CIC-DUX4 Induces Small Round Cell Sarcomas Distinct from Ewing
Total Page:16
File Type:pdf, Size:1020Kb
Load more
										Recommended publications
									
								- 
												  Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
- 
												  The Mucin 5AC Level in Medical Faculty Students with Computer Vision Syndrome (CVS)ORIGINAL ARTICLE Bali Medical Journal (Bali Med J) 2019, Volume 8, Number 2: 460-463 P-ISSN.2089-1180, E-ISSN.2302-2914 The mucin 5AC level in medical faculty students with ORIGINAL ARTICLE Computer Vision Syndrome (CVS) Published by DiscoverSys CrossMark Doi: http://dx.doi.org/10.15562/bmj.v8i2.1425 I Gusti Ayu Made Juliari,1* Ratna Sari Dewi,1 Ni Luh Made Novi Ratnasari,2 Ariesanti Tri Handayani1 Volume No.: 8 ABSTRACT Introduction: Prolonged computer use will lead to a group of level which less than 186.33 ng/mL categorized as low mucin, while symptoms such as dryness of eyes, tired, headache and others called more than 186.33 ng/mL categorized as normal mucin level. Data was Issue: 2 Computer Vision Syndrome (CVS). The decrease of Mucin 5 AC (MUC5AC) analyzed by crosstabulation table and chi-square test with significant level could be one of the signs of dry eye disease on persons with CVS. value p < 0.05. Objective: The purpose of this study is to describe the Mucin 5AC Result: Most of the students who diagnosed with CVS had lower level in medical faculty students of Udayana University, Bali, Indonesia mucin 5AC levels as much as 77,3% and 33,3% students with CVS had First page No.: 460 with CVS. normal mucin 5AC level. This study analyses found there is significant Method: It is an observational cross-sectional analytic study at association between level of mucin 5AC with CVS. The students with Medical Faculty Udayana University on October 2018. Thirty four low level of mucin 5AC had 6,8 higher risk tend to be CVS (OR=6,8; CI P-ISSN.2089-1180 subject selected by purposive sampling and examined with Schirmer 95%= 1,42-32,37; p=0,012).
- 
												  Mucins: the Old, the New and the Promising Factors in Hepatobiliary CarcinogenesisInternational Journal of Molecular Sciences Review Mucins: the Old, the New and the Promising Factors in Hepatobiliary Carcinogenesis Aldona Kasprzak 1,* and Agnieszka Adamek 2 1 Department of Histology and Embryology, Poznan University of Medical Sciences, Swiecicki Street 6, 60-781 Pozna´n,Poland 2 Department of Infectious Diseases, Hepatology and Acquired Immunodeficiencies, University of Medical Sciences, Szwajcarska Street 3, 61-285 Pozna´n,Poland; [email protected] * Correspondence: [email protected]; Tel.: +48-61-8546441; Fax: +48-61-8546440 Received: 25 February 2019; Accepted: 10 March 2019; Published: 14 March 2019 Abstract: Mucins are large O-glycoproteins with high carbohydrate content and marked diversity in both the apoprotein and the oligosaccharide moieties. All three mucin types, trans-membrane (e.g., MUC1, MUC4, MUC16), secreted (gel-forming) (e.g., MUC2, MUC5AC, MUC6) and soluble (non-gel-forming) (e.g., MUC7, MUC8, MUC9, MUC20), are critical in maintaining cellular functions, particularly those of epithelial surfaces. Their aberrant expression and/or altered subcellular localization is a factor of tumour growth and apoptosis induced by oxidative stress and several anti-cancer agents. Abnormal expression of mucins was observed in human carcinomas that arise in various gastrointestinal organs. It was widely believed that hepatocellular carcinoma (HCC) does not produce mucins, whereas cholangiocarcinoma (CC) or combined HCC-CC may produce these glycoproteins. However, a growing number of reports shows that mucins can be produced by HCC cells that do not exhibit or are yet to undergo, morphological differentiation to biliary phenotypes. Evaluation of mucin expression levels in precursors and early lesions of CC, as well as other types of primary liver cancer (PLC), conducted in in vitro and in vivo models, allowed to discover the mechanisms of their action, as well as their participation in the most important signalling pathways of liver cystogenesis and carcinogenesis.
