DOCSLIB.ORG

Additional Information #1

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

Additional information #1. Genes with a statistically different expression as a result of exposure to bleomycin, analyzed in 14 lymphoblastoid cell lines Gene Description p-value GenBank Accession Increased expression by bleo treatment CAMK1 Calcium/calmodulin-dependent protein kinase I 0.001 NM_003656 CDKN1A Cyclin-dependent kinase inhibitor 1A (p21, Cip1) 0.001 U03106 XPC Xeroderma pigmentosum, complementation group C 0.001 NM_004628 H2AFZ H2A histone family, member Z 0.001 NM_002106 POLH Polymerase (DNA directed), eta 0.001 NM_006502 FDXR Ferredoxin reductase 0.001 NM_004110 RGS16 Regulator of G-protein signalling 16 0.001 NM_002928 FRDA Frataxin 0.001 NM_000144 TNFSF7 Tumor necrosis factor (ligand) superfamily, member 7 0.001 NM_001252 TNFSF9 Tumor necrosis factor (ligand) superfamily, member 9 0.001 NM_003811 UBR1 Ubiquitin protein ligase E3 component n-recognin 1 0.001 AF061556 BBC3 BCL2 binding component 3 0.001 U82987 CD37 CD37 antigen 0.001 NM_001774 ANKFY1 Ankyrin repeat and FYVE domain containing 1 0.001 NM_016376 CX3CL1 Chemokine (C-C motif) ligand 22 0.001 NM_002990 PPM1D Protein phosphatase 1D magnesium-dependent, delta isoform 0.001 NM_003620 COL4A4 Collagen, type IV, alpha 4 0.002 NM_000092 DDB2 Damage-specific DNA binding protein 2, 48kDa 0.002 NM_000107 TKTL1 Transketolase-like 1 0.002 NM_012253 RABL4 RAB, member of RAS oncogene family-like 4 0.002 NM_006860 SLMAP Sarcolemma associated protein 0.002 NM_007159 GKAP1 G kinase anchoring protein 1 0.002 AF319476 TNFSF14 Tumor necrosis factor (ligand) superfamily, member 14 0.002 NM_003807 HIRIP3 HIRA interacting protein 3 0.002 NM_003609 KIF3B Kinesin family member 3B 0.002 NM_004798 PLK3 Polo-like kinase 3 (Drosophila) 0.002 NM_004073 ITIH2 Inter-alpha (globulin) inhibitor H2 0.002 NM_002216 SERPINA4 Serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4 0.002 NM_006215 MYL3 Myosin, light polypeptide 3, alkali; ventricular, skeletal, slow 0.002 NM_000258 ATP5B ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide 0.003 NM_001686 GNLY Granulysin 0.003 NM_012483 DRP2 Dystrophin related protein 2 0.003 NM_001939 GRID2 Glutamate receptor, ionotropic, delta 2 0.003 NM_001510 SGSH N-sulfoglucosamine sulfohydrolase (sulfamidase) 0.003 NM_000199 UCN Urocortin 0.003 NM_003353 PGLS 6-phosphogluconolactonase 0.003 NM_012088 PHKG2 Phosphorylase kinase, gamma 2 (testis) 0.003 NM_000294 SLC25A5 Solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5 0.003 L32786 ARID3A AT rich interactive domain 3A (BRIGHT- like) 0.003 NM_005224 TITF1 Hypothetical protein LOC253970 0.003 AK027147 IL27RA Interleukin 27 receptor, alpha 0.003 NM_004843 PGS1 Phosphatidylglycerophosphate synthase 0.004 AL359590 GP9 Glycoprotein IX (platelet) 0.004 NM_000174 DPP4 Dipeptidylpeptidase 4 (CD26, adenosine deaminase complexing protein 2) 0.004 NM_001935 HSD11B2 Hydroxysteroid (11-beta) dehydrogenase 2 0.004 NM_000196 METTL1 Methyltransferase like1 0.004 Y18643 DNAH7 Dynein, axonemal, heavy polypeptide 7 0.004 AJ132084 SNAP25 Synaptosomal-associated protein, 25kDa 0.004 NM_003081 HSD3B2 Hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2 