DOCSLIB.ORG

Proteomic Identification of Mediators Implicated in the Metastatic Progression of Ovarian Cancer

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Proteomic Identification of Mediators Implicated in the Metastatic Progression of Ovarian Cancer Proteomic Identification of Mediators Implicated in the Metastatic Progression of Ovarian Cancer by Natasha Musrap A thesis submitted in conformity with the requirements for the degree of Doctorate of Philosophy Department of Laboratory Medicine and Pathobiology University of Toronto © Copyright by Natasha Musrap 2015 Proteomic Identification of Mediators Implicated in the Metastatic Progression of Ovarian Cancer Natasha Musrap Doctor of Philosophy Laboratory Medicine and Pathobiology University of Toronto 2015 Abstract Ovarian cancer (OvCa) is the leading cause of death among gynecological malignancies, and is characterized by peritoneal metastasis and increased resistance to chemotherapy. Acquired drug resistance is often attributed to the formation of multicellular aggregates (MCAs) in the peritoneal cavity, which seed abdominal surfaces, particularly, the mesothelial lining of the peritoneum. Given that the presence of metastatic implants is a predictor of poor survival, a better understanding of the underlying biology surrounding OvCa metastasis may lead to the identification of key molecules that are integral to the progression of the disease, which therefore, may serve as practicable therapeutic targets. To that end, in vitro cell line models of cancer-peritoneal interaction and aggregate formation were used to identify proteins that are differentially expressed during cancer progression, using mass spectrometry-based approaches. First, we performed a proteomics analysis of a co-culture model of ovarian cancer and mesothelial cells, in which we identified numerous proteins that were differentially regulated during cancer-peritoneal interaction. We further validated one protein, MUC5AC, and confirmed its expression at the cancer-peritoneal interface. Next, we conducted a quantitative proteomics analysis of a cell line grown as a monolayer and as MCAs. After identifying a subset of overexpressed proteins, we determined that CLCA1 plays a role in MCA formation. ii Additional studies using a CLCA1 blocker, as well as siRNA knockdown of CLCA1 in OvCa cells, resulted in a decreased ability of cancer cells to aggregate, a reduced ability to adhere to extracellular matrix components, and decreased cell viability. Moreover, we demonstrated that CLCA1 is able to regulate MUC5AC expression, as CLCA1-knockdown cells exhibited reduced expression of MUC5AC. In summary, the research presented in this thesis adds to our current understanding about ovarian cancer progression, and identifies two proteins that play a role in OvCa progression, which may serve as novel therapeutic targets. iii Acknowledgements This thesis would not have been possible without the help and support of many individuals around me, with whom I am very grateful to share this journey. First and foremost, I would like to express my sincere gratitude to my supervisor, Dr. Eleftherios P. Diamandis, for his continuous support and guidance throughout my PhD. I would like to thank him for giving me the opportunity and freedom to pursue my scientific interests, and for his patience and mentorship that led me to complete this work. He taught me that success takes hard work and is an excellent role model of that principle. I would also like to extend my gratitude and thanks to members of my advisory committee, Dr. Bharati Bapat and Dr. Patricia Shaw, for providing valuable advice and feedback throughout the years and challenging me to take my project as far as possible. Also, I would like to thank members of my final oral examination committee, Dr. Ivan Blasutig and Dr. James Scholey, for their time and providing feedback. I am also very grateful to my external examiner, Dr. Barbara Vanderhyden, for dedicating her time in reviewing the thesis and being a key part of my defense. Also, I would like to express my thanks to all past and present members of the Advanced Centre for the Detection of Cancer. You have all made my time here enjoyable and I will definitely miss each and every one of you. Not only have you all helped me grow as a researcher; you have also helped me grow as a person. Thank you to my friends for always supporting me, and thank you to Vince for cheering me on and for reassuring me when I needed it the most. Thanks to members of the Department of Laboratory Medicine and Pathobiology, including Rama Ponda, Ferzeen Sammy, and Dr. Harry Elsholtz, for administrative help in scheduling the iv defense. I would also like to acknowledge the funding I received from the LMP department and the Canadian Institutes of Health Research. Last but not least, none of this work would have been possible without the love and support of my family. Thank you to my brother, Chris, and more importantly, my parents, Joanne and Ramatali, for always believing in me, and encouraging me to do my best – this thesis is dedicated to you. v Table of Contents Abstract ..................................................................................................................................... ii Acknowledgements .................................................................................................................. iv Table of Contents ..................................................................................................................... vi List of Abbreviations ................................................................................................................ x List of Tables ......................................................................................................................... xiii List of Figures ......................................................................................................................... xiv Chapter 1: Introduction ........................................................................................................... 1 1.1 Ovarian Cancer .............................................................................................................. 2 1.1.1 Ovarian cancer statistics and epidemiology ............................................................... 2 1.1.2 Classification and histological subtypes .................................................................... 3 1.1.3 Ovarian cancer diagnosis and treatment .................................................................... 5 1.1.3.1 Diagnosis ............................................................................................................. 5 1.1.3.2 Treatment ............................................................................................................ 6 1.2 The Role of the Tumor Microenvironment during Ovarian Cancer Progression and its Clinical Implications ......................................................................................... 9 1.2.1 Inflammatory cytokine and chemokine networks in ovarian cancer ....................... 11 1.2.2 The role of tumor-associated stromal cells .............................................................. 14 1.2.2.1 Tumor-associated macrophages ........................................................................ 15 1.2.2.2 Cancer-associated fibroblasts ............................................................................ 18 1.2.2.3 Omentum-derived adipocytes ........................................................................... 22 1.2.2.4 Mesenchymal stem cells ................................................................................... 23 1.2.3 Targeting extracellular matrix components ............................................................. 25 1.3 Ovarian Cancer Metastasis ......................................................................................... 27 1.3.1 Ovarian cancer progression to the peritoneum ........................................................ 27 1.3.2 Ovarian cancer spheroid formation .......................................................................... 28 1.4 Proteomic Approaches to Study Ovarian Cancer Biology ....................................... 30 1.4.1 Proteomics initiatives in OvCa ................................................................................ 30 1.4.2 Quantitative proteomics ........................................................................................... 32 1.4.2.1 Labeling approaches ......................................................................................... 33 1.4.2.2 Label-free quantitation ...................................................................................... 33 1.5 Rationale and Goals ..................................................................................................... 35 1.5.1 Rationale .................................................................................................................. 35 1.5.2 Hypothesis ................................................................................................................ 35 1.5.3 Objectives ................................................................................................................ 36 Chapter 2: Proteomic analysis of cancer and mesothelial cells reveals an increase in Mucin 5AC during ovarian cancer and peritoneal interaction ...................................... 38 2.1 Introduction .................................................................................................................. 39 2.2 Materials and Methods ................................................................................................ 42 vi 2.2.1 Cell lines .................................................................................................................
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Table S1 the Four Gene Sets Derived from Gene Expression Profiles of Escs and Differentiated Cells