- 
												  Multiple Antibodies Identify Glypican-1 Associated with Exosomes from PancreaticbioRxiv preprint doi: https://doi.org/10.1101/145706; this version posted July 6, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Multiple antibodies identify glypican-1 associated with exosomes from pancreatic cancer cells and serum from patients with pancreatic cancer Chengyan Dong1*, Li Huang1*, Sonia A. Melo2,3,4, Paul Kurywchak1, Qian Peng1, Christoph Kahlert5, Valerie LeBleu1# & Raghu Kalluri1# 1Department of Cancer Biology, Metastasis Research Center, University of Texas MD Anderson Cancer Center, Houston, TX 77005 2Instituto de Investigação e Inovação em Saúde, Universidade do Porto, Portugal (iI3S), 4200 Porto, Portugal; 3Institute of Pathology and Molecular Immunology of the University of Porto (IPATIMUP), 4200 Porto, Portugal; 4Medical School, Porto University (FMUP), 4200 Porto, Portugal 5 Department of Gastrointestinal, Thoracic and Vascular Surgery, Technische Universität Dresden, Germany * co-first authors # co-corresponding authors Exosomes are man-sized vesicles shed by all cells, including cancer cells. Exosomes can serve as novel liquid biopsies for diagnosis of cancer with potential prognostic value. The exact mechanism/s associated with sorting or enrichment of cellular components into exosomes are still largely unknown. We reported Glypican-1 (GPC1) on the surface of cancer exosomes and provided evidence for the enrichment of GPC1 in exosomes from patients with pancreatic cancer1. Several different laboratories have validated this novel conceptual advance and reproduced the original experiments using multiple antibodies from different sources. These include anti-GPC1 antibodies from ThermoFisher (PA5- 28055 and PA-5-24972)1,2, Sigma (SAB270028), Abnova (MAB8351, monoclonal antibodies clone E9E)3, EMD Millipore (MAB2600-monoclonal antibodies)4, SantaCruz5, and R&D Systems (BAF4519)2.
- 
												  Appendix 2. Significantly Differentially Regulated Genes in Term Compared with Second Trimester Amniotic Fluid SupernatantAppendix 2. Significantly Differentially Regulated Genes in Term Compared With Second Trimester Amniotic Fluid Supernatant Fold Change in term vs second trimester Amniotic Affymetrix Duplicate Fluid Probe ID probes Symbol Entrez Gene Name 1019.9 217059_at D MUC7 mucin 7, secreted 424.5 211735_x_at D SFTPC surfactant protein C 416.2 206835_at STATH statherin 363.4 214387_x_at D SFTPC surfactant protein C 295.5 205982_x_at D SFTPC surfactant protein C 288.7 1553454_at RPTN repetin solute carrier family 34 (sodium 251.3 204124_at SLC34A2 phosphate), member 2 238.9 206786_at HTN3 histatin 3 161.5 220191_at GKN1 gastrokine 1 152.7 223678_s_at D SFTPA2 surfactant protein A2 130.9 207430_s_at D MSMB microseminoprotein, beta- 99.0 214199_at SFTPD surfactant protein D major histocompatibility complex, class II, 96.5 210982_s_at D HLA-DRA DR alpha 96.5 221133_s_at D CLDN18 claudin 18 94.4 238222_at GKN2 gastrokine 2 93.7 1557961_s_at D LOC100127983 uncharacterized LOC100127983 93.1 229584_at LRRK2 leucine-rich repeat kinase 2 HOXD cluster antisense RNA 1 (non- 88.6 242042_s_at D HOXD-AS1 protein coding) 86.0 205569_at LAMP3 lysosomal-associated membrane protein 3 85.4 232698_at BPIFB2 BPI fold containing family B, member 2 84.4 205979_at SCGB2A1 secretoglobin, family 2A, member 1 84.3 230469_at RTKN2 rhotekin 2 82.2 204130_at HSD11B2 hydroxysteroid (11-beta) dehydrogenase 2 81.9 222242_s_at KLK5 kallikrein-related peptidase 5 77.0 237281_at AKAP14 A kinase (PRKA) anchor protein 14 76.7 1553602_at MUCL1 mucin-like 1 76.3 216359_at D MUC7 mucin 7,
- 