0.004 NM_000198 SPPL2B Signal peptide peptidase-like 2B 0.004 AB040965 PLG Plasminogen 0.004 NM_000301 RHOBTB1 Rho-related BTB domain containing 1 0.004 AB018283 AR Androgen receptor 0.004 L29496 Decreased expression by bleomycin treatment PIP5K1A Phosphatidylinositol-4-phosphate 5-kinase, type I, alpha 0.001 NM_003557 ACSL1 Acyl-CoA synthetase long-chain family member 1 0.001 NM_001995 TPX2 TPX2, microtubule-associated protein homolog (Xenopus laevis) 0.001 AB024704 BST2 Bone marrow stromal cell antigen 2 0.001 NM_004335 PPP3CB Protein phosphatase 3 (formerly 2B), catalytic subunit, beta isoform (calcineurin A beta) 0.001 M29551 CSNK2A1 Casein kinase 2, alpha 1 polypeptide 0.001 NM_001895 CD53 CD53 antigen 0.001 M37033 CENPA Centromere protein A, 17kDa 0.001 NM_001809 CCNB2 Cyclin B2 0.001 NM_004701 ZNF410 Zinc finger protein 410 0.001 U90919 DCTN2 Dynactin 2 (p50) 0.001 NM_006400 TLP19 Endoplasmic reticulum thioredoxin superfamily member, 18 kDa 0.001 NM_015913 LTA4H Leukotriene A4 hydrolase 0.001 NM_000895 CCNA2 Cyclin A2 0.001 NM_001237 TUBA6 Tubulin alpha 6 0.001 D28390 CECR5 Cat eye syndrome chromosome region, candidate 5 0.001 NM_017829 FKBP4 FK506 binding protein 4, 59kDa 0.001 NM_002014 KNTC2 Kinetochore associated 2 0.001 NM_006101 LAPTM4A Lysosomal-associated protein transmembrane 4 alpha 0.001 NM_014713 TM9SF1 Transmembrane 9 superfamily member 1 0.001 NM_006405 MORF4L2 Mortality factor 4 like 2 0.001 NM_012286 ELAVL1 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R) 0.001 NM_001419 MRPS17 Mitochondrial ribosomal protein S17 0.001 NM_015969 PLK1 Polo-like kinase 1 (Drosophila) 0.001 NM_005030 CDC25B Cell division cycle 25B 0.001 NM_004358 RAC1 Ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1) 0.001 D25274 RAMP RA-regulated nuclear matrix-associated protein 0.001 NM_016448 SSR2 Signal sequence receptor, beta (translocon-associated protein beta) 0.001 NM_003145 TM9SF2 Transmembrane 9 superfamily member 2 0.001 NM_004800 DERP6 S-phase 2 protein 0.001 NM_015362 SF1 Splicing factor 1 0.001 NM_004630 SIAH2 Seven in absentia homolog 2 (Drosophila) 0.001 NM_005067 XBP1 X-box binding protein 1 0.001 NM_005080 EIF4G2 Eukaryotic translation initiation factor 4 gamma, 2 0.001 NM_001418 ADAMTS9 A disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9 0.001 NM_020249 NEDD8 Neural precursor cell expressed, developmentally down-regulated 8 0.001 NM_006156 UBE2G1 Ubiquitin-conjugating enzyme E2G 1 (UBC7 homolog, C. elegans) 0.001 D78514 TIMM10 Translocase of inner mitochondrial membrane 10 homolog (yeast) 0.001 NM_012456 CCT8 Chaperonin containing TCP1, subunit 8 (theta) 0.002 NM_006585 HSPA8 Heat shock 70kDa protein 8 0.002 NM_006597 BCAP29 B-cell receptor-associated protein 29 0.002 NM_018844 CALU Calumenin 0.002 NM_001219 NALP1 NACHT, leucine rich repeat and PYD (pyrin domain) containing 1 0.002 NM_014922 RGC32 Response gene to complement 32 0.002 NM_014059 CLIC4 Chloride intracellular channel 4 0.002 NM_013943 CDK4 Cyclin-dependent kinase 4 0.002 NM_000075 DCTD DCMP deaminase 0.002 NM_001921 DAP3 Death associated protein 3 0.002 NM_004632 DLD Dihydrolipoamide dehydrogenase 0.002 NM_000108 PSAP Prosaposin (variant Gaucher