A Dissertation
entitled
Exploring the Roles of TM4SF3 and CSN4 in Prostate Cancer
by
Meenakshi Bhansali
Submitted to the Graduate Faculty as partial fulfillment of the requirements for the
Doctor of Philosophy Degree in Biology
______Dr. Lirim Shemshedini, Committee Chair
______Dr. Scott Leisner, Committee Member
______Dr. Malathi Krishnamurthy, Committee Member
______Dr. Paul W. Erhardt, Committee Member
______Dr. Jeffrey G. Sarver, Committee Member
______Dr. Patricia R. Komuniecki, Dean College of Graduate Studies
The University of Toledo
December 2014
Copyright 2014, Meenakshi Bhansali
This document is copyrighted material. Under copyright law, no parts of this document may be reproduced without the expressed permission of the author. An Abstract of
Exploring the Roles of TM4SF3 and CSN4 in Prostate Cancer
by
Meenakshi Bhansali
Submitted to the Graduate Faculty as partial fulfillment of the requirements for the Doctor of Philosophy Degree in Biology
The University of Toledo December 2014
Prostate cancer (PCa) is the most common non-skin cancer in males in the United States.
Androgen Receptor (AR) is believed to remain active during progression of castration resistant PCa (CRPC). We performed gene microarray analysis and identified sGCα1 as an androgen-induced gene while TM4SF3 and BARD1 were repressed genes. Earlier we published that sGCα1 is involved in PCa cell growth and survival, independent of the classical nitric oxide (NO) signaling pathway and its association with sGCβ1. We identified by mass spectrometric analysis CSN4 as a novel binding partner for sGCα1.
We observed that sGCα1 and CSN4 interact and co-localize in PCa cells. CSN4 positively regulates the sGCα1 protein stability by preventing sGCα1 proteasome- dependent degradation. Furthermore, disruption of CSN4 led to reduced PCa cell growth and these cells can be rescued significantly but not entirely by overexpression of sGCα1.
This observation opened the possibility of another target for CSN4, which is p53. We observed that CSN4 negatively regulates p53 protein stability by promoting its proteasome-dependent degradation. Most importantly, CSN4 knock-down cells were rescued almost completely when we overexpressed sGCα1 and p53 knock-down. CSN5 acts downstream of CSN4 and is involved in mediating the CSN4-dependent effect on
iii sGCα1 and p53 proteins. Further, we found that CK2 kinase exists in sGCα1-p53-CSN4-
CSN5 protein complex and is involved in influencing the stability of sGCα1 and p53.
TM4SF3 is unique in its androgen regulation as the mRNA is androgen-repressed and protein is androgen up-regulated. We focused on androgen up-regulation of TM4SF3 in different PCa cell lines. Androgen positively regulates TM4SF3 protein stability by preventing the proteasomal-degradation of TM4SF3. Our findings demonstrate that
TM4SF3 is required for migration/invasiveness and epithelial mesenchymal transition of
PCa cells. In addition to being localized in the membrane, TM4SF3 exhibits a novel androgen-dependent nuclear localization in AR-positive PCa cells. Interestingly endogenous TM4SF3 interacts with nuclear AR in an androgen-dependent manner in PCa cells and in vitro. Most importantly, the association of TM4SF3 with AR is required for
AR protein stability, transactivation and androgen-induced proliferation of PCa cells.
TM4SF3 and AR are overexpressed in prostate tumors, consistent with their mutual stabilization in PCa cells. Like TM4SF3, BARD1 is androgen-repressed gene, down- regulated at the mRNA and protein levels in PCa cells. Most importantly, overexpression of BARD1 affects endogenous AR protein levels, its transcriptional activity and endogenous gene prostate specific antigen.
iv Acknowledgements
I would like to thank my mentor, Dr. LIRIM SHEMSHEDINI for his encouragement, valuable time, guidance and patience while working on my projects. He provided me freedom and the opportunity to work on two novel projects. I learned art of scientific and manuscripts writings from him that helped me immensely while working on the dissertation.
A special thank to my committee members for their precious time and suggestions. My sincere thanks to Dr. Richard Komuniecki and Dr. Malathi
Krishnamurthy for their unconditional help and emotional support during my stay here. I take this moment to express my gratitude to the University of Toledo for funding and the opportunity to gain teaching experience. A deep sense of gratitude to the Molecular
Endocrinology Journal for highlighting my publication in June 2014.
I like to thank all my old lab members, especially, Dr. Shuai Gao and current lab member Jun Zhou for their support. My heartfelt thanks to all my friends in the department. I cannot forget to thank my family and my husband Pravin who was with me in my every odd and even moments.
v Table of Contents
Abstract ...... iii
Acknowledgements ...... v
Table of Contents ...... vii
List of Figures ...... viii
List of Abbreviations ...... x
1 Introduction…...... ….1
2 Manuscript 1 …...... ….21
3 Manuscript 2…...... ….75
4 Additional Results…...... ….126
5 Discussion…….…...... ….159
References ...... 178
vi List of Figures
Figure A. Structure of different functional domains of human AR……...... 2
Figure B. Diagram of Tetraspanin structure ...... 12
Figure 1-I: CSN4 is a novel binding partner for sGCα1 in prostate cancer cells...... 50
Figure 2-I: CSN4 positively regulates sGCα1 stability and is involved in sGCα1-
dependent prostate cancer cell growth...... 52
Figure 3-I: CSN4 negatively regulates p53 stability and provides prostate cancer cells
enhanced growth...... 54
Figure 4-I: CSN4 affects p53 transcriptional activity and disrupts p53-dependent
apoptosis...... 56
Figure 5-I: CSN4 protein is over-expressed in prostate tumors and correlates directly with
sGCα1 and inversely with p53 proteins...... 58
Figure 6-I: CSN4 regulates CSN5 protein levels in prostate cancer cell lines...... 60
Figure 7-I: CSN5 antagonistically regulates p53 and sGCα1 proteins in prostate cancer.62
Figure 8-I: CK2 associates with and regulates p53 and sGCα1 proteins in prostate cancer
cells ...... 64
Figure S1-I: CSN4 does not affect mRNA expression of sGCα1, p53, or CSN5...... 66
Figure S2-I: CSN4 affects the growth of AR-positive prostate cancer cells, but not AR-
negative cells...... 68
vii Figure S3-I: Cyclase-deficient sGCα1 rescues the growth of prostate cancer cells depleted
for CSN4...... 70
Figure S4-I: p53 does not affect sGCα1 protein levels nor the growth of prostate cancer
cells...... 72
Figure S5-I: CSN4 mRNA is over-expressed in prostate tumors...... 74
Figure 1-II: Androgen down-regulates TM4SF3 mRNA and up-regulates the protein.. 105
Figure 2-II: AR is required for androgen up-regulation of TM4SF3 protein...... 107
Figure 3-II: TM4SF3 induces invasion, migration, and EMT of prostate cancer cells.. 109
Figure 4-II: TM4SF3 co-localizes and interacts with AR in prostate cancer cells...... 111
Figure 5-II: TM4SF3 co-localizes and interacts with AR in AR-expressing PC-3 cells. 113
Figure 6-II: TM4SF3 up-regulates the AR protein and androgen signaling...... 115
Figure 7-II: TM4SF3 and AR are over-expressed in prostate cancer...... 117
Figure S1-II: Androgen down-regulates TM4SF3 mRNA...... 119
Figure S2-II: TM4SF3 induces invasion and migration of prostate cancer cells...... 121
Figure S3-II: Androgen up-regulates and induces nuclear localization of exogenous
TM4SF3 in prostate cancer...... 123
Figure S41-II: TM4SF3 up-regulates the AR protein and androgen signaling...... 125
Figure 1-III: CSN4 regulates CSN6 protein levels in prostate cancer cell lines...... 136
Figure 2-III: Androgen down-regulates TM4SF3 mRNA in AR-positive prostate cancer
cells...... 138
Figure 3-III: AR is required for androgen down-regulation of TM4SF3 mRNA...... 140
Figure 4-III: Androgen down- regulates endogenous, but not exogenous, TM4SF3
mRNA...... 142
viii Figure 5-III: Transcription and translation are required for androgen down-regulation of
TM4SF3 mRNA...... 144
Figure 6-III: Down-regulation of TM4SF3 protein results in reduced expression of
AGR2...... 146
Figure 7-III: AGR2 acts down-stream of TM4SF3 and involved in PC-3 cell invasion and
migration...... 148
Figure 8-III: Down-regulation of TM4SF3 leads to decrease in AKT and disruption of
AKT down-regulates TM4SF3 in PC-3 cells...... 150
Figure 9-III: Palmitoylation of TM4SF3 affects its stability and function...... 152
Figure 10-III: Androgen down-regulates BARD1 mRNA and protein in prostate cancer..
...... 154
Figure 11-III: AR is required for androgen down-regulation of BARD1mRNA in
androgen-dependent prostate cancer cells...... 156
Figure 12-III: BARD1 is involved in regulating endogenous AR expression and activity
in prostate cancer cells...... 158
ix List of Abbreviations
ADT androgen-deprivation therapy AF1 activation function 1 AF2 activation function 2 AGR2 anterior gradient 2 AIPC androgen-independent AR androgen receptor ARF alternative reading frame AR-Vs AR splice variants 2-BP 2-bromopalmitate BRD4 bromodomain containing protein 4 CK2 casein kinase 2 COP1 constitutive photomorphogenic 1 CRLs cullin-RING ligases CRPC castration resistant prostate cancer CSN4 COP9 signalosome subunit 4 DBD DNA-binding domain DHEA dehydroepiandrosterone DHT 5α-dihydrotestosterone ECL extra cellular loop EMT epithelial to mesenchymal transition ER endoplasmic reticulum GPCR G-protein coupled receptor GRAIL gene related to anergy in lymphocytes GSK3 glycogen synthase kinase 3 HSD3B1 3α-hydroxysteroid dehydrogenase 1 HSPs heat shock proteins JAMM Jab/MPN/Mov34 LBD ligand-binding domain LEL large extracellular loop LZAP LXXLL/leucine zipper-containing ARF binding protein MPN Mpr1-Pad1-N-terminal mTOR mammalian target of rapamycin NLBP novel LZAP-binding protein NLS nuclear localization signal NO nitric oxide
x PCa prostate cancer PCI proteasome, COP9, initiation factor 3 PDI protein disulphide isomerase PDK1 phosphoinositide-dependent kinase-1 PI3K phosphatidylinositol 3-kinase Pirh2 p53-induced RING H2 domain protein PKD protein kinase D PTEN phosphatase and tensin analog SCF Skp1-cullin-F-box TM transmembrane regions TM4SF3 transmembrane 4 superfamily 3 TORC2 mTOR complex 2 TSC tuberous sclerosis complex XAG2 Xenopus anterior gradient 2
xi Chapter 1
Introduction
Androgens:
Androgens, male sex steroid hormones, play important roles in development of male secondary sex characteristics and prostate gland (1). Androgens are produced by adrenal gland and testis in males and function as a physiological ligand for their cognitive receptor, androgen receptor (AR), a member of nuclear receptor family (1, 2). Compared to adrenal androgens, testicle testosterone and 5α-dihydrotestosterone (DHT) bind to AR with high affinity. Testosterone is reduced to DHT, a higher affinity ligand, by the enzyme 2,5α-reductases in normal prostate tissues. The adrenal gland produces weak androgens like androstenedione and dehydroepiandrosteron (DHEA), which are reduced to testosterone by 3α-hydroxysteroid dehydrogenase 1 (HSD3B1) in prostate gland (1, 2).