												  MALE Protein Name Accession Number Molecular Weight CP1 CP2 H1 H2 PDAC1 PDAC2 CP Mean H Mean PDAC Mean T-Test PDAC Vs. H T-TestMALE t-test t-test Accession Molecular H PDAC PDAC vs. PDAC vs. Protein Name Number Weight CP1 CP2 H1 H2 PDAC1 PDAC2 CP Mean Mean Mean H CP PDAC/H PDAC/CP - 22 kDa protein IPI00219910 22 kDa 7 5 4 8 1 0 6 6 1 0.1126 0.0456 0.1 0.1 - Cold agglutinin FS-1 L-chain (Fragment) IPI00827773 12 kDa 32 39 34 26 53 57 36 30 55 0.0309 0.0388 1.8 1.5 - HRV Fab 027-VL (Fragment) IPI00827643 12 kDa 4 6 0 0 0 0 5 0 0 - 0.0574 - 0.0 - REV25-2 (Fragment) IPI00816794 15 kDa 8 12 5 7 8 9 10 6 8 0.2225 0.3844 1.3 0.8 A1BG Alpha-1B-glycoprotein precursor IPI00022895 54 kDa 115 109 106 112 111 100 112 109 105 0.6497 0.4138 1.0 0.9 A2M Alpha-2-macroglobulin precursor IPI00478003 163 kDa 62 63 86 72 14 18 63 79 16 0.0120 0.0019 0.2 0.3 ABCB1 Multidrug resistance protein 1 IPI00027481 141 kDa 41 46 23 26 52 64 43 25 58 0.0355 0.1660 2.4 1.3 ABHD14B Isoform 1 of Abhydrolase domain-containing proteinIPI00063827 14B 22 kDa 19 15 19 17 15 9 17 18 12 0.2502 0.3306 0.7 0.7 ABP1 Isoform 1 of Amiloride-sensitive amine oxidase [copper-containing]IPI00020982 precursor85 kDa 1 5 8 8 0 0 3 8 0 0.0001 0.2445 0.0 0.0 ACAN aggrecan isoform 2 precursor IPI00027377 250 kDa 38 30 17 28 34 24 34 22 29 0.4877 0.5109 1.3 0.8 ACE Isoform Somatic-1 of Angiotensin-converting enzyme, somaticIPI00437751 isoform precursor150 kDa 48 34 67 56 28 38 41 61 33 0.0600 0.4301 0.5 0.8 ACE2 Isoform 1 of Angiotensin-converting enzyme 2 precursorIPI00465187 92 kDa 11 16 20 30 4 5 13 25 5 0.0557 0.0847 0.2 0.4 ACO1 Cytoplasmic aconitate hydratase IPI00008485 98 kDa 2 2 0 0 0 0 2 0 0 - 0.0081 - 0.0
- 
												  Proteomic Analysis of Cancer and Mesothelial Cells Reveals an Increase in Mucin 5AC During Ovarian Cancer and Peritoneal InteractionJOURNAL OF PROTEOMICS 103 (2014) 204– 215 Available online at www.sciencedirect.com ScienceDirect www.elsevier.com/locate/jprot Proteomic analysis of cancer and mesothelial cells reveals an increase in Mucin 5AC during ovarian cancer and peritoneal interaction Natasha Musrapa,b, George S. Karagiannisa,b, Punit Saraona,b, Ihor Batruchb, Chris Smithc, Eleftherios P. Diamandisa,b,c,⁎ aDepartment of Laboratory Medicine and Pathobiology, University of Toronto, Toronto, Ontario, Canada bDepartment of Pathology and Laboratory Medicine, Mount Sinai Hospital, Toronto, Ontario, Canada cDepartment of Clinical Biochemistry, University Health Network, Toronto, Ontario, Canada ARTICLE INFO ABSTRACT Article history: Ovarian cancer is a highly metastatic disease that is often characterized by widespread Received 4 December 2013 abdominal dissemination. A hallmark of ovarian cancer progression is the attachment of Accepted 27 March 2014 malignant cells to the mesothelium and the formation of invasive peritoneal implants. Available online 12 April 2014 Therefore, delineating factors involved in cancer-peritoneal cell interaction is critical to improving patient survival, as it may lead to the discovery of novel therapeutic targets. As Keywords: such, we aimed to identify proteins that participate in this interaction by comparing the Ovarian cancer secreted proteome of a co-culture model containing ovarian cancer (OVCAR-5) and mesothelial Proteomics cells (LP-9), to their respective monoculture secretomes. In total, 49 proteins were differentially Co-culture secreted during cancer and mesothelial cell contact. Relative mRNA expression of candidates Peritoneum was performed, which revealed a significant increase in MUC5AC gene expression in cancer Metastasis cells cultured in three different co-culture models (OVCAR-5 and LP-9; BG-1 and LP-9; OV-90 and Mucin 5AC LP-9).
