wynn, R.K. Grencis, and D.J. Thornton, Muc5ac: a critical component mediating the rejection of enteric nematodes. J. Exp. Med. 208 (2011) 893-900.

[28] C.K. Marko, A.S. Tisdale, S. Spurr-Michaud, C. Evans, and I.K. Gipson, The ocular surface phenotype of Muc5ac and Muc5b null mice. Invest Ophthalmol. Vis. Sci. 55 (2014) 291-300.

[29] S.Z. Hasnain, C.M. Evans, M. Roy, A.L. Gallagher, K.N. Kindrachuk, L. Barron, B.F. Dickey, M.S. Wilson, T.A. Wynn, R.K. Grencis, and D.J. Thornton, Muc5ac: a critical component mediating the rejection of enteric nematodes. J. Exp. Med. 208 (2011) 893-900.

[30] D.M. Besmer, J.M. Curry, L.D. Roy, T.L. Tinder, M. Sahraei, J. Schettini, S.I. Hwang, Y.Y. Lee, S.J. Gendler, and P. Mukherjee, Pancreatic ductal adenocarcinoma mice lacking mucin 1 have a profound defect in tumor growth and metastasis. Cancer Res. 71 (2011) 4432- 4442.

153

Chapter V

Mucins and associated glycan signatures in colon adenoma-

carcinoma sequence: Prospective pathological implication(s)

for early diagnosis of colon cancer.

This chapter has been adapted from:

Krishn SR, Kaur S, Smith LM, Johansson SL, Jain M, Patel A, Gautam SK, Hollingsworth MA,

Mandel U, Clausen H, Lo WC, Fan WL, Manne U, Batra SK. Mucins and associated glycan signatures in colon adenoma-carcinoma sequence: Prospective pathological implication(s) for early diagnosis of colon cancer. Cancer Lett. 2016 Feb 16. pii: S0304-3835(16)30070-2. doi:

10.1016/j.canlet.2016.02.016. 154

Mucins and associated glycan signatures in colon adenoma-carcinoma sequence:

prospective pathological implication(s) for early diagnosis of colon cancer

Shiv Ram Krishna, Sukhwinder Kaura, Lynette M. Smithb, Sonny L. Johanssonc, Maneesh Jaina,

Asish Pateld, Shailendra K. Gautama, Michael A. Hollingswortha, e, Ulla Mandelf, Henrik

Clausenf, Wing-Cheong Log, Wai-Tong Louis Fanh, Upender Mannei and Surinder K. Batraa, e

aDepartment of Biochemistry and Molecular Biology, bDepartment of Biostatistics, College of

Public Health, cDepartment of Pathology and Microbiology, dDepartment of Surgery, eFred and

Pamela Buffett Cancer Center, Eppley Institute for Research in Cancer and Allied Diseases,

University of Nebraska Medical Center, Omaha, Nebraska, USA; fDepartment of Cellular and

Molecular Medicine, Copenhagen Center for Glycomics, University of Copenhagen,

Copenhagen, Denmark; gDepartment of Mathematics, City University of Hong Kong, Hong Kong

SAR; hDepartment of Mathematics, University of Wisconsin, Madison, Wisconsin, USA;

iDepartment of Pathology, University of Alabama at Birmingham, Birmingham, Alabama, USA.

Running Title: Mucins and mucin-associated glycans during colon cancer progression

Key words: colonic mucin, glycan, hyperplastic polyp, adenoma, colorectal cancer

Address for correspondence Sukhwinder Kaur (Ph.D.) and Surinder K. Batra (Ph.D.), Department of Biochemistry and Molecular Biology, University of Nebraska Medical Center, Omaha, Nebraska, 68198-5870, USA; Phone: 402-559-5455, Fax: 402-559-6650, Email: [email protected]; [email protected]

155

1. Synopsis

Development of biomarkers that detect early stage resectable premalignant lesions of colon can

provide critical aid in the prevention of colorectal cancer. Recent lines of evidence suggest the

utility of mucin expression to predict malignant transformation of colon pre-neoplastic lesions. In this study, we investigated the combined expression of multiple mucins and mucin-associated glycans during the adenoma-carcinoma sequence of colon cancer progression. Further, we evaluated their applicability as markers for differentiating adenomas/adenocarcinomas from hyperplastic polyps. Immunohistochemical analyses performed on colon disease tissue microarrays revealed downregulation of MUC2 and MUC4 expression (p<0.0001) while MUC1 and MUC5AC expressions were upregulated (p=0.01) during adenoma-adenocarcinoma progression. Expression of MUC17 was downregulated in inflamed tissues compared to normal tissues, but its increased expression differentiated adenomas (p=0.0028) and adenocarcinomas

(p=0.025) from inflammation. Glycan epitope-Tn/STn-MUC1 showed higher expression in hyperplastic polyps (p=0.023), adenomas (p=0.042) and adenocarcinomas (p=0.0096) compared to normal tissues. Multivariate regression analyses indicated that a combination of MUC2,

MUC5AC, and MUC17 could effectively discriminate adenoma-adenocarcinoma from hyperplastic polyps. Altogether, a combined analysis of altered mucins and mucin-associated glycans is a useful approach to distinguish premalignant/malignant lesions of colon from benign polyps.

156

2. Background & Rationale

For colorectal cancer (CRC), incidence and mortality rates are high worldwide [1]. CRC is the

third most common cancer in both men and women, and the second leading cause of cancer

deaths in the US [1]. In 2016, about 134,490 people will be diagnosed with CRC, and about

49,190 people will die of the disease [2]. Survival from CRC is associated with the stage of cancer when diagnosed, with the advanced disease having the worst outcome; the 5-year survival

being 13% [3]. Only 40% of CRCs are diagnosed at early stages, due in part to the underuse of

screening modalities. Thus, there is a need for specific and sensitive modalities for early

diagnoses.

CRC is a heterogeneous disease. Its etiology involves modifiable, medical and hereditary risk factors, and the precise events vary from one individual to another [4]. Various pathways of neoplastic progression contribute to the molecular and biological heterogeneity exhibited by

CRCs [5]. About 85% of CRCs are sporadic and progress slowly by accumulating multiple genetic mutations (APC, KRAS, p53, and DCC) in precancerous lesions (polyps/adenomas). The

process is referred to as adenoma-carcinoma sequence [6]. Recent studies highlight the diagnostic

potential of the mucin expression profiles in pre-neoplastic colon polyps [7, 8]. Intestinal mucosal

and goblet cells produce, store, and secrete heavily glycosylated proteins termed mucins (MUCs)

which are the building blocks of the gastrointestinal (GI) mucus system. Mucins provide a

selective molecular barrier for luminal protection of the GI tract against factors such as food,

acid, enzymes and bacteria [9, 10]. To date, 21 mucin genes have been identified and categorized

into two subgroups: membrane-bound and secretory mucins [11]. The apical cell surfaces of

intestinal enterocytes and colonic columnar cells anchor membrane-bound mucins (MUC1,

MUC4, and MUC17) [10]. These mucins sense the intestinal environment to mediate intracellular

signaling and provide a diffusion barrier [10]. In contrast, secretory mucins (MUC2, MUC5B, 157

MUC5AC, and MUC6) form polymeric gels that facilitate lubrication and protection of GI

system [10]. Various inflammatory, benign (hyperplastic polyps), premalignant (adenomas), and

malignant conditions of colon are associated with alterations in mucin expression, organization,

glycosylation which in turn impact their functioning. Mucin aberrations affect a variety of cellular

activities, including growth, differentiation, transformation, adhesion, invasion, and immune

surveillance [12]. Several studies have investigated the expression of mucins, including MUC1,

MUC2, MUC4, MUC5AC, MUC6, and MUC17 and their associated glycans during the colon

adenoma-carcinoma progression [13-17]. However, there has been no analysis of these mucins as

a panel of markers for differentiating malignancies from normal/benign controls. The present

study, for the first time, compared concurrent expression of mucins (MUC1, MUC2, MUC4,

MUC5B, MUC5AC, MUC6, and MUC17) and mucin-associated glycans (Tn/STn-MUC1,

TAG72 and CA 19-9) in normal, inflamed colon tissues as well as in tissues obtained from hyperplastic polyps, adenomas, and adenocarcinomas of the colon, and investigated the utility of a panel of markers to differentiate premalignant and malignant lesions from benign conditions.

3. Results

The comprehensive immunophenotypic expression profiling of mucins and mucin-associated glycans was performed utilizing a commercial colon disease spectrum array. The primary objective was to delineate differentially expressed mucins for discriminating normal and benign tissues (hyperplastic polyps) from premalignant (adenomas) and malignant (colon adenocarcinoma) lesions. A further goal was to identify a panel of markers that could differentiate benign colon tissues from neoplastic precursor lesions and malignant lesions.

3.A Expression of transmembrane mucins

Looking at previous reports of expression and association of transmembrane mucins (MUC1,

MUC4 and MUC17) with CRC, in this study, we investigated their comprehensive expression 158

profile during adenoma-carcinoma sequence.

MUC1: In normal colon tissues, a weak to mild MUC1 expression (mean±SE CS, 3.5±0.5; mean±SE IS, 1.7±0.2) was observed (Figure 5.1A, Table 5.1). In comparison to normal tissues, no appreciable difference in expression of MUC1 was observed in inflamed tissues (mean CS,

5.2±1.2; mean IS, 1.9±0.3), hyperplastic polyps (mean CS, 3.8±1.1; mean IS, 2.1±0.3), or adenomas (mean CS, 4.0±0.6; mean IS, 1.9± 0.2) (Figure 5.1B-D, Table 5.1). MUC1 expression was higher in adenocarcinomas (mean CS, 5.8±0.9; mean IS, 2.4±0.2) in comparison to normal tissues (Figure 5.1E, Table 5.1). Notably, a significant increase in the intensity and extent of

MUC1 expression was observed in adenocarcinomas (56% of tissues having 3+ intensity scores) as compared to normal tissues (none having 3+ intensity scores).

MUC4: There was strong expression of MUC4 in 89% of the normal colon samples (mean CS,

11.6±0.3; mean IS, 3±0) (Figure 5.1F, Table 5.1); its expression was reduced to moderate levels in inflamed tissues (mean CS, 7.9±1; mean IS, 2.5±0.3) (Figure 5.1G, Table 5.1). Relative to normal tissues, expression of MUC4 was significantly low in hyperplastic polyps (mean CS,

4.4±1.5; mean IS, 1.5±0.4) (Fig 1H, Table 5.1). Further reduction in MUC4 expression in adenomas (mean CS, 4.2±0.7; mean IS, 1.6±0.2) significantly differentiated them from normal and inflammatory tissues (Figure 5.1I, Table 5.1). However, 13% of adenoma tissues exhibited strong expression of MUC4. Adenocarcinomas had drastic reduction in MUC4 expression with undetectable expression in 63% of samples (means CS, 0.6±0.3, mean IS, 0.5±0.2) (Figure 5.1J,

Table 5.1). Overall, expression of MUC4 was significantly downregulated (p<0.0001) in the adenoma-carcinoma sequence.

MUC17: All normal tissues showed MUC17 positivity (mean CS, 8.5±1; mean IS, 2.4±0.2)

(Figure 5.1K, Table 5.1), with mild, moderate, and strong expression distributed uniformly.

Relative to normal tissues, expression of MUC17 was downregulated in inflamed tissues (mean

CS, 5.6±0.9; mean IS, 2±0.3), with none of the tissues having strong expression (Figure 5.1L, 159

Table 5.1). There was no significant differences in MUC17 expression in hyperplastic polyps compared to normal and inflamed tissues (mean CS, 7.7±1.5; mean IS, 2.3±0.3) (Figure 5.1M,

Table 5.1). In adenomas, however, there was significantly higher MUC17 expression in comparison to inflamed tissues (mean CS, 9.5±0.6; mean IS, 2.5±0.1) (Figure 5.1N, Table 5.1), with 60% of adenomas showing strong expression. Further, MUC17 expression significantly differentiated adenocarcinomas from inflamed tissues (mean CS, 9±0.8; mean IS, 2.4±0.1)

(Figure 5.1O, Table 5.1). Overall, higher MUC17 expression was a significant marker (p=0.047) to differentiate premalignant and malignant lesions from inflammation.

3.B Expression of secretory mucins

Alterations in the expression of secretory mucins (MUC2, MUC5AC, MUC5B and MUC6) have been associated with CRC. Next, we examined their comprehensive expression signature during adenoma-carcinoma sequence.

MUC2: Strong expression of MUC2 was observed in all normal colon samples (mean CS, 12±0; mean IS, 3±0) (Figure 5.2A, Table 5.2). In tissues with inflammation, there was a slight decrease in MUC2 expression (mean CS, 11.4±0.4; Mean IS, 3±0) (Figure 5.2B, Table 5.2). Expression of MUC2 was significantly lower in hyperplastic polyps relative to normal tissues (mean CS,

9.7±1.1; mean IS, 2.9±0.1) (Figure 5.2C, Table 5.2), and in adenomas relative to normal, inflamed tissues and hyperplastic polyps (mean CS, 7.4±0.6; mean IS, 2.8±0.1) (Figure 5.2D,

Table 5.2). Interestingly, 13% of adenomas exhibited relatively strong MUC2 expression. In adenocarcinomas, significantly lower MUC2 expression (mean CS, 3.8±0.9; mean IS, 2±0.3) was observed relative to normal, inflammation, hyperplastic polyps and adenoma tissues (Figure

5.2E, Table 5.2). Further, strong expression of MUC2 was reduced to only 6% of adenocarcinomas. Overall, MUC2 expression was significantly decreased (p<0.0001) in the adenoma-carcinoma sequence.

MUC5AC: The expression of MUC5AC was undetectable in the normal colon tissues (mean CS, 160

0±0; mean IS, 0±0) (Figure 5.2F, Table 5.2), however 30% of inflamed tissues expressed

MUC5AC at low levels (mean CS, 0.5±0.3; mean IS, 0.5± 0.3) (Figure 5.2G, Table 5.2). There was a further significant increase in expression of MUC5AC in 50% of hyperplastic polyps (mean

CS, 1.8±1; mean IS, 0.9±0.4) (Figure 5.2H, Table 5.2) and in 63% of adenomas (mean CS,

3.1±0.6; mean IS, 1.5±0.2) (Figure 5.2I, Table 5.2) relative to normal tissues. For adenocarcinomas, a statistically significant upregulation of MUC5AC was found in 38% of tissues relative to normal colon (mean CS, 1.7±0.7; mean IS, 1.1±0.4) (Figure 5.2J, Table 5.2).

Overall, high MUC5AC expression was a significant marker (p=0.01) that differentiated

neoplastic precursors and malignant lesions from normals.

MUC5B and MUC6: None of the normal colon tissues expressed MUC5B and/or MUC6

(Figure 5.2K & Figure 5.2P, Table 5.2). However, expression of MUC5B was evident in a

fraction of inflamed tissues (20%) (Figure 5.2L), hyperplastic polyps (20%) (Figure 5.2M),

adenomas (27%) (Figure 5.2N), and adenocarcinomas (12.5%) (Figure 5.2O). In adenomas,

there was intense staining of MUC5B relative to normal tissues (mean IS, 0.8±0.2) (Table 5.2).

In contrast to MUC5B, MUC6 expression was noted in only 10% of adenomas (Figure 5.2S) and

in 19% of adenocarcinomas (Figure 5.2T). Overall, the expression of MUC5B and MUC6 were

not appreciably different between normal, inflammation, benign, and premalignant and malignant

colonic tissues.

3.C Expression of mucin-associated glycans

Altered glycosylation is one of the hallmarks of cancers. Looking at previously reported

diagnostic potential of alterations in mucin-associated glycans CA 19-9, TAG72 during CRC, we examined their expression signature during adenoma carcinoma sequence.

CA 19-9 (Sialyl-LewisA): Weak expression of CA 19-9 (mean CS, 2.8±0.9; IS, 1.9±0.5) was observed in 77.8% normal tissues (Figure 5.3F, Table 5.3) and a lack of expression in 22.2% cases. There was a similar pattern in inflamed tissues (mean CS, 3±1; mean IS, 1.6±0.5) (Figure 161

5.3G, Table 5.3). Relative to normal tissues, there was a mild increase in expression of CA 19-9

in hyperplastic polyps (mean CS, 3.3±0.9; mean IS, 2.1±0.3) (Figure 5.3H, Table 5.3) and adenomas (mean CS, 3.2±0.6; mean IS, 1.8±0.2) (Figure 5.3I, Table 5.3). Further, there were higher levels of CA 19-9 in adenocarcinomas relative to normal and inflamed tissues (mean CS,

6.1±1.2; mean IS, 2.2±0.3) (Figure 5.3J, Table 5.3). Interestingly, similar to normal colon, 25% of the adenocarcinomas were negative for CA 19-9 expression. In summary, CA 19-9 expression was higher in adenocarcinomas relative to normal tissues; however, this expression did not allow significant differentiation between hyperplastic polyps, adenomas, inflammatory and normal colon.

TAG72 (Sialyl-Tn): Normal colon tissues exhibited weak expression of TAG72 (mean CS,

1.7±0.3; mean IS, 1.1±0.2) (Figure 5.3K, Table 5.3). However, there was elevated expression in inflamed tissues (mean CS, 3.5±0.3; mean IS, 1.7±0.3) (Figure 5.3L, Table 5.3) and hyperplastic polyps (mean CS, 4.5±0.5; mean IS, 2.1±0.3) (Figure 5.3M, Table 5.3) relative to normal tissues. Further, TAG72 expression was significantly elevated in adenomas (mean CS, 4.5±0.1; mean IS, 2.0±0.1) (Figure 5.3N, Table 5.3) and adenocarcinomas (mean CS, 5.2±0.2; mean IS,

2.0±0.2) (Figure 5.3O, Table 5.3), differentiating these tissues from normal tissues. Relative to normal tissues, 38% of cancers had intense staining (3+) for TAG72. Overall, there was a progressive increase in TAG-72 expression during adenoma-carcinoma sequence.

Tn/STn-MUC1: Considering the overexpression of MUC1 during CRC, we also investigated the antigenic expression of MUC1-associated Tn/STn glycans during adenoma-carcinoma sequence.

Although MUC1 was expressed in normal tissues, the presence of Tn/STn-MUC1 was not detectable in 89% samples (mean CS, 0.1±0.1; mean IS, 0.1±0.1); while positive samples exhibited weak expression (Figure 5.3A, Table 5.3). The expression of Tn/STn-MUC1 was higher in 40% of inflamed tissues (mean CS, 1.3±0.7; mean IS, 0.5±0.3) (Figure 5.3B, Table

5.3). Further, significantly high expression of Tn/STn-MUC1 was observed in 60% of 162

hyperplastic polyps (mean CS, 2.4±1; mean IS, 1.2±0.4), 47% adenomas (mean CS, 1.8±0.5; mean IS, 0.9±0.2), and 63% adenocarcinomas (mean CS, 3.5±1.0; mean IS, 1.5±0.32) (Figure

5.3C-E, Table 5.3) relative to normal tissues. Overall, Tn/STn-MUC1 is progressively increased during adenoma-carcinoma sequence and significantly differentiates normal tissues from adenomas and adenocarcinomas.

Differences in CS for each colon tissue type were converted into a heat map for better visualization (Supplementary Fig. 1).