These weak adrenal androgens appear to be significant sources of an intratumoral synthesis of testosterone and may play an important role in progression of androgen- independent latter known as castration resistance prostate cancer (CRPC) (2, 3).
1 Androgen Receptor:
AR, a ligand-dependent transcription factor, belongs to nuclear receptor family, which regulate expression of different genes (1, 4).
Figure A: Structure of different functional domains of human AR indicated as N- terminal domain (NTD) containing activation function 1 (AF1), a central DNA-binding domain (DBD), a small hinge region (H), a C-terminal ligand-binding domain (LBD) containing activation function 2 (AF2). Reprinted from Mol Endocrinol. 2008;22(11):2373-82
As shown in Figure A (5), AR is a modular protein consists of different functional domains (6). Like other nuclear receptors, AR contains an N-terminal activation function
1 (AF1) which regulates interactions with co-activators or co-repressors, a central DNA- binding domain (DBD) that facilitates AR-DNA binding to the promoters of target genes, a small hinge region (H), a C-terminal ligand-binding domain (LBD) required for the ligand-binding, and a second, ligand-dependent activation function 2 (AF2). AR homodimerisation is required for DNA binding and transcriptional activation (7).
Androgen signaling and Androgen Receptor:
In an inactive state, AR is associated with heat shock proteins (HSPs) in the cytoplasm. Upon ligand binding, AR dissociates from heat-shock proteins in the cytoplasm, undergoes a conformational change, inducing phosphorylation (6), nuclear translocation (8), and dimerization (9). After homodimerisation, AR binds to the classical androgen-response elements in the promoter regions of target genes. Subsequent binding of AR to co-regulators, both co-activators and co-repressors either promotes or prevents
2 its interaction with the general transcription machinery. Activation or repression of target genes results in cell differentiation, survival, and proliferation in normal as well as prostate cancer cells (10-14).
Androgen signaling in prostate cancer:
Prostate adenocarcinoma is the most common non-cutaneous male malignancy and the second leading cause of cancer death in men in western countries (1). In 2011 in
USA, it is estimated that around 27,000 men will die due to prostate cancer; thus, it remains a major clinical challenge in the future (15-17).
Androgen signaling via AR is required for the development and growth of normal prostate tissues as well as prostate carcinogenesis (18). As androgens and AR signaling pathways are central oncogenic drivers in prostate carcinogenesis, they are main target for prostate cancer treatment.
In 1941, Huggins and Hodges reported the clinical activity of androgen- deprivation therapy (ADT), which induced regression of prostate tumors, and it remains the mainstay of systemic therapy (9, 19). ADT includes surgical castration and chemical castration to inhibit androgen production (20). Surgical castration includes direct androgen depletion by castration, (e.g., surgical orchiectomy, luteinizing hormone- releasing hormone (LHRH) agonists), chemical castration includes blockage of the AR
(e.g., flutamide, bicalutamide, MDV300), or combinations of AR antagonists like flutamide and bicalutamide that inhibit androgen binding to the androgen receptor (8).
Despite continuous ADT, primary prostate cancer progresses to the advanced stage,
CRPC (9).
3 In CRPC, though the prostate tumor is androgen-independent, still expresses functional AR and has a requirement of AR in the advance stage of prostate cancer (21).
Possible mechanisms involved in continued AR signaling in CRPC are:
1) AR amplification: In CRPC, AR gene amplification attributes to over-expression of
AR, which leads to increased AR sensitivity to low levels of intra-tumoral androgens, that led to restoration of AR transcriptional activity (22, 23).
2) AR mutations: In CRPC, the absence of androgens and anti-androgen therapy induce the selective pressure for emergence of AR mutations. These mutations are predominantly located in the ligand -binding domain and result in reduced specificity of
AR-ligand interaction. Mutations in the AR amino terminal region also facilitate androgen-independent AR activation resulting in increased ligand affinity to different non-androgens (24-26).
3) AR splice variants (AR-Vs): A large number of AR-Vs, which show insertion of an exon downstream of AR-DBD or deletion of exon in AR-LBD, have identified and up- regulated in CRPC (27). Two important AR-Vs, AR-V7 and ARv567es, have been shown to regulate the expression of subset of genes independent of full length AR and thus are involved in progression of CRPC (28, 29).
4) Alterations of the AR co-regulators: More than 170 potential co-regulators of AR have been identified which associate with AR and modify AR transcriptional activity by altering ligand binding. Some of them, like Steroid Receptor Co-activator (SRC) family members, have been reported to be overexpressed and bind to AR-N-terminal domain
(NTD). This binding allows AR transactivation in androgen-depleted conditions during
CRPC (30-33).
4 5) Post-translational modifications of AR: Post translational modifications of AR affect its stability and enhance AR transactivation in response to androgen-depleted conditions in CRPC (34). Different proteins like CDK1, AKT p38, ACK1 JNK and RNF6 have been reported to phosphorylate AR at distinct tyrosine sites, resulting in increase in the sensitivity of AR to low levels of androgens and thus enhancing AR transactivation (35-
37). Recently, CDK5-mediated serine phosphorylation of AR was shown to prevent its proteasome-dependent degradation thereby leading to subsequent activation of AR (38).
6) Alternative growth and survival pathways in CRPC: It has been shown that PI3K-
Akt pathway is genetically modified in 100% of metastatic prostate cancer. In a mouse study, it was observed that PTEN loss resulted in release and deregulation of the pro- apoptotic oncogene Bcl-2 that leads to prostate cancer cell survival and progression (30,
31).
Several studies have revealed that the AR transcriptional network is modified during the development of CRPC when AR can alter the transcription of a significant number of genes such as those involved in androgen synthesis like AKR1C3 and
SRD5A1, (39-41). AR directly regulates M-phase checkpoint inactivator genes like
CDC20, CDK1 and UBE2C and promotes tumor growth in mouse models (42). Another example of altered AR activity is a reactivation of TMPRSS2:ERG fusion gene expression by AR, contributing to the tumor progression in CRPC (43), ERG overexpression is reported to promote prostate cancer invasion (44, 45). Besides pro- growth function of AR, it also promotes prostate cancer cell invasion by up-regulating the expression of the (ETs Variant Gene 1) ETV1(1). However the mechanism of pro- invasive role of AR is still a wide area of research.
5 AR and Soluble Guanylyl Cyclase α1 Subunit (sGCα1):
Previously, our laboratory has identified the soluble guanylyl cyclase alpha one
(sGCα1; gene name GUCY1A3) as a novel direct target of AR, required for the growth and survival of AR-positive prostate cancer cells (18, 46). The classical function of sGCα1 is to heterodimerize with sGCβ1 to form the sGC enzyme, the receptor of nitric oxide (NO). Once dimerization, the protein regulates NO signaling by catalyzing the synthesis of cyclic guanosine monophosphate (cGMP), a key signaling messenger in cardiovascular and nervous system (18, 47-49). Interestingly both pro-growth and pro- survival functions of sGCα1 in prostate cancer are independent of NO signaling (18, 50).
Recently we also published that sGCα1 physically associates with and sequesters p53 in the cytoplasm and prevent prostate cancer cells to undergo p53-dependent apoptosis (50).
Furthermore, we synthesized a peptide that can disrupt the pro-proliferative functions of sGCα1. In mouse xenograft studies, we observed that this peptide inhibited growth of androgen-dependent, most importantly castration-resistant tumors. These in-vivo studies indicate that sGCα1 is required for the progression of advance stage of prostate cancer
(51). Interestingly sGCα1 is over-expressed in hormone-refractory cells and advance prostate tumors, contradictory to sGCβ1,which shows very weak expression (18). This observation suggests that sGCα1 may form a complex, other than associating with its classical binding partner sGCβ1 to play the pro-proliferative role in prostate cancer.
However the identification of novel sGCα1 binding partner and a mechanism by which it regulates the proliferation of prostate cancer cells is still unknown. In order to gain more insight about the role of sGCα1, we performed co-purification studies followed by the mass-spectrometric (MS) analysis and identified COP9 signalosome subunit 4 (CSN4;
6 gene name COPS4) as a novel binding partner for sGCα1.
p53 and tumor progression:
p53 was originally identified as an oncogene promoting tumor growth. However this finding was challenged by the data showing mutant form, wild type p53 inhibits transformed cell growth as well as tumor growth and thus function as a tumor suppressor
(52, 53). Extensive tumor studies indicate that 50 % of tumors have p53 mutations and
95% out of these mutations are found in the central DNA binding domain (54-57).
Recent findings indicate the R270H mutation of p53 plays a significant role in prostate cancer initiation as well as progression under androgen deprivation (58). It has also been published that combined inactivation of phosphatase and tensin (PTEN) analog and p53 is required for initiation of invasive prostate cancer in mice (59). p53, as a transcription factor, regulates the expression of target genes involved in induction of cell cycle arrest, apoptosis and DNA repair (50). In response to different stresses like oncogenic activation, DNA damage and hypoxia, p53 is significantly accumulated in the cell nucleus where it induces the expression of pro-apoptotic genes like BAX, NOXA, PUMA and p53AIP1 (60-63).
Protein expression of p53 plays key role in regulating its pro-apoptotic function, so there is always balance between its protein production and degradation. Endogenous p53 is normally maintained at extremely low steady state levels. It is well established that under different cellular stresses, p53 expression can be significantly induced via an increase in its protein stability (54-56). p53 protein stability is controlled by MDM2, a
RING finger type E3 ubiquitin ligases. MDM2 directly associates with p53 at the amino
7 terminal transactivation domain, and promotes its proteasome-dependent degradation by stimulating ubiquitination of six lysine residues at carboxy-terminal of p53 (64, 65). In addition to MDM2, other RING-finger type protein ligases like Constitutive
Photomorphogenic 1 (COP1) and p53-induced RING H2 domain protein (Pirh2) also interact with p53 and thus regulate its proteasome-dependent protein degradation (66,
67). However, regulation of p53 protein stability in prostate cancer is not well understood.