disease and variant metachromatic leukodystrophy) 0.002 J03077 GEMIN6 Gem (nuclear organelle) associated protein 6 0.002 AK027112 GOT1 Glutamic-oxaloacetic transaminase 1, soluble (aspartate aminotransferase 1) 0.002 NM_002079 GARS Glycyl-tRNA synthetase 0.002 NM_002047 TUBB1 Tubulin, beta 1 0.002 AJ292757 ARF3 ADP-ribosylation factor 3 0.002 NM_001659 RHEB Ras homolog enriched in brain 0.002 NM_005614 MTHFD1 Methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, 0.002 NM_005956 DHX35 DEAH (Asp-Glu-Ala-His) box polypeptide 35 0.002 AK026412 MLC1 Megalencephalic leukoencephalopathy with subcortical cysts 1 0.002 D25217 IDH3B Isocitrate dehydrogenase 3 (NAD+) beta 0.002 NM_006899 ED1 Ectodysplasin A 0.002 NM_001399 MAPRE1 Microtubule-associated protein, RP/EB family, member 1 0.002 NM_012325 MRPL37 Mitochondrial ribosomal protein L37 0.002 NM_016491 MLLT3 Myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 0.002 NM_004529 NUP93 Nucleoporin 93kDa 0.002 NM_014669 SLC29A2 Solute carrier family 29 (nucleoside transporters), member 2 0.002 AF034102 OLFM1 Olfactomedin 1 0.002 U79299 FLJ20399 DEAD (Asp-Glu-Ala-Asp) box polypeptide 28 0.002 NM_018380 PRDX1 Peroxiredoxin 1 0.002 NM_002574 CUL7 Cullin 7 0.002 NM_014780 MID1 Midline 1 (Opitz/BBB syndrome) 0.002 NM_000381 DUSP12 Dual specificity phosphatase 12 0.002 NM_007240 RAB2 RAB2, member RAS oncogene family 0.002 NM_002865 RAD21 RAD21 homolog (S. pombe) 0.002 NM_006265 TRA2A Transformer-2 alpha 0.002 NM_013293 CBFB Core-binding factor, beta subunit 0.002 AF294326 GRB7 Growth factor receptor-bound protein 7 0.002 NM_005310 RNUT1 RNA, U transporter 1 0.002 NM_005701 SKP1A S-phase kinase-associated protein 1A (p19A) 0.002 D17032 AF5Q31 ALL1 fused gene from 5q31 0.002 NM_014423 EIF4A1 CD68 antigen 0.002 D17188 RFP Ret finger protein 0.002 NM_006510 TPD52 Tumor protein D52 0.002 NM_005079 CUL2 Cullin 2 0.002 NM_003591 ZNF330 Zinc finger protein 330 0.002 NM_014487 AK3L1 Adenylate kinase 3 0.003 NM_016282 MGAT2 Mannosyl (alpha-1,6-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase 0.003 NM_002408 SLC38A2 Solute carrier family 38, member 2 0.003 NM_018976 ANXA2 Annexin A2 0.003 NM_004039 BAT1 HLA-B associated transcript 1 0.003 NM_004640 FADD Fas (TNFRSF6)-associated via death domain 0.003 NM_003824 SSA1 Tripartite motif-containing 21 0.003 NM_003141 PRKRA Protein kinase, interferon-inducible double stranded RNA dependent activator 0.003 NM_003690 EXO1 Exonuclease 1 0.003 NM_003686 XPO6 Exportin 6 0.003 AB002368 ATP6V1E1 ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E isoform 1 0.003 NM_001696 PGAM1 Phosphoglycerate mutase 1 (brain) 0.003 NM_002629 NUP54 Nucleoporin 54kDa 0.003 NM_017426 OAZIN Antizyme inhibitor 1 0.003 NM_015878 OGDHL Oxoglutarate dehydrogenase-like 0.003 NM_018245 HPRP8BP WD repeat domain 57 (U5 snRNP specific) 0.003 NM_004814 PHB Prohibitin 0.003 NM_002634 TRAPPC4 Trafficking protein particle complex 4 0.003 NM_016146 COPZ1 Coatomer protein complex, subunit zeta 1 0.003 NM_016057 SNX1 Sorting nexin 1 0.003 NM_003099
Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
  • ATP-Induced Focal Adhesion Kinase Activity Is Negatively Modulated by Phospholipase D2 in PC12 Cells