3.D Multivariate analyses to evaluate biomarker combinations as predictors of malignancy:

To determine the ability of mucins and mucin-associated glycans as biomarkers for discriminating adenoma/adenocarcinoma from hyperplastic polyp, we first performed univariate analysis. We observed that loss of MUC2 was a significant predictor (p=0.016) of adenoma/adenocarcinoma vs. hyperplastic polyps. We next investigated whether combinations of significantly altered mucins (MUC2, MUC4, MUC5AC, and MUC17) and mucin-associated glycans (Tn/STn-MUC1) can improve prediction of benign lesions (hyperplastic polyps) from neoplastic precursors (adenomas) and malignant lesions (adenocarcinoma). For this multivariate logistic regression method was utilized. In a full multivariate model, after adjusting for other variables, for each one-unit increase in CS of MUC2 it was 33% less likely to have adenoma/adenocarcinoma than hyperplastic polyp (p=0.014) (Table 5.4). Further, after adjusting for other variables, for each one-unit increase in CS for MUC17 and MUC5AC, the likelihood of adenoma/adenocarcinoma than hyperplastic polyp was 25% and 34% respectively (Table 5.4). In a backward selected model including only MUC4 and MUC2, after adjusting for MUC4, for each one-unit increase in CS for MUC2, it was 37% less likely to have adenocarcinoma than hyperplastic polyp (p=0.011) (data not shown). In a reduced model which includes MUC17,

MUC5AC, and Tn/STn-MUC1, for each one-unit increase in CS for MUC17 after adjusting for

MUC5AC and Tn/STn-MUC1, it was 31% more likely to have adenoma than hyperplastic polyp 163

(p=0.040) (data not shown). In summary, a combination of MUC2, MUC5AC, and MUC17

expression profiles could be useful for predicting the odds of having premalignant and/or

malignant lesions of the colon.

4. Discussion

Alterations in the expression of mucin proteins and in their O-glycosylation are postulated to be

involved in colon carcinogenesis and are considered as molecular markers for clinical use [19]. In

this context, the present study is the first to comprehensively evaluate the differential expression

of mucins and mucin-associated glycans during sequential progression to colon carcinogenesis

and to provide their utility in combinations for predicting the development of colon cancer.

MUC1 is a transmembrane mucin that is expressed in normal colon and overexpressed in inflammatory bowel disease (IBD) [20]. It is expressed in 19-76% of adenomas and is associated with increasing dysplasia along the adenoma-carcinoma sequence [14, 21]. Further, there is

overexpression of MUC1 in most colorectal tumors, with expression in the range of 30-100% [22,

23]. Higher expression of MUC1 positively correlates with stage, metastasis, poor tumor

differentiation, and worse long-term survival [22-25]. Although our results regarding MUC1 are

in accordance with aforementioned findings, its expression did not serve as a statistically

significant marker of tumor progression, a deficiency that could be attributed to the limited

sample size. However, MUC1 can be considered as a prognostic marker for colon cancer [22].

The present study represents a comprehensive analysis of MUC4 expression in the adenoma-carcinoma sequence. MUC4 is a high-molecular-weight transmembrane mucin that is overexpressed in many carcinomas and is associated with a poor prognosis [26], especially for

early stage CRCs [27]. An inverse relationship of MUC4 expression with the severity of Crohn’s

disease (CD) and ulcerative colitis (UC) has been established [28], and MUC4 expression is also

reduced in hyperplastic polyps. Similarly, loss of MUC4 expression in serrated adenomas has

been suggested to be a useful marker to identify patients with an elevated risk of developing 164

colon cancer [13]. However, utilizing the Muc4-/- mice, it was demonstrated that during

conditions of increased inflammation, loss of Muc4 renders resistance to chemical induced colitis

and CRC. In addition, loss of Muc4 was shown to be compensated by elevation of Muc2 and

Muc3 in this colitis induced tumor model [29]. In current study, we observed low MUC4 expression in inflammatory colon samples, suggesting that different inflammatory pathways may

be involved in its regulation. In this regard, association of MUC4 with prognosis of IBD patients

who develop CRC needs further validation in a large cohort of samples. Further, association between MUC4 expression and colon cancer has been variable among several studies.

Shanmugam et al. reported the complete loss/decreased MUC4 expression in 75% of CRCs [27].

Biemer-Huttmann et al. demonstrated MUC4 expression in 34% of adenocarcinomas and 47% of

mucinous colon cancers and suggested an inverse association between MUC4 expression and

tumor stage in MUC4-positive tissues [30]. Similarly, Zhang et al. observed intense MUC4 expression in 50% of colon cancers [31]. The findings of the present study align with

Shanmugam et al [27] which demonstrated strong MUC4 expression in normal colon with

progressive decrease during progression to carcinoma. Identification of the molecular

mechanisms underlying the downregulation of MUC4 expression during the adenoma-carcinoma

process could further establish its association with colon cancer carcinogenesis.

MUC17 is another membrane-bound mucin found by our laboratory, to be highly expressed on normal colon apical epithelium and crypt columnar epithelial cells and is downregulated in ulcerative colitis, Crohn’s disease, hyperplastic polyps, tubular, tubulovillous

adenomas, and adenocarcinomas [17]. Consistent with our previous report, there was mild to

strong expression of MUC17 in normal colon tissues, and it was reduced in inflamed colon.

However, contrary to our previous report, there was higher MUC17 expression in adenomas and

adenocarcinomas relative to inflamed tissues. Similar to present observation, a recent study

reported that there was an 82-fold increase in MUC17 expression that differentiated sessile 165

serrated adenomas/polyps (SSA/P) from hyperplastic polyps, adenomatous polyps, and normal

tissues [32]. Further, our unpublished findings from another CRC cohort study suggested that loss

of the punctate immunostaining pattern and the diffused cytoplasmic staining pattern of MUC17

were associated with aggressive behavior of CRCs and shortened patient survival (data not

shown). The observation conflicts could be due to limited sample number, different site from

where the tissues were obtained or different ethnicity of patient population. Therefore, these

observations warrant further investigation in a larger set of subtypes of colorectal polyps and

adenocarcinomas for defining MUC17 as a marker to differentiate pre-malignant lesions and to

establish its conclusive association with colorectal carcinogenesis.

The gel-forming mucin, MUC2, is secreted by goblet and columnar cells of the colonic

epithelium and is organized into two layers of protective mucus [33]. In CRCs, there is lower

MUC2 expression at both the mRNA and protein levels and low expression correlates with

reduced patient survival and a high incidence of liver and nodal metastases [34-36]. In contrast to

colon adenocarcinomas, colonic mucinous carcinomas are characterized by overexpression of

MUC2 [15, 37]. Consistent with these studies, we found a sequential and significant reduction of

MUC2 in the adenoma-carcinoma sequence. Loss of MUC2 differentiates adenomas and

adenocarcinomas from normal and benign controls. Overall, the findings suggest that a reduction

of MUC2 in adenomas can be utilized as an early-stage marker to identify precursor lesions with

malignant potential.

MUC5AC is not expressed in normal colon mucosa [15], but there is aberrant overexpression of MUC5AC in IBD [38], ulcerative colitis-associated dysplasia/neoplasms [39], hyperplastic polyps (HP), tubular adenomas, and SSA/Ps [8, 15, 16, 40]. It is also found in poorly differentiated adenocarcinomas located in the proximal colon independent of microsatellite instability status [41] and in mucinous CRCs. Consistent with previous studies, we found no

expression of MUC5AC in normal colon tissues, but its expression was significantly higher in 166

adenomas and adenocarcinomas. Higher MUC5AC expression differentiated adenocarcinomas

from normal colon tissues. Overall, expression of MUC5AC in colon pathologies, its association

with the adenoma-carcinoma sequence and its secretory nature suggests that MUC5AC combined with other relevant markers could be a useful marker for early diagnosis of CRC.

Among mucin-associated glycans, the TAG72 epitope is carried by high-molecular- weight mucins and identified as Sialyl-Tn. It is overexpressed in several malignancies, including

CRC, and is considered as an early marker for CRC and other dysplastic colonic diseases [42,

43]. The present results regarding TAG72 expression are consistent with those previously

reported studies. Although expression of TAG72 differentiated adenoma and adenocarcinoma

from normal colon, yet it could not emerge as a significant marker during adenoma-carcinoma

sequence.

CA 19-9 identifies the tumor surface marker sialylated Lewis (a). The incidence of

elevated serum CA 19-9 levels in CRCs ranges from 20–40% [44]. However, CA 19-9 is also expressed in normal colonic mucosa, thus limiting its diagnostic efficacy. We observed expression of CA 19-9 in 78% of normal colon tissues with weak/mild reactivity. Prominent CA

19-9 expression was observed in 94.4% of ulcerative and 72.4% of Crohn’s colitis tissues previously [45]. In contrast, we did not observe appreciable alterations in CA 19-9 expression in inflammatory tissues relative to normal colon tissues. Confounding views regarding the utility and feasibility of measuring CA 19-9 to differentiate low and high-risk adenomatous polyps have been published. Despite positivity for CA 19-9 in 60% of adenomas, its utility as a marker of the adenoma-carcinoma sequence is questionable due to lack of correlation with degree of dysplasia, size of adenoma and villous component [45, 46]. These results from previous studies are corroborated by our finding that CA 19-9 was present in 90% of hyperplastic polyps and 67% of adenomas, but it could not differentiate these lesions from benign or inflammatory conditions.

Although the diagnostic sensitivity and specificity of CA 19-9 for CRC has been estimated to be 167

70% and 61%, respectively [47], our results underscore the inability of CA 19-9 assays to

differentiate normal and inflammatory colon from adenocarcinoma, despite its increase in

expression in 75% of tissues. Since the elevated CA 19-9 levels correlate with tumor stage and

with the highest sensitivity in patients with metastases [48], it may serve as a useful marker for

advanced disease.

The Tn and sialyl-Tn epitopes appear to be colon cancer-associated antigens that act as markers of poorly differentiated adeno- and mucinous carcinomas [49]. Of colon carcinoma tissues, 82% express Tn antigens, and 73% express STn antigens on mucins in the cytoplasm or

in luminal cell membranes [50]. Malignant effusions from breast, colon, gastric, and ovarian

cancers have Tn antigen on MUC1 [51]. Proximity ligation assays have been applied for

detection of aberrant mucin glycoforms in cancer. Tn/STn-MUC1 glycoforms are the most

frequently expressed cancer biomarkers in the series of mucinous colon carcinomas [52].

Considering the overexpression of MUC1 and associated glycoforms in the adenoma-carcinoma

sequence and their association with increased malignant potential of colon tissues, we

investigated the antigenic expression of MUC1-associated Tn/STn glycans utilizing 5E5 antibody

characterized previously [53]. The antibody 5E5 reacts with all Tn and STn glycoforms of the

MUC1 tandem repeat but shows no reactivity with non-glycosylated MUC1 peptides. Our results demonstrate the utility of Tn/STn-MUC1 in differentiating hyperplastic polyps (p<0.05), adenomas (p<0.05), and adenocarcinomas (p<0.005) from normal colon. Of normal colon tissues,

89% did not express Tn/STn-MUC1 while the remaining 11% exhibited focal immunoreactivity.

The incidences of Tn/STn-MUC1 in adenomas and adenocarcinomas were 47% and 63%, respectively. As Tn/STn-MUC1 is tumor associated antigen, its higher expression was observed in comparison to MUC1 in certain cases. A further analysis of histologically-defined subtypes of cancer-associated adenomas and examination of adenocarcinomas and metastatic tissues are needed to establish its utility as a diagnostic marker in the adenoma-carcinoma sequence. 168

In addition to determining the pattern of distribution of mucins and mucin-associated glycans individually in the adenoma-carcinoma sequence, the present study performed multivariate regression analyses to identify combinations of mucins and mucin-associated glycans for predicting colon carcinogenesis at an early stage. The results suggest that a combination of

MUC2, MUC17, and MUC5AC can be utilized to assess the likelihood of adenoma and adenocarcinoma versus benign hyperplastic polyps.

While this study utilized a comprehensive panel of mucin and associated glycan antibodies, it is limited by the small sample size. The colon disease array used in this study did not include mucinous adenocarcinoma and metastatic colon cancer samples, limiting the complete picture of mucin and mucin-associated glycans expression in malignant tissues (e.g. MUC2 and

MUC5AC which are highly expressed in mucinous adenocarcinomas). Additionally, the lack of information about the sites in the colon from which the tissues were procured and about associated mutations limits the interpretations with regard to prediction of malignancy.

Overall, we investigated the signature of mucins and mucin-associated glycans associated with the adenoma-carcinoma sequence and found significant alterations in expressions of MUC2,

MUC4, MUC5AC, MUC17, and Tn/STn-MUC1. We also explored combinations of mucins and mucin-associated glycans for early-stage prediction of colon carcinogenesis. The combination of

MUC2, MUC5AC, and MUC17 may indicate the likelihood of a colon lesion being premalignant and/or malignant versus benign. Future efforts are underway to determine utility of mucin and mucin-associated glycans profile in risk stratification of different colorectal polyp subtypes to enhance early stage management of this malignancy.

169

Figure 5.1: Expression analysis of transmembrane mucins (MUC1, MUC4, and MUC17) in colon disease tissue microarrays. Colon tissue microarrays (Cat. # 809a) were probed with

MUC1 (HMFG2), MUC4 (8G7) monoclonal antibodies and MUC17 polyclonal antibody (SN-

1132) after non-specific blocking with horse serum. All sections were examined under a

microscope and the expression was evaluated on the basis of reddish brown staining by a

pathologist. Representative photomicrographs are shown for MUC1 (A-E), MUC4 (F-J) and

MUC17 (K-O) stained tissues of normal, Inflamed Colon, hyperplastic polyp, adenoma, and adenocarcinoma respectively. Elevated expression of MUC1 was observed during inflammation

(B), hyperplastic polyp (C), adenoma (D) and adenocarcinoma (E) of the colon in comparison to normal colon samples (A). Strong expression of MUC4 was observed in normal colon tissues (F) that were gradually lost during further progression to inflammation (G), hyperplastic polyp (H), adenoma (I) and adenocarcinoma (J). High immunoreactivity of MUC17 observed in normal colon (K) was downregulated in colon inflammation cases (L) and was observed to be significantly upregulated during further progression to a hyperplastic polyp (M), adenoma (N) and adenocarcinoma (O) cases in comparison to colonic inflammation cases. 170

Figure 5.1:

Normal Inflammation Polyp Adenoma Adenocarcinoma A B C D E

MUC1

F G H I J

MUC4

K L M N O

MUC17

171

Figure 5.2: Expression analysis of secretory mucins (MUC2, MUC5AC, MUC5B and

MUC6) in colon disease tissue array: Colon tissue microarrays (Cat. # 809a) were probed with

MUC2 (EPR6145), MUC5AC (45M1), MUC5B (19.4E) and MUC6 (CLH5) monoclonal antibodies after non-specific blocking with horse serum. All sections were examined under a microscope, and the positive expression was evaluated on the basis of reddish brown staining by a pathologist. Representative photomicrographs are shown for MUC2 (A-E), MUC5AC (F-J),

MUC5B (K-O) and MUC6 (P-T) stained tissues of normal, inflamed colon, hyperplastic polyp, adenoma and adenocarcinoma of colon respectively. Strong expression of MUC2 observed in normal colon tissues (A). Gradual loss of expression was observed during progression to inflammation (B), hyperplastic polyps (C), adenoma (D) and adenocarcinoma (E). No immunoreactivity of MUC5AC was observed in normal colon cases (F). Expression was significantly enhanced in a hyperplastic polyp (H), adenoma (I) and adenocarcinoma (J) of colon in comparison to normal colon (A) and inflammation cases (G). No MUC5B expression was observed in normal colon (K) while rare expression was observed during inflammation (L), hyperplastic polyp (M), adenoma (N) and adenocarcinoma (O). MUC6 expression was rarely observed in cases of adenoma (S) and adenocarcinoma (T). 172

Figure 5.2:

Normal Inflammation Polyp Adenoma Adenocarcinoma A B C D E

MUC2

F G H I J

MUC5AC

K L M N O

MUC5B

P Q R S T

MUC6 173

Figure 5.3: Expression analysis of mucin-associated glycans (Tn/STn-MUC1, CA 19-9 and

TAG72) in colon disease tissue array. Colon tissue microarrays (Cat. # 809a) were probed with

Tn/STn-MUC1 (5E5), CA 19-9 (NS19.9) and TAG72 (CC49) monoclonal antibodies after non- specific blocking with horse serum. All sections were examined under a microscope, and the positive expression was evaluated on the basis of reddish brown staining by a pathologist.

Representative photomicrographs are shown for Tn/STn-MUC1 (A-E), CA 19-9 (F-J) and

TAG72 (K-O) stained tissues of normal or inflamed colon, hyperplastic polyp, adenoma and adenocarcinoma of the colon. Tn/STn-MUC1 expression was elevated during colonic inflammation (B) that was further significantly enhanced in a hyperplastic polyp (C), adenoma

(D) and adenocarcinoma (E) cases of the colon when compared to normal colon samples (A). An increase in CA 19-9 expression was observed in inflammation (G), hyperplastic polyp (H), adenoma (I) and adenocarcinoma (J) when compared to normal colon cases (F). Low expression of TAG72 was observed in normal colon cases (K). An increase in its expression was observed in colon inflammation (L) and hyperplastic polyp (M) cases that was significantly upregulated in colon adenoma (N) and adenocarcinoma (O) cases in comparison to normal colon (K). 174

Figure 5.3:

Normal Inflammation Polyp Adenoma Adenocarcinoma A B C D E

Tn/STn on MUC1

F G H I J

CA19.9

K L M N O

TAG-72

175

Supplementary Figure 5.1: Heat map for mucin and mucin-associated glycans expression analysis in normal colon, colon inflammation, hyperplastic polyps, adenoma and adenocarcinoma: Higher intensity of color corresponds to higher levels of expression based on composite score (see Materials and Methods). Statistically significant mucins differentially expressed during progression to colon cancer are represented by asterisks when compared to controls. 176

Supplementary Figure 5.1:

Normal Inflammation Polyp Adenoma Adenocarcinoma MUC1 *MUC4 *MUC17 *MUC2 MUC5B *MUC5AC MUC6 CA19.9 TAG-72 Tn/STn on MUC1

No Expression High Expression

177

Table 5.1: Composite and intensity scores for transmembrane mucins (MUC1, MUC4, and MUC17) expression in normal, inflammation, hyperplastic polyp, adenoma and adenocarcinoma tissues of the colon.

Overall Diagnosis Normal Inflammation Polyp Adenoma CAC p-value

Mean ± SE 3.5 ± 0.5 5.2 ± 1.2 3.8 ± 1.1 4.0 ± 0.6 5.8 ± 0.9 0.34 MUC1 Median (Min, Max) 4 (1, 6) 6 (0, 12) 2.5 (0, 12) 2 (0, 12) 5 (0, 12)

Mean ± SE 11.6 ± 0.3 5,8,11,14 7.9 ± 1 2,9,14 4.4 ± 1.5 2,12 4.2 ± 0.7 3,4,13 0.6 ± 0.3 3,6,7,10

<0.0001

MUC4 Median (Min, Max) 12 (9, 12) 8.5 (0, 12) 3 (0, 12) 3.5 (0, 12) 0 (0, 4)

Composite Scores Composite Mean ± SE 8.5 ± 1 5.6 ± 0.9 10,12 7.7 ± 1.5 9.5 ± 0.6 5 9.0 ± 0.8 4 0.047

MUC17 Median (Min, Max) 8 (4, 12) 6 (1, 9) 9 (1, 12) 12 (0, 12) 8.0 (4, 12)

Mean ± SE 1.7 ± 0.212 1.9 ± 0.3 2.1 ± 0.3 1.9 ± 0.212 2.4 ± 0.2 1,9

Transmembrane mucins Transmembrane 0.057

MUC1 Median (Min, Max) 2 (1, 2) 2 (0, 3) 2 (0, 3) 2 (0, 3) 3 (0, 3)

Mean ± SE 3 ± 0 8,4,11 2.5 ± 0.3 7,9,14 1.5 ± 0.4 2,4,12 1.6 ± 0.2 3,4,13 0.5 ± 0.2 3,6,7,10 <0.0001 Intensity Scores Intensity

MUC4 Median (Min, Max) 3 (3, 3) 3 (0, 3) 2 (0, 3) 2 (0, 3) 0 (0, 2) 178

Mean ± SE 2.4 ± 0.2 2 ± 0.3 2.3 ± 0.3 2.5 ± 0.1 2.4 ± 0.1 0.47

MUC17 Median (Min, Max) 2 (2, 3) 2 (1, 3) 3 (1, 3) 3 (0, 3) 2 (1, 3)

1p<0.05 vs. normal; 2p<0.005 vs. normal; 3p<0.0005 vs. normal; 4p<0.05 vs. inflammation; 5p<0.005 vs. inflammation; 6p<0.0005 vs. inflammation; 7p<0.05 vs. polyp; 8<0.005 vs. polyp; 9p<0.05 vs. adenoma; 10p<0.005 vs. adenoma; 11p<0.0005 vs. adenoma; 12p<0.05 vs. adenocarcinoma; 13p<0.005 vs. adenocarcinoma; 14p<0.0005 vs. adenocarcinoma p-value <0.05 has been shown as the bold numbers in last column (overall p-value) colon adenocarcinoma (CAC); standard error (SE); composite score (CS); intensity score (IS)

179

Table 5.2: Composite and intensity scores for secretory mucins (MUC2, MUC5B, MUC5AC, and MUC6) expression in tissues corresponding to normal, inflammation, polyp, adenoma and adenocarcinoma tissues of the colon.