COP 9 signalosome complex, sGCα1 and p53:
The CSN protein complex is evolutionarily conserved in all eukaryotes from yeast to humans and consists of 8 core subunits (CSN1-CSN8) in order of descending molecular weight (68, 69). While first identified as a negative regulator of photo- morphogenesis in plants, the mammalian CSN complex plays very important roles in regulating cell proliferation and survival shown by targeted disruption of any one of the
CSN subunits leading to lethal for mice embryonic development due to impairment in cell growth (70-73). Each CSN subunit contains unique domains: CSN1,2,3,4,7,8 components have PCI (proteasome, COP9, initiation factor 3) and CSN5 and CSN6 have
Mpr1-Pad1-N-terminal (MPN) domains. These domains are common in most of the subunits of 19S proteasome lid complex and eIF3 complex and thus these different complexes show remarkable structural similarity (74) .
The mammalian CSN complex is a multifunctional complex, involved in regulation of protein stability, proliferation, cell-cycle checkpoint control, transcription and protein phosphorylation (71, 75-77). The well-characterized role of CSN is to
8 differentially regulate ubiquitin-proteasome-dependent degradation of many tumor suppressors and onco-proteins (78-80), including p53 and p27 (81, 82). These important activities are performed through regulating cullin-RING ligases (CRLs), a ubiquitin ligase and regulation of deubiquitination. Skp1-Cullin-F-box (SCF) is one of the ubiquitin ligases which targets different proteins for ubiquitin-dependent degradation
(83). The C-terminus of Cullin facilitates the assembly of CRLs. Ubiquitin-like modifier neural precursor cells expressed developmentally down-regulated gene 8 (Nedd8) is conjugated to Cullin in CRLs. For the activation of CRLs, removal of Nedd8
(deneddylation) from Cullin is catalyzed by CSN5 due to the presence of the MPN domain containing Jab/MPN/Mov34 (JAMM) motif linked to the metalloprotease motif
(84-86). The CSN complex regulates COP1 and ring-containing ubiquitin ligases such as
MDM2, which mediates the interactions between the proteasome and different ubiquitin ligases (87, 88). CSN interacts with certain deubiqitination enzymes to inhibit the degradation and thus, protects some protein stability depending on the context of intracellular signaling. For example, in mammals, USP15 is associated with CSN and functions as a de-ubiquitin enzyme thereby regulateing the activation of NF-kB (89). The
Role of CSN5 in negatively regulating p53 protein stability is well understood. Line of evidence showed that CSN5-null mouse embryos have significant accumulation of p53 protein, suggesting that CSN5 is a critical regulator of p53 (73). Furthermore biochemical studies suggest that CSN5 interacts with p53, facilitates MDM2-dependent p53 ubiquitination, induces its nuclear export and subsequent proteasome-dependent degradation (88). Thus, the CSN complex regulates ubiquitin-mediated degradation of p53 and p27, stabilization of these proteins is essential for maintenance of their tumor
9 suppressor functions (81, 82). Based on oncomine data analyses CSN subunits like CSN5 and CSN6 are over-expressed in many different type of cancers (90-92). In breast cancer,
CSN5 isopeptidase activity is required for breast cancer progression and epithelial transformation (93). In 293T and HeLa cells, down-regulation of CSN4 leads to reduced levels of Skp2 which is involved in p27 tumor suppressor proteolysis (94, 95). In
Arabidopsis and in Drosophila, loss of CSN4 alone is sufficient to destabilize the other
CSN subunits (94). However, the exact mechanism by which the CSN complex regulates the stability of these different proteins is not well established.
The first purification of the CSN complex in mammalian cells, reported to be associated with kinase activity directed to different proteins like c-Jun, p53 and IkB (96).
Further detailed analyses showed the co-purification and identification of three different serine-threonine kinases that interact with the CSN complex, the kinases are 1,3,4- trisphosphate 5/6-kinase (5/6-kinase) (97), Protein Kinase-D (PKD) and Casein Kinase-2
(CK2). While c-Jun protein stability is positively regulated by CSN dependent phosphorylation, p53 phosphorylation induces its degradation (98-100). Interestingly curcumin has been shown to inhibit the kinase activity of all three CSN associated kinases and prevent the degradation of p53 (77, 98). The CSN itself is a target of this kinase activity, it was reported that different CSN subunits like CSN7, CSN3, CSN2, interact with and get phosphorylated by CK2 and PKD kinases (98, 101). Recently it has been published that in neuroblastoma cells, CSN4 regulates the stability of two synaptic proteins, Snapin and Stonin 2. Interestingly, Snapin is phosphorylated by PKD and its expression is decreased in response to PKD kinase inhibition (102).
Recently our lab has identified CSN4 as a novel binding partner for sGCα1.
10 Interestingly CSN4 regulates the endogenous expression of sGCα1 by preventing its proteasome-dependent degradation and thus positively regulates its protein stability in both androgen-dependent LNCaP and androgen-independent CWR22RV1 cell lines. This positive regulation of sGCα1 protein stability by CSN4 is involved significantly but incompletely in CSN4 mediated prostate cancer cell growth. This finding led to the identification of another target for CSN4, p53. Contradictory to its effect on sGCα1,
CSN4 promotes p53 proteasome-dependent degradation and thus negatively regulates p53 protein stability. Our data strongly suggests that CSN5, functions downstream of
CSN4 and mediates the CSN4 effects on sGCα1 and p53. Most importantly we showed that CK2 kinase activity, along with CSN4 and CSN5, regulates the stability of these two important proteins. Based on IP experiments, we discovered the novel endogenous cytoplasmic complex made up of CSN4, CSN5, sGCα1, p53, and CK2 involved in regulating prostate cancer cell survival and proliferation.
AR and TM4SF3:
Using gene-profiling studies, we identified Transmembrane 4 Superfamily 3
(TM4SF3) as a novel androgen down-regulated gene. TM4SF3 is a trans-membrane protein, belongs to the family of 33 mammalian tetraspanins conserved from sponges to mammals (103). TM4SF3, also known as C0-029 in humans and D6.1 in rats was identified as a tumor-associated antigen due to its high expression in different human carcinomas (104).
As shown in Figure B below (105), tetraspanins have four trans-membrane domains, two intracellular N- and C-termini with two extracellular loops. The small
11 extracellular loop (ECL1) between the trans-membrane regions (TM) TM1 and TM2, a small intracellular loop between TM2 and TM3, and a large extracellular loop between
TM3 and TM4 are all required for glycosylation and for different protein-protein interactions respectively. The characteristic structural features of tetraspanins include 4-6 conserved extracellular cysteine residues (CCG motif) and polar amino acids in trans- membrane domains in the large extracellular loop (LEL). This CCG motif is required for the formation of two to four disulfide bridges with additional cysteine residues at fixed positions within the LEL (106, 107). !"#$"%&
<&%8(7(#$%&'())*)&%7)990 different cancer and host microenvironment cell types are probably influenced by the association of CD9 with -./*)01.2(3/$&4.).5(2 a range of partner proteins. Depending on the cell type, 6&%.&4)(7%(8.9, CD9 can directly associate with its most common partner proteins: Glu-Trp-Ile motif-containing pro- G tein 2 (EWI2; also known as IGSF8 and CD316) and C EWIF (also known as PTGFRN, CD9P1 and CD315). :;&))7(#$%&'())*)&%7)990 " These partner proteins, which can markedly influ- "#$%&'())*)&% ence the molecular organization and function of CD9 in the plasma membrane64–66, might have opposing roles. For example, in glioblastoma the expression of EWI2 (which inhibits tumour growth and is associ- ated with increased patient survival) is significantly A @ B ? D%&,/;(;4%&,( decreased; by contrast, EWIF expression is signifi- cantly increased, which is consistent with a pro-tumour growth function for this partner protein66.
!"#$%&'($&"#)*"+*$,$%-).-#&#)*$"*/,$-)$-)&) Pro-metastatic roles for CD151. Early work showed that E&);.$9F)&$.9,7/.$( +,$%&'())*)&% CD151 in both tumour cells27,67,68 and host animals69 can >3$(%;.,*/ =3$(%;.,*/ :19%$7.,,(%7)990 promote tumour cell metastasis, but experiments were limited to models of intravenous tumour cell injec- tion (that is, experimental metastasis). Recent results !"#$%&'(')'!"#$%#&'()'*+,"-#.'*/*%#0,#1"1'0*%2-*2%/3' *+&',&,%-./-0"0'/%1,&"0'2-3"456' have shown that CD151 can also promote spontaneous 7+"8+'".'810.&%9&:',+%1$#+1$,'&$;-%51,"8'&914$,"106'810,-"0.'<<'3&3=&%.'"0'+$3-0.!"#$%&'(&)*&+,'!'-"./&%(>?@' Figure B: Diagram of Tetraspanin structure.The intact(>B tetraspanin protein containtumour four metastasis, as shown in a transgenic ERBB2 *+&'"0,-8,'/%1,&"0'".'214:&:'"0,1'-',"#+,'%1:A4";&'.,%$8,$%& ',+-,'+-.'21$%',%-0.3&3=%-0&' 29 transmembrane C*DE'+&4"8&.'C4"#+,'#%&5'-0:':-%;'#%&5F'4-=&44&:'(GHE@domains (TM), the large extracellular'*+&'4-%#&'&I,%-8&44$4-%'411/'CJKG(
adhesion12 and migration53. Therefore, tetraspanins such tumour microenvironment. In MCF-10A immortal- as TSPAN12 (REF. 54) and members of the TSPANC8 ized mammary cells overexpressing activated ERBB2, subgroup55,56 that promote the maturation and/or func- CD151 ablation caused marked in vitro reductions in tion of ADAM10 are predicted to have a pro-tumour cell invasion and transendothelial migration, which is effect. Indeed, TSPAN12 does promote human breast consistent with the decreased metastasis that was seen in cancer growth in a mouse xenograft model57. However, mice that overexpressed ERBB2 and lacked CD15129. the mechanism was attributed to the facilitation of In the absence of CD151, tumour cell signalling path- signalling through β-catenin, rather than to effects on ways that involve FAK, ERK, EGFR and PKCα were ADAM10 (REF. 57). disrupted. Furthermore, there was a decrease in the Tetraspanin CD9 typically suppresses tumour phosphorylation of β4 integrin at key sites (Ser1356 and progression in various cancers, with low CD9 levels Ser1424)29, which is consistent with dysregulated PKCα associated with poor patient prognosis11. However, and ERK functions and with decreased migration and increased CD9 expression in gastric cancer is associ- metastasis35,70,71. Although transforming growth factor-β1 ated with increased disease severity and poor prog- (TGFβ1) can stimulate metastasis72, TGFβ1 signalling nosis58,59. In addition, CD9 might have an oncogenic and function was not altered by CD151 removal from function, as shown in an ovarian cancer cell line60, and ERBB2-overexpressing MCF-10A cells29. However, it might promote cancer stem cell-like properties in B CD151 in the breast cancer cell line MDA-MB-231 did cell acute lymphoblastic leukaemia61. In another study, promote TGFβ1 signalling, and this correlated with host animal CD9 facilitated tumour growth in a lung increased lung metastasis68. In another study, CD151 carcinoma implantation model62. However an absence in lung epithelial cells seemed to suppress TGFβ1 of CD9 had no effect on de novo primary tumour onset signalling73. One possibility, which has not yet been in the TRAMP model63. The diverse roles of CD9 on tested, is that the association of CD151 with different
NATURE REVIEWS | 456478' VOLUME 14 | JANUARY 2014 | 01 cell-fusion. Tetraspanin family members like CD9 and CD81 were shown to be involved in egg-sperm fusion (108, 109).