    Table S1 The four gene sets derived from gene expression profiles of ESCs and differentiated cells Uniform High Uniform Low ES Up ES Down EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol 269261 Rpl12 11354 Abpa 68239 Krt42 15132 Hbb-bh1 67891 Rpl4 11537 Cfd 26380 Esrrb 15126 Hba-x 55949 Eef1b2 11698 Ambn 73703 Dppa2 15111 Hand2 18148 Npm1 11730 Ang3 67374 Jam2 65255 Asb4 67427 Rps20 11731 Ang2 22702 Zfp42 17292 Mesp1 15481 Hspa8 11807 Apoa2 58865 Tdh 19737 Rgs5 100041686 LOC100041686 11814 Apoc3 26388 Ifi202b 225518 Prdm6 11983 Atpif1 11945 Atp4b 11614 Nr0b1 20378 Frzb 19241 Tmsb4x 12007 Azgp1 76815 Calcoco2 12767 Cxcr4 20116 Rps8 12044 Bcl2a1a 219132 D14Ertd668e 103889 Hoxb2 20103 Rps5 12047 Bcl2a1d 381411 Gm1967 17701 Msx1 14694 Gnb2l1 12049 Bcl2l10 20899 Stra8 23796 Aplnr 19941 Rpl26 12096 Bglap1 78625 1700061G19Rik 12627 Cfc1 12070 Ngfrap1 12097 Bglap2 21816 Tgm1 12622 Cer1 19989 Rpl7 12267 C3ar1 67405 Nts 21385 Tbx2 19896 Rpl10a 12279 C9 435337 EG435337 56720 Tdo2 20044 Rps14 12391 Cav3 545913 Zscan4d 16869 Lhx1 19175 Psmb6 12409 Cbr2 244448 Triml1 22253 Unc5c 22627 Ywhae 12477 Ctla4 69134 2200001I15Rik 14174 Fgf3 19951 Rpl32 12523 Cd84 66065 Hsd17b14 16542 Kdr 66152 1110020P15Rik 12524 Cd86 81879 Tcfcp2l1 15122 Hba-a1 66489 Rpl35 12640 Cga 17907 Mylpf 15414 Hoxb6 15519 Hsp90aa1 12642 Ch25h 26424 Nr5a2 210530 Leprel1 66483 Rpl36al 12655 Chi3l3 83560 Tex14 12338 Capn6 27370 Rps26 12796 Camp 17450 Morc1 20671 Sox17 66576 Uqcrh 12869 Cox8b 79455 Pdcl2 20613 Snai1 22154 Tubb5 12959 Cryba4 231821 Centa1 17897
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • New York Chapter American College of Physicians Annual
    New York Chapter American College of Physicians Annual Scientific Meeting Poster Presentations Saturday, October 12, 2019 Westchester Hilton Hotel 699 Westchester Avenue Rye Brook, NY New York Chapter American College of Physicians Annual Scientific Meeting Medical Student Clinical Vignette 1 Medical Student Clinical Vignette Adina Amin Medical Student Jessy Epstein, Miguel Lacayo, Emmanuel Morakinyo Touro College of Osteopathic Medicine A Series of Unfortunate Events - A Rare Presentation of Thoracic Outlet Syndrome Venous thoracic outlet syndrome, formerly known as Paget-Schroetter Syndrome, is a condition characterized by spontaneous deep vein thrombosis of the upper extremity. It is a very rare syndrome resulting from anatomical abnormalities of the thoracic outlet, causing thrombosis of the deep veins draining the upper extremity. This disease is also called “effort thrombosis― because of increased association with vigorous and repetitive upper extremity activities. Symptoms include severe upper extremity pain and swelling after strenuous activity. A 31-year-old female with a history of vascular thoracic outlet syndrome, two prior thrombectomies, and right first rib resection presented with symptoms of loss of blood sensation, dull pain in the area, and sharp pain when coughing/sneezing. When the patient had her first blood clot, physical exam was notable for swelling, venous distension, and skin discoloration. The patient had her first thrombectomy in her right upper extremity a couple weeks after the first clot was discovered. Thrombolysis with TPA was initiated, and percutaneous mechanical thrombectomy with angioplasty of the axillary and subclavian veins was performed. Almost immediately after the thrombectomy, the patient had a rethrombosis which was confirmed by ultrasound.
    [Show full text]
  • Emerging Roles for Multifunctional Ion Channel Auxiliary Subunits in Cancer T ⁎ Alexander S
    Cell Calcium 80 (2019) 125–140 Contents lists available at ScienceDirect Cell Calcium journal homepage: www.elsevier.com/locate/ceca Emerging roles for multifunctional ion channel auxiliary subunits in cancer T ⁎ Alexander S. Hawortha,b, William J. Brackenburya,b, a Department of Biology, University of York, Heslington, York, YO10 5DD, UK b York Biomedical Research Institute, University of York, Heslington, York, YO10 5DD, UK ARTICLE INFO ABSTRACT Keywords: Several superfamilies of plasma membrane channels which regulate transmembrane ion flux have also been Auxiliary subunit shown to regulate a multitude of cellular processes, including proliferation and migration. Ion channels are Cancer typically multimeric complexes consisting of conducting subunits and auxiliary, non-conducting subunits. Calcium channel Auxiliary subunits modulate the function of conducting subunits and have putative non-conducting roles, further Chloride channel expanding the repertoire of cellular processes governed by ion channel complexes to processes such as trans- Potassium channel cellular adhesion and gene transcription. Given this expansive influence of ion channels on cellular behaviour it Sodium channel is perhaps no surprise that aberrant ion channel expression is a common occurrence in cancer. This review will − focus on the conducting and non-conducting roles of the auxiliary subunits of various Ca2+,K+,Na+ and Cl channels and the burgeoning evidence linking such auxiliary subunits to cancer. Several subunits are upregu- lated (e.g. Cavβ,Cavγ) and downregulated (e.g. Kvβ) in cancer, while other subunits have been functionally implicated as oncogenes (e.g. Navβ1,Cavα2δ1) and tumour suppressor genes (e.g. CLCA2, KCNE2, BKγ1) based on in vivo studies. The strengthening link between ion channel auxiliary subunits and cancer has exposed these subunits as potential biomarkers and therapeutic targets.