- 
												  Supp Table 6.PdfSupplementary Table 6. Processes associated to the 2037 SCL candidate target genes ID Symbol Entrez Gene Name Process NM_178114 AMIGO2 adhesion molecule with Ig-like domain 2 adhesion NM_033474 ARVCF armadillo repeat gene deletes in velocardiofacial syndrome adhesion NM_027060 BTBD9 BTB (POZ) domain containing 9 adhesion NM_001039149 CD226 CD226 molecule adhesion NM_010581 CD47 CD47 molecule adhesion NM_023370 CDH23 cadherin-like 23 adhesion NM_207298 CERCAM cerebral endothelial cell adhesion molecule adhesion NM_021719 CLDN15 claudin 15 adhesion NM_009902 CLDN3 claudin 3 adhesion NM_008779 CNTN3 contactin 3 (plasmacytoma associated) adhesion NM_015734 COL5A1 collagen, type V, alpha 1 adhesion NM_007803 CTTN cortactin adhesion NM_009142 CX3CL1 chemokine (C-X3-C motif) ligand 1 adhesion NM_031174 DSCAM Down syndrome cell adhesion molecule adhesion NM_145158 EMILIN2 elastin microfibril interfacer 2 adhesion NM_001081286 FAT1 FAT tumor suppressor homolog 1 (Drosophila) adhesion NM_001080814 FAT3 FAT tumor suppressor homolog 3 (Drosophila) adhesion NM_153795 FERMT3 fermitin family homolog 3 (Drosophila) adhesion NM_010494 ICAM2 intercellular adhesion molecule 2 adhesion NM_023892 ICAM4 (includes EG:3386) intercellular adhesion molecule 4 (Landsteiner-Wiener blood group)adhesion NM_001001979 MEGF10 multiple EGF-like-domains 10 adhesion NM_172522 MEGF11 multiple EGF-like-domains 11 adhesion NM_010739 MUC13 mucin 13, cell surface associated adhesion NM_013610 NINJ1 ninjurin 1 adhesion NM_016718 NINJ2 ninjurin 2 adhesion NM_172932 NLGN3 neuroligin
- 
												  Derived Cytotoxic T-Lymphocyte Epitope PeptideINTERNATIONAL JOURNAL OF ONCOLOGY 42: 831-838, 2013 Identification of an H2-Kb or H2-Db restricted and glypican-3- derived cytotoxic T-lymphocyte epitope peptide TATSUAKI IWAMA1,2, KAZUTAKA HORIE1, TOSHIAKI YOSHIKAWA1, DAISUKE NOBUOKA1, MANAMI SHIMOMURA1, YU SAWADA1 and TETSUYA NAKATSURA1,2 1Division of Cancer Immunotherapy, Research Center for Innovative Oncology, National Cancer Center Hospital East, Kashiwa, Chiba 277-8577; 2Research Institute for Biomedical Sciences, Tokyo University of Science, Japan Received November 15, 2012; Accepted December 28, 2012 DOI: 10.3892/ijo.2013.1793 Abstract. Glypican-3 (GPC3) is overexpressed in human cholangiocarcinoma (ICC), with HCC as the most common. hepatocellular carcinoma (HCC) but not expressed in normal Regarding HCC therapy, hepatectomy, percutaneous local tissues except for placenta and fetal liver and therefore is an therapy and transcatheter arterial embolization (TAE) are ideal target for cancer immunotherapy. In this study, we common, but the recurrence rate with conventional therapies for identified an H2-Kb or H2-Db restricted and murine GPC3 advanced HCC patients is still high (2). Therefore, developing a (mGPC3)-derived cytotoxic T-lymphocyte (CTL) epitope novel curative therapy or an effective adjuvant therapy for HCC peptide in C57BL/6 (B6) mice, which can be used in the design is important. of preclinical studies of various therapies with GPC3-target Recently, immunotherapy, which consists of a peptide immunotherapy in vivo. First, 11 types of 9- to 10-mer peptides vaccine, protein vaccine, or DNA vaccine, has become a predicted to bind with H2-Kb or H2-Db were selected from the potentially promising option for HCC (3,4).
- 
												  Supplementary Material ContentsSupplementary Material Contents Immune modulating proteins identified from exosomal samples.....................................................................2 Figure S1: Overlap between exosomal and soluble proteomes.................................................................................... 4 Bacterial strains:..............................................................................................................................................4 Figure S2: Variability between subjects of effects of exosomes on BL21-lux growth.................................................... 5 Figure S3: Early effects of exosomes on growth of BL21 E. coli .................................................................................... 5 Figure S4: Exosomal Lysis............................................................................................................................................ 6 Figure S5: Effect of pH on exosomal action.................................................................................................................. 7 Figure S6: Effect of exosomes on growth of UPEC (pH = 6.5) suspended in exosome-depleted urine supernatant ....... 8 Effective exosomal concentration....................................................................................................................8 Figure S7: Sample constitution for luminometry experiments..................................................................................... 8 Figure S8: Determining effective concentration .........................................................................................................