Human and rat TM4SF3 associates with CD9, CD81, CD151 tetraspanins as well as several integrins, including α3β1 and α6β4, and regulates cell signaling, migration and fusion (110). In the tetraspanins web, association of tetraspanins with their non- tetraspanin partners is considered as primary association. The distinctive aspect of the primary interaction is, in different cell types, a single tetraspanin protein can associate with different primary partners (111). For example, tetraspanin CD81 associates with
CD19, a B-lineage-specific molecule in B cells (112), whereas it associates with CD4 and
CD8 in T cells (113). Another important feature of primary interaction is that it can be formed with the extracellular or intracellular domains of partner molecules. Thus CD81 interacts with extracellular domain of CD19 (114) and intracellular domain of another partner molecule EWI-2 (115, 116), both of which are immunoglobin super-family members. Some primary associations are direct, highly stoichiometrical and cannot be disrupted after lysis with harsh detergents like 1% NP-40. Examples of such strong partnerships are the association of CD151 with α3β1-integrin (117).
Tetraspanin–tetraspanin associations with each other referred as secondary associations and these associations are not stoichiometric (111). Mild detergents like 1%
Brij 96 does not disrupt these secondary interactions (118). Palmitoylation of juxtamembrane cysteines is required for the maintenance of tetraspanin-tetraspanin interactions. In CD9 and CD151 tetraspanins, mutation of all juxtamembrane cysteines resulted in disruption of these secondary interactions (118, 119).
As mentioned above palmitoylation of the intracellular cysteine residues plays an
13 important role in the maintenance of tetraspanin-tetraspanin interactions. Interestingly, palmitoylation of partner proteins is also important for their incorporation in the tetraspanins web. For example, the CD151 a tetraspanin protein associates with laminin- binding integrins α3β1, α6β1, and α6β4. Immunoprecipitation studies showed that not only CD151 but also co-precipitated laminin binding α3-, α6-, and β4-integrins are also palmitoylated (120).
Indirect association of tetraspanins with some other proteins, referred as class three interactions, which are not disrupted in milder detergent like 1% CHAPS and are required for cross-talk with intracellular signaling pathways (121).
Some tetraspanins like CD9 and CD151 function as a cell surface receptor.
PSG17, an endogenous soluble ligand, was identified for mouse CD9 (122). Similarly tetraspanins CD81was identified as the receptor for the Hepatitis C virus envelope protein
E2 (123). Currently, CD9 and CD81 are the only tetraspanins, which function as cell surface receptors for soluble ligands.
The role of tetraspanins in cancer is emerging now, a few tetraspanin, like CD151 is over-expressed in various cancers and facilitates in vivo xenograft tumor growth and metastasis (124-126). Recently it was observed that CD151 plays key role in tumor initiation, promotion and progression of skin and breast cancer (126-128). CD151 plays a significant role in prostate invasion and lyphangiogenesis in vivo (129). Contradictory to
CD151, CD9 functions as a suppressor of metastasis in many different cancers like breast, colon and lung cancer (130-132). Recently it has been published that CD9 inhibits metastasis in the TRAMP prostate cancer mouse models (133). In some circumstances
CD9 is pro-invasive depending on the association with different binding partners. For
14 example, overexpression of CD9 directly correlates with increased in vitro melanoma cell invasion (134). Another important function of Tetraspanins is to promote tumor growth by inducing angiogenesis. CD151 knock-out mice shows decrease in tumor growth in
Lewis lung carcinoma cells, associated with reduced angiogenesis (135).
TM4SF3 is described as tumor-associated antigen due to its high expression in different human carcinomas (136). It is reported as a metastasis-associated gene in different types of tumors and promotes tumor growth features like tumor cell proliferation, angiogenesis, and tumor cell motility (137, 138).
TM4SF3 over-expression is required for the progression of hepatocellular carcinoma (139), since its interaction with platelets and leukocytes is advantageous for tumor cells to survive during metastatic spread (140). TM4SF3 up-regulates the
ADAM12m (A disintegrin and metalloproteinase) expression in esophageal carcinoma and promotes esophageal cancer cell invasion (136). In pancreatic adenocarcinoma,
TM4SF3 co-localization with integrins increases pancreatic tumor cell motility (110). In a rat pancreatic tumor cell line, overexpression of D6.1A (TM4SF3 rat homologue) induces angiogenesis and thus supports tumor growth (138). In colon cancer, disruption of E-cadherin led to TM4SF3-dependent in vitro colon cancer cell motility (141).
As mentioned above, TM4SF3 is associated with multiple functions in cancer, including invasiveness, metastasis, and cell proliferation. However TM4SF3 regulation and biological function are unknown in prostate cancer. In our lab, we observed that
TM4SF3 is unique in its androgen regulation, in prostate cancer. Interestingly and surprisingly, our earliest results showed reciprocal androgen regulation of TM4SF3 mRNA and protein in LNCaP cells: androgen represses the mRNA but induces the
15 protein. Thus, our initial experiments focused on confirming these results. To confirm the effect on mRNA, five different primer sets were used to measure TM4SF3 mRNA using real-time PCR, and all five exhibited androgen repression. As for the protein, Western- blotting detected a protein in LNCaP (AR expressing cells) and PC-3 (AR-negative), cells that was the expected size of TM4SF3. In addition, we utilized siRNA that targets
TM4SF3, and this resulted in depletion of the protein detected in the Western blot.
Having verified the identities of both the mRNA and protein and the reciprocal effects of androgens, we started studying androgen effects on and biological functions of TM4SF3.
We observed that androgen prevents proteasome-dependent degradation of TM4SF3 and thus positively regulates TM4SF3 protein stability. This event leads to prostate cancer cell invasion migration and epithelial mesenchymal transition (EMT). Most surprisingly while confirming the androgen up-regulation of TM4SF3, we observed that in addition to being localized in trans-membrane, TM4SF3 also shows androgen-dependent nuclear localization and interact with AR in cells and in vitro. Interestingly, our data shows that
TM4SF3 up-regulates endogenous AR protein levels and its biological activities. In prostate tumors, TM4SF3 is over-expressed and its expression is positively correlates with AR expression mimicking the mutual stabilization in prostate cancer cells.
TM4SF3, AGR2 and AKT:
AGR1, AGR2 and AGR3 are three different components belonging to the Protein
Disulphide Isomerase (PDI) family involved in regulating different functions like reduction or isomerization of disulphide bonds in the endoplasmic reticulum (ER) (142).
Outside the ER, AGR2 is a secreted protein that plays a role at the cell surface and in the
16 extracellular matrix. AGR2, the human homologue of Xenopus anterior gradient 2
(XAG-2) (143), is an (Estrogen Receptor) ER-regulated gene, overexpressed in ER- positive breast cancer, associated with poor prognosis for the breast tumors that are resistant to anti-hormone therapies (144, 145). AGR2 is also up-regulated in different carcinomas like esophageal, lung, colorectal, ovarian, prostate cancer and breast cancer and promotes cellular metastasis in breast carcinoma (146). Several different studies showed that overexpression or disruption of AGR2 could influence metastasis and tumor growth in vitro (147). The role of AGR2 in prostate cancer cell invasion and migration has not yet been studied.
The Phosphatidylinositol 3-Kinase (PI3K)/Akt/Mammalian Target of Rapamycin
(mTOR) is one of the most key oncogenic signaling pathways associated with tumorogenesis. This pathway is involved in wide array of diverse functions including regulation of proliferation, cell survival, migration and angiogenesis (148, 149). Serine- threonine kinase AKT (also known as a PKB) is an important down-stream target of
PI3K (150). Activation of PI3K leads to phosphorylation of Phosphatidylinositol-3,4,5- trisphosphate (PI(3,4,5)P3). PIP3 recruits AKT and Phosphoinositide-Dependent Kinase-
1 (PDK1) to the plasma membrane (151). PKD1-dependent phosphorylation of AKT at
T308 and S473 by the mTOR complex 2 (TORC2) is required for the complete activation of AKT (152). AKT phosphorylates the downstream proteins like Glycogen Synthase
Kinase 3 (GSK3), tuberous sclerosis complex (TSC), and FOXO transcription factors, leading to cell growth and survival (149, 151). Tumor suppressor Phosphatases and
Tensin Homolog (PTEN) is a negative regulator of PI3K/AKT signaling pathway. Loss of PTEN leads to constitutive activation of PI3K/AKT signaling pathway (150). LNCaP
17 and PC-3 prostate cancer cells, harbor a deletion or mutation in PTEN and thus rendering constitutive activation of AKT, that results in increased tumor growth. In 50%-80% of primary prostate cancer, PTEN expression is lost or deleted. Complete loss of PTEN results in the progression of CRPC (153, 154). Both these events, loss of PTEN and activation of AKT is associated with recurrence of the cancer after prostectomy and thus led to poor outcome (155). Pre-clinical reports showed that the AKT signaling pathway is involved in epithelial-to-mechenchymal transition (EMT) in prostate cancer and involved in promoting metastasis of prostate tumors (156). Interestingly, the down-stream targets of AKT and its pro-metastatic functions in prostate cancer are unknown.