    [Show full text]
  • Transcriptomic Analysis of Native Versus Cultured Human and Mouse Dorsal Root Ganglia Focused on Pharmacological Targets Short
    bioRxiv preprint doi: https://doi.org/10.1101/766865; this version posted September 12, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Transcriptomic analysis of native versus cultured human and mouse dorsal root ganglia focused on pharmacological targets Short title: Comparative transcriptomics of acutely dissected versus cultured DRGs Andi Wangzhou1, Lisa A. McIlvried2, Candler Paige1, Paulino Barragan-Iglesias1, Carolyn A. Guzman1, Gregory Dussor1, Pradipta R. Ray1,#, Robert W. Gereau IV2, # and Theodore J. Price1, # 1The University of Texas at Dallas, School of Behavioral and Brain Sciences and Center for Advanced Pain Studies, 800 W Campbell Rd. Richardson, TX, 75080, USA 2Washington University Pain Center and Department of Anesthesiology, Washington University School of Medicine # corresponding authors [email protected], [email protected] and [email protected] Funding: NIH grants T32DA007261 (LM); NS065926 and NS102161 (TJP); NS106953 and NS042595 (RWG). The authors declare no conflicts of interest Author Contributions Conceived of the Project: PRR, RWG IV and TJP Performed Experiments: AW, LAM, CP, PB-I Supervised Experiments: GD, RWG IV, TJP Analyzed Data: AW, LAM, CP, CAG, PRR Supervised Bioinformatics Analysis: PRR Drew Figures: AW, PRR Wrote and Edited Manuscript: AW, LAM, CP, GD, PRR, RWG IV, TJP All authors approved the final version of the manuscript. 1 bioRxiv preprint doi: https://doi.org/10.1101/766865; this version posted September 12, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • Role of Cornification and Triglyceride Synthesis Genes
    Gillespie et al. BMC Genomics 2013, 14:169 http://www.biomedcentral.com/1471-2164/14/169 RESEARCH ARTICLE Open Access Transcriptome analysis of pigeon milk production – role of cornification and triglyceride synthesis genes Meagan J Gillespie1,2*, Tamsyn M Crowley1,3, Volker R Haring1, Susanne L Wilson1, Jennifer A Harper1, Jean S Payne1, Diane Green1, Paul Monaghan1, John A Donald2, Kevin R Nicholas3 and Robert J Moore1 Abstract Background: The pigeon crop is specially adapted to produce milk that is fed to newly hatched young. The process of pigeon milk production begins when the germinal cell layer of the crop rapidly proliferates in response to prolactin, which results in a mass of epithelial cells that are sloughed from the crop and regurgitated to the young. We proposed that the evolution of pigeon milk built upon the ability of avian keratinocytes to accumulate intracellular neutral lipids during the cornification of the epidermis. However, this cornification process in the pigeon crop has not been characterised. Results: We identified the epidermal differentiation complex in the draft pigeon genome scaffold and found that, like the chicken, it contained beta-keratin genes. These beta-keratin genes can be classified, based on sequence similarity, into several clusters including feather, scale and claw keratins. The cornified cells of the pigeon crop express several cornification-associated genes including cornulin, S100-A9 and A16-like, transglutaminase 6-like and the pigeon ‘lactating’ crop-specific annexin cp35. Beta-keratins play an important role in ‘lactating’ crop, with several claw and scale keratins up-regulated. Additionally, transglutaminase 5 and differential splice variants of transglutaminase 4 are up-regulated along with S100-A10.