    ATP-Induced Focal Adhesion Kinase Activity Is Negatively Modulated by Phospholipase D2 in PC12 Cells

    EXPERIMENTAL and MOLECULAR MEDICINE, Vol. 33, No. 3, 150-155, September 2001 ATP-induced focal adhesion kinase activity is negatively modulated by phospholipase D2 in PC12 cells Yoe-Sik Bae1 and Sung Ho Ryu1,2 Introduction 1 Division of Molecular and Life Sciences, Pohang University of Purinergic receptors have been reported to play impor- Science and Technology, Pohang 790-784, Korea tant roles on the regulation of neuronal cell functions 2 Corresponding author: Tel, +82-54-279-2292; (Communi et al., 2000; Di Iorio et al., 1998). ATP, a Fax, +82-54-279-2199; E-mail, [email protected] ligand for the receptors modulate various cellular re- sponses such as mitogenic and morphogenic activity in Accepted 18 September 2001 PC12 rat pheochromocytoma cells (Neary et al., 1996; Soltoff et al., 1998; Schindelholz et al., 2000). Stimu- Abbreviations: Fak, focal adhesion kinase; PLD, phospholipase D; lation of cells with ATP induces tyrosine phosphorylation PA, phosphatidic acid; PC, phosphatidylcholine; DAG, diacylglyc- of several cytoskeletal proteins and focal adhesion erol; PBt, phosphatidylbutanol; PKC, protein kinase C; PAP, phos- molecules such as focal adhesion kinase (Fak), proline- phatidic acid phosphohydrolase rich tyrosine kinase (Pyk2), and paxillin (Soltoff et al., 1998; Schindelholz et al., 2000). Since these cytosk- eleton-associated proteins have been regarded as important factors for the regulation of neuronal cell Abstract functions, the study on the regulatory mechanism for the proteins remains an important issue. Extracellular ATP has been known to modulate vari- Phospholipase D (PLD) catalyzes the hydrolysis of ous cellular responses including mitogenesis, secre- phosphatidylcholine (PC) into phosphatidic acid (PA) tion and morphogenic activity in neuronal cells.
  • Oncogenic KRAS and BRAF Drive Metabolic Reprogramming in Colorectal Cancer

    Oncogenic KRAS and BRAF Drive Metabolic Reprogramming in Colorectal Cancer

    Oncogenic KRAS and BRAF Drive Metabolic Reprogramming in Colorectal Cancer By Josiah Ewing Hutton, III. Dissertation Submitted to the Faculty of the Graduate School of Vanderbilt University in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY in Biochemistry December 2016 Nashville, Tennessee Approved: Daniel C. Liebler, Ph.D. Robert J. Coffey, M.D. Bruce D. Carter, Ph.D. Nicholas J. Reiter, Ph.D. Jamey D. Young, Ph.D. Charles R. Sanders, Ph.D. Acknowledgements I would like to acknowledge my mentor, Dr. Daniel Liebler, for his constant guidance throughout my graduate career. Dan allowed me the freedom to develop as a scientist, and tactfully provided the tutelage and discussion I needed at exactly the right time and not a moment earlier. I will be grateful for his mentorship, insight, and his wit for the rest of my career. I would also like to acknowledge all current and former laboratory members for not only providing insight and guidance with my dissertation, but also for making every single day in lab enjoyable. I wish to acknowledge my committee members, Dr. Bruce Carter, Dr. Robert Coffey, Dr. Nicholas Reiter, Dr. Charles Sanders, and Dr. Jamey Young. Our meetings throughout the years have helped to guide my research to the work that it is today. I am grateful to my friends, who have always been there for me and would quietly, and sometimes not so quietly, listen to me rehearse my dissertation while we were climbing, so long as I would then push them to climb harder. Lastly, I am grateful to my family, who have always supported me and driven me to work harder.
  • Datasheet for Protein Phosphatase 1 (PP1) (P0754; Lot 0121306)

    Datasheet for Protein Phosphatase 1 (PP1) (P0754; Lot 0121306)