We identified AGR2 as a potential interacting partner for TM4SF3 in prostate cancer. Disruption of AGR2 leads to decreased cell invasion and migration of prostate cancer cells consistent with TM4SF3 knock-down in these cells. Interestingly, we observed that siRNA targeted knock-down of TM4SF3 resulted in reduced expression in
PC-3 and a decrease in androgen-induced expression of AGR2 in LNCaP cells. However, endogenous TM4SF3 expression was not affected by AGR2 knock-down in PC-3 cells, suggesting that AGR2 acts downstream of TM4SF3. To understand the mechanism of
AGR2 regulation by TM4SF3, we observed that TM4SF3 knock down had no effect on
AGR2 mRNA expression. However, AGR2 protein expression was significantly reduced over time in response to endogenous depletion of TM4SF3 in Cyclohexamide treated PC-
3 cells suggestive of regulation of AGR2 protein stability by TM4SF3 in prostate cancer cells. We identified the AKT signaling pathway, a novel pathway working together with
TM4SF3 in prostate cancer cells, our data showed that mutual knock-down of either
18 TM4SF3 or AKT, resulted in reduced levels of AKT and its phosphorylation at S473 or
TM4SF3 respectively.
AR and BARD1:
BRCA1-associated RING domain 1 (BARD1) is identified as a classical binding partner for breast cancer 1 early onset (BRCA1) through yeast two hybrid screening.
BARD1 heterodimerizes with BRCA1 through the interaction between their RING finger domains to form a BRCA1/ BARD1 complex that shuttles between nucleus and cell cytoplasm. BRCA1/ BARD1 function as a tumor suppressor by influencing apoptosis, gene expression regulation and DNA repair mechanisms (157, 158). BRCA1 is mutated in 50% of breast and ovarian cancers. It is observed that homozygous disruption of
BARD1 resulted in embryonic lethality and genomic instability, so loss of function mutations are rare in BARD1. However some mutations and truncations which influence its function may involved in the pathogenesis of breast and ovarian cancer (159). The
BRCA1-BARD1 heterodimer has ubiquitin ligase enzymatic activity. The cancer predisposing mutations like C61G and C64G in the RING domain of BRCA1 resulted in loss of E3 ubiquitin-ligase activity and thus inhibit the tumor suppressor function of
BRCA1-BARD1 (160, 161). The different identified substrates for BRCA1/BARD1- dependent ubiquitination are RNA polymerase II, histones and λ-tubulin. In mouse mammary gland tissue BRCA1-BARD1is implicated to regulate poly-ubiquitination and subsequent proteasome degradation of progesterone receptor (PR). Recently it has been published that ligand-binding domain (LBD) of estrogen receptor α (ERα) is mono-
19 ubiquitinated by BRCA1-BARD1 in the breast cancer (162). Role of BRCA1-BARD1 in regulating AR-ubiquitination and activity has not been studied in prostate cancer.
In our preliminary study we observed that androgen represses BARD1 mRNA and protein in androgen-dependent LNCaP cells and AR is required for BARD1 mRNA down-regulation. Most importantly we found that over-expression of BARD1 leads to dramatic decrease in AR protein expression without affecting AR mRNA. Furthermore, we found that AR transcriptional activity is significantly reduced and endogenous PSA expression is affected in response to over-expression of BARD1 in LNCaP prostate cancer cells.
20 Chapter 2
Manuscript 1
COP9 Subunits 4 and 5 Target Soluble Guanylyl Cyclase α1 and p53 in Prostate
Cancer Cells
Meenakshi Bhansali and Lirim Shemshedini
Department of Biological Sciences, University of Toledo, Toledo, Ohio 43606
Corresponding Author: Lirim Shemshedini, Department of Biological Sciences,
University of Toledo, Toledo, Ohio 43606, Tel. (419) 530-1553; Fax. (419) 530-7737;
Email: [email protected]
Running Title: CSN4/5 up-regulate sGCα1 and down-regulate p53.
Keywords: COP9 Signalosome, CSN4, CSN5, Soluble Guanylyl Cyclase α1, p53, prostate cancer, survival
Word Count: 5000
DISCLOSURE STATEMENT: The authors have nothing to disclose.
Notes:
-This work was supported by grants from NIH.
-All authors have no conflict-of-interest to declare.
- 8 figures.
21 ABSTRACT
Our laboratory previously has identified soluble guanylyl cyclase alpha 1 (sGCα1) as a direct target of Androgen Receptor (AR) and essential for prostate cancer cell growth via a pathway independent of nitric oxide (NO) signaling. We identified the COP9
Signalosome Subunit 4 (CSN4) as a novel interacting partner for sGCα1. Importantly, the CSN4-sGCα1 interaction inhibits sGCα1 proteasomal-degradation. Consistent with this, disruption of CSN4 led to a significant decrease in prostate cancer cell proliferation, which was significantly but not completely rescued by sGCα1 over-expression, opening the possibility of an additional target of CSN4. Interestingly, IP experiments showed that p53 is found in the CSN4-sGCα1 cytoplasmic protein complex. However, in contrast to sGCα1, p53 protein stability was compromised by CSN4, leading to prostate cancer cell survival and proliferation. Interestingly, we observed that CSN4 was over-expressed in prostate tumors and its protein level correlates directly with sGCα1 and inversely with p53 proteins, mimicking what was observed in prostate cancer cells. Our data further showed that CSN4 silencing decreased CSN5 protein levels and suggest that the CSN4 effects on sGCα1 and p53 proteins are mediated by CSN5. Lastly, our study showed that
Caseine Kinase-2 (CK2) was involved in regulating p53 and sGCα1 protein stability as determined by both disruption of CK2 expression and inhibition of its kinase activity.
Collectively, our study has identified a novel endogenous CSN4-CSN5-CK2 complex with sGCα1and p53 that oppositely controls the stability of these two proteins and provides prostate cancer cells an important mechanism for survival and proliferation.
22 INTRODUCTION
Androgens and Androgen Receptor (AR) play essential roles in development of prostate cancer. Indeed, one of the most important mechanisms for the development of castration- resistant prostate cancer is over-expression and restoration of AR transcriptional activity (1-3). AR action is mediated by androgen-regulated genes, of which many have been identified in recent years. Our laboratory has focused its recent efforts on one of these newly identified genes, soluble guanylyl cyclase alpha-1 (sGCα1),
(sGCα1; gene name GUCY1A3). This gene is a direct target of AR and mediates the pro growth and pro-survival functions of AR-positive prostate cancer cells (4-6). The classical function of sGCα1 is to heterodimerizes with sGCβ1, forming the sGC enzyme, the principle receptor for nitric oxide (NO) and mediator of NO signaling (6-9).
Interestingly, both the pro-growth and pro-survival functions of sGCα1 in prostate cancer are independent of NO signaling (6, 10). Recently, we also published that sGCα1 physically associates with and sequesters p53 in the cytoplasm and prevent prostate cancer cells from undergoing p53-dependent apoptosis (10). As one of the most important inducers of apoptosis in mammalian biology (11), p53 is most commonly mutated gene in human cancers and is under complex regulation (12-15). While p53 mutations are rare in early-stage prostate cancer, they are far more common in advanced disease (14, 15). Many interacting partners have been identified for p53, from proteins that regulate p53 gene expression to proteins that control p53 stability and to proteins that regulate p53 activity as a transcription factor (16, 17). Among these many interacting proteins, sGCα1 represents a new partner for p53 that blocks its activity by mediating its cytoplasmic sequestration (10). We have also previously shown that p53 can disrupt AR
23 transcriptional activity in prostate cancer cells (18).
To disrupt these pro-growth and pro-survival functions of sGCα1, we synthesized an interacting peptide, which exhibited potent cytotoxicity against both androgen- dependent and castration-resistant prostate cancer cells and, more importantly, strong anti-cancer activity in mouse xenograft studies (19). Furthermore, sGCα1 is over- expressed in castration-resistant prostate tumors, while sGCβ1 showed very weak expression (6). In view of all these published data, we hypothesized that sGCα1 may form a protein complex, independent of its complex with sGCβ1, that serves pro-growth and pro-survival functions in prostate cancer.
To identify such a protein complex in prostate cancer, mass spectrometric (MS) analysis was used and identified the COP9 signalosome subunit 4 (CSN4) (CSN4; gene name COPS4) as a novel binding partner for sGCα1. The CSN protein complex consists of 8 core subunits (CSN1-CSN8) and is evolutionarily conserved in all eukaryotes from yeast to humans (20, 21). While first identified as a negative regulator of photo- morphogenesis in plants, the mammalian CSN complex plays very important roles in regulating cell proliferation and survival (22-25). The CSN complex shows structural similarity with the 19S proteasome regulatory complex (26). The well-characterized role of CSN is to differentially regulate ubiquitin-proteasome-dependent degradation of many tumor suppressors and onco-proteins (27-29), including p53 and p27 (30, 31).
When CSN was purified from mammalian cells, two kinases were identified to copurify: serine threonine kinases like Protein Kinase-D (PKD) and Casein Kinase-2
(CK2). CSN-associated kinase activity was later shown to be involved in phosphorylating c-Jun and p53, with opposite effect on their subsequent ubiquitin-dependent degradation
24 (32-34). Interestingly Curcumin can inhibit enzyme activity of both kinases and prevent the degradation of p53 (32, 35). In addition, different CSN subunits, such as CSN7,
CSN3, CSN2, are reported to bind and be phosphorylated by CK2 and PKD kinases (32,
36). Recently it has been published that in neuroblastoma cells, CSN4 regulates the stability of two synaptic proteins, Snapin and Stonin 2. Interestingly, Snapin is phosphorylated by PKD and its expression is decreased in response to PKD kinase inhibition (37).
In this study, we report for the first time that CSN4 is a novel binding partner for sGCα1. CSN4 interacts with not only sGCα1, but also p53 in prostate cancer cells, having a positive effect on sGCα1 protein and negative on p53. Our data strongly suggest that CSN5 mediates the CSN4 affects on p53. Furthermore, CK2 kinase activity is involved in regulating the stability of sGCα1 and p53 proteins. Lastly, IP experiments show the existence in prostate cancer cells of a novel endogenous, cytoplasmic complex, consisting of CSN4, CSN5, sGCα1, p53, and CK2.
MATERIALS AND METHODS
Cell Culture, siRNA Transfection, and Inhibitors
LNCaP, C81, CWR-22Rv1, and PC-3 cells were grown as previously described
(from ATCC, passage 15-30 for all cell lines) and Control siRNA, sGCα1 siRNA (6, 10),
CSN4 siRNA (CDS) ACAGCAUCUUGCA UCUAUAUU), CSN4 siRNA (3’UTR)
(GUGAAAUAUCUGUGGCUAAUU), CSN5 siRNA, (CUUGAGCUGUUGUGGA
AUA), and CK2 siRNA (UCAAGAUGACUACC AGCUGUU) (Dharmacon) were transfected at 50 nM final concentration into cells using Lipofectamine siMAX
25 (Invitrogen) or Lipofectamine 2000 (Invitrogen). LNCaP and CWR-22Rv1 cells were treated with 40 µM Curcumin or Emodin (from Sigma) for 24 hrs and 48 hrs, cell extracts were prepared using 2% SDS and then subjected to Western blotting.