    [Show full text]
  • Expression Profiling of Ion Channel Genes Predicts Clinical Outcome in Breast Cancer
    UCSF UC San Francisco Previously Published Works Title Expression profiling of ion channel genes predicts clinical outcome in breast cancer Permalink https://escholarship.org/uc/item/1zq9j4nw Journal Molecular Cancer, 12(1) ISSN 1476-4598 Authors Ko, Jae-Hong Ko, Eun A Gu, Wanjun et al. Publication Date 2013-09-22 DOI http://dx.doi.org/10.1186/1476-4598-12-106 Peer reviewed eScholarship.org Powered by the California Digital Library University of California Ko et al. Molecular Cancer 2013, 12:106 http://www.molecular-cancer.com/content/12/1/106 RESEARCH Open Access Expression profiling of ion channel genes predicts clinical outcome in breast cancer Jae-Hong Ko1, Eun A Ko2, Wanjun Gu3, Inja Lim1, Hyoweon Bang1* and Tong Zhou4,5* Abstract Background: Ion channels play a critical role in a wide variety of biological processes, including the development of human cancer. However, the overall impact of ion channels on tumorigenicity in breast cancer remains controversial. Methods: We conduct microarray meta-analysis on 280 ion channel genes. We identify candidate ion channels that are implicated in breast cancer based on gene expression profiling. We test the relationship between the expression of ion channel genes and p53 mutation status, ER status, and histological tumor grade in the discovery cohort. A molecular signature consisting of ion channel genes (IC30) is identified by Spearman’s rank correlation test conducted between tumor grade and gene expression. A risk scoring system is developed based on IC30. We test the prognostic power of IC30 in the discovery and seven validation cohorts by both Cox proportional hazard regression and log-rank test.
    [Show full text]
  • Anti-Inflammatory Role of Curcumin in LPS Treated A549 Cells at Global Proteome Level and on Mycobacterial Infection
    Anti-inflammatory Role of Curcumin in LPS Treated A549 cells at Global Proteome level and on Mycobacterial infection. Suchita Singh1,+, Rakesh Arya2,3,+, Rhishikesh R Bargaje1, Mrinal Kumar Das2,4, Subia Akram2, Hossain Md. Faruquee2,5, Rajendra Kumar Behera3, Ranjan Kumar Nanda2,*, Anurag Agrawal1 1Center of Excellence for Translational Research in Asthma and Lung Disease, CSIR- Institute of Genomics and Integrative Biology, New Delhi, 110025, India. 2Translational Health Group, International Centre for Genetic Engineering and Biotechnology, New Delhi, 110067, India. 3School of Life Sciences, Sambalpur University, Jyoti Vihar, Sambalpur, Orissa, 768019, India. 4Department of Respiratory Sciences, #211, Maurice Shock Building, University of Leicester, LE1 9HN 5Department of Biotechnology and Genetic Engineering, Islamic University, Kushtia- 7003, Bangladesh. +Contributed equally for this work. S-1 70 G1 S 60 G2/M 50 40 30 % of cells 20 10 0 CURI LPSI LPSCUR Figure S1: Effect of curcumin and/or LPS treatment on A549 cell viability A549 cells were treated with curcumin (10 µM) and/or LPS or 1 µg/ml for the indicated times and after fixation were stained with propidium iodide and Annexin V-FITC. The DNA contents were determined by flow cytometry to calculate percentage of cells present in each phase of the cell cycle (G1, S and G2/M) using Flowing analysis software. S-2 Figure S2: Total proteins identified in all the three experiments and their distribution betwee curcumin and/or LPS treated conditions. The proteins showing differential expressions (log2 fold change≥2) in these experiments were presented in the venn diagram and certain number of proteins are common in all three experiments.
    [Show full text]
  • The Mucin 5AC Level in Medical Faculty Students with Computer Vision Syndrome (CVS)
    ORIGINAL ARTICLE Bali Medical Journal (Bali Med J) 2019, Volume 8, Number 2: 460-463 P-ISSN.2089-1180, E-ISSN.2302-2914 The mucin 5AC level in medical faculty students with ORIGINAL ARTICLE Computer Vision Syndrome (CVS) Published by DiscoverSys CrossMark Doi: http://dx.doi.org/10.15562/bmj.v8i2.1425 I Gusti Ayu Made Juliari,1* Ratna Sari Dewi,1 Ni Luh Made Novi Ratnasari,2 Ariesanti Tri Handayani1 Volume No.: 8 ABSTRACT Introduction: Prolonged computer use will lead to a group of level which less than 186.33 ng/mL categorized as low mucin, while symptoms such as dryness of eyes, tired, headache and others called more than 186.33 ng/mL categorized as normal mucin level. Data was Issue: 2 Computer Vision Syndrome (CVS). The decrease of Mucin 5 AC (MUC5AC) analyzed by crosstabulation table and chi-square test with significant level could be one of the signs of dry eye disease on persons with CVS. value p < 0.05. Objective: The purpose of this study is to describe the Mucin 5AC Result: Most of the students who diagnosed with CVS had lower level in medical faculty students of Udayana University, Bali, Indonesia mucin 5AC levels as much as 77,3% and 33,3% students with CVS had First page No.: 460 with CVS. normal mucin 5AC level. This study analyses found there is significant Method: It is an observational cross-sectional analytic study at association between level of mucin 5AC with CVS. The students with Medical Faculty Udayana University on October 2018. Thirty four low level of mucin 5AC had 6,8 higher risk tend to be CVS (OR=6,8; CI P-ISSN.2089-1180 subject selected by purposive sampling and examined with Schirmer 95%= 1,42-32,37; p=0,012).