Overall Diagnosis Normal Inflammation Polyp Adenoma CAC p-value

Mean ± SE 12 ± 0 7,11,14 11.4 ± 0.4 11,14 9.7±1.1 1,9,13 7.4 ± 0.6 3,6,7,13 3.8 ± 0.9 3,6,8,10 <0.0001

MUC2 Median (Min, Max) 12 (12, 12) 12 (9, 12) 12 (3, 12) 9 (1, 12) 3 (0, 12)

Mean ± SE 0 ± 0 0.4 ± 0.3 0.8 ± 0.6 2.2 ± 0.7 0.19 ± 0.1 0.34

MUC5B Median (Min, Max) 0 (0, 0) 0 (0, 3) 0 (0, 6) 0 (0, 12) 0 (0, 2)

Mean ± SE 0 ± 0 7,10,12 0.5 ± 0.3 9 1.8 ± 1 1 3.1 ± 0.6 2,5 1.7 ± 0.7 1 0.01 Median (Min, Max) 0 (0, 0) 0 (0, 2) 0.5 (0, 9) 1.5 (0, 9) 0 (0, 9) Composite Scores CS) Scores Composite MUC5AC

Mean ± SE 0 ± 0 0 ± 0 0 ± 0 0.5 ± 0.4 0.19 ± 0.1 Secretory mucins Secretory 0.29

MUC6 Median (Min, Max) 0 (0, 0) 0 (0, 0) 0 (0, 0) 0 (0, 12) 0 (0, 1)

Mean ± SE 3 ± 012 3 ± 012 2.9 ± 0.1 2.8 ± 0.112 2 ± 0.3 1,4,9

0.0069

MUC2 Median (Min, Max) 3 (3, 3) 3 (3, 3) 3 (2, 3) 3 (1, 3) 3 (0, 3) (IS)

5B Mean ± SE 0 ± 0 0.4 ± 0.3 0.4 ± 0.3 0.8 ± 0.2 0.2 ± 0.1 0.34 Intensity Scores Scores Intensity MUC 180

Median (Min, Max) 0 (0, 0) 0 (0, 3) 0 (0, 2) 0 (0, 3) 0 (0, 2)

Mean ± SE 0 ± 0 7,10,12 0.5 ± 0.3 9 0.9 ± 0.4 1 1.5 ± 0.2 2,4 1.1 ± 0.3 1 0.013 Median (Min, Max) 0 (0, 0) 0 (0, 2) 0.5 (0, 3) 1 (0, 3) 0 (0, 3) MUC5AC

Mean ± SE 0 ± 0 0 ± 0 0 ± 0 0.2 ± 0.1 0.2 ± 0.1 0.29

MUC6 Median (Min, Max) 0 (0, 0) 0 (0, 0) 0 (0, 0) 0 (0, 3) 0 (0, 1)

1p<0.05 vs. normal; 2p<0.005 vs. normal; 3p<0.0005 vs. normal; 4p<0.05 vs. inflammation; 5p<0.005 vs. inflammation; 6p<0.0005 vs. inflammation; 7p<0.05 vs. polyp; 8<0.005 vs. polyp; 9p<0.05 vs. adenoma; 10p<0.005 vs. adenoma; 11p<0.0005 vs. adenoma; 12p<0.05 vs. adenocarcinoma; 13p<0.005 vs. adenocarcinoma; 14p<0.0005 vs. adenocarcinoma;

p-value <0.05 has been shown as the bold numbers in last column (overall p-value)

colon adenocarcinoma (CAC); standard error (SE); composite score (CS); intensity score (IS) 181

Table 5.3: Composite and intensity scores for mucin-associated glycans (CA 19-9, TAG72, and Tn/STn on MUC1) in tissues corresponding to normal, inflammation, hyperplastic polyp, adenoma and adenocarcinoma tissues of the colon.

Overall Diagnosis Normal Inflammation Polyp Adenoma CAC p-value

9

- Mean ± SE 2.8 ± 0.9 3 ± 1.0 3.3 ± 0.9 3.2 ± 0.6 6.1 ± 1.2 0.3

CA 19 Median (Min, Max) 3 (0, 6) 2.5 (0, 9) 2.5 (0, 9) 3 (0, 12) 6 (0, 12)

Mean ± SE 1.7 ± 0.3 5,6 3.5 ± 0.3 4.5 ± 0.5 4.5 ± 0.1 2 5.2 ± 0.2 1 0.093

TAG72 Median (Min, Max) 1(0, 4) 2.5 (1, 9) 4 (0, 9) 4 (0, 12) 6 (0, 12)

Composite Scores Composite Mean ± SE 0.11 ± 0.1 3,4,7 1.3 ± 0.7 2.4 ± 1 1 1.8 ± 0.5 1 3.5 ± 1.0 2 0.077

Tn/STn Median (Min, Max) 0 (0, 1) 0 (0, 6) 1.5 (0, 9) 0 (0, 9) 2 (0, 12) on MUC1

9

- Mean ± SE 1.9 ± 0.5 1.6 ± 0.5 2.1 ± 0.3 1.8 ± 0.2 2.2 ± 0.3 0.71

CA 19 Median (Min, Max) 3 (0, 3) 2 (0, 3) 2.5 (0, 3) 2 (0, 3) 3 (0, 3)

Glycans associated Mucins Mean ± SE 1.1 ± 0.2 3,5,6 1.7 ± 0.3 2.1 ± 0.3 1 2 ± 0.1 2 2.0 ± 0.2 1 0.043

TAG72 Median (Min, Max) 1(0, 2) 1.5 (1, 3) 2 (0, 3) 2 (0, 3) 2 (0, 3)

Intensity Scores Intensity Mean ± SE 0.1 ± 0.1 3,4,6 0.5 ± 0.3 1.2 ± 0.4 1 0.9 ± 0.2 1 1.5 ± 0.3 1 0.036

Tn/STn Median (Min, Max) 0 (0, 1) 0 (0, 2) 1.5 (0, 3) 0 (0, 3) 2 (0, 3) on MUC1 182

1p<0.05 vs. normal; 2p<0.005 vs. normal; 3p<0.05 vs. hyperplastic polyp; 4p<0.05 vs. adenoma; 5p<0.005 vs. adenoma; 6p<0.05 vs. adenocarcinoma; 7p<0.005 vs. adenocarcinoma p-value <0.05 has been shown as the bold numbers in last column (overall p-value) colon adenocarcinoma (CAC); standard error (SE); composite score (CS); intensity score (IS)

183

Table 5.4: Univariate and multivariate analyses: odds of Adenoma/Adenocarcinoma vs. Hyperplastic polyp

Univariate Multivariate 95% CI 95% CI Effect OR Lower Upper p-value OR Lower Upper p-value MUC4 0.918 0.779 1.081 0.300 0.837 0.668 1.050 0.120 MUC17 1.128 0.940 1.354 0.200 1.254 0.960 1.638 0.097 MUC2 0.724 0.557 0.942 0.016 0.672 0.490 0.921 0.014 MUC5AC 1.092 0.861 1.385 0.470 1.338 0.962 1.859 0.083 Tn/STn on MUC1 1.003 0.808 1.246 0.980 0.754 0.538 1.057 0.100

p-value <0.05 has been shown as the bold numbers in last column (overall p-value).

Confidence interval (CI); Odds Ratio (OR)

184

Reference List

[1] Y. Hazewinkel and E. Dekker, Colonoscopy: basic principles and novel techniques. Nat. Rev. Gastroenterol. Hepatol. 8 (2011) 554-564.

[2] R.L. Siegel, K.D. Miller, and A. Jemal, Cancer statistics, 2015. CA Cancer J. Clin. 65 (2015) 5-29.

[3] B. Moghimi-Dehkordi and A. Safaee, An overview of colorectal cancer survival rates and prognosis in Asia. World J. Gastrointest. Oncol. 4 (2012) 71-75.

[4] F.A. Haggar and R.P. Boushey, Colorectal cancer epidemiology: incidence, mortality, survival, and risk factors. Clin. Colon Rectal. Surg. 22 (2009) 191-197.

[5] M. Kolos, A. Wasaznik-Jedras, and A. Nasierowska-Guttmejer, Can the histological type of colorectal cancer determine the carcinogenesis pathway? Pol. J. Pathol. 66 (2015) 109-120.

[6] T. Armaghany, J.D. Wilson, Q. Chu, and G. Mills, Genetic alterations in colorectal cancer. Gastrointest. Cancer Res. 5 (2012) 19-27.

[7] M. Molaei, B.K. Mansoori, R. Mashayekhi, M. Vahedi, M.A. Pourhoseingholi, S.R. Fatemi, and M.R. Zali, Mucins in neoplastic spectrum of colorectal polyps: can they provide predictions? BMC. Cancer 10 (2010) 537.

[8] J.H. Kim, K.J. Kim, Y.Y. Rhee, J.M. Bae, N.Y. Cho, H.S. Lee, and G.H. Kang, Gastric- type expression signature in serrated pathway-associated colorectal tumors. Hum. Pathol 46 (2015) 643-656.

[9] G.C. Hansson, Role of mucus layers in gut infection and inflammation. Curr. Opin. Microbiol. 15 (2012) 57-62.

[10] M.E. Johansson, H. Sjovall, and G.C. Hansson, The gastrointestinal mucus system in health and disease. Nat. Rev. Gastroenterol. Hepatol. 10 (2013) 352-361.

[11] S. Kaur, S. Kumar, N. Momi, A.R. Sasson, and S.K. Batra, Mucins in pancreatic cancer and its microenvironment. Nat. Rev. Gastroenterol. Hepatol. 10 (2013) 607-620.

[12] Y.S. Kim and S.B. Ho, Intestinal goblet cells and mucins in health and disease: recent insights and progress. Curr. Gastroenterol. Rep. 12 (2010) 319-330.

[13] A.E. Biemer-Huttmann, M.D. Walsh, M.A. McGuckin, Y. Ajioka, H. Watanabe, B.A. Leggett, and J.R. Jass, Immunohistochemical staining patterns of MUC1, MUC2, MUC4, and MUC5AC mucins in hyperplastic polyps, serrated adenomas, and traditional adenomas of the colorectum. J. Histochem. Cytochem. 47 (1999) 1039-1048.

[14] S. Percinel, B. Savas, A. Ensari, I. Kuzu, M.A. Kuzu, M. Bektas, H. Cetinkaya, and N. Kursun, Mucins in the colorectal neoplastic spectrum with reference to conventional and serrated adenomas. Turk. J. Gastroenterol. 18 (2007) 230-238. 185

[15] X.D. Bu, N. Li, X.Q. Tian, L. Li, J.S. Wang, X.J. Yu, and P.L. Huang, Altered expression of MUC2 and MUC5AC in progression of colorectal carcinoma. World J. Gastroenterol. 16 (2010) 4089-4094.

[16] K. Fujita, M. Hirahashi, H. Yamamoto, T. Matsumoto, M. Gushima, Y. Oda, J. Kishimoto, T. Yao, M. Iida, and M. Tsuneyoshi, Mucin core protein expression in serrated polyps of the large intestine. Virchows Arch. 457 (2010) 443-449.

[17] S. Senapati, S.B. Ho, P. Sharma, S. Das, S. Chakraborty, S. Kaur, G. Niehans, and S.K. Batra, Expression of intestinal MUC17 membrane-bound mucin in inflammatory and neoplastic diseases of the colon. J. Clin. Pathol. 63 (2010) 702-707.

[18] S. Kaur, T. Shimizu, M.J. Baine, S. Kumar, and S.K. Batra, Immunohistochemistry of pancreatic neoplasia. Methods Mol. Biol. 980 (2013) 29-42.

[19] S.D. Szajda, A. Jankowska, and K. Zwierz, Carbohydrate markers in colon carcinoma. Dis. Markers 25 (2008) 233-242.

[20] A.E. Furr, S. Ranganathan, and O.J. Finn, Aberrant expression of MUC1 mucin in pediatric inflammatory bowel disease. Pediatr. Dev. Pathol 13 (2010) 24-31.

[21] S.B. Ho, S.L. Ewing, C.K. Montgomery, and Y.S. Kim, Altered mucin core peptide immunoreactivity in the colon polyp-carcinoma sequence. Oncol. Res. 8 (1996) 53-61.

[22] F. Xu, F. Liu, H. Zhao, G. An, and G. Feng, Prognostic Significance of Mucin Antigen MUC1 in Various Human Epithelial Cancers: A Meta-Analysis. Medicine (Baltimore) 94 (2015) e2286.

[23] M.V. Kesari, V.L. Gaopande, A.R. Joshi, S.V. Babanagare, B.P. Gogate, and A.V. Khadilkar, Immunohistochemical study of MUC1, MUC2 and MUC5AC in colorectal carcinoma and review of literature. Indian J. Gastroenterol. 34 (2015) 63-67.

[24] T.J. Duncan, N.F. Watson, A.H. Al-Attar, J.H. Scholefield, and L.G. Durrant, The role of MUC1 and MUC3 in the biology and prognosis of colorectal cancer. World J Surg Oncol. 5 (2007) 31.

[25] Y. Zeng, Q. Zhang, Y. Zhang, M. Lu, Y. Liu, T. Zheng, S. Feng, M. Hao, and H. Shi, MUC1 Predicts Colorectal Cancer Metastasis: A Systematic Review and Meta-Analysis of Case Controlled Studies. PLoS. One. 10 (2015) e0138049.

[26] N. Yamada, Y. Nishida, H. Tsutsumida, M. Goto, M. Higashi, M. Nomoto, and S. Yonezawa, Promoter CpG methylation in cancer cells contributes to the regulation of MUC4. Br. J Cancer 100 (2009) 344-351.

[27] C. Shanmugam, N.C. Jhala, V.R. Katkoori, W. Wan, S. Meleth, W.E. Grizzle, and U. Manne, Prognostic value of mucin 4 expression in colorectal adenocarcinomas. Cancer 116 (2010) 3577-3586.

[28] A.E. Dorofeyev, I.V. Vasilenko, O.A. Rassokhina, and R.B. Kondratiuk, Mucosal barrier in ulcerative colitis and Crohn's disease. Gastroenterol. Res. Pract. 2013 (2013) 431231. 186

[29] S. Das, S. Rachagani, Y. Sheinin, L.M. Smith, C.B. Gurumurthy, H.K. Roy, and S.K. Batra, Mice deficient in Muc4 are resistant to experimental colitis and colitis-associated colorectal cancer. Oncogene (2015) Epub ahead of print.

[30] A.E. Biemer-Huttmann, M.D. Walsh, M.A. McGuckin, L.A. Simms, J. Young, B.A. Leggett, and J.R. Jass, Mucin core protein expression in colorectal cancers with high levels of microsatellite instability indicates a novel pathway of morphogenesis. Clin. Cancer Res. 6 (2000) 1909-1916.

[31] S. Zhang, H.S. Zhang, C. Cordon-Cardo, G. Ragupathi, and P.O. Livingston, Selection of tumor antigens as targets for immune attack using immunohistochemistry: protein antigens. Clin. Cancer Res. 4 (1998) 2669-2676.

[32] D.A. Delker, B.M. McGettigan, P. Kanth, S. Pop, D.W. Neklason, M.P. Bronner, R.W. Burt, and C.H. Hagedorn, RNA sequencing of sessile serrated colon polyps identifies differentially expressed genes and immunohistochemical markers. PLoS. One. 9 (2014) e88367.

[33] M.E. Johansson, M. Phillipson, J. Petersson, A. Velcich, L. Holm, and G.C. Hansson, The inner of the two Muc2 mucin-dependent mucus layers in colon is devoid of bacteria. Proc. Natl. Acad. Sci. U. S. A 105 (2008) 15064-15069.

[34] A. Elzagheid, F. Emaetig, A. Buhmeida, M. Laato, O. El-Faitori, K. Syrjanen, Y. Collan, and S. Pyrhonen, Loss of MUC2 expression predicts disease recurrence and poor outcome in colorectal carcinoma. Tumour. Biol. 34 (2013) 621-628.

[35] H. Kang, B.S. Min, K.Y. Lee, N.K. Kim, S.N. Kim, J. Choi, and H. Kim, Loss of E- cadherin and MUC2 expressions correlated with poor survival in patients with stages II and III colorectal carcinoma. Ann. Surg. Oncol. 18 (2011) 711-719.

[36] L. Ohlsson, A. Israelsson, A. Oberg, R. Palmqvist, H. Stenlund, M.L. Hammarstrom, S. Hammarstrom, and G. Lindmark, Lymph node CEA and MUC2 mRNA as useful predictors of outcome in colorectal cancer. Int. J. Cancer 130 (2012) 1833-1843.

[37] M. Melis, J. Hernandez, E.M. Siegel, J.M. McLoughlin, Q.P. Ly, R.M. Nair, J.M. Lewis, E.H. Jensen, M.D. Alvarado, D. Coppola, S. Eschrich, G.C. Bloom, T.J. Yeatman, and D. Shibata, Gene expression profiling of colorectal mucinous adenocarcinomas. Dis. Colon Rectum 53 (2010) 936-943.

[38] R. Shaoul, Y. Okada, E. Cutz, and M.A. Marcon, Colonic expression of MUC2, MUC5AC, and TFF1 in inflammatory bowel disease in children. J Pediatr. Gastroenterol. Nutr. 38 (2004) 488-493.

[39] N. Tatsumi, R. Kushima, M. Vieth, K. Mukaisho, R. Kakinoki, H. Okabe, F. Borchard, M. Stolte, T. Okanoue, and T. Hattori, Cytokeratin 7/20 and mucin core protein expression in ulcerative colitis-associated colorectal neoplasms. Virchows Arch. 448 (2006) 756-762.

[40] S. Ban, H. Mitomi, H. Horiguchi, H. Sato, and M. Shimizu, Adenocarcinoma arising in small sessile serrated adenoma/polyp (SSA/P) of the colon: clinicopathological study of eight lesions. Pathol Int. 64 (2014) 123-132. 187

[41] Y. Imai, Poorly differentiated adenocarcinoma of the colon: subsite location and clinicopathologic features. Int. J Colorectal Dis. 30 (2015) 187-196.

[42] H. Ding, M.M. Carlton, S.P. Povoski, K. Milum, K. Kumar, S. Kothandaraman, G.H. Hinkle, D. Colcher, R. Brody, P.D. Davis, A. Pokora, M. Phelps, E.W. Martin, Jr., and M.F. Tweedle, Site specific discrete PEGylation of (124)I-labeled mCC49 Fab' fragments improves tumor MicroPET/CT imaging in mice. Bioconjug. Chem. 24 (2013) 1945-1954.