    Supplied in: 200 mM NaCl, 50 mM HEPES Unit Definition: One unit is defined as Notes On Use: Avoid freeze/thaw cycles. Can be Protein the amount of enzyme that hydrolyzes 1 nmol of stored for 1 week or less at –20°C. (pH 7.0 @ 25°C), 1 mM MnCl2, 0.1 mM EGTA, Phosphatase 1 2.5 mM dithiothreitol, 0.025% Tween-20 and p-Nitrophenyl Phosphate (50 mM) (NEB #P0757) 50% glycerol. Store at –70°C in 1 minute at 30°C in a total reaction volume of The following information can be used as (PP1) 50 µl. suggested initial conditions for dephosphorylation 1-800-632-7799 Applications: PP1 can be used to release of proteins with PP1. [email protected] phosphate groups from phosphorylated serine, Specific Activity: ~ 80,000 units/mg. www.neb.com 0.1 unit of PP1 removes ~100% of phosphates P0754S 012130614061 threonine and tyrosine residues in proteins. Note that different proteins are dephosphorylated at Molecular Weight: 37.5 kDa. (0.5 nmol) from phosphoserine/threonine different rates. residues in phosphorylase a as well as in P0754S r y Purity: PP1 has been purified to > 90% phosphorylated myelin basic protein (phospho- 100 units 2,500 U/ml Lot: 0121306 Reagents Supplied with Enzyme: homogeneity as determined by SDS-PAGE and MyBP, 18.5 kDa) in 30 minutes in a 50 µl reaction. RECOMBINANT Store at –70°C Exp: 6/14 10X NEBuffer for Protein MetalloPhosphatases Coomassie Blue staining. The concentration of phospho-MyBP is 10 µM (PMP) with respect to phosphate. Description: Protein Phosphatase 1 (PP1) is a 10X MnCl2 (10 mM) Quality Assurance: PP1 contains no detectable Mn2+-dependent protein phosphatase with activity protease activity.
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • Laboratory Genetic Testing in Clinical Practice

    Laboratory Genetic Testing in Clinical Practice

    BioMed Research International Laboratory Genetic Testing in Clinical Practice Guest Editors: Ozgur Cogulu, Yasemin Alanay, and Gokce A. Toruner Laboratory Genetic Testing in Clinical Practice BioMed Research International Laboratory Genetic Testing in Clinical Practice Guest Editors: Ozgur Cogulu, Yasemin Alanay, and Gokce A. Toruner Copyright © 2013 Hindawi Publishing Corporation. All rights reserved. This is a special issue published in “BioMed Research International.” All articles are open access articles distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Contents Laboratory Genetic Testing in Clinical Practice,OzgurCogulu,YaseminAlanay,andGokceA.Toruner Volume 2013, Article ID 532897, 1 page Identification and Characterization of DM1 Patients by a NewDiagnostic Certified Assay: Neuromuscular and Cardiac Assessments, Rea Valaperta, Valeria Sansone, Fortunata Lombardi, Chiara Verdelli, Alessio Colombo, Massimiliano Valisi, Elisa Brigonzi, Elena Costa, and Giovanni Meola Volume 2013, Article ID 958510, 6 pages Ultradeep Pyrosequencing of Hepatitis C Virus Hypervariable Region 1 in Quasispecies Analysis, Kamila Caraballo Cortes,´ Osvaldo Zagordi, Tomasz Laskus, Rafal Ploski, Iwona Bukowska-O´sko, Agnieszka Pawelczyk, Hanna Berak, and Marek Radkowski Volume 2013, Article ID 626083, 10 pages Feasibility of a Microarray-Based Point-of-Care CYP2C19 Genotyping Test for Predicting Clopidogrel On-Treatment Platelet
  • Role of Phospholipases in Adrenal Steroidogenesis

    Role of Phospholipases in Adrenal Steroidogenesis

    229 1 W B BOLLAG Phospholipases in adrenal 229:1 R29–R41 Review steroidogenesis Role of phospholipases in adrenal steroidogenesis Wendy B Bollag Correspondence should be addressed Charlie Norwood VA Medical Center, One Freedom Way, Augusta, GA, USA to W B Bollag Department of Physiology, Medical College of Georgia, Augusta University (formerly Georgia Regents Email University), Augusta, GA, USA [email protected] Abstract Phospholipases are lipid-metabolizing enzymes that hydrolyze phospholipids. In some Key Words cases, their activity results in remodeling of lipids and/or allows the synthesis of other f adrenal cortex lipids. In other cases, however, and of interest to the topic of adrenal steroidogenesis, f angiotensin phospholipases produce second messengers that modify the function of a cell. In this f intracellular signaling review, the enzymatic reactions, products, and effectors of three phospholipases, f phospholipids phospholipase C, phospholipase D, and phospholipase A2, are discussed. Although f signal transduction much data have been obtained concerning the role of phospholipases C and D in regulating adrenal steroid hormone production, there are still many gaps in our knowledge. Furthermore, little is known about the involvement of phospholipase A2, Endocrinology perhaps, in part, because this enzyme comprises a large family of related enzymes of that are differentially regulated and with different functions. This review presents the evidence supporting the role of each of these phospholipases in steroidogenesis in the Journal Journal of Endocrinology adrenal cortex. (2016) 229, R1–R13 Introduction associated GTP-binding protein exchanges a bound GDP for a GTP. The G protein with GTP bound can then Phospholipids serve a structural function in the cell in that activate the enzyme, phospholipase C (PLC), that cleaves they form the lipid bilayer that maintains cell integrity.
  • Anti-IDH3A Antibody (ARG42205)