    [Show full text]
  • Transmembrane Protein with Unknown Function 16A Overexpression Promotes Glioma Formation Through the Nuclear Factor‑Κb Signaling Pathway
    1068 MOLECULAR MEDICINE REPORTS 9: 1068-1074, 2014 Transmembrane protein with unknown function 16A overexpression promotes glioma formation through the nuclear factor‑κB signaling pathway JUN LIU1, YU LIU2, YINGANG REN1, LI KANG1 and LIHUA ZHANG1 Departments of 1Geriatrics and 2Neurology, Tangdu Hospital, Fourth Military Medical University, Xi'an, Shaanxi 710038, P.R. China Received July 18, 2013; Accepted January 2, 2014 DOI: 10.3892/mmr.2014.1888 Abstract. Ion channels have been suggested to be important in Introduction the development and progression of tumors, however, chloride channels have rarely been analyzed in tumorigenesis. More In previous years, the association between ion channels and recently, transmembrane protein with unknown function 16A tumors has drawn particular attention. Increasing evidence has (TMEM16A), hypothesized to be a candidate calcium-acti- demonstrated that ion channels are involved in the regulation vated Cl- channel, has been found to be overexpressed in a of tumor progression, including potassium (1-3), calcium (4) number of tumor types. Although several studies have impli- and sodium channels (5,6). Therefore, understanding the cated the overexpression of TMEM16A in certain tumor types, underlying molecular mechanisms of ion channels in tumori- the exact role of TMEM16A in gliomas and the underlying genesis, and tumor progression and migration provides novel mechanisms in tumorigenesis, remain poorly understood. In insights into tumor pathogenesis, and also identifies potential the present study, the role of TMEM16A in gliomas and the targets for tumor prevention and treatment. potential underlying mechanisms were analyzed. TMEM16A Chloride channels are expressed ubiquitously and are was highly abundant in various grades of gliomas and important in various cellular processes, including the cell cycle cultured glioma cells.
    [Show full text]
  • Computational and Experimental Approaches for Evaluating the Genetic Basis of Mitochondrial Disorders
    Computational and Experimental Approaches For Evaluating the Genetic Basis of Mitochondrial Disorders The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Lieber, Daniel Solomon. 2013. Computational and Experimental Approaches For Evaluating the Genetic Basis of Mitochondrial Disorders. Doctoral dissertation, Harvard University. Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:11158264 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA Computational and Experimental Approaches For Evaluating the Genetic Basis of Mitochondrial Disorders A dissertation presented by Daniel Solomon Lieber to The Committee on Higher Degrees in Systems Biology in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the subject of Systems Biology Harvard University Cambridge, Massachusetts April 2013 © 2013 - Daniel Solomon Lieber All rights reserved. Dissertation Adviser: Professor Vamsi K. Mootha Daniel Solomon Lieber Computational and Experimental Approaches For Evaluating the Genetic Basis of Mitochondrial Disorders Abstract Mitochondria are responsible for some of the cell’s most fundamental biological pathways and metabolic processes, including aerobic ATP production by the mitochondrial respiratory chain. In humans, mitochondrial dysfunction can lead to severe disorders of energy metabolism, which are collectively referred to as mitochondrial disorders and affect approximately 1:5,000 individuals. These disorders are clinically heterogeneous and can affect multiple organ systems, often within a single individual. Symptoms can include myopathy, exercise intolerance, hearing loss, blindness, stroke, seizures, diabetes, and GI dysmotility.
    [Show full text]