[43] J.P. Tiernan, S.L. Perry, E.T. Verghese, N.P. West, S. Yeluri, D.G. Jayne, and T.A. Hughes, Carcinoembryonic antigen is the preferred biomarker for in vivo colorectal cancer targeting. Br. J. Cancer 108 (2013) 662-667.

[44] S. Hundt, U. Haug, and H. Brenner, Blood markers for early detection of colorectal cancer: a systematic review. Cancer Epidemiol. Biomarkers Prev. 16 (2007) 1935-1953.

[45] G. Frykholm, P. Enblad, L. Pahlman, and C. Busch, Expression of the carcinoma- associated antigens CA 19-9 and CA-50 in inflammatory bowel disease. Dis. Colon Rectum 30 (1987) 545-548.

[46] G.F. Tucci, M. Grande, I. Stroppa, F. Federico, and A.M. Farinon, [Tissue expression of carbohydrate antigen 19-9 (CA 19-9) in adenomatous lesions of the colorectum]. Chir Ital. 51 (1999) 165-172.

[47] Y.R. Wang, J.X. Yan, and L.N. Wang, The diagnostic value of serum carcino-embryonic antigen, alpha fetoprotein and carbohydrate antigen 19-9 for colorectal cancer. J Cancer Res. Ther. 10 Suppl (2014) 307-309.

[48] S. Zhang, Y. Chen, Z. Zhu, Y. Ding, S. Ren, and Y. Zuo, Differential expression of carbohydrate antigen 19-9 in human colorectal cancer: A comparison with colon and rectal cancers. Mol. Clin. Oncol. 1 (2013) 1072-1078.

[49] S. Holst, M. Wuhrer, and Y. Rombouts, Glycosylation characteristics of colorectal cancer. Adv. Cancer Res. 126 (2015) 203-256.

[50] T.F. Orntoft, N. Harving, and N.C. Langkilde, O-linked mucin-type glycoproteins in normal and malignant colon mucosa: lack of T-antigen expression and accumulation of Tn and sialosyl-Tn antigens in carcinomas. Int. J Cancer 45 (1990) 666-672.

[51] T. Freire, A. Medeiros, C.A. Reis, F.X. Real, and E. Osinaga, Biochemical characterization of soluble Tn glycoproteins from malignant effusions of patients with carcinomas. Oncol. Rep. 10 (2003) 1577-1585.

[52] R. Pinto, A.S. Carvalho, T. Conze, A. Magalhaes, G. Picco, J.M. Burchell, J. Taylor- Papadimitriou, C.A. Reis, R. Almeida, U. Mandel, H. Clausen, O. Soderberg, and L. David, Identification of new cancer biomarkers based on aberrant mucin glycoforms by in situ proximity ligation. J Cell Mol. Med. 16 (2012) 1474-1484.

[53] A.L. Sorensen, C.A. Reis, M.A. Tarp, U. Mandel, K. Ramachandran, V. Sankaranarayanan, T. Schwientek, R. Graham, J. Taylor-Papadimitriou, M.A. Hollingsworth, J. Burchell, and H. Clausen, Chemoenzymatically synthesized multimeric Tn/STn MUC1 glycopeptides 188

elicit cancer-specific anti-MUC1 antibody responses and override tolerance. Glycobiology 16 (2006) 96-107.

[54] J. Burchell, S. Gendler, J. Taylor-Papadimitriou, A. Girling, A. Lewis, R. Millis, and D. Lamport, Development and characterization of breast cancer reactive monoclonal antibodies directed to the core protein of the human milk mucin. Cancer Res. 47 (1987) 5476-5482.

[55] N. Moniaux, G.C. Varshney, S.C. Chauhan, M.C. Copin, M. Jain, U.A. Wittel, M. Andrianifahanana, J.P. Aubert, and S.K. Batra, Generation and characterization of anti- MUC4 monoclonal antibodies reactive with normal and cancer cells in humans. J. Histochem. Cytochem. 52 (2004) 253-261.

[56] N. Moniaux, W.M. Junker, A.P. Singh, A.M. Jones, and S.K. Batra, Characterization of human mucin MUC17. Complete coding sequence and organization. J. Biol. Chem. 281 (2006) 23676-23685.

[57] C.A. Reis, L. David, F. Carvalho, U. Mandel, B.C. de, E. Mirgorodskaya, H. Clausen, and M. Sobrinho-Simoes, Immunohistochemical study of the expression of MUC6 mucin and co-expression of other secreted mucins (MUC5AC and MUC2) in human gastric carcinomas. J. Histochem. Cytochem. 48 (2000) 377-388.

[58] D.G. Sheer, J. Schlom, and H.L. Cooper, Purification and composition of the human tumor- associated glycoprotein (TAG-72) defined by monoclonal antibodies CC49 and B72.3. Cancer Res. 48 (1988) 6811-6818.

189

Chapter VI

Combinatorial assessment of CA 19-9/MUC17/MUC5AC expression discriminates sessile serrated adenoma/polyps and

tubular adenoma from hyperplastic polyps

190

1. Synopsis

Sessile serrated adenoma/polyps (SSA/Ps) are precursors of colorectal cancer. Failure to identify and remove sessile serrated adenoma/polyps due to their anatomical position, inconsistent pathological diagnosis, and dearth of the molecular markers to discriminate them from hyperplastic polyps result in mis-diagnosis, causing suboptimal surveillance and colonoscopy interval cancers. Owing to the suitability of combined mucins and associated glycan epitopes expression to discriminate premalignant/malignant lesions of colon from hyperplastic polyps

(HP), this study aimed to determine the individual and combinatorial predictive value of mucins and associated glycan epitopes expression, for comprehensive stratification of sessile serrated adenoma/polyp from other colorectal polyp subtypes. This approach as an adjunct to colonoscopy would help clinicians for accurate diagnosis and management of colorectal polyps. For this we investigated expression of mucins (MUC1, MUC4, MUC17, MUC2, and MUC5AC) and associated glycan epitopes (CA 19-9 and Tn/STn-MUC1) by immunohistochemical analysis on sessile serrated adenoma/polyps (n=39), tubular adenoma (TA) (n=34), and hyperplastic polyp

(n=33). Efficacy of individual and combinatorial panels of mucins and associated glycan epitopes as biomarkers to discriminate colorectal polyps was investigated further. We observed significant differential expression of mucins and associated glycan epitopes in SSA/Ps, TA and HP. In univariate logistic regression analysis, significant markers of SSA/Ps vs. HP were MUC4,

MUC17, and MUC5AC. The significant predictors of SSA/P vs. TA were MUC1, MUC17,

MUC2, MUC5AC, Tn/STn-MUC1, CA 19-9 and the significant predictors of TA vs. HP were

MUC4, MUC2, MUC5AC, and CA 19-9. Further, multivariate logistic regression and ROC curve analysis demonstrated that a combination of MUC5AC/MUC17 effectively discriminates SSA/Ps vs. HP (SN/SP=85/82%), MUC1/MUC17/CA 19-9 combination improved prediction of SSA/P vs. TA (SN/SP=92/97%), and CA19-9 alone effectively predicts TA vs. HP (SN/SP=89/82%).

Effective discrimination of SSA/P from other colorectal polyps, using combinatorial panel of 191

mucins and associated glycan epitopes, as an adjunct to colonoscopy can help clinicians for easy diagnosis and better surveillance strategy to reduce colonoscopy interval cancers. 192

2. Background and rationale

Colorectal cancer (CRC) is molecularly and histologically heterogeneous, biologically diverse public health problem with over one million new cases diagnosed worldwide every year [1]. The multistep process of colorectal carcinogenesis is associated with accumulation of genetic and epigenetic alterations in epithelial cells via distinct molecular pathways including the most common “adenoma–carcinoma” pathway and the recently identified “serrated polyp-neoplasia” pathway [2-4]. Conventional adenomas (tubular, villous, and tubulovillous) exhibit characteristic cytological dysplasia and are widely understood to be the premalignant lesions accounting for 65-

70% of CRCs [5]. In contrast to this, the serrated neoplasia pathway is associated with serrated polyps. It accounts for 15-30% of CRCs, and potentially the majority of interval cancers with the characteristics of microsatellite instability along with DNA hypermethylation and BRAF mutations and predominantly occurring in the right colon [6, 7]. As per the latest World Health

Organization (WHO) recommendations, the heterogeneous group of serrated lesions is classified pathologically into hyperplastic polyp (HP), sessile serrated adenomas/Polyp (SSA/P) and traditional serrated adenomas (TSA) [8]. Traditionally, the smaller HPs are considered to be benign and non-neoplastic [9]. In contrast, large serrated polyps have been significantly associated with synchronous advanced adenocarcinomas [10]. Evidences suggest that neoplastic progression with the serrated neoplasia pathway is faster than the classical adenoma-carcinoma sequence and may take as little as eight months [11-13].

The different cancer risks of HPs and SSA/Ps make their morphological distinction clinically relevant. However, owing to costly and impractical assessment of genetic events

(KRAS and BRAF mutations) that lack specificity [14], and difficult histologic evaluation due to shared morphologic features, a diagnostic “gray zone” exists between HP and SSA/P, with a wide interobserver variability [15-17]. As current surveillance recommendations depend on the histologic type of the polyp, underdiagnoses of these premalignant precursors may lead to an 193

inappropriate follow-up care and therapy thus contributing to interval carcinomas [18]. Therefore,

sensitive and specific markers that could significantly aid in improving the diagnosis of SSA/Ps

from other polyp subtypes are urgently needed.

Secreted and transmembrane mucins forms the most abundant component of colon and

are major building blocks of the dynamic stratified gastrointestinal mucus layer [19]. Alterations

in mucins and their associated carbohydrate structures play a role in various GI disorders

(inflammatory bowel diseases and colorectal cancers) [20]. Recent analyses of combinatorial

panel of mucins core protein and associated glycan epitopes by our group highlighted their

potential to discriminate premalignant and malignant lesions of colon from benign polyps [21].

Further, a recent study identified transmenbrane mucin MUC17 as potential

immunohistochemical marker for SSA/Ps [22]. In another study, Bartley et al. found the relatively high specificity of MUC6 (82%) but low sensitivity (54%) for sessile serrated adenoma

[23], while Renauld et al. observed MUC5AC hypomethylation as an early marker of polyps with malignant potential [24]. However, most of these studies were conducted on one or few mucins, did not consider alterations in mucin-associated glycan epitopes, and did not investigate mucins and associated glycan epitopes as combinatorial panels of biomarkers for stratification of polyp sub-types. Considering the complexity associated with morphological distinction of various polyp sub-types and high clinical utility of their appropriate classification, in the present study, we comprehensively evaluated the potential of most abundant colonic mucins (MUC1, MUC4,

MUC17, MUC2, MUC5AC) and associated glycan epitopes (Tn/STn-MUC1, CA 19-9) for

differentiating pre-neoplastic precursor lesions of colon cancer from benign polyps. Further, we

evaluated their clinical utility as biomarkers to discriminate SSA/Ps from other polyp subtypes.

3. Results

Mucins are the most abundant component of the colon, involved in making and maintaining the

physicochemical barrier of colon. Based on our earlier findings of differential expression of 194

mucins and associated glycan epitopes during progression of colon cancer, utility to differentiate benign lesions from precancerous/cancerous lesions, their emergence as differential marker in the global studies, in present study, we comprehensively investigated the expression of transmembrane (MUC1, MUC4, MUC17), secreted (MUC2, MUC5AC) and associated glycan epitopes (Tn/STn-MUC1 and CA 19-9). The major objective was to identify combinatorial panels of mucins and associated glycan epitopes that can efficiently discriminate SSA/Ps from other polyp subtypes.

3.A Expression of mucins and associated glycan expressions in colorectal polyps

An overlap in the expression of transmembrane (MUC1, MUC4, MUC17), secretory mucins

(MUC2, and MUC5AC) and glycan epitopes (CA 19-9 and Tn/STn-MUC1) was observed in different colorectal polyp subtypes when compared to adjacent normal colon crypts (ANCC).

Expression of MUC1, MUC5AC, Tn/STn-MUC1, and CA 19-9 were significantly upregulated in all polyp subtypes compared to lesion adjacent normal colon crypts (Figure 6.1A, Table 6.1).

Expression of MUC17 was significantly high in HP and SSA/Ps with non-significant alterations in TA compared to ANCC (Figure 6.1A, Table 6.1). MUC4 was significantly downregulated in

SSA/Ps, with non-significant alterations in HP and TA (Figure 6.1A, Table 6.1), while MUC2 was significantly downregulated in both SSA/Ps and TA with non-significant alterations compared to ANCC (Table 6.1). Difference is localization patterns for expression of different mucins and associated glycan epitopes in ANCC and different polyp groups has been tabulated

(Supplementary table 6.1).

3.B Association of mucins and associated glycan epitopes expression in colorectal polyps with clinicopathological features

As summarized in (Table 6.2) expression of mucins and associated glycan epitopes were independent of age, gender, family history of colon cancer, and polyp size of the patient. In polyps of cases with Caucasian ethnicity significant increase in expression of MUC5AC 195

(p=0.027) and CA 19-9 (p=0.021) were observed in comparison to any others ethnicity. MUC4

was the only mucin whose expression altered significantly as per the polyp site (p=0.037),

tobacco consumption (p=0.021), and diagnosis of ≥2 precancerous polyps (p=0.013). Expression of MUC4 was high in polyps resected from descending colon compared to all other sites, in patients who used tobacco compared to non-tobacco users and low in cases with diagnosis of ≥2 precancerous polyps compared to <2 precancerous polyps. Interestingly, expression of MUC1 was significantly higher in cases with ≥2 polyps. MUC2 levels were significantly high (p=0.024) in polyps of cases who had undergone ≥2 prior or subsequent colonoscopies.

3.C Differential expression of mucins and associated glycan epitopes among colorectal polyp subtypes

Looking at aberrant expression of mucins and associated glycan epitopes in different colorectal polyps, we next investigated whether mucins and associated glycan epitopes are differentially expressed between benign (HP) and pre-cancerous lesions of colon (SSA/Ps, TA).

SSA/Ps and HP: SSA/Ps had reduced expression of MUC4 (p=0.0066) and elevated expression of MUC17 (p=0.0002), and MUC5AC (p<0.0001) in comparison to HP (Figure 6.1B panel g,h, j,k, p,q; Table 6.1). Interestingly in SSA/Ps, intense reactivity of MUC4 was restricted to 10% of cases in comparison to 45% of HP cases. While moderate to intense reactivity of MUC17, MUC5AC was observed in 33% and 62% of SSA/P cases, respectively, compared to only 6% and 15% of HP cases respectively. Notably, in conjunction with quantitative expressional changes stark differences were also observed in MUC5AC expression pattern within the colon crypts among the study groups. Qualitatively, expression of MUC5AC was absent in normal colon. Among HP cases, it was limited to goblet cells in 61% cases, and both goblet and cytoplasmic compartments in 39% cases. Interestingly, in SSA/Ps cases goblet cell only expression of MUC5AC was limited to only 11% cases while in significantly high number of cases (89%, p<0.0001) aberrantly increased MUC5AC expression was observed in 196

both goblet and cytoplasmic compartments (Figure 6.1C, panel a-d). With regard to MUC4

expression, in normal colon MUC4 was localized in cytoplasmic compartments throughout the

crypts. However it was absent from luminal surface epithelium. In HP and TAs, expression of

MUC4 was observed throughout the crypt along with luminal surface epithelium. Interestingly in

approximately 30% SSA/P cases, MUC4 expression was limited to lower one third of the crypts

only, while in rest 70% cases, qualitative expression pattern was similar to HP and TA (Figure

6.1C, panel e-h).

SSA/P vs. TA: TA had elevated expression of MUC1 (p=0.0005), and downregulation of

MUC17 (p=0.0054), MUC2 (p=0.02), MUC5AC (p<0.0001) and CA 19-9 (p<0.0001) as compared to SSA/Ps (Figure 6.1B-e,f; k,l; n,o; q,r; w,x; Table 6.1). TA had moderate to intense reactivity of MUC1 in 47% of cases compared to 13% of SSA/Ps cases. Further, moderate to intense reactivity of MUC17, MUC2, MUC5AC, CA 19-9 was observed in 33%, 100%, 62%,

82% of SSA/P cases respectively compared to 11%, 58%, 8%, none respectively in TA cases.

TA vs. HP: HP had elevated expression of MUC2 (p=0.0018), MUC5AC (p<0.0001) and CA 19-9 (p<0.0001) compared to TA (Figure 6.1B-m, o; p, r; v, x; Table 6.1). Intense to moderate immunoreactivity of MUC2 was observed in 94% of HP cases, compared to 58% of TA polyps. MUC5AC was expressed in all the HP cases, while its incidence was limited to 43% in

TA. Further, 67% of HP cases had moderate to intense CA 19-9 reactivity, compared to none in

TA.

3.D Mucins and associated glycan epitopes: potential molecular marker(s) for differentiating colon polyps

Considering the significant differences in the level and localization of multiple mucins and associated glycan epitopes, we next evaluated their statistical power to discriminate polyp- subtypes alone or in combination. The univariate logistic regression analysis with receiver- 197

operator characteristics (ROC) curves was utilized to investigate discrimination of polyp sub-

types.

SSA/Ps vs. HP: MUC4, MUC17 and MUC5AC differentiated SSA/P polyps from HP with the sensitivity and specificity (SN/SP) of 61.5%/70%, 67%/91% and 77%/73% respectively (Figure

6.2A, Table 6.3). SSA/P vs. TA: MUC1, MUC17, MUC2, MUC5AC, Tn/STn-MUC1 and CA

19-9 differentiated SSA/P from TA with the sensitivity and specificity (SN/SP) of 74.4%/72.2%,

67%/78%, 72%/58.3%, 92.3%/81%, 79.5%/44.4% and 87.2%/100% respectively (Table 6.3). TA

vs. HP: MUC4, MUC2, MUC5AC, Tn/STn-MUC1 and CA 19-9 differentiated TA from HP with

the SN/SP of 78%/54.5%, 50%/91%, 78%/70%, 44.4%/91%, 89%/82% respectively (Table 6.3).

3.E Combinatorial panels of mucins and associated glycan epitopes for differentiating

colorectal polyp sub-types:

Next, we evaluated the combined utility of significantly altered mucins for differential

identification of polyp subtypes. For this multivariate regression models were created, using the

most promising markers from the univariate logistic regression analysis, in conjunction with ROC

curve based analysis.

SSA/P vs. HP: The combination of MUC17/MUC5AC effectively discriminated SSA/P from HP

with SN/SP of 85%/82% (Figure 6.3A, Table 6.4). The optimal cut point derived from the model

[P(SSA/P) =≥0.49] suggest that, if the predicted probability from the combined

MUC17/MUC5AC model is ≥0.49 then the model predicts SSA/P, and if it is <0.49 then model

predicts HP. SSA/P vs. TA: The combination of MUC1/MUC17/CA 19-9 effectively

discriminated SSA/P from TA with SN/SP of 92.3%/97.2% (Figure 6.3B, Table 6.4). Further,

optimal cutpoint [P(SSA/P) ≥0.385] suggests that if the predicted probability from the combined

MUC1/MUC17/CA 19-9 model is ≥0.385 then the model predicts SSA/P and if it is <0.385 then

model predicts TA. TA vs. HP: Multivariate logistic regression analysis demonstrated that CA

19-9 can effectively discriminate TA from HP at optimal cutpoint obtained as a probability of the 198

logistic model of ≤0.3 with SN/SP of 89%/82% (Figure 6.3C, Table 6.4). Overall, if CA19-9 is

≤0.3 then the model predicts TA, and if CA19-9 is >0.3 then model predicts HP.