Reporter Assay and Plasmid Transfection
LNCaP cells were grown to 70-80% confluence in RPMI-1640 with 10% FBS.
After 24 hrs, cells were transiently transfected with 0.1 µg p53-Luc reporter plasmid, and control siRNA, or CSN4 (3’UTR specific) siRNA, CSN5 siRNA, and/or CSN4/CMV plasmid. The pCH110 plasmid (0.5 µg) encoding b-Galactosidase was used to control for transfection efficiency (38). The p53-Luc plasmid was kindly provided by Dr. William
Taylor and contains three p53-responsive elements. Lipofectamine 2000 (Invitrogen) was used for transfection and Luciferase activity was measured using Luciferase assay system from Promega. LNCaP and CWR-22Rv1 cells were transiently transfected with CSN4 siRNA, control siRNA, p53 siRNA, CSN5 siRNA, 2 µg sGCα1/pCI-Neo, and 2 µg
CSN4/CMV and, 48 hrs after transfection, cell extracts were prepared using 2% SDS and subjected to Western blotting.
Proliferation and Apoptosis Assays
For proliferation, cells were transfected with siRNA and then 72 hrs after transfection, 20,000 cells were seeded in 24-well plates. The MTT assay (Sigma) was used as before (19) to determine cell number. For apoptosis, 5000 cells were seeded in
96-well plates and treated with Vehicle (DMSO), CSN4 siRNA (50 µM), Etoposide (20
µM) (Sigma) at different time points. Caspase-3/7 activity was measured using the Apo-
26 ONE Homogeneous Caspase-3/7 assay kit (Promega). PARP cleavage was also used to measure apoptosis in LNCaP and CWR-22Rv1 cells, after transiently transfected with
CSN4 siRNA or Control siRNA. Cells were harvested 72 hrs after transfection and subjected to Western blotting.
Western Blotting and Cell Fractionation
Western blotting was performed as described (6) using antibodies against sGCα1
(Cayman Chemical Cat # 160895), CSN4 (Abcam Cat # ab12322), CSN5 (Santa Cruz
Cat # sc-13157), p53 (Santa Cruz Cat# sc-263), β-Tubulin (Abcam Cat # ab6046), RARα
(Santa Cruz Cat # sc-551), β-Actin (Abcam Cat # ab-6276), CK2 (Thermo-scientific Cat
# PA1-86381), Survivin (71G4B7) and PARP (Cell Signaling Technology Cat # 2808,
Cat # 9242). LNCaP cells treated with CSN5 siRNA were washed with cold PBS and harvested, and 10% of the cells were saved as Input and the remaining portion was subjected to cytosolic and nuclear cell fractionation using Nuclear/Cytosol Fractionation
Kit (MBL International). The fractions were subjected to Western blotting to measure
CSN5 and p53 protein levels.
Prostate tissues
Prostate tumors were obtained from the Cooperative Human Tissue Network
(CHTN). Protein extracts were prepared by boiling 12 normal and 20 tumors tissues
(Gleason scores between 6-7) in 3X SDS buffer and then subjected to Western blotting to measure CSN4, sGCα1 and p53, expression levels.
27 Semi-Quantitative RT-PCR and QRT-PCR
Total mRNA was isolated from LNCaP and CWR-22Rv1 cells using the Trizol reagent following the manufacturer’s protocol (Invitrogen) and subjected to semi-
Quantitative RT-PCR and QRT- PCR analyses as described (39). The PCR upstream and downstream primers, respectively, used for each gene were: CSN4, 5’-GTAAG
CCTCTGCCTGGACTG-3’ and 5’-AGGAGCAGGTTGCTTCCATA-3’; GAPDH, 5’-
CGACCACTTTGTCAAGCTCA-3’ and 5’-AGGGGAGATTCAGTGTGGTG-3’; CSN5,
5’-GCCAACCTGTTTTGCATTTT-3’and 5’-TCTGCTGAAGATGGTGATGC-3’;
Survivin, 5’-GGACCACCGCATCTCTACAT-3’and 5’-GACAGAAAGGAAAG
CGCAAC-3’; p53, 5’-GGCCCACTTCA CCGTACTAA-3’ and 5’-GTGGTTTCAAGG
CCAGATGT-3’; sGCα1, 5’-AGCAGTGT GGAGAGCTGGAT-3’ and 5’CTGATCCAG
AGTGCAGTCCA-3’.
Immunocytochemistry
Immunocytochemistry was used to study the subcellular localization of sGCα1 and CSN4 in LNCaP and CWR-22Rv1 cells as described in (38). Reagents used were an anti-CSN4 antibody (1:100 dilution; Abcam) and a FITC-labeled anti-sGCα1 antibody
(1:100 dilution; Santa Cruz Biotechnology). Note that all micrographs were taken at the same microscope settings.
Immunoprecipitation
IP experiments were performed as described previously (10, 19). Whole-cell extracts from LNCaP and CWR-22Rv1 cells were subjected to IP using Protein A/G plus
28 Agarose (Santa Cruz). IP antibodies were against sGCα1 (Cayman Chemical), p53 (Santa
Cruz), CSN5 (Santa Cruz), CSN4 (Abcam), CK2 (Thermo-Scientific) or rabbit or mouse
IgG (Santa Cruz) as control.
Mass Spec Analysis
Whole-cell extracts from LNCaP cells were subjected to an IP experiment, as described previously (10, 19), using an antibody against sGCα1 (Cayman Chemical) or
IgG as a negative control. The purified material was run on an SDS-PAGE gel and stained with Coomassie blue. Stained proteins only found in the anti-sGCα1 IP were identified by mass spec. analysis (provided by the Mass Spectrometry-based Proteomics
Facility at the University of Michigan).
RESULTS
The CSN4 subunit of the CSN signalosome complex is a novel binding partner for sGCα1 in prostate cancer cells
Previously we identified sGCα1 as a novel androgen-regulated gene required for proliferation of both androgen-dependent and castration-resistant, AR-positive prostate cancer cells (6). Furthermore we published that sGCα1 expression is significantly elevated in prostate cancer cells and prostate tumors as compared to sGCβ1, with which sGCα1 hetero-dimerizes and mediates NO signaling. Interestingly the sGCα1 pro-growth effect in prostate cancer cells is independent of NO signaling pathway (6, 10). Based on these results, we hypothesized that sGCα1 may exist in a protein complex distinct from the hetero-dimeric complex with sGCβ1, to regulate prostate cancer cell proliferation.
29 To identify novel sGCα1-interacting proteins, we immunoprecipitated endogenous sGCα1 from LNCaP cells and used mass spectrometric (MS) analysis to identify co-purified proteins. This analysis led to the identification of CSN4 (COP9
Signalosome Subunit 4) as a novel interacting partner for sGCα1. To confirm the MS analysis, immunoprecipitation (IP) were performed in LNCaP cells with endogenous proteins. IP purification of sGCα1 resulted in co-purification of endogenous CSN4, which was not seen with the control IgG (Figure 1A). A complementary IP showed that sGCα1 was co-purified with endogenous CSN4 in (Figure 1B). Collectively, these results strongly suggest that endogenous sGCα1 and CSN4 co-associate in androgen-dependent
LNCaP cells. The same interaction was observed in CWR-22Rv1 cells (Figures 1A and
1B), a human prostatic carcinoma xenograft cell line that shows androgen-independent proliferation, expresses AR and different AR splice variants, including AR-V7, which play an important role in development of castration resistance in prostate cancer (40, 41).
Interestingly, sGCα1 and CSN4 are over-expressed in these cells compared to androgen- dependent LNCaP cells (see Figure 2B).
To confirm the CSN4-sGCα1 interaction, immunocytochemistry was used in
LNCaP and CWR-22RV1 cells to see the sub-cellular localization of endogenous CSN4 and sGCα1. As shown in Figure 1C, endogenous CSN4 was localized in cytoplasm and co-localized with sGCα1, suggestive of the existence of a cytoplasmic CSN4-sGCα1 complex. Together, all these results show that endogenous CSN4 and sGCα1 interact in the cytoplasm of both androgen-dependent and castration-resistant prostate cancer cells.
CSN4 promotes prostate cancer cell proliferation by up-regulating sGCα1
30 The CSN complex shares structural similarities with the proteasome lid sub- complex and can differentially regulate the stability of several target proteins (42). As
CSN4 interacts with sGCα1, we were interested to see whether this interaction affects the cellular levels of sGCα1. To test our hypothesis, we depleted endogenous level of CSN4 in LNCaP cells by siRNA, which interestingly resulted in markedly reduced levels of sGCα1 protein (Figure 2A). Importantly, when CSN4 was exogenously expressed in
CSN4 siRNA-treated cells, sGCα1 protein expression was rescued (Figure 2B), clearly demonstrating that CSN4 is responsible for regulating endogenous sGCα1 protein in
LNCaP cells. The same findings were made in C81 cells, an androgen-independent line derived from LNCaP cells (43), and CWR-22Rv1 cells, where knockdown of CSN4 diminished sGCα1 protein levels (Figure 2A) and exogenous CSN4 rescued these levels
(Figure 2B). As shown in before (6), the AR-negative PC-3 cells exhibit very low expression of sGCα1 and CSN4 (Figure 2A). We also observed that sGCα1 mRNA levels remain unaffected in CSN4 knockdown in both LNCaP and CWR-22Rv1 cells (Figure
S1A and S1B), clearly demonstrating that the CSN4 targets the sGCα1 protein.
One possible mechanism of CSN4 regulation of sGCα1 is inhibition of protein degradation. In view of the well-known function of the CSN complex in regulating proteasome-dependent stability of different proteins, we were interested to study a possible role for CSN4 in inhibiting proteasome-dependent degradation of sGCα1. To address this, we measured the time-dependent degradation of endogenous sGCα1 in
CSN4 knockdown LNCaP cells, using the translational inhibitor Cycloheximide and proteasome inhibitor MG132. The sGCα1 steady state levels strongly decreased between
0-5 hrs in CSN4 knockdown LNCaP cells, consistent with down-regulation of sGCα1 in
31 response to reduced CSN4. Interestingly, when MG132 was added to CSN4 siRNA- treated cells, sGCα1 steady state levels were maintained during the first 5 hrs and these levels were comparable to Control siRNA-treated cells. The same findings were made in
CWR-22Rv1 cells (Figure 2C). Based on these results, we conclude that CSN4 positively regulates endogenous sGCα1 protein stability in both androgen-dependent and castration-resistant prostate cancer cells by preventing its proteasome-dependent degradation.