- 
												  A Krasg12d-Driven Genetic Mouse Model of Pancreatic Cancer Requires Glypican-1 for Efficient Proliferation and AngiogenesisOncogene (2012) 31, 2535–2544 & 2012 Macmillan Publishers Limited All rights reserved 0950-9232/12 www.nature.com/onc ORIGINAL ARTICLE A KrasG12D-driven genetic mouse model of pancreatic cancer requires glypican-1 for efficient proliferation and angiogenesis CA Whipple1,2, AL Young1,2 and M Korc1,2 1Departments of Medicine and Pharmacology and Toxicology, Dartmouth Medical School, Hanover, NH, USA and 2The Norris Cotton Cancer Center at Dartmouth-Hitchcock Medical Center, Lebanon, NH, USA Pancreatic ductal adenocarcinomas (PDACs) exhibit Introduction multiple molecular alterations and overexpress heparin- binding growth factors (HBGFs) and glypican-1 (GPC1), Pancreatic ductal adenocarcinoma (PDAC) is a highly a heparan sulfate proteoglycan that promotes efficient metastatic malignancy that is the fourth leading cause signaling by HBGFs. It is not known, however, whether of cancer death in the United States, with an overall GPC1 has a role in genetic mouse models of PDAC. 5-year survival rate of o6% (Siegel et al., 2011). PDAC Therefore, we generated a GPC1 null mouse that exhibits a wide range of genetic and epigenetic altera- combines pancreas-specific Cre-mediated activation of tions including a high frequency (90–95%) of activating oncogenic Kras (KrasG12D) with deletion of a conditional Kras mutations, homozygous deletion (85%) and INK4A/Arf allele (Pdx1-Cre;LSL-KrasG12D;INK4A/ epigenetic silencing (15%) of the tumor suppressor Arflox/lox;GPC1À/À mice). By comparison with Pdx1- genes p16INK4A/p14ARF (INK4A), as well as an over- Cre;LSL-KrasG12D;INK4A/Arflox/lox mice that were wild abundance of heparin-binding growth factors (HBGFs) type for GPC1, the Pdx1-Cre;LSL-KrasG12D;INK4A/ (Korc, 2003; Schneider and Schmid, 2003).
- 
												  Is Osteopontin a Friend Or Foe of Cell Apoptosis in InflammatoryInternational Journal of Molecular Sciences Review Is Osteopontin a Friend or Foe of Cell Apoptosis in Inflammatory Gastrointestinal and Liver Diseases? Tomoya Iida ID , Kohei Wagatsuma, Daisuke Hirayama and Hiroshi Nakase * Department of Gastroenterology and Hepatology, Sapporo Medical University School of Medicine, Minami 1-jo Nishi 16-chome, Chuo-ku, Sapporo 060-8543, Japan; [email protected] (T.I.); [email protected] (K.W.); [email protected] (D.H.) * Correspondence: [email protected]; Tel.: +81-11-611-2111; Fax: +81-11-611-2282 Received: 22 November 2017; Accepted: 19 December 2017; Published: 21 December 2017 Abstract: Osteopontin (OPN) is involved in a variety of biological processes, including bone remodeling, innate immunity, acute and chronic inflammation, and cancer. The expression of OPN occurs in various tissues and cells, including intestinal epithelial cells and immune cells such as macrophages, dendritic cells, and T lymphocytes. OPN plays an important role in the efficient development of T helper 1 immune responses and cell survival by inhibiting apoptosis. The association of OPN with apoptosis has been investigated. In this review, we described the role of OPN in inflammatory gastrointestinal and liver diseases, focusing on the association of OPN with apoptosis. OPN changes its association with apoptosis depending on the type of disease and the phase of disease activity, acting as a promoter or a suppressor of inflammation and inflammatory carcinogenesis. It is essential that the roles of OPN in those diseases are elucidated, and treatments based on its mechanism are developed. Keywords: osteopontin; apoptosis; gastrointestinal; liver; inflammation; cacinogenesis 1. Introduction Cancer epidemiologists have described three carcinogenesis factors: daily diet, smoking, and inflammation [1].