3.F MUC5AC, MUC17 and CA19.9: a unique biomarker combination for differentiating polyp subtypes: Next, we evaluated clinical utility of the significant markers obtained from multivariate logistic regression results utilizing the tree based modeling to predict the diagnostic group (HP, SSA/P, or TA). The combined utility of three markers (CA 19-9, MUC17 and

MUC5AC in order of preference) was highlighted for differential diagnosis of precancerous polyps (SSA/P and TA) from benign polyp (HP) (Figure 6.3D). As per model, if observed CA19-

9 levels are <0.525, the polyp under observation is predicted to be TA. If CA19-9 histological score is ≥0.525 then the next marker considered is MUC17. If MUC17 is ≥0.75, there are higher chances of SSA/P. However, if MUC17 is <0.75, then next marker considered is MUC5AC. If levels of MUC5AC is ≥1.05, then SSA/P is predicted and if MUC5AC <1.05, then HP is predicted. Overall, the tree based model predicts HP, SSA/P and TA with SN/SP of 58%/95%,

79%/90% and 97%/83% respectively.

Overall, we demonstrated the utility of combinatorial panels of differentially expressed mucins and associated glycan epitopes for effective discrimination of colorectal polyp subtypes.

4. Discussion

A substantial increase in colonoscopy interval CRCs in recent times disputed its effectiveness in the surveillance of colon cancer [25]. Interestingly, the culprit precursor lesions for the interval cancers were hypothesized to be SSA/P’s. Despite the increasing recognition that serrated polyps are significantly associated with CRC [10], the diagnostic criteria for serrated polyps at the morphological, histopathological, and molecular levels remains enigmatic. This confusion and inconsistency translates in misdiagnoses of serrated lesions due to interobserver variability and ultimately inappropriate follow-up care and therapy. In this context, different investigations have aimed at determining mucin gene expression levels in different colorectal polyp subtypes. 199

Unfortunately, most of these studies were either limited to one or few mucins, did not consider

modifications of associated glycan epitopes, focused only to detect expression levels without

emphasizing diagnostic utility, and did not combine mucins and glycan epitopes as a panel of

markers. Looking at utility of mucins and associated glycan epitopes as biomarkers to

discriminate benign polyps from premalignant and malignant lesions [21], this study for the first

time comprehensively investigated expression of all the major mucins and associated glycan

epitopes significantly altered during colon carcinogenesis, for discriminating SSA/Ps from HP

and TA.

Previous studies have highlighted that MUC1 is either absent or is weakly expressed in

normal colonic mucosa [26, 27]. Focal to mild reactivity in HP and its inability to discriminate

them from SSA/Ps has previously been described [26, 28-30]. In contrast, increased MUC1

positivity has been reported in conventional adenomas [26]. Consistent with these studies, we

observed focal to mild immunoreactivity of MUC1 in serrated polyps and significantly higher

expression in TA. Looking at focal to mild MUC1 expression in serrated polyps and a previous

report demonstrating MUC1 expression to be independent of microsatellite status [31], it can be

suggested that MUC1 may not be a prominent player in the serrated pathway of neoplasia.

However, its higher levels in TA’s along with reports of its highest values in colorectal

adenocarcinomas [27], and association with invasion risk [30] argue in favor of the potential

applicability of MUC1 expression as a predictor of malignant transformation in the adenoma-

carcinoma sequence.

Congruent to previous studies [26], MUC4 appeared to be a prominent mucin gene expressed in normal colon as evidenced by its expression in polyp adjacent normal colon crypts.

Loss of MUC4 in CRC cases has previously been demonstrated [21, 32]. Interestingly, we

observed a significant loss of MUC4 in SSA/Ps compared to HP, suggesting that loss of MUC4

might play an important role during serrated pathway of neoplasia. Significant utility of MUC4 as 200

an independent predictor of precancerous lesions (SSA/P and TA) versus benign lesions (HP) was

also revealed in this study. However, MUC4 did not appear as a significant contributor among

combinatorial panels of biomarkers to discriminate different polyp subtypes. Further, MUC4 was

the only mucin whose expression was significantly altered as per the site of the polyp suggesting

the role of microenvironment in regulation of this mucin. Interestingly, in our analysis, we also

found that MUC4 expression was significantly high in polyps of the patients who consumed

tobacco. Long-term cigarette smoking is associated with colorectal polyps and increased risk of

colorectal cancer mortality in both men and women [33, 34]. Recently it has been reported that

smoke exposure increased Muc4 expression in the distal colon of mice [35]. Cigarette smoke

mediated upregulation of MUC4 has also been reported previously from our lab [36]. Presence of

MUC4 confers worse prognosis to early stage colorectal cancer patients [32, 37] therefore, in future it would be interesting to investigate role of cigarette smoke mediated upregulation of

MUC4 during colorectal cancer progression.

MUC17 is significantly upregulated in colon adenocarcinoma cases compared to colon inflammation cases [21]. In this study, we not only conducted comprehensive analysis of MUC17 expression in different colorectal subtypes, but also observed its exceptional utility as a biomarker to discriminate SSA/Ps from HP and TA. MUC17 has previously been shown to be a top differentially expressed gene in SSA/P tissue versus TA [38]. RNA-seq analysis has also shown an 82-fold increase in MUC17 in SSA/Ps compared to adenomatous polyps, uninvolved and normal colon samples [22]. Interestingly, none of these studies considered hyperplastic polyps to compare differential expression of genes in SSA/Ps, thus limiting the overall interpretations in terms of molecular characterization of SSA/Ps for their efficient diagnosis. We observed significant upregulation of MUC17 expression in HP and SSA/Ps compared to adjacent normal colon crypts. MUC17 was also significantly overexpressed in SSA/Ps in comparison to both HP and TA cases, and it turned out to be a significant independent predictor of SSA/P versus HP and 201

TA with high specificity. Further, in multivariate models, the combination of MUC17 and

MUC5AC exceptionally improved the diagnostic accuracy of SSA/Ps versus HP with 85% sensitivity and 82% specificity. Furthermore, MUC17 was a significant contributor to the combinatorial panel of diagnostic markers that discriminate SSA/P from TA. It has been

demonstrated that hypomethylation near the transcriptional start site contributes

to MUC17 expression in LS-174 colon cancer cells [39]. Therefore, we hypothesize that hypomethylation of MUC17 may contribute to its increased expression in SSA/Ps and

identification of MUC17 hypomethylation in future may be a useful approach to identify serrated

neoplasia pathway-related precursor lesions. Due to the paucity of information regarding the association of MUC17 with BRAF mutation, CIMP, MSI and MSI-H colon carcinomas, additional studies addressing these aspects would help establish MUC17 as a marker of neo-

transformation through the serrated neoplasia pathway.

Numerous different studies have previously reported MUC5AC expression in normal colon, hyperplastic polyps, sessile serrated adenomas, traditional serrated adenomas, mixed polyps and all the subtypes of adenomatous polyps. Unfortunately, none of these studies could establish the diagnostic utility of MUC5AC for differentiating between polyps [26, 27, 40-42].

Conceptually, high positivity of MUC5AC represents an early gain of gastric differentiation in

SSA/Ps and is significantly associated with MSI-H CRCs sporadic tumors (P<0.001) [43].

Consistent with these studies, we also observed significant alterations in the expression of

MUC5AC in HP, SSA/Ps, and TA when compared to the adjacent normal colon. Further,

significant overexpression of MUC5AC was observed in SSA/Ps when compared to HP and TA.

Increased expression of MUC5AC in SSA/Ps has recently been attributed to MUC5AC

hypomethylation. MUC5AC hypomethylation is specifically associated with serrated lesions with

BRAF mutation, CIMP-H or MSI [24]. Therefore, increased expression of MUC5AC in SSA/P

may be reflective of neoplastic biological process. Additionally, our univariate analysis revealed 202

that higher expression of MUC5AC significantly discriminates SSA/P from HP, HP from TA and

SSA/P from TA. Further, combination of MUC5AC and MUC17 discriminates SSA/P from HP

with AUC=0.865 and sensitivity and specificity of 86%/82%. Interestingly, MUC5AC was the

only marker which could significantly differentiate SSA/Ps from HP and TA on basis of its

localization pattern. Given these results, IHC for these markers may be helpful to pathologists for

effective discrimination of SSA/Ps from benign HP. Further studies characterizing role of

MUC5AC during the serrated pathway of colon cancer progression would be helpful in

cementing its utility as a predictive marker of neoplastic transformation.

CA 19-9 is a monosialosyl Lewis (a) blood group antigen that has been shown to be

differentially expressed during adenoma-carcinoma sequence [21]. The importance of CA 19-9

serum levels at the beginning of malignant alterations for monitoring colorectal tumors has been

underscored [44] and its diagnostic utility to discriminate premalignant lesions from cancer has

previously been reported [45]. To our knowledge, none of the previous studies considered

evaluation of CA 19-9 in SSA/Ps and attempted an assessment of its diagnostic efficacy to

discriminate colorectal polyps in combination with other mucins. Our study clearly demonstrated

that CA 19-9 expression is significantly increased in all colorectal polyp subtypes. Interestingly,

comparisons between polyp subtypes revealed its highest levels in SSA/Ps, and significant

reduction in TA when compared to HP and SSA/Ps. Diagnostic utility of CA 19-9 was evident

from the fact that CA 19-9 in combination with MUC1 and MUC17 predicts SSA/P from TA

with very high sensitivity and specificity (92.3%/97.2%). Our assessment from multivariate

models was further corroborated in decision tree model where CA 19-9 proved to be a very

effective marker to clearly discriminate adenomatous lesions from serrated polyps at the very first

step.

Looking at the promising results of this study, future studies would focus on further validation of the combinatorial panels from this study in a larger set of colorectal polyp subtypes 203

and to discriminate micro vesicular HP from SSA/Ps, colorectal polyp subtypes with varying

degree of dysplasia, anatomical location, and recurrence after prior polypectomy. Findings from

these studies could help circumvent the current challenges with histopathological classification

and nomenclature of colon polyps that are ambiguous, lack consensus and demonstrate high interobserver variability.

Recent study on Stool DNA tests offered some promise in the detection of SSA/Ps [46].

Stool methylated maker mBMP3 was noted to have high discriminative power for detection of

SSA/P ≥ 1 cm with significantly greater specificity than fecal immunochemical test (FIT) [46].

Incorporating colorectal adenoma specific combinatory mucin and mucin associated glycan

epitopes to current sensitive and specific stool DNA tests could add incremental value in the

detection of precancerous polyps and CRC.

Cancer associated posttranslational modifications frequently produces aberrant O-linked truncated glycoproteins. These Aberrant O-linked glycoproteins in combination with protein

backbone induce autoantibodies due to lack of tolerance [47]. One recent study reported cancer-

associated autoantibodies to a set of aberrant glycopeptide derived from mucin MUC1 and MUC4

in serum of patients with CRC [47]. Therefore, future research efforts should also focus attention on identification of CRC specific glycan epitopes on differentially expressed mucins (MUC1,

MUC2, MUC4, MUC5AC and MUC17). This information can be utilized for developing CRC specific glycopeptide microarrays for seromic profiling of patients with colon polyps with an objective to identify polyps with malignant potential.

Efforts should continue to further elucidate the currently unexplored roles of mucins

MUC4, MUC17 and MUC5AC in pathogenesis of CRC via different pathways, along with their association with various genetic and epigenetic mutations in CRC. This will firmly establish their utility for assessment of malignant potential of polyps. In addition, investigation of molecular mechanisms associated with upregulation of mucins like MUC17 and MUC5AC in SSA/Ps, may 204

further help in devising novel diagnostic markers, and therapies targeting these precancerous lesions.

Overall, this study is the first critical step addressing the “gray zone” in differentiating SSA/Ps from other polyp subtypes due to shared morphologic features (leading to the inter-observer variability among pathologists), and current non-availability of specific and sensitive markers.

The efficient discrimination of different colorectal polyp subtypes utilizing the combinatorial panel of molecular markers CA 19-9/MUC17/MUC5AC, in conjunction with currently available tests and colonoscopy, may aid clinicians for devising the personalized colon cancer screening recommendations.

205

Figure 6.1: Immunohistochemical expression of mucins and associated glycan epitopes in colorectal polyps: (A) Venn diagram showing considerable overlaps in expression of mucins and associated glycan epitopes in HP, SSA/P and TA when compared to adjacent normal colon crypts

(ANCC). Markers in red were upregulated while markers in green were downregulated in

comparison to ANCC. (B) HP, SSA/P and TA tissue specimens were probed with MUC1

(HMFG2), MUC4 (8G7), MUC17 (SN-1132), MUC2 (EPR6145), MUC5AC (45M1), CA 19-9

(NS 19.9), and Tn/STn-MUC1 (5E5) antibodies after non-specific blocking with horse serum. All

the tissue sections were examined under microscope, and the expression was evaluated on the

basis of reddish brown staining by a pathologist. Representative photomicrographs (20X) of

Hematoxylin & Eosin staining (a-c) and for MUC1 (d-f), MUC4 (g-i), MUC17 (j-l), MUC2 (m-

o) and MUC5AC (p-r), Tn/STn-MUC1 (s-u), and CA 19-9 (v-x), stained tissues of HP, SSA/Ps

and TA were taken. MUC1 expression was significantly high (p=0.0005) in TA (f) in comparison

to HP (d) and SSA/P (e). Strong expression of MUC4 was observed in adjacent normal colon

crypts. Compared to HP (g), MUC4 expression was significantly reduced (p=0.0066) in SSA/P

(h). Significantly high immunoreactivity of MUC17 was observed in SSA/P lesions (k) compared to HP (j) and TA (l). Compared to HP (m) and SSA/P (n), MUC2 expression was significantly reduced in TA (o) (p=0.0018, 0.020 respectively). MUC5AC expression is significantly high in

HP (p) and SSA/P (q) compared to TA (r) (p<0.0001). HP (s), SSA/P (t), and TA (u) expressed

Tn/STn-MUC1 at similar levels. CA 19-9 expression was significantly high in HP (v) (p<0.0001) and SSA/P (w) (p<0.0001) compared to TA (x). (C) Localization pattern of MUC5AC expression revealed its absence in normal colon crypts, goblet cell (GC) specific expression in HP, goblet cell and cytoplasmic pattern (CP) in SSA/Ps and goblet cell specific in TA. MUC4 expression in normal colon was throughout the colon crypts (CC) excluding luminal surface epithelium (LE).

HP revealed MUC4 expression throughout CC including LE. In 30% SSA/P cases MUC4 206

expression was limited to lower one third of CC and in TA, MUC4 expressed throughout CC including LE. 207

Figure 6.1

A B HP SSA/P

MUC17 MUC4 MUC1 MUC5AC Tn/STn-MUC1 CA 19-9 MUC2

ANCC

TA

C

NORMAL HP SSA/P TA

CP CP

MUC5AC GC GC a b GC c d LE LE LE

CC CC CC MUC4 CC e f g h

208

Figure 6.2: Diagnostic performances of mucins and associated glycan epitopes from univariate models for discriminating colorectal polyp subtypes: ROC curves comparing different mucins and associated glycan epitopes for differentiating (A) SSA/P from HP, (B)

SSA/P from TA and (C) TA from HP. MUC1, MUC17, MUC2, MUC5AC, Tn/STn-MUC1, and

CA 19-9 were the significant predictors of SSA/P from TA. MUC4, MUC17, and MUC5AC were the significant predictors of SSA/P from HP. MUC4, MUC2, MUC5AC, Tn/STn-MUC1, and

CA 19-9 were the significant predictors of TA from HP. 209

Figure 6.2

A B C

210

Figure 6.3: Diagnostic performances of mucins and associated glycan epitopes in

combination for discriminating colorectal polyp subtypes: ROC curves representing

diagnostic potential of mucins and associated glycan epitopes combinatorial panels for

differentiating (A) SSA/P from HP, (B) SSA/P from TA and (C) TA from HP.

MUC17/MUC5AC combination (AUC=0.87) was the significant predictor of SSA/P from HP

(A). MUC1/MUC17/CA 19-9 (AUC= 0.99) combination efficiently predicts SSA/P from TA. CA

19-9 (AUC 0.89) itself improves diagnosis of TA from HP. (D) Tree based model highlighted CA

19-9/MUC17/MUC5AC combinatorial panel of markers for effective diagnosis of disease group

(HP, SSA/P and TA). 211

Figure 6.3 A B

C D

212

Table 6.1: Expression of mucins and associated glycans (H-Scores) in different colorectal polyp subtypes and corresponding adjacent normal colon

ANCC-H HP ANCC-S SSA/P ANCC-T TA

Mean ± SE 0.25±0.07 e 0.76 ± 0.09 b 0.09±0.02 l 0.53 ± 0.09 c,h 0.28±0.05 i 1.02 ± 0.09 c,k MUC1 Median (Min, Max) 0.1(0,1.4) 0.6(0.1, 2.1) 0.05(0, 0.3) 0.4(0.05, 2.4) 0.2(0, 1) 1(0.1, 2.4)

Mean ± SE 1.87±0.11 1.66 ± 0.12 k 1.63±0.15 l 1.05 ± 0.12 c,e 1.25±0.12 1.21 ± 0.12 MUC4 2.1(0.2, Median (Min, Max) 1.8(0.3, 2.7) 1.8(0.1, 2.4) 1(0.05, 2.7) 1.2(0.05, 2.4) 1.3(0.1, 2.4) 2.55) Mean ± SE 0.11±0.03 f 0.37 ± 0.05 c,l 0.06±0.02 l 0.85 ± 0.08 c,f,g 0.24±0.05 0.47 ± 0.07 j MUC17 Median (Min, Max) 0.05(0, 0.7) 0.2(0.05, 1.2) 0(0, 0.3) 1(0.05, 2.1) 0.1(0, 1.2) 0.4(0, 1.4)

Mean ± SE 2.31±0.09 2.09 ± 0.09 h 2.26±0.09 k 1.92 ± 0.08 b,g 2.21±0.06 i 1.35 ± 0.14 c,e,j MUC2 2.4(1.2, Median (Min, Max) 2.4(0.75, 2.7) 2.4(0.9, 2.7) 1.8(1.2, 2.7) 2.4(1, 2.7) 1.3(0.1, 2.7) 2.7) Mean ± SE 0±0 f 0.65 ± 0.08 c,l,i 0±0 l 1.24 ± 0.09 c,f,i 0.03±0.02 i 0.3 ± 0.08 c,f,l MUC5AC Median (Min, Max) 0(0, 0) 0.6(0.15, 2.1) 0(0, 0) 1.2(0.15, 2.4) 0(0, 0.6) 0.06(0, 2.1)

Mean ± SE 0.23±0.05 f 1.42 ± 0.07 c 0.17±0.05 l 1.39 ± 0.08 c 0.39±0.05 i 1.13 ± 0.1 c Tn/STn- MUC1 Median (Min, Max) 0.1(0, 0.8) 1.4(0.6, 2.7) 0(0, 0.8) 1.4(0.3, 2.4) 0.3(0, 1.6) 1.2(0, 2.4)

Mean ± SE 0.1±0.05 f 1.53 ± 0.17 c,i 0.04±0.02 l 1.72 ± 0.13 c,i 0.02±0.01 i 0.1 ± 0.03 c,f,l CA 19-9 Median (Min, Max) 0(0, 1.2) 1.8(0, 2.7) 0(0, 0.4) 2.1(0, 2.7) 0(0, 0.3) 0(0, 0.6) ap<0.05 vs. adjacent normal; bp<0.005 vs. adjacent normal; cp<0.0005 vs. adjacent normal; dp<0.05 vs. HP; ep<0.005 vs. HP; fp<0.0005 vs. HP; gp<0.05 vs. TA; hp<0.005 vs. TA; ip<0.0005 vs. TA; jp<0.05 vs. SSA/P; kp<0.005 vs. SSA/P; lp<0.0005 vs. SSA/P Abbreviations: ANCC-H, Adjacent normal colon crypts to hyperplastic lesion; ANCC-S, Adjacent normal colon crypts to sessile serrated adenoma; ANCC-T, Adjacent normal colon crypts to tubular adenoma; HP, Hyperplastic polyps; SSA/P, Sessile serrated adenoma/polyp; TA, Tubular adenoma; SE, Standard error; Min, Minimum; Max, Maximum