Previously, we published that reduced sGCα1 expression directly correlates with decreased prostate cancer cell growth (6). As down-regulation of CSN4 resulted in diminution of sGCα1 protein in prostate cancer cells, we were interested to see whether
CSN4 plays any role in sGCα1-mediated prostate cancer cellular proliferation. To test our hypothesis, endogenous CSN4 expression was reduced in LNCaP cells using CSN4- specific siRNA and cell growth was measured. As shown in Figure 2D, knockdown of
CSN4 resulted in a significant decrease in LNCaP cellular proliferation, whereas control siRNA had no effect. Importantly, the CSN4-knockdown cells were rescued by exogenous over-expression of CSN4 (Figure S2A), showing that CSN4 does indeed control prostate cancer cell proliferation. Consistent with the LNCaP cells, C81 (Figure
S2A) and CWR-22Rv1 (Figure 2D) cells also exhibit significantly reduced growth when in the context of diminution of CSN4 knockdown. Interestingly, CSN4 silencing had no effect on the growth of PC-3 cells (Figure S2A), which are deficient in sGCα1 protein and have weak expression of CSN4 compared to LNCaP and CWR-22Rv1 cells (Figure
2A). Based on these results, we conclude that endogenous CSN4 protein levels are directly correlated to prostate cancer cellular proliferation.
32 In the view of the above results, we hypothesized that one mechanism for CSN4 control of cell growth is by regulation of the sGCα1 protein. We tested this hypothesis by over-expressing sGCα1, resulting in significant elevation of sGCα1 protein in the CSN4 siRNA-treated LNCaP cells (Figure S2B). Interestingly, over-expression of sGCα1 significantly rescued the growth of CSN4 siRNA-treated cells, both LNCaP and CWR-
22Rv1, while sGCα1 had only a weakly positive effect in Control siRNA-treated cells
(Figure 2E). Collectively, these data suggest that sGCα1 down-regulation is responsible for the negative effect of CSN4 siRNA on cell growth.
To determine whether NO signaling is involved in the sGCα1 rescue of CSN4- depleted cells, we used the sGCα1 mutant (D531A), which is deficient in cyclase activity
(10). Importantly, this mutant rescued the CSN4-knockdown cells as well as wild-type sGCα1 (Figure S3A). Western blotting confirmed equal expression of both sGCα1 proteins in LNCaP cells (Figure S3B). In addition, sGCβ1, the binding partner for sGCα1 in NO signaling, was very weakly expressed and remained unaffected in response to
CSN4 knockdown in both LNCaP and CWR-22Rv1 cells (Figure S3C). Collectively, these data demonstrate that role of sGCα1 in CSN4-mediated growth is independent of
NO signaling in prostate cancer cells.
CSN4 down-regulates p53 protein and leads to prostate cancer cell survival and proliferation
Our earlier data showed that over-expression of sGCα1 can significantly, but incompletely, rescue cells with CSN4 knockdown (see Figure 2E). The incomplete rescue suggests that CSN4 knockdown affects additional targets. Since we have published
33 earlier that sGCα1 interacts with p53 (10), we examined 53 as an additional target.
Interestingly, complementary IP experiments using anti-p53 and anti-sGCα1 antibodies revealed that p53 is associated with CSN4 and sGCα1 prostate cancer cells (Figure 3A).
Since CSN4 stabilized the sGCα1 protein, we monitored the p53 protein in the context of altered levels of CSN4. Interestingly, lowering levels of CSN4 resulted in increased p53 protein in LNCaP, C81, and CWR-22Rv1 cells (Figure 3B). Importantly, this positive p53 effect of the CSN4 siRNA was abolished by over-expressed exogenous CSN4
(Figure 3C), clearly demonstrating that CSN4 is indeed regulating p53 protein levels. The mRNA levels of p53 were not affected by CSN4 (Figure S1A), showing that CSN4 targets the p53 protein. This was confirmed by performing a protein stability assay using
Cycloheximide. As shown in Figure 3D, siRNA knockdown of CSN4 greatly enhanced p53 protein stability, mimicking what was observed with the proteasome inhibitor
MG132 (Figure 3D).
Since one important cellular effect of p53 is to shut down cellular proliferation, we tested the possibility that elevated levels of p53 may be involved in the negative effect of CSN4 siRNA on cell growth. To do this, we performed a knockdown of p53 in the background of CSN4 knockdown, which resulted in a significant rescue of the cells
(Figure 3E). Yet, like the experiment with sGCα1 over-expression (see Figure 2E), the rescue with p53 knockdown was not complete. Thus, we opted to repeat the rescue experiment with both sGCα1 over-expression and p53 knockdown, resulting in nearly
100% rescued of cells treated with CSN4 siRNA (Figure 3F). Collectively, these results suggest that the CSN4 regulates prostate cancer cell proliferation via the combined effects on the pro-growth sGCα1 and the anti-growth p53.
34 p53 is an important regulator of gene transcription. To begin to study this, we first measured CSN4 effect on p53 transcriptional activity. As measured by a reporter gene assay, endogenous p53 activity was significantly enhanced by CSN4 siRNA and this was relieved by CSN4 over-expression (Figure 4A). To study an endogenous p53-repressed gene, we chose survivin, which was markedly increased at both the mRNA and protein levels in the context of CSN4 knockdown (Figure 4B), suggesting that CSN4 knockdown leads to p53-dependent apoptosis. Apoptosis was first measured by monitoring
Caspase3/7 activity, which was strongly enhanced in response to CSN4 siRNA, comparable to what was observed with Etoposide treatment (Figure 4C). This finding was confirmed using PARP cleavage, which was also greatly enhanced when cells were treated with CSN4 siRNA (Figure 4D). To directly test the role of p53, LNCaP and
CWR-22Rv1 cells were transfected with CSN4 siRNA alone or combined with p53 siRNA. Significantly, co-knockdown of p53 markedly reduced PARP cleavage induced by CSN4 knockdown (Figure 4E), demonstrating that apoptosis triggered by CSN4 knockdown is p53-dependent. It is important to mention that p53 siRNA did not influence the negative effect of CSN4 knockdown on sGCα1 (Figure S4A and S4B).
Also, knockdown of endogenous p53 (Figure S4D) had no effect on prostate cancer cell proliferation (Figure S4C), as published earlier (10).
Expression of CSN4 protein is strongly enhanced in prostate cancer.
To obtain evidence for CSN4 regulation of sGCα1 and p53 in prostate cancer, we monitored the expression of all three proteins in prostate tumors. The first set of tumors clearly demonstrated high CSN4 protein over-expression as compared to normal (Figure
35 5A, upper panel). The same finding was made when CSN4 mRNA levels were measured
(Figure S5A). All three proteins were measured in second set of tumors, which also exhibited a strong over-expression of CSN4 protein in prostate cancer (Figure 5A).
Intriguingly, these cancer tissues also exhibited high levels of sGCα1 and very low levels of p53, while the normal prostate tissues expressed little CSN4 and sGCα1, but high levels of p53 (Figure 5B). When protein levels were quantified, we observed a direct correlation between CSN4 and sGCα1 proteins and inverse correlation between CSN4 and p53 (Figure 5B, Lower). These data are consistent with the activities of CSN4 in prostate cancer cells and make it possible that CSN4 is indeed regulating sGCα1 and p53 protein levels in prostate cancer.
CSN5 mediates the CSN4 effects on p53 and sGCα1.
CSN4 was identified as a part of the CSN. Another CSN subunit of particular interest here is CSN5 (also known as JAB1), which previously was reported to associate with p53 and mediate its nuclear export (44). Interestingly, siRNA knockdown of CSN4 resulted in markedly reduced levels of CSN5 in both LNCaP and CWR-22Rv1 cells
(Figure 6A). The complementary experiment, CSN5 knockdown, did not significantly affect CSN4 protein (Figure 6B), suggesting that CSN5 acts downstream of CSN4.
While there was no effect on CSN4 protein levels, CSN5 depletion led to elevated levels of p53 (Figure 7A) and reduced levels of sGCα1 (Figure 7B), mimicking what was observed with the CSN4 knockdown in our earlier experiments (see Figures 2A and 3B).
This finding suggests that the effects of CSN4 knockdown on the sGCα1 and p53 proteins are mediated by the elevated levels of CSN5 protein that result from the CSN4
36 knockdown. IP experiments demonstrated that CSN5 can interact with both p53 (Figure
7C), as shown previously (35), and sGCα1 (Figures 7D and S4D), once again duplicating what was observed with CSN4 (see Figure 3A). Indeed, our data showed that CSN5 was found in a single complex with CSN4, p53, and sGCα1 (see Figure 8D). With respect to p53, we confirmed that CSN5 regulates p53 subcellular localization in prostate cancer cells (44), as CSN5 knockdown led to greatly enhanced levels of nuclear p53 (Figure 7E) and increased p53 transcriptional activity (Figure 7F). Since CSN5 regulates the levels of p53 and sGCα1, we expected that CSN5 would act on prostate cancer cell proliferation.
Indeed, CSN5 depletion resulted in markedly reduced proliferation of both CWR-22Rv1
(Figure 7G) and LNCaP cells (7H). These depleted cells were rescued by either siRNA knockdown of p53 (Figure 7H) or sGCα1 over-expression (Figure 7I). Importantly, sGCα1 over-expression had a significantly lower positive effect on cells treated with
Control siRNA (Figure 7I). Thus, CSN5, like CSN4, regulates prostate cancer cell proliferation by targeting the sGCα1 and p53 proteins.
CK2 is involved the CSN regulation of the p53 and sGCα1 proteins.
Previous evidence has shown that Caseine Kinase-2 (CK2) and Protein Kinase-D
(PKD) are associated with the CSN complex (32). Thus, we tested the possible involvement of these two kinases in the CSN4 and CSN5 regulation of sGCα1 and p53 using chemical inhibitors first. Interestingly, treatment of cells with Curcumin, which inhibits both kinases, resulted in reduced sGCα1 and elevated p53 (Figure 8A). To study each kinase individually, we treated cells with CID, a PKD inhibitor, or Emodin, a CK2 inhibitor. While CID had no significant effect (Figure S5B), Emodin had a strong
37 negative effect on sGCα1 and positive on p53 (Figure 8B), reproducing the data we observed with CSN4 and CSN5 knockdowns. To confirm these data, CK2 levels were depleted by siRNA, resulting in the same effects on sGCα1 and p53 (Figure 8C) as seen with Emodin treatment (see Figure 8B). Thus, CK2 expression and activity are important in regulating the levels of sGCα1 and p53 proteins.