    Anti-IDH3A Antibody (ARG42205)

    Product datasheet [email protected] ARG42205 Package: 100 μl anti-IDH3A antibody Store at: -20°C Summary Product Description Rabbit Polyclonal antibody recognizes IDH3A Tested Reactivity Hu, Ms, Rat Tested Application ICC/IF, IHC-P, WB Host Rabbit Clonality Polyclonal Isotype IgG Target Name IDH3A Antigen Species Human Immunogen Recombinant fusion protein corresponding to aa. 28-366 of Human IDH3A (NP_005521.1). Conjugation Un-conjugated Alternate Names Isocitrate dehydrogenase [NAD] subunit alpha, mitochondrial; EC 1.1.1.41; NAD; Isocitric dehydrogenase subunit alpha; + Application Instructions Application table Application Dilution ICC/IF 1:50 - 1:200 IHC-P 1:50 - 1:200 WB 1:500 - 1:2000 Application Note * The dilutions indicate recommended starting dilutions and the optimal dilutions or concentrations should be determined by the scientist. Positive Control Raji Calculated Mw 40 kDa Observed Size ~ 40 kDa Properties Form Liquid Purification Affinity purified. Buffer PBS (pH 7.3), 0.02% Sodium azide and 50% Glycerol. Preservative 0.02% Sodium azide Stabilizer 50% Glycerol Storage instruction For continuous use, store undiluted antibody at 2-8°C for up to a week. For long-term storage, aliquot and store at -20°C. Storage in frost free freezers is not recommended. Avoid repeated freeze/thaw www.arigobio.com 1/3 cycles. Suggest spin the vial prior to opening. The antibody solution should be gently mixed before use. Note For laboratory research only, not for drug, diagnostic or other use. Bioinformation Gene Symbol IDH3A Gene Full Name isocitrate dehydrogenase 3 (NAD+) alpha Background Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate.
  • Supplementary Table 1: Adhesion Genes Data Set

    Supplementary Table 1: Adhesion Genes Data Set

    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
  • Datasheet: MCA740PE Product Details

    Datasheet: MCA740PE Product Details

    Datasheet: MCA740PE Description: MOUSE ANTI HUMAN CD42b:RPE Specificity: CD42b Other names: GPIB-ALPHA Format: RPE Product Type: Monoclonal Antibody Clone: AK2 Isotype: IgG1 Quantity: 100 TESTS Product Details Applications This product has been reported to work in the following applications. This information is derived from testing within our laboratories, peer-reviewed publications or personal communications from the originators. Please refer to references indicated for further information. For general protocol recommendations, please visit www.bio-rad-antibodies.com/protocols. Yes No Not Determined Suggested Dilution Flow Cytometry Neat Where this antibody has not been tested for use in a particular technique this does not necessarily exclude its use in such procedures. The suggested working dilution is given as a guide only. It is recommended that the user titrates the antibody for use in his/her own system using appropriate negative/positive controls. Target Species Human Product Form Purified IgG conjugated to R. Phycoerythrin (RPE) - lyophilized Reconstitution Reconstitute with 1 ml distilled water Max Ex/Em Fluorophore Excitation Max (nm) Emission Max (nm) RPE 488nm laser 496 578 Preparation Purified IgG prepared by affinity chromatography on Protein A from tissue culture supernatant Buffer Solution Phosphate buffered saline Preservative 0.09% Sodium Azide Stabilisers 1% Bovine Serum Albumin 5% Sucrose External Database Links UniProt: P07359 Related reagents Entrez Gene: 2811 GP1BA Related reagents Page 1 of 3 Specificity Mouse anti Human CD42b antibody, clone AK2 recognizes the human CD42b cell surface antigen, also known as platelet glycoprotein GP1B. CD42b is expressed by platelets and megakaryocytes. Clone AK2 has been reported to block the binding of von Willebrand Factor (VWF) to platelets Flow Cytometry Use 10ul of the suggested working dilution to label 100ul whole blood.
  • Folate Cycle Enzyme MTHFD1L Confers Metabolic Advantages in Hepatocellular Carcinoma