213

Table 6.2: Association of mucins and associated glycans expression with clinicopathological characteristics

Tn/STn- MUC1 MUC4 MUC17 MUC2 MUC5AC CA 19-9 MUC1 N Mean ± Mean ± Mean ± Mean ± Mean ± Mean ± Mean ± SE SE SE SE SE SE SE 0.77 ± 1.31 ± 1.71 ± 0.88 ± 1.21 ± < 60 years 47 0.5 ± 0.07 1.34 ± 0.07 0.09 0.11 0.11 0.09 0.15 Age 0.72 ± 1.27 ± 0.64± 0.68 ± 0.98 ± >=60 years 50 1.2 ± 0.07 0.08 0.11 0.06 1.8 ± 0.1 0.09 0.14 p-value 0.76 0.79 0.093 0.54 0.1 0.25 0.37 0.74 ± 0.57 ± 0.71 ± 1.12 ± Female 57 1.29 ± 0.1 1.28 ± 0.06 0.07 0.06 1.7 ± 0.1 0.08 0.14 Gender 1.29 ± 0.58 ± 1.84 ± 0.87 ± 1.04 ± Male 40 0.75 ± 0.1 1.25 ± 0.09 0.12 0.08 0.12 0.11 0.15 p-value 0.67 0.96 0.68 0.25 0.32 0.41 0.61 0.73 ± 1.31 ± 0.56 ± 1.73 ± 0.83 ± 1.18 ± Caucasian 74 1.22 ± 0.06 0.06 0.09 0.05 0.09 0.08 0.12 Ethnicity 0.87 ± 0.48 ± 1.85 ± 0.45 ± Other 13 1.31 ± .21 0.4 ± 0.12 1.45 ± 0.15 0.18 0.12 0.17 0.21 p-value 0.51 0.95 0.58 0.79 0.027 0.021 0.15 0.75 ± 1.19 ± Cecum 8 0.65 ± 0.1 1.03 ± .14 0.75 ± 0.1 1.15 ± 0.1 1.6 ± 0.16 0.15 0.24 0.73 ± 0.56 ± 1.96 ± 0.93 ± 1.01 ± Ascending 22 1.28 ± .22 1.28 ± 0.15 0.12 0.19 0.12 0.24 0.28 1.11 ± 0.55 ± 1.43 ± 0.54 ± 0.84 ± Transverse 13 0.5 ± 0.15 1.05 ± 0.14 0.27 0.16 0.32 0.25 0.36 Polyp site 0.68 ± 1.73 ± 1.57 ± 0.59 ± 0.95 ± Descending 12 0.55 ± 0.1 1.35 ± 0.13 0.17 0.19 0.19 0.09 0.21 0.74 ± 1.42 ± 0.43 ± 1.98 ± 0.79 ± 1.17 ± Sigmoid 21 1.3 ± 0.11 0.12 0.16 0.09 0.15 0.11 0.22 1.02 ± 0.59 ± 1.88 ± 1.06 ± 1.03 ± Rectum 19 0.93 ± 0.2 1.39 ± 0.13 0.15 0.11 0.19 0.24 0.28 p-value 0.16 0.037 0.33 0.33 0.47 0.93 0.42 0.77 ± 1.27 ± 0.56 ± 1.72 ± 0.77 ± 0.97 ± no 74 1.28 ± 0.06 0.07 0.09 0.05 0.09 0.08 0.11 FH of colon cancer 0.62 ± 1.38 ± 1.92 ± 0.76 ± 1.44 ± yes 17 0.49 ± 0.1 1.13 ± 0.1 0.09 0.14 0.11 0.18 0.25 p-value 0.58 0.66 0.64 0.65 0.9 0.064 0.15 214

0.63 ± 1.02 ± 0.51 ± 1.65 ± 0.89 ± no 29 1.1 ± 0.18 1.28 ± 0.1 0.09 0.13 0.07 0.15 0.14 Tobacco 0.79 ± 0.56 ± 1.02 ± yes 63 1.43 ± 0.1 0.7 ± 0.08 1.24 ± 0.06 0.08 0.06 1.8 ± 0.09 0.13 p-value 0.3 0.021 0.78 0.52 0.27 0.51 0.84 0.53 ± 1.78 ± 0.72 ± 0.98 ± <0.05 cm3 66 0.7 ± 0.07 1.3 ± 0.09 1.25 ± 0.07 0.06 0.08 0.08 0.12 Polyp size 3 0.83 ± 1.31 ± 0.68 ± 1.75 ± 0.98 ± 1.29 ± >=0.05 cm 24 1.32 ± 0.08 0.14 0.16 0.09 0.17 0.13 0.21 p-value 0.51 0.9 0.11 0.84 0.087 0.17 0.27 0.58 ± 0.62 ± 1.91 ± 0.97 ± 1.28 ± <2 21 1.3 ± 0.17 1.33 ± 0.13 0.14 0.11 0.12 0.17 0.22 Number of polyps 0.79 ± 0.57 ± 1.71 ± 0.72 ± 1.02 ± >=2 75 1.29 ±0.09 1.25 ± 0.06 0.06 0.05 0.09 0.07 0.12 p-value 0.034 0.99 0.76 0.44 0.2 0.35 0.41 0.73 ± 1.62 ± 1.82 ± 0.69 ± 1.36 ± <2 23 0.5 ± 0.1 1.43 ± 0.1 0.08 0.18 0.13 0.11 0.21 Number of precancerous 0.81 ± 1.05 ± 0.65 ± 1.58 ± 0.89 ± polyps >=2 49 0.76 ± 0.1 1.23 ± 0.07 0.08 0.11 0.07 0.12 0.14 p-value 0.85 0.013 0.14 0.31 0.88 0.077 0.18 1.05 ± 1.48 ± 0.99 ± <2 45 0.7 ± 0.08 0.6 ± 0.08 0.71 ± 0.1 1.19 ± 0.07 0.13 0.11 0.15 Prior or subsequent 0.69 ± 1.25 ± 1.91 ± 0.84 ± colonoscopies with polyps >=2 21 0.6 ± 0.1 0.95 ± 0.2 1.35 ± 0.11 0.11 0.14 0.14 0.15 p-value 0.94 0.31 0.78 0.024 0.48 0.83 0.25 Abbreviations: FH, Family history; SE, Standard error

215

Table 6.3: Univariate logistic regression and ROC curve analysis for mucins and associated glycans as biomarkers to discriminate different colorectal polyps

Marker Diagnosis OR (95% CI) p-value AUC (95% CI) Cutpoint Sensitivity Specificity

SSA/P vs. 0.411 (0.156, 1.084) 0.072 0.6772 (0.5531, 0.8012) <=0.30 0.487 0.848 HP MUC1 TA vs. HP 2.626 (0.987, 6.983) 0.053 0.6515 (0.5201, 0.7830) >=1.0 0.583 0.727 SSA/P vs. 0.188 (0.069, 0.509) 0.001 0.7639 (0.6545, 0.8733) <=0.60 0.744 0.722 TA SSA/P vs. 0.324 (0.160, 0.657) 0.0018 0.7257 (0.6089, 0.8425) <=1.2 0.615 0.697 HP MUC4 TA vs. HP 0.417 (0.206, 0.842) 0.015 0.6692 (0.5422, 0.7962) <=1.6 0.778 0.545 SSA/P vs. 0.745 (0.395, 1.405) 0.36 0.5630 (0.4319, 0.6942) <=1.2 0.615 0.5 TA SSA/P vs. 14.376 (3.664, 56.41) 0.0001 0.7739 (0.6623, 0.8855) >=0.8 0.667 0.909 HP MUC17 TA vs. HP 2.292 (0.588, 8.929) 0.23 0.5560 (0.4174, 0.6946) >=0.4 0.611 0.606 SSA/P vs. 5.990 (1.955, 18.346) 0.0017 0.7222 (0.6047, 0.8397) >=0.80 0.667 0.778 TA SSA/P vs. 0.530 (0.210, 1.337) 0.18 0.5960 (0.4640, 0.7279) <=1.8 0.513 0.727 HP MUC2 TA vs. HP 0.244 (0.111, 0.535) 0.0004 0.7546 (0.6421, 0.8672) <=1.2 0.5 0.909 SSA/P vs. 3.288 (1.573, 6.873) 0.0016 0.6991 (0.5765, 0.8216) >=1.60 0.718 0.583 TA SSA/P vs. 9.112 (2.912, 28.51) 0.0001 0.7995 (0.6947, 0.9043) >=0.9 0.769 0.727 HP MUC5AC TA vs. HP 0.194 (0.057, 0.660) 0.0087 0.8018 (0.6934, 0.9101) <=0.3 0.778 0.697 SSA/P vs. 21.755 (5.985, 79.078) <0.0001 0.9081 (0.8320, 0.9842) >=0.60 0.923 0.806 TA SSA/P vs. 0.870 (0.317, 2.390) 0.79 0.5085 (0.3756, 0.6415) <=0.8 0.179 0.939 HP Tn/STn- TA vs. HP 0.294 (0.100, 0.866) 0.026 0.6620 (0.5337, 0.7904) <=1.0 0.444 0.909 MUC1 SSA/P vs. 2.472 (1.016, 6.016) 0.046 0.6353 (0.5095, 0.7611) >=1.2 0.795 0.444 TA SSA/P vs. CA 19-9 1.279 (0.746, 2.194) 0.37 0.5287 (0.3907, 0.6668) >2.1 0.333 0.606 HP 216

TA vs. HP 0.014 (<0.001, 0.214) 0.0021 0.8948 (0.8110, 0.9786) <=0.3 0.888 0.818 SP/A vs. 54.383 (6.489, 455.7) 0.0002 0.9551 (0.9095, 1.0000) >=0.80 0.872 1 TA

Abbreviations: HP, Hyperplastic polyps; SSA/P, Sessile serrated adenoma/polyp; TA, Tubular adenoma; OR, Odds ratio; AUC, Area under curve; CI, Confidence of interval

217

Table 6.4: Multivariate logistic regression and ROC curve analysis for mucins and associated glycans as biomarkers to discriminate different colorectal polyps

AUC 95% CI

Diagnosis Comparison AUC Lower Upper Threshold Sensitivity Specificity SSA/P vs. HP MUC17+MUC5AC 0.865 0.776 0.954 P(SP)>= 0.4928 0.846 0.818 TA vs. HP CA19-9 0.8948 0.811 0.9786 CA19-9<=0.3 0.888 0.818 SSA/P vs. TA MUC1+MUC17+CA19-9 0.9868 0.97 1 P(SPT)>=0.385 0.923 0.972

To calculate P (SP) uses the formula: P (SP) = 1/(1+exp[-(-2.7740 + 2.2098*MUC17+ 1.7847*MUC5AC)])

To calculate P (SPT) use the formula: P (SPT) = 1/(1+exp[-(-1.1109 -3.6250*MUC1 +2.7928*MUC17+3.6299*CA19-9)])

Abbreviations: HP, Hyperplastic polyps; SSA/P, Sessile serrated adenoma/polyp; TA, Tubular adenoma; OR, Odds ratio; AUC, Area under curve; CI, Confidence of interval 218

Supplementary Table 6.1: Localization pattern of different mucins and associated glycan

epitopes in normal colon and different colorectal polyp subtypes

Normal HP SSA/P TA

MUC1 Cytoplasmic Cytoplasmic Cytoplasmic Cytoplasmic Cytoplasmic, Cytoplasmic, Throughout the Cytoplasmic, Throughout the crypt and on Cytoplasmic, Throughout the crypt, absent on luminal surface Throughout the MUC4 crypt and present on epithelium (70% crypt and luminal luminal surface luminal surface cases), in lower one surface epithelium epithelium epithelium third of crypt (30% cases) Cytoplasmic and Cytoplasmic and Cytoplasmic and Cytoplasmic and MUC17 granular granular granular granular Goblet cells and Goblet cells and Goblet cells and MUC2 Goblet cells Cytoplasmic Cytoplasmic Cytoplasmic

Goblet cells and MUC5AC Absent Goblet cells Cytoplasmic Goblet cells

Goblet cells and Goblet cells and Goblet cells and CA 19-9 Absent Cytoplasmic Cytoplasmic Cytoplasmic

Tn/STn- Cytoplasmic and Cytoplasmic and Cytoplasmic and Cytoplasmic and MUC1 granular granular granular granular

Abbreviations: HP, Hyperplastic polyps; SSA/Ps, Sessile serrated adenoma/Polyps; TA, Tubular adenoma 219

Reference List

[1] P. Jain, S.K. Mondal, S.K. Sinha, M. Mukhopadhyay, and I. Chakraborty, Diagnostic and prognostic significance of different mucin expression, preoperative CEA, and CA-125 in colorectal carcinoma: A clinicopathological study. J. Nat. Sci. Biol. Med. 5 (2014) 404- 408.

[2] J.M. Carethers and B.H. Jung, Genetics and Genetic Biomarkers in Sporadic Colorectal Cancer. Gastroenterology 149 (2015) 1177-1190.

[3] Y. Okugawa, W.M. Grady, and A. Goel, Epigenetic Alterations in Colorectal Cancer: Emerging Biomarkers. Gastroenterology 149 (2015) 1204-1225.

[4] M. Pancione, A. Remo, and V. Colantuoni, Genetic and epigenetic events generate multiple pathways in colorectal cancer progression. Patholog. Res. Int. 2012 (2012) 509348.

[5] W.M. Grady and J.M. Carethers, Genomic and epigenetic instability in colorectal cancer pathogenesis. Gastroenterology 135 (2008) 1079-1099.

[6] S.D. Crockett, D.C. Snover, D.J. Ahnen, and J.A. Baron, Sessile serrated adenomas: an evidence-based guide to management. Clin. Gastroenterol. Hepatol. 13 (2015) 11-26.

[7] J.E. IJspeert, L. Vermeulen, G.A. Meijer, and E. Dekker, Serrated neoplasia-role in colorectal carcinogenesis and clinical implications. Nat. Rev. Gastroenterol. Hepatol. 12 (2015) 401-409.

[8] D.K. Rex, D.J. Ahnen, J.A. Baron, K.P. Batts, C.A. Burke, R.W. Burt, J.R. Goldblum, J.G. Guillem, C.J. Kahi, M.F. Kalady, M.J. O'Brien, R.D. Odze, S. Ogino, S. Parry, D.C. Snover, E.E. Torlakovic, P.E. Wise, J. Young, and J. Church, Serrated lesions of the colorectum: review and recommendations from an expert panel. Am. J. Gastroenterol. 107 (2012) 1315-1329.

[9] D.E. Aust and G.B. Baretton, Serrated polyps of the colon and rectum (hyperplastic polyps, sessile serrated adenomas, traditional serrated adenomas, and mixed polyps)- proposal for diagnostic criteria. Virchows Arch. 457 (2010) 291-297.

[10] D. Li, C. Jin, C. McCulloch, S. Kakar, B.M. Berger, T.F. Imperiale, and J.P. Terdiman, Association of large serrated polyps with synchronous advanced colorectal neoplasia. Am. J. Gastroenterol. 104 (2009) 695-702.

[11] N.S. Goldstein, Small colonic microsatellite unstable adenocarcinomas and high-grade epithelial dysplasias in sessile serrated adenoma polypectomy specimens: a study of eight cases. Am. J. Clin. Pathol. 125 (2006) 132-145.

[12] R. Lazarus, O.E. Junttila, T.J. Karttunen, and M.J. Makinen, The risk of metachronous neoplasia in patients with serrated adenoma. Am. J. Clin. Pathol. 123 (2005) 349-359. [13] Y. Oono, K. Fu, H. Nakamura, Y. Iriguchi, A. Yamamura, Y. Tomino, J. Oda, M. Mizutani, S. Takayanagi, D. Kishi, T. Shinohara, K. Yamada, J. Matumoto, and K. Imamura, Progression of a sessile serrated adenoma to an early invasive cancer within 8 months. Dig. Dis. Sci. 54 (2009) 906-909. 220

[14] S.R. Owens, S.I. Chiosea, and S.F. Kuan, Selective expression of gastric mucin MUC6 in colonic sessile serrated adenoma but not in hyperplastic polyp aids in morphological diagnosis of serrated polyps. Mod. Pathol. 21 (2008) 660-669.

[15] A.B. Farris, J. Misdraji, A. Srivastava, A. Muzikansky, V. Deshpande, G.Y. Lauwers, and M. Mino-Kenudson, Sessile serrated adenoma: challenging discrimination from other serrated colonic polyps. Am. J. Surg. Pathol. 32 (2008) 30-35.

[16] K. Glatz, B. Pritt, D. Glatz, A. Hartmann, M.J. O'Brien, and H. Blaszyk, A multinational, internet-based assessment of observer variability in the diagnosis of serrated colorectal polyps. Am. J. Clin. Pathol. 127 (2007) 938-945.

[17] D. Sandmeier, W. Seelentag, and H. Bouzourene, Serrated polyps of the colorectum: is sessile serrated adenoma distinguishable from hyperplastic polyp in a daily practice?. Virchows Arch. 450 (2007) 613-618.

[18] S.J. Winawer, A.G. Zauber, R.H. Fletcher, J.S. Stillman, M.J. O'Brien, B. Levin, R.A. Smith, D.A. Lieberman, R.W. Burt, T.R. Levin, J.H. Bond, D. Brooks, T. Byers, N. Hyman, L. Kirk, A. Thorson, C. Simmang, D. Johnson, and D.K. Rex, Guidelines for colonoscopy surveillance after polypectomy: a consensus update by the US Multi-Society Task Force on Colorectal Cancer and the American Cancer Society. Gastroenterology 130 (2006) 1872-1885.

[19] M.A. Hollingsworth and B.J. Swanson, Mucins in cancer: protection and control of the cell surface. Nat. Rev. Cancer 4 (2004) 45-60.

[20] Y.H. Sheng, S.Z. Hasnain, T.H. Florin, and M.A. McGuckin, Mucins in inflammatory bowel diseases and colorectal cancer. J. Gastroenterol. Hepatol. 27 (2012) 28-38.

[21] S.R. Krishn, S. Kaur, L.M. Smith, S.L. Johansson, M. Jain, A. Patel, S.K. Gautam, M.A. Hollingsworth, U. Mandel, H. Clausen, W.C. Lo, W.L. Fan, U. Manne, and S.K. Batra, Mucins and associated glycan signatures in colon adenoma-carcinoma sequence: Prospective pathological implication(s) for early diagnosis of colon cancer. Cancer Lett. (2016).

[22] D.A. Delker, B.M. McGettigan, P. Kanth, S. Pop, D.W. Neklason, M.P. Bronner, R.W. Burt, and C.H. Hagedorn, RNA sequencing of sessile serrated colon polyps identifies differentially expressed genes and immunohistochemical markers. PLoS. One. 9 (2014) e88367.

[23] A.N. Bartley, P.A. Thompson, J.A. Buckmeier, C.Y. Kepler, C.H. Hsu, M.S. Snyder, P. Lance, A. Bhattacharyya, and S.R. Hamilton, Expression of gastric pyloric mucin, MUC6, in colorectal serrated polyps. Mod. Pathol. 23 (2010) 169-176.

[24] F. Renaud, C. Mariette, A. Vincent, A. Wacrenier, V. Maunoury, J. Leclerc, L. Coppin, M. Crepin, S. Van, I, E. Leteurtre, and M.P. Buisine, The serrated neoplasia pathway of colorectal tumors: Identification of MUC5AC hypomethylation as an early marker of polyps with malignant potential. Int. J. Cancer2015).

221

[25] J. Adler and D.J. Robertson, Interval Colorectal Cancer After Colonoscopy: Exploring Explanations and Solutions. Am. J. Gastroenterol. 110 (2015) 1657-1664.

[26] A.E. Biemer-Huttmann, M.D. Walsh, M.A. McGuckin, Y. Ajioka, H. Watanabe, B.A. Leggett, and J.R. Jass, Immunohistochemical staining patterns of MUC1, MUC2, MUC4, and MUC5AC mucins in hyperplastic polyps, serrated adenomas, and traditional adenomas of the colorectum. J. Histochem. Cytochem. 47 (1999) 1039-1048.

[27] S. Percinel, B. Savas, A. Ensari, I. Kuzu, M.A. Kuzu, M. Bektas, H. Cetinkaya, and N. Kursun, Mucins in the colorectal neoplastic spectrum with reference to conventional and serrated adenomas. Turk. J. Gastroenterol. 18 (2007) 230-238.

[28] J.A. Gibson, H.P. Hahn, A. Shahsafaei, and R.D. Odze, MUC expression in hyperplastic and serrated colonic polyps: lack of specificity of MUC6. Am. J. Surg. Pathol. 35 (2011) 742-749.

[29] A.M. Hanby, R. Poulsom, S. Singh, J. Jankowski, D. Hopwood, G. Elia, L. Rogers, K. Patel, and N.A. Wright, Hyperplastic polyps: a cell lineage which both synthesizes and secretes trefoil-peptides and has phenotypic similarity with the ulcer-associated cell lineage. Am. J. Pathol. 142 (1993) 663-668.

[30] M. Molaei, B.K. Mansoori, R. Mashayekhi, M. Vahedi, M.A. Pourhoseingholi, S.R. Fatemi, and M.R. Zali, Mucins in neoplastic spectrum of colorectal polyps: can they provide predictions? BMC. Cancer 10 (2010) 537.

[31] A.E. Biemer-Huttmann, M.D. Walsh, M.A. McGuckin, L.A. Simms, J. Young, B.A. Leggett, and J.R. Jass, Mucin core protein expression in colorectal cancers with high levels of microsatellite instability indicates a novel pathway of morphogenesis. Clin. Cancer Res. 6 (2000) 1909-1916.

[32] C. Shanmugam, N.C. Jhala, V.R. Katkoori, W. Wan, S. Meleth, W.E. Grizzle, and U. Manne, Prognostic value of mucin 4 expression in colorectal adenocarcinomas. Cancer 116 (2010) 3577-3586.

[33] T.R. Haque, P.T. Bradshaw, and S.D. Crockett, Risk factors for serrated polyps of the colorectum. Dig. Dis. Sci. 59 (2014) 2874-2889.

[34] B. Yang, E.J. Jacobs, S.M. Gapstur, V. Stevens, and P.T. Campbell, Active smoking and mortality among colorectal cancer survivors: the Cancer Prevention Study II nutrition cohort. J. Clin. Oncol. 33 (2015) 885-893.

[35] L. Allais, F.M. Kerckhof, S. Verschuere, K.R. Bracke, S.R. De, D. Laukens, P. Van den Abbeele, V.M. De, N. Boon, G.G. Brusselle, C.A. Cuvelier, and T. Van de Wiele, Chronic cigarette smoke exposure induces microbial and inflammatory shifts and mucin changes in the murine gut. Environ. Microbiol.(2015).

[36] N. Momi, M.P. Ponnusamy, S. Kaur, S. Rachagani, S.S. Kunigal, S. Chellappan, M.M. Ouellette, and S.K. Batra, Nicotine/cigarette smoke promotes metastasis of pancreatic cancer through alpha7nAChR-mediated MUC4 upregulation. Oncogene 32 (2013) 1384- 1395.

222

[37] d.T. Khanh, E. Mekata, K. Mukaisho, H. Sugihara, T. Shimizu, H. Shiomi, S. Murata, S. Naka, H. Yamamoto, Y. Endo, and T. Tani, Transmembrane mucin MUC1 overexpression and its association with CD10(+) myeloid cells, transforming growth factor-beta1 expression, and tumor budding grade in colorectal cancer. Cancer Sci. 104 (2013) 958-964.

[38] M. Caruso, J. Moore, G.J. Goodall, M. Thomas, S. Phillis, A. Tyskin, G. Cheetham, N. Lerda, H. Takahashi, and A. Ruszkiewicz, Over-expression of cathepsin E and trefoil factor 1 in sessile serrated adenomas of the colorectum identified by gene expression analysis. Virchows Arch. 454 (2009) 291-302.

[39] S. Kitamoto, N. Yamada, S. Yokoyama, I. Houjou, M. Higashi, M. Goto, S.K. Batra, and S. Yonezawa, DNA methylation and histone H3-K9 modifications contribute to MUC17 expression. Glycobiology 21 (2011) 247-256.

[40] K. Fujita, M. Hirahashi, H. Yamamoto, T. Matsumoto, M. Gushima, Y. Oda, J. Kishimoto, T. Yao, M. Iida, and M. Tsuneyoshi, Mucin core protein expression in serrated polyps of the large intestine. Virchows Arch. 457 (2010) 443-449.

[41] T. Higuchi, K. Sugihara, and J.R. Jass, Demographic and pathological characteristics of serrated polyps of colorectum. Histopathology 47 (2005) 32-40.

[42] A. Mochizuka, T. Uehara, T. Nakamura, Y. Kobayashi, and H. Ota, Hyperplastic polyps and sessile serrated 'adenomas' of the colon and rectum display gastric pyloric differentiation. Histochem. Cell Biol. 128 (2007) 445-455.

[43] J.H. Kim, K.J. Kim, Y.Y. Rhee, J.M. Bae, N.Y. Cho, H.S. Lee, and G.H. Kang, Gastric- type expression signature in serrated pathway-associated colorectal tumors. Hum. Pathol. 46 (2015) 643-656.

[44] S. Stajic, R. Novakovic, N. Kostic, J. Josifovski, P. Simic, V. Katic, and M. Kovijanic, The importance of monitoring colorectal adenomas by tumor markers (ROC analysis). Med. Pregl. 46 Suppl 1 (1993) 69-71.

[45] E.M. Goldberg, L.M. Simunovic, S.L. Drake, W.F. Mueller, Jr., and H.L. Verrill, Comparison of serum CA 19-9 and CEA levels in a population at high risk for colorectal cancer. Hybridoma 8 (1989) 569-575.

[46] R.I. Heigh, T.C. Yab, W.R. Taylor, F.T. Hussain, T.C. Smyrk, D.W. Mahoney, M.J. Domanico, B.M. Berger, G.P. Lidgard, and D.A. Ahlquist, Detection of colorectal serrated polyps by stool DNA testing: comparison with fecal immunochemical testing for occult blood (FIT). PLoS. One. 9 (2014) e85659.

[47] J.W. Pedersen, O. Blixt, E.P. Bennett, M.A. Tarp, I. Dar, U. Mandel, S.S. Poulsen, A.E. Pedersen, S. Rasmussen, P. Jess, H. Clausen, and H.H. Wandall, Seromic profiling of colorectal cancer patients with novel glycopeptide microarray. Int. J. Cancer 128 (2011) 1860-1871.

223

Chapter VII

General Conclusions and Future Directions

1. Summary and Conclusions

2. Future Directions 224

1. Summary and Conclusions

Mucins are the high molecular weight glycoproteins expressed by various epithelial cell types to protect them from fluctuations in molecular compositions associated with harsh and complex environments under physiological and pathological conditions [1]. By playing a central role in the maintenance of homeostasis, mucins promote cell survival under diverse conditions [1]. One such

condition is cancer where dysregulation of mucins is implicated in growth, invasion, and

metastasis by configuring the inhospitable conditions of the tumor microenvironment [2]. Both

the membrane-bound and secretory mucins are differentially expressed and functionally involved

in multiple malignancies [3]. Consequently, mucins have been identified as potential diagnostic

markers and therapeutic targets in cancer [3]. Over the years, our lab has made research efforts to

comprehend the expression profile, regulation, and functional significance of mucins in

pancreatic and colorectal cancer with an objective to exploit their potential in early stage

diagnosis and therapy of these malignancies [4-8]. Previous studies have shown that secretory

mucin MUC5AC is overexpressed in pancreatic cancer (PC) [9] and colorectal cancer (CRC)

[10]. Since MUC5AC was one of the top most differentially expressed gene in PC compared with

normal pancreas [11], we explored the role of MUC5AC during PC onset and progression with an

objective to recognize MUC5AC as a therapeutic target for PC. Further, considering differential

overexpression of MUC5AC in precursor lesions of CRC [12] along with its secretory nature we

were interested in investigating whether differential expression of MUC5AC, other mucins, and

associated glycoepitopes can discriminate premalignant/malignant lesions of the colon from

benign polyps. Hence in this dissertation, we explored the MUC5AC associated functional

implications and their mechanistic basis during the initiation and progression of PC using in vitro

and in vivo models. Further, we comprehensively explored the potential utility of MUC5AC,

other differentially expressed mucins, and associated glycoepitopes to predict premalignant lesions and colorectal malignancy. Overall, to elucidate the role of MUC5AC in pancreatic and colorectal cancer the study was divided into four main parts: 1) Functional and mechanistic 225

implications of MUC5AC in PC, 2) Impact of loss of Muc5ac expression in onset and

progression of PC utilizing the KrasG12D; Pdx1-Cre; Muc5ac-/- mouse model, 3) Mucins and

associated glycan signatures in colon adenoma-carcinoma sequence: prospective pathological

implication(s) for early diagnosis of colon cancer, 4) Combinatorial assessment of CA 19-

9/MUC17/MUC5AC expression for discriminating sessile serrated adenoma/polyps and tubular

adenoma from hyperplastic polyps.

1) Functional and mechanistic implications of MUC5AC in PC

PC remains the most lethal malignancy despite continuous research efforts over the past decades

[13]. Research studies have continuously focused on identifying and validating different

molecules for the early diagnosis and treatment of PC. However, PC remains to be a devastating disease underscoring poor understanding and lack of complete knowledge about the biological and molecular processes involved in the initiation and progression of this deadly malignancy.

Therefore, to develop a more in-depth understanding of the various signaling pathways deregulated in PC, advancement of studies to elucidate roles of newer molecules is necessitated.

Mucins are universally recognized as key components that are deregulated in cancer and have been identified as biomarkers or molecular targets for the treatment of PC [3]. Interestingly, secretory mucin MUC5AC was observed to be one of the top most differentially expressed genes in PC when compared to the normal pancreas [11]. Overexpression of MUC5AC was reported to be associated with poor prognosis of PC patients [9]. Few in vitro, in vivo studies also highlighted the role of MUC5AC in pancreatic tumor growth and metastasis. However, the mechanistic basis of MUC5AC functioning remained unexplored. In light of these observations, we proposed that

MUC5AC might have a significant role in the progression of PC. We sought to characterize this

mucin in PC with an objective to contribute towards better understanding of the disease and

developing therapeutic modalities.

In this context, I could provide further experimental evidence that MUC5AC is not detected

in the normal pancreas while it is significantly overexpressed in PC. Looking at these 226

observations, I could conclude that overexpressed MUC5AC may play an important role in the

progression of PC. For further functional characterization, I identified PC cell lines that

endogenously express MUC5AC. I performed knockdown of MUC5AC in two PC cell lines

(FG/COLO357 and SW1990). My findings using these cell line models show that MUC5AC is a

critical player in facilitating PC cell proliferation, chemoresistance, migration, and angiogenesis.

Decreased expression of MUC5AC resulted in the impaired viability of PC cells, significantly

decreased anchorage-independent growth, and increased apoptosis. The impact of MUC5AC on cell proliferation was further validated by cell cycle analysis assay. My study emphasizes the novel role of MUC5AC in significantly faster progression of the cell cycle through G1/S phase.

Mechanistically, I observed increased expression of cell cycle inhibitor p27 and decreased expression of G1/S phase regulatory proteins Cyclin-D1 and Cyclin-E on knockdown of

MUC5AC.

One of the problems associated with PC is early stage metastasis to distant locations. As

MUC5AC is expressed at early stages of PC, we wanted to explore whether overexpressed

MUC5AC can impact migration and adhesive properties to extracellular matrix proteins. In my observations, significant reduction in the migratory potential of PC cells was observed on knockdown of MUC5AC. Interestingly, MUC5AC positive cells revealed a significantly higher tendency to adhere to Matrigel, advocating the role of MUC5AC in the metastatic process.

Mechanistically, I observed increased expression of epithelial marker E-Cadherin upon

MUC5AC knockdown. As a recent study highlighted the role of MUC5AC in regulating expression of integrins in lung cancer, I also investigated the impact of MUC5AC on the expression of integrins. I observed a downregulation of αV-, β5-integrin on knockdown of

MUC5AC. As β5-integrin is known to mediate its effects through Src-FAK signaling, I

investigated the impact of MUC5AC knockdown on phosphorylation of Src kinase. Interestingly,

knockdown of MUC5AC decreases phosphorylation of Src-(Y416). It has been speculated that

that MUC5AC may impact localization of E-Cadherin to cell membrane and by colocalizing with 227

E-Cadherin, MUC5AC and MUC1 may modulate E-Cadherin function. In light of these studies, I

hypothesized that MUC5AC may physically interact with E-Cadherin. Interestingly, my

immunoprecipitation experiments revealed the interaction between MUC5AC and E-Cadherin.

Moreover, I could also observe an interaction of MUC5AC with β-Catenin and Src. Looking at

these observations, I conclude that by its interactions with E-Cadherin/β-Catenin complex

MUC5AC may impact PC cell growth and metastasis. However, this conclusion warrants further

comprehensive experimental validation.

Angiogenesis is one of the most important factor associated with growth and metastasis

of different cancers. Previous studies showed MUC5AC mediated impact on phosphorylation of

VEGFR-1. Therefore, impacts of MUC5AC knockdown were explored on angiogenesis process.

Knockdown of MUC5AC decreases mRNA levels of VEGF-A, significantly decreases

endothelial cell viability and endothelial tube formation capacity, quantified as percentage vessels

area and a total number of endothelial tube junctions formed. From these observations, I assume

that MUC5AC assist metastasis of PC cells through increased angiogenesis. To further

investigate the impact of MUC5AC on metastasis in vivo, we utilized an orthotopic model of PC.

In this experiment, I observed a significantly high pancreatic tumor size/weight and number of metastases to distant organs in mice orthotopically injected with MUC5AC expressing cells. In conclusion, using various biochemical and functional assays, we report for the first time a novel cell cycle and metastasis-associated role of MUC5AC in PC.

It has been speculated that polymeric secretory mucins like MUC5AC may form a layer over cell surface and hinder the effective targeting of therapeutics. In a recent study from our lab, it was shown that MUC5AC plays a critical role in cisplatin resistance of lung cancer cells.

Looking at my observations of MUC5AC mediated anti-apoptotic impact and above mentioned studies, I tested the hypothesis that MUC5AC may play an important role in resisting the anti- proliferative impact of chemotherapeutic drug-Gemcitabine. Interestingly, I observed that decreased expression of MUC5AC sensitizes PC cells to Gemcitabine. A dose dependent 228

significant decrease in PC cell viability was observed in MUC5AC knockdown cells on treatment with Gemcitabine. Further, there was a significant increase in apoptosis and necrosis in

Gemcitabine-treated MUC5AC knockdown PC cells. Mechanistically, I observed increased expression of apoptotic mediators Cyt-c, BAD, cleaved caspase-3 and cleaved caspase-9 in cytoplasmic extracts form MUC5AC knockdown PC cells. Further, reactivation of Wnt/β-Catenin signaling in Gemcitabine-resistant cancer-cells has previously been demonstrated. WNT/β-

Catenin signaling coordinates cancer stem cell state. It has been reported that GLI mediated increased MUC5AC expression mediates nuclear accumulation of β-Catenin in the nucleus.

Therefore, I tested the hypothesis that MUC5AC mediated increased nuclear translocation of β-

Catenin may enrich the stem cell population in Gemcitabine-resistant PC cells. Interestingly, I observed a significant decrease in nuclear translocation of β-Catenin in Gemcitabine treated

MUC5AC knockdown cells. Further evaluation of stem cell markers revealed a significant reduction in expression of ESA, SHH, SOX2 and OCT3/4 in Gemcitabine-treated MUC5AC knockdown PC cells.

In totality, the first objective of my dissertation shows that MUC5AC plays a critical role in PC progression and MUC5AC can be identified as an important therapeutic target. In light of these observations, I wanted to explore further the tumor enhancing role of MUC5AC PC spontaneous mouse model.

2) Impact of loss of Muc5ac expression in onset and progression of PC utilizing the

KrasG12D; Pdx1-Cre; Muc5ac-/- mouse model

Development of genetically engineered mouse models (GEMM) of PC has been one of the most progressive steps taken towards a better understanding of the pancreatic carcinogenesis process and the underlying mechanisms. As early identification remains the key to effective management of PC, the mice models provide a system to study the role of differentially expressed genes during initiation and progression of PC. Similar to humans, where MUC5AC is overexpressed during PC progression, a recent study in our lab demonstrated expression of mucins Muc1, Muc4 and 229

Muc5ac in KRasG12D; Pdx1-Cre (KC) mouse model of PC. Expression of Muc5ac in the pancreas of KC mice was observed as early as 10 weeks of age, and it further increased with progression.

Therefore, for functional and mechanistic characterization of Muc5ac under in vivo conditions, we acquired the Muc5ac knockout mice, and I developed the KRasG12D; Pdx1-Cre; Muc5ac-/- mice model by breeding Muc5ac-/- mice with KC mice.

Interestingly, I observed a consistent decrease in pancreas weight and a high percentage of the normal pancreas in KCMuc5ac-/- mice compared to KCMuc5ac+/+ mice. Further, on individual analysis of pancreatic intraepithelial neoplasia (PanIN) lesions, I observed reduced number of PanIN-1 (p<0.01) and PanIN-2 lesions at the 10th week of age in KCMuc5ac-/- mice compared to KCMuc5ac+/+ mice, suggesting the critical role of Muc5ac in the onset of PC.

Additionally, decreased number of high-grade PanIN-3 lesions at 20th, 30th, 40th (p<0.01) and 50th

(p<0.01) weeks of age in KCMuc5ac-/- mice and a significant reduction in the number of nuclei staining positive for Ki-67 in KCMuc5ac-/- mice pancreas clearly established an important role of

Muc5ac in the progression of PC. Therefore, I provide the first evidence that Kras mutation mediated upregulation of Muc5ac during PC, plays a critical role in the onset and progression of

PC, and loss of Muc5ac may provide a survival benefit to PC patients.

3) Mucins and associated glycan signatures in colon adenoma-carcinoma sequence: prospective pathological implication(s) for early diagnosis of colon cancer

CRC is the third most common cancer in both men and women and the second leading cause of cancer deaths in the US. The advanced stages of CRC have a worst outcome with 5-year survival being 13%. Ironically, only 40% of CRCs are diagnosed at early stages, due to the underuse of screening modalities. Thus, development of biomarkers that detect early stage resectable premalignant lesions of the colon can provide critical aid in the prevention of this malignancy. In this context, various inflammatory, benign (hyperplastic polyps), premalignant (adenomas), and malignant conditions of the colon are associated with alterations in mucin expression, organization, and glycosylation. Some previous evidence advocated the utility of differential 230

mucin expression to predict malignant transformation of colon pre-neoplastic lesions. Therefore,

in this study, I investigated the combined expression of various mucins and mucin-associated glycans during the adenoma-carcinoma sequence of colon cancer progression with my objective being evaluation of the applicability of mucins and associated glycoepitopes as markers for differentiating adenomas/adenocarcinomas from benign hyperplastic polyps.