    Folate Cycle Enzyme MTHFD1L Confers Metabolic Advantages in Hepatocellular Carcinoma

    RESEARCH ARTICLE The Journal of Clinical Investigation Folate cycle enzyme MTHFD1L confers metabolic advantages in hepatocellular carcinoma Derek Lee,1 Iris Ming-Jing Xu,1 David Kung-Chun Chiu,1 Robin Kit-Ho Lai,1 Aki Pui-Wah Tse,1 Lynna Lan Li,1 Cheuk-Ting Law,1 Felice Ho-Ching Tsang,1 Larry Lai Wei,1 Cerise Yuen-Ki Chan,1 Chun-Ming Wong,1,2 Irene Oi-Lin Ng,1,2 and Carmen Chak-Lui Wong1,2 1Department of Pathology and 2State Key Laboratory for Liver Research, The University of Hong Kong, Hong Kong, China. Cancer cells preferentially utilize glucose and glutamine, which provide macromolecules and antioxidants that sustain rapid cell division. Metabolic reprogramming in cancer drives an increased glycolytic rate that supports maximal production of these nutrients. The folate cycle, through transfer of a carbon unit between tetrahydrofolate and its derivatives in the cytoplasmic and mitochondrial compartments, produces other metabolites that are essential for cell growth, including nucleotides, methionine, and the antioxidant NADPH. Here, using hepatocellular carcinoma (HCC) as a cancer model, we have observed a reduction in growth rate upon withdrawal of folate. We found that an enzyme in the folate cycle, methylenetetrahydrofolate dehydrogenase 1–like (MTHFD1L), plays an essential role in support of cancer growth. We determined that MTHFD1L is transcriptionally activated by NRF2, a master regulator of redox homeostasis. Our observations further suggest that MTHFD1L contributes to the production and accumulation of NADPH to levels that are sufficient to combat oxidative stress in cancer cells. The elevation of oxidative stress through MTHFD1L knockdown or the use of methotrexate, an antifolate drug, sensitizes cancer cells to sorafenib, a targeted therapy for HCC.
  • TPMS Technology to Infer Biomarkers of Macular Degeneration Prognosis

    TPMS Technology to Infer Biomarkers of Macular Degeneration Prognosis

    bioRxiv preprint doi: https://doi.org/10.1101/625889; this version posted May 2, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. TPMS technology to infer biomarkers of macular degeneration prognosis in in silico simulated prototype-patients under the study of heart failure treatment with sacubitril and valsartan Guillem Jorba1,*, Joaquim Aguirre-Plans2,*, Valentin Junet1, Cristina Segú-Vergés1, José Luis Ruiz1, Albert Pujol1, NarCis Fernandez-Fuentes3, José Manuel Mas1, Baldo Oliva2 1AnaxomiCs BioteCh SL, BarCelona 08008, Catalonia, Spain 2StruCtural BioinformatiCs Group, ResearCh Programme on BiomediCal InformatiCs, Department of Experimental and Health ScienCe, Universitat Pompeu Fabra, BarCelona 08003, Catalonia, Spain 3Department of BiosCienCes, U ScienCe TeCh, Universitat de ViC-Universitat Central de Catalunya, ViC 08500, Catalonia, Spain *These authors Contributed equally to this work and are Considered to be Co-first authors Brief running title TPMS for in silico simulations of patients Corresponding author Baldo Oliva & José Manuel Mas Manuscript keywords: - In SiliCo CliniCal Trials - CardiovasCular Diseases - Heart Failure - Adverse effeCts - MaCular Degeneration - Comorbidity Authorship Confirmation Statement: JAP, GJ, CSV, JMM & BO analysed the data. GJ, VJ, CSV, JLR & JMM studied HF and MD with TPMS. AP, GJ, JLR & JMM desCribed the methods of TPMS. JAP, NFF & BO desCribed the methods of GUILDify. CSV & JMM analysed and desCribed the potential biomarkers for MD adverse effects by sacubitril/valsartan. JAP, NFF & BO Compared the results of TPMS with GUILDify.