Interestingly, by immunohistochemical analysis on colon disease array having samples of normal colon, inflammed colon, hyperplastic polyps, different adenomas and colon adenocarcinoma, I found significant alterations in expressions of mucins MUC2, MUC4,

MUC5AC, MUC17, and glycan epitope Tn/STn-MUC1 during adenoma-carcinoma sequential progression. After analyzing the individual efficacy of these differentially expressed mucins and glycans for early-stage prediction of colon carcinogenesis, I also explored the combinatorial efficacy of these markers for early-stage prediction of colon carcinogenesis. I could demonstrate that a combination of MUC2, MUC5AC, and MUC17 may indicate the likelihood of a colon lesion being premalignant and/or malignant versus benign hyperplastic polyp. Looking at the promising results from this study, we further extended our work to determine the expression profile of mucin and associated glycans in colon cancer precursor lesions-sessile serrated adenomas/polyp (SSA/P) and tubular adenoma (TA) and evaluated their efficacy to discriminate from benign hyperplastic polyps (HP).

4) Combinatorial assessment of CA 19-9/MUC17/MUC5AC expression discriminates sessile serrated adenoma/polyps and tubular adenoma from hyperplastic polyps

The multistep process of histologically and molecularly heterogeneous colorectal carcinogenesis is known to proceed via the most common “adenoma–carcinoma” pathway and the recently identified “serrated polyp-neoplasia” pathway. Evidence suggests that neoplastic progression with the serrated neoplasia pathway is faster than the classical adenoma-carcinoma sequence. Failure to identify sessile serrated adenoma/polyp (SSA/P), due to inconsistent pathological diagnosis and dearth of the molecular markers to discriminate them from hyperplastic polyp (HP), results in 231

misdiagnosis causing suboptimal surveillance and colonoscopy interval cancers. My previous study established the combinatorial efficacy of mucins and associated glycoepitopes to discriminate premalignant/malignant lesions of the colon from benign polyps (HP). Further, in this study, I aimed to address the “gray zone” in differentiating SSA/Ps from other polyp subtypes due to shared morphologic features (leading to the inter-observer variability among pathologists), and current non-availability of specific and sensitive markers.

I could demonstrate that a combinatorial panel of molecular markers CA 19-

9/MUC17/MUC5AC could discriminate SSA/P, TA and HP with high sensitivity and specificity.

My findings hold immense translational relevance as when employed in conjunction with gold standard colonoscopy; it would help clinicians for accurate diagnosis, management of colorectal polyps and may aid them in devising the personalized colon cancer screening recommendations.

2. Future directions

1. Elucidate the factors responsible for the upregulation of MUC5AC at early stage of PC

A better understanding of the etiology and early developmental events of PC requires serious attention. Recurrent pancreatic injuries due to multiple factors induce a pro-inflammatory milieu.

The various types of immune cells release different cytokines, chemokines, and growth factors leading to prolonged/chronic inflammatory conditions. Extensive studies conducted in last decade highlighted the role of different cytokines, chemokines, and growth factors in the regulation of

MUC5AC expression specifically in the context of inflammatory airway diseases. It has been shown that de novo expression of MUC5AC is an early event in PC progression. Further, I showed that MUC5AC plays a significant role in PC cell growth, migration, angiogenesis, and resistance to Gemcitabine. Therefore, to devise strategies for early stage modulation of MUC5AC overexpression during PC, it is important to elucidate different inflammatory factors at an early stage of PC that might be responsible for increased MUC5AC expression. A better understanding of the inflammatory factors regulating MUC5AC expression in PC would help to identify novel molecular targets and better therapeutic intervention for this lethal malignancy. 232

2. Elucidation of MUC5AC domain that interacts with E-Cadherin and β-Catenin

It has been speculated that GLI1 mediated upregulation of MUC5AC may interfere with

membrane localization of E-Cadherin resulting in increased nuclear translocation of β-Catenin mediated enhanced migration and proliferation of PC cells. Besides this, colocalization of MUC1 and MUC5AC with E-Cadherin was assumed to be related to loss of E-Cadherin function. On the basis of these studies, we hypothesized that MUC5AC may physically interact with E-Cadherin and β-Catenin to modulate its functions. In this dissertation, I have shown that by physically

interacting with E-Cadherin and β-Catenin MUC5AC may impact PC cell growth and metastasis.

By deciphering the exact domain of MUC5AC that interacts with E-Cadherin and β-Catenin, strategies can be devised to hinder this association therapeutically for modulation of PC cell growth and metastasis. I anticipate that MUC5AC hinders stabilization of E-Cadherin on plasma membrane due to the formation of polymeric gel layer on the cell surface. Therefore, strategies to

break these polymeric gels might prove beneficial for proper assembly of E-Cadherin on plasma membrane, inhibiting nuclear localization of β-Catenin, thus inhibiting growth and migratory properties of PC cells.

3. To elucidate the impact of Muc5ac on pancreatitis and acinar to ductal metaplasia

Lack of early stage diagnostic markers and metastasis to distant locations by the time of diagnosis makes PC one of the most lethal malignancies. The current research efforts in PC field are trying to identify markers that can be utilized for early stage diagnosis and can simultaneously be targeted to combat this disease. Pancreatitis is considered one of the most prominent risk factor of

PC. Previous studies have shown strong expression of MUC5AC in pancreatitis cases. Recent studies identified production of Muc5ac along with enhanced BrdU incorporation in pancreatic duct glands in a mice model of diabetes and pancreatitis. Data from our lab suggests increased

Muc5ac expression in cerulein-induced KC mice model of pancreatitis. In this dissertation, I have shown that Muc5ac plays a major role in the initiation of PC. Therefore, based on above mentioned studies, I anticipate that pancreatitis patients with increased MUC5AC expression may 233

progress faster to PC. Hence, I propose a future investigation of Muc5ac roles in pancreatitis along with the onset of acinar to ductal metaplasia and thus PC, utilizing the cerulein-induced KC mice model of pancreatitis in presence and absence of Muc5ac.

4. To elucidate the impact of Muc5ac on neutrophil infiltration during PC progression

A hallmark of pancreatic ductal adenocarcinoma is the fibro-inflammatory microenvironment that

consists of extracellular matrix proteins, activated pancreatic stellate cells, and a variety of

inflammatory cells, such as T-cells, macrophages, or neutrophils [14]. The interaction between

cancer cells and inflammatory cells plays a critical role in the initiation and progression of cancer;

however, this interaction has not been systematically investigated in pancreatic neoplasia [15].

Infiltration of neutrophils has been associated with the promotion of aggressive tumor growth and

increased metastatic potential [16]. A recent meta-analysis suggests that PC patients with

elevated neutrophil to lymphocyte ratio (NLR) have shorter overall survival [17]. In this

dissertation, I showed that knockout of Muc5ac in PC progression mice model delays the

initiation and progression of PC. Several factors may impact the tumor-infiltrating neutrophils

within the tumor. Interestingly, previous studies utilizing Muc5ac-/- mice model in the context of

airway pathologies, have demonstrated impact of Muc5ac on the infiltration of inflammatory

mediators such as neutrophils. Based on these studies, and my observations in this dissertation,

I propose further investigation of Muc5ac mediated impact on neutrophils and T-lymphocytes

infiltration along with underlying mechanistic basis, utilizing the KCMuc5ac+/+ and

KCMuc5ac-/- PC mice models.

5. Validation of the CA 19-9/MUC17/MUC5AC panel in a diverse set of colorectal polyp subtypes

From our study, we could clearly establish that expression of mucins and associated glycoepitopes can be utilized for efficient discrimination of SSA/P and TA from HP. However, our study was limited by a smaller sample size, lack of further subtypes in each polyp category, 234

lack of adenomas with different grades of dysplasia, and lack of information regarding mutational

profiles of these samples. A subtype of HP- microvesicular hyperplastic polyps that have similar

histologic and molecular features to SSA/P has been pointed out to be the potential colorectal

carcinoma precursor [18]. This necessitates immediate attention as to date malignant potential of

HP was not indicated. Therefore, future studies should first focus on employing the combinatorial

panels from our study, on a larger set of colorectal polyp subtypes in a blinded manner so that a validation of current findings can be made. Further efforts should also focus to elucidate markers that can discriminate micro-vesicular HP from SSA/Ps, colorectal polyp subtypes with varying

degree of dysplasia, anatomical location, and recurrence after prior polypectomy. Findings from

these future studies could help circumvent the current challenges with histopathological

classification and nomenclature of colon polyps that are ambiguous, lack consensus and

demonstrate high interobserver variability.

6. Development of CRC-specific glycopeptide microarrays with an objective to identify

polyps with malignant potential

Diagnosis of a polyp type that would progress to cancer is one of the biggest challenges faced by pathologists. This necessitates identification of highly specific and sensitive markers that can efficiently discriminate the early stage precursor lesions of colon cancer from benign polyps.

Cancer-associated posttranslational modifications frequently produce aberrant O-linked

glycoproteins and these aberrant O-linked glycoproteins in combination with protein backbone

induce autoantibodies [19]. Mucins are known to be aberrantly glycosylated during cancer. One

recent study reported cancer-associated autoantibodies to a set of aberrant glycopeptide derived

from mucin MUC1 and MUC4 in the serum of patients with CRC [19]. Looking at this, future

research efforts could focus on identification of CRC-specific glycan epitopes on differentially

expressed mucins (MUC1, MUC2, MUC4, MUC5AC, and MUC17). The information gained can

be utilized for developing CRC-specific glycopeptide microarrays for seromic profiling of

patients with colon polyps with an objective to identify polyps with malignant potential. This can 235

also be utilized for effective monitoring of the patients during colonoscopy interval period.

7. Elucidate the mechanisms associated with upregulation of MUC5AC and its role in

pathogenesis of CRC

Expression of MUC5AC is not detected in the normal colon while it is significantly

overexpressed during adenoma-carcinoma sequence [20]. Interestingly, expression of MUC5AC was strongly associated with carcinogenic features via the serrated neoplasia pathway, including

CIMP positivity, BRAFp.V600E mutation and increased tumor-stage [12, 21]. Despite all these information, none of the studies to date explored the role of MUC5AC and associated mechanisms in CRC. Therefore, future efforts should focus to elucidate the currently unexplored roles of secretory mucin MUC5AC in the pathogenesis of CRC. This will firmly establish the utility of MUC5AC as a marker for assessment of the malignant potential of polyps. Also, investigation of molecular mechanisms associated with upregulation of MUC5AC in SSA/P may further help in devising novel therapies targeting these precancerous lesions. 236

Reference List

[1] M.A. Hollingsworth and B.J. Swanson, Mucins in cancer: protection and control of the cell surface. Nat. Rev. Cancer 4 (2004) 45-60.

[2] S. Kaur, S. Kumar, N. Momi, A.R. Sasson, and S.K. Batra, Mucins in pancreatic cancer and its microenvironment. Nat. Rev. Gastroenterol. Hepatol. 10 (2013) 607-620.

[3] M.P. Torres, S. Chakraborty, J. Souchek, and S.K. Batra, Mucin-based targeted pancreatic cancer therapy. Curr. Pharm. Des 18 (2012) 2472-2481.

[4] S. Das, S. Rachagani, Y. Sheinin, L.M. Smith, C.B. Gurumurthy, H.K. Roy, and S.K. Batra, Mice deficient in Muc4 are resistant to experimental colitis and colitis-associated colorectal cancer. Oncogene(2015).

[5] S. Das, S. Rachagani, M.P. Torres-Gonzalez, I. Lakshmanan, P.D. Majhi, L.M. Smith, K.U. Wagner, and S.K. Batra, Carboxyl-terminal domain of MUC16 imparts tumorigenic and metastatic functions through nuclear translocation of JAK2 to pancreatic cancer cells. Oncotarget. 6 (2015) 5772-5787.

[6] P. Chaturvedi, A.P. Singh, S. Chakraborty, S.C. Chauhan, S. Bafna, J.L. Meza, P.K. Singh, M.A. Hollingsworth, P.P. Mehta, and S.K. Batra, MUC4 mucin interacts with and stabilizes the HER2 oncoprotein in human pancreatic cancer cells. Cancer Res. 68 (2008) 2065-2070.

[7] M. Andrianifahanana, A.P. Singh, C. Nemos, M.P. Ponnusamy, N. Moniaux, P.P. Mehta, G.C. Varshney, and S.K. Batra, IFN-gamma-induced expression of MUC4 in pancreatic cancer cells is mediated by STAT-1 upregulation: a novel mechanism for IFN-gamma response. Oncogene 26 (2007) 7251-7261.

[8] S. Senapati, S.B. Ho, P. Sharma, S. Das, S. Chakraborty, S. Kaur, G. Niehans, and S.K. Batra, Expression of intestinal MUC17 membrane-bound mucin in inflammatory and neoplastic diseases of the colon. J. Clin. Pathol. 63 (2010) 702-707.

[9] M. Takikita, S. Altekruse, C.F. Lynch, M.T. Goodman, B.Y. Hernandez, M. Green, W. Cozen, M. Cockburn, S.M. Sibug, M. Topor, C. Zeruto, B. Abedi-Ardekani, M.E. Reichman, and S.M. Hewitt, Associations between selected biomarkers and prognosis in a population-based pancreatic cancer tissue microarray. Cancer Res. 69 (2009) 2950- 2955.

[10] B. Kocer, A. Soran, S. Erdogan, M. Karabeyoglu, O. Yildirim, A. Eroglu, B. Bozkurt, and O. Cengiz, Expression of MUC5AC in colorectal carcinoma and relationship with prognosis. Pathol. Int. 52 (2002) 470-477.

[11] C.A. Iacobuzio-Donahue, R. Ashfaq, A. Maitra, N.V. Adsay, G.L. Shen-Ong, K. Berg, M.A. Hollingsworth, J.L. Cameron, C.J. Yeo, S.E. Kern, M. Goggins, and R.H. Hruban, Highly expressed genes in pancreatic ductal adenocarcinomas: a comprehensive characterization and comparison of the transcription profiles obtained from three major technologies. Cancer Res. 63 (2003) 8614-8622. 237

[12] F. Renaud, C. Mariette, A. Vincent, A. Wacrenier, V. Maunoury, J. Leclerc, L. Coppin, M. Crepin, S. Van, I, E. Leteurtre, and M.P. Buisine, The serrated neoplasia pathway of colorectal tumors: Identification of MUC5AC hypomethylation as an early marker of polyps with malignant potential. Int. J. Cancer 138 (2016) 1472-1481.

[13] M. Hidalgo, New insights into pancreatic cancer biology. Ann. Oncol. 23 Suppl 10 (2012) x135-x138.

[14] K. Felix and M.M. Gaida, Neutrophil-Derived Proteases in the Microenvironment of Pancreatic Cancer -Active Players in Tumor Progression. Int. J. Biol. Sci. 12 (2016) 302- 313.

[15] M.D. Reid, O. Basturk, D. Thirabanjasak, R.H. Hruban, D.S. Klimstra, P. Bagci, D. Altinel, and V. Adsay, Tumor-infiltrating neutrophils in pancreatic neoplasia. Mod. Pathol. 24 (2011) 1612-1619.

[16] K. Felix and M.M. Gaida, Neutrophil-Derived Proteases in the Microenvironment of Pancreatic Cancer -Active Players in Tumor Progression. Int. J. Biol. Sci. 12 (2016) 302- 313.

[17] H. Cheng, F. Long, M. Jaiswar, L. Yang, C. Wang, and Z. Zhou, Prognostic role of the neutrophil-to-lymphocyte ratio in pancreatic cancer: a meta-analysis. Sci. Rep. 5 (2015) 11026.

[18] I. Mesteri, G. Bayer, J. Meyer, D. Capper, S.F. Schoppmann, D.A. von, and P. Birner, Improved molecular classification of serrated lesions of the colon by immunohistochemical detection of BRAF V600E. Mod. Pathol. 27 (2014) 135-144.

[19] J.W. Pedersen, O. Blixt, E.P. Bennett, M.A. Tarp, I. Dar, U. Mandel, S.S. Poulsen, A.E. Pedersen, S. Rasmussen, P. Jess, H. Clausen, and H.H. Wandall, Seromic profiling of colorectal cancer patients with novel glycopeptide microarray. Int. J. Cancer 128 (2011) 1860-1871.

[20] S.R. Krishn, S. Kaur, L.M. Smith, S.L. Johansson, M. Jain, A. Patel, S.K. Gautam, M.A. Hollingsworth, U. Mandel, H. Clausen, W.C. Lo, W.T. Fan, U. Manne, and S.K. Batra, Mucins and associated glycan signatures in colon adenoma-carcinoma sequence: Prospective pathological implication(s) for early diagnosis of colon cancer. Cancer Lett. 374 (2016) 304-314.

[21] M.D. Walsh, M. Clendenning, E. Williamson, S.A. Pearson, R.J. Walters, B. Nagler, D. Packenas, A.K. Win, J.L. Hopper, M.A. Jenkins, A.M. Haydon, C. Rosty, D.R. English, G.G. Giles, M.A. McGuckin, J.P. Young, and D.D. Buchanan, Expression of MUC2, MUC5AC, MUC5B, and MUC6 mucins in colorectal cancers and their association with the CpG island methylator phenotype. Mod. Pathol. 26 (2013) 1642-1656.

238

Bibliography of Shiv Ram Krishn

[1] S.R. Krishn, S. Kaur, L.M. Smith, S.L. Johansson, M. Jain, A. Patel, S.K. Gautam, M.A. Hollingsworth, U. Mandel, H. Clausen, W.C. Lo, W.T. Fan, U. Manne, and S.K. Batra, Mucins and associated glycan signatures in colon adenoma-carcinoma sequence: Prospective pathological implication(s) for early diagnosis of colon cancer. Cancer Lett. 374 (2016) 304-314.

[2] I. Lakshmanan, S. Rachagani, R. Hauke, S.R. Krishn, S. Paknikar, P. Seshacharyulu, S. Karmakar, R.K. Nimmakayala, G. Kaushik, S.L. Johansson, G.B. Carey, M.P. Ponnusamy, S. Kaur, S.K. Batra, and A.K. Ganti, MUC5AC interactions with integrin beta4 enhances the migration of lung cancer cells through FAK signaling. Oncogene (2016) Online.

[3] S. Kaur, S.R. Krishn, S. Rachagani, and S.K. Batra, Significance of microRNA-based biomarkers for pancreatic cancer. Ann. Transl. Med. 3 (2015) 277.

[4] S.R. Krishn, S.K. Batra, and S. Kaur, Advances in miRNA-Mediated Mucin Regulation. Curr. Pharm. Rep.1 (2015) 355-364.

[5] M.A. Macha, S.R. Krishn, R. Jahan, K. Banerjee, S.K. Batra, and M. Jain, Emerging potential of natural products for targeting mucins for therapy against inflammation and cancer. Cancer Treat. Rev. 41 (2015) 277-288.

[6] M.A. Macha, P. Seshacharyulu, S.R. Krishn, P. Pai, S. Rachagani, M. Jain, and S.K. Batra, MicroRNAs (miRNAs) as biomarker(s) for prognosis and diagnosis of gastrointestinal (GI) cancers. Curr. Pharm. Des 20 (2014) 5287-5297.

[7] S. Kaur, N. Sharma, S.R. Krishn, I. Lakshmanan, S. Rachagani, M.J. Baine, L.M. Smith, S.M. Lele, A.R. Sasson, S. Guha, K. Mallya, J.M. Anderson, M.A. Hollingsworth, and S.K. Batra, MUC4-mediated regulation of acute phase protein lipocalin 2 through HER2/AKT/NF-kappaB signaling in pancreatic cancer. Clin. Cancer Res. 20 (2014) 688- 700.

[8] N. Momi, S. Kaur, S.R. Krishn, and S.K. Batra, Discovering the route from inflammation to pancreatic cancer. Minerva Gastroenterol. Dietol. 58 (2012) 283-297.