Since CK2 appears to mediate the antagonistic effects of CSN4 and CSN5 on sGCα1 and p53, it is possible that CK2 may be associated with these proteins. Thus, IP experiments were performed using an anti-CK2 antibody, which yielded co-purification of CSN4, CSN5, p53, and sGCα1 in both LNCaP and CWR-22Rv1 cells (Figure 8D), strongly arguing that prostate cancer cells harbor an endogenous complex containing all these proteins.
To monitor the effect of androgens on this complex, LNCaP cells were treated with androgens. Interestingly, only sGCα1 responded (Figure 8E), exhibiting the expected up-regulation (6).
DISCUSSION
The proteins p53 and sGCα1 exhibit an interesting dichotomy in prostate cancer: p53 is widely studied and has anti-survival, anti-growth, and anti-cancer functions (11), while sGCα1 is poorly studied and has pro-survival, pro-growth, and pro–cancer functions (6, 10). Moreover, these two proteins interact with one another in prostate cancer cells, leading to suppression of p53 activity (10). Now we report that p53 and sGCα1 are part of a larger complex that includes two subunits of the CSN complex and the CK2 kinase. The two subunits are CSN4 and CSN5, and together with CK2, they
38 have antagonistic activities on the sGCα1 and p53 proteins: sGCα1 is stabilized while p53 is destabilized, providing prostate cancer cells increased capacity to survive and grow. As would be expected, CSN4 protein expression is greatly elevated in prostate tumors, as is sGCα1, while p53 expression is down-regulated. Thus, our data suggest that the over-expression of CSN4 in prostate cancer is, at least in part, responsible for the elevated levels of sGCα1 protein (6) and reduced levels of p53 (14).
Our finding that CSN5 regulates p53 is consistent with earlier published work showing that CSN5 mediates p53 nuclear export and protein degradation (44), an effect that we have been able to reproduce in prostate cancer cells. Our finding that CSN4 affects CSN5, leading to sGCα1 stabilization, is completely novel and represents a new target for CSN5. Moreover and more importantly, CSN4 appears to be a master regulator of CSN5 and therefore downstream target of CSN4. While knockdown of CSN5 affects protein levels of both p53 and sGCα1, there is no change in CSN4 protein expression.
Yet, knockdown of CSN4 greatly diminished the levels of CSN5 protein, as well as affecting the p53 and sGCα1 proteins. These data suggest that CSN4 is upstream of
CSN5 and regulates p53 and sGCα1 via CSN5. There is no published work to date suggesting this hierarchical arrangement of CSN4 and CSN5 in acting on common downstream targets. While this may be unique to prostate cancer, it is unlikely to be so in view of the ubiquitous expression of the CSN complex and its subunits among different tissues and cells (42).
The CSN complex consists of 8 subunits (45) and our data here show that two of these subunits, CSN4 and CSN5, are associated with sGCα1 and p53. Interestingly, our preliminary data suggest that CNS6 and CSN7 may also be part of this complex (data not
39 shown). With respect to this, an earlier study identified a sub-complex of the CSN that consists of CSN4, CSN5, CSN6, and CSN7 (46). The role of this sub-complex and specifically the CSN6 and CSN7 subunits in regulating sGCα1 and p53 will be studied in the future.
The CSN complex was previously determined to harbor kinase activity (27), and later work showed that this kinase activity is due to associated CK2 and PKD kinases
(32). Our study here found that the kinase activity of CK2, but not PKD, is indeed important in the CSN regulation of sGCα1 and p53. We further showed that CK2 is found in the complex containing sGCα1, p53, CSN4, and CSN5. Thus, we have advanced the earlier study done in erythrocytes (27) to show that a CSN complex containing CK2 and p53 exists in prostate cancer cells and this complex also contains sGCα1. Moreover, both sGCα1 and p53 proteins are targets of regulation within this complex and they are oppositely regulated. Our data also show that CK2 kinase activity is the mediator of sGCα1 and p53 regulation. With respect to p53, it has already been reported that CK2 phosphorylates p53 and thereby mediates its ubiquitin-dependent degradation (32), which is likely occurring in prostate cancer cells. On the other hand, no data have been reported about sGCα1 phosphorylation or interaction with the CSN or CK2. Thus, sGCα1 may be a direct substrate of CK2 kinase activity or an indirect target of this enzyme’s activity, with future work directed at addressing this important issue. Published data already have shown that CK2 can phosphorylate CSN2 and CSN7 subunits (32), providing one indirect mechanism for sGCα1 regulation. It is also possible that the multi-protein complex may exist in prostate cancer to regulate CK2 kinase activity and substrate
40 specificity, by bringing p53 and possibly sGCα1 in proximity to CK2. This is another important area of future work.
We recently published that sGCα1 down-regulates p53 activity by mediating its cytoplasmic sequestration via physical interaction in the cytoplasm (10). This current study shows that this cytoplasmic complex of sGCα1 and p53 also contains the CSN subunits and CK2. In view of the CSN5 activity on p53 nuclear export (44), it is possible that CSN5 brings p53 into this multi-protein complex, where CK2 can phosphorylate p53 and mediates its degradation. The sGCα1 protein may be a necessary component of this complex, and its down-regulation may destabilize the complex, thereby preventing p53 phosphorylation and degradation. Thus, it will be important in the future to dissect the cytoplasmic complex to map the interaction partners and determine the necessary components to maintain the stability and function of the complex. Regardless of what this future work will reveal, it is important to emphasize that the CSN activities we observed in prostate cancer cells on sGCα1 and p53 are mimicked in prostate cancer tissues.
Intriguingly, CSN4 expression was directly correlated with sGCα1 expression and inversely related to p53 expression in prostate cancer tissues, strongly arguing that CSN4, and likely CSN5 and CK2, are important regulators of the sGCα1 and p53 proteins, providing prostate tumors an enhanced ability to survive and grow.
Taking into account of our data, we provide a model connecting all the proteins
(Figure 8F). CSN4 is the upstream player controlling the levels of CSN5, which acts to oppositely regulate the proteasomal-degradation of sGCα1 and p53. CK2 enzyme activity is important in this regulation, possibly by affecting CSN4/5. Interestingly, while androgen signaling via AR has the expected positive effect on sGCα1 (6), it has no effect
41 on the other proteins in this complex. Thus, as our data have shown, this endogenous complex exists in both androgen-dependent and –independent prostate cancer cells, and
AR may ensure that sGCα1 expression is sufficient to support complex formation.
Interestingly, the negative effect of this complex on p53 can lead to enhanced AR activity in prostate cancer, since we have previously published that p53 disrupts AR transcriptional activity (18). Future work can address this possibility.
ACKNOWLEDGEMENTS
We would like to extend our gratitude to Dr. Rafael Garcia-Mata for providing the secondary antibody for immunofluorescence. We want to thank Dr. William Taylor for providing the p53 luciferase reporter.
GRANT SUPPORT
This work was supported by grants from National Institutes of Health.
REFERENCES
1. Jenster G. The role of the androgen receptor in the development and progression
of prostate cancer. Semin Oncol. 1999;26(4):407-421.
2. Arnold JT, Isaacs JT. Mechanisms involved in the progression of androgen-
independent prostate cancers: it is not only the cancer cell's fault. Endocr Relat
Cancer. 2002;9(1):61-73.
42 3. Han G, Buchanan G, Ittmann M, Harris JM, Yu X, Demayo FJ, Tilley W,
Greenberg NM. Mutation of the androgen receptor causes oncogenic
transformation of the prostate. Proc Natl Acad Sci U S A. 2005;102(4):1151-1156.
4. Chen CD, Welsbie DS, Tran C, Baek SH, Chen R, Vessella R, Rosenfeld MG,
Sawyers CL. Molecular determinants of resistance to antiandrogen therapy. Nat
Med. 2004;10(1):33-39.
5. Isaacs JT. Role of androgens in prostatic cancer. Vitam Horm. 1994;49:433-502.
6. Cai C, Chen SY, Zheng Z, Omwancha J, Lin MF, Balk SP, Shemshedini L.
Androgen regulation of soluble guanylyl cyclasealpha1 mediates prostate cancer
cell proliferation. Oncogene. 2007;26(11):1606-1615.
7. Krumenacker JS, Hanafy KA, Murad F. Regulation of nitric oxide and soluble
guanylyl cyclase. Brain Res Bull. 2004;62(6):505-515.
8. Sinnaeve P, Chiche JD, Nong Z, Varenne O, Van Pelt N, Gillijns H, Collen D,
Bloch KD, Janssens S. Soluble guanylate cyclase alpha(1) and beta(1) gene
transfer increases NO responsiveness and reduces neointima formation after
balloon injury in rats via antiproliferative and antimigratory effects. Circ Res.
2001;88(1):103-109.
9. Garthwaite G, Bartus K, Malcolm D, Goodwin D, Kollb-Sielecka M,
Dooldeniya C, Garthwaite J. Signaling from blood vessels to CNS axons
through nitric oxide. J Neurosci. 2006;26(29):7730-7740.
10. Cai C, Hsieh CL, Gao S, Kannan A, Bhansali M, Govardhan K, Dutta R,
Shemshedini L. Soluble guanylyl cyclase alpha1 and p53 cytoplasmic
43 sequestration and down-regulation in prostate cancer. Mol Endocrinol.
2012;26(2):292-307.
11. Zilfou JT, Lowe SW. Tumor suppressive functions of p53. Cold Spring Harb
Perspect Biol. 2009;1(5):a001883.
12. Hollstein M, Sidransky D, Vogelstein B, Harris CC. p53 mutations in human
cancers. Science. 1991;253(5015):49-53.
13. Greenblatt MS, Bennett WP, Hollstein M, Harris CC. Mutations in the p53
tumor suppressor gene: clues to cancer etiology and molecular pathogenesis.
Cancer Res. 1994;54(18):4855-4878.
14. Qian J, Hirasawa K, Bostwick DG, Bergstralh EJ, Slezak JM, Anderl KL,
Borell TJ, Lieber MM, Jenkins RB. Loss of p53 and c-myc overrepresentation
in stage T(2-3)N(1-3)M(0) prostate cancer are potential markers for cancer
progression. Mod Pathol. 2002;15(1):35-44.
15. Navone NM, Labate ME, Troncoso P, Pisters LL, Conti CJ, von Eschenbach
AC, Logothetis CJ. p53 mutations in prostate cancer bone metastases suggest
that selected p53 mutants in the primary site define foci with metastatic potential.
J Urol. 1999;161(1):304-308.
16. Pei D, Zhang Y, Zheng J. Regulation of p53: a collaboration between Mdm2 and
Mdmx. Oncotarget. 2012;3(3):228-235.
17. Roemer K. Notch and the p53 clan of transcription factors. Adv Exp Med Biol.
2012;727:223-240.
18. Shenk JL, Fisher CJ, Chen SY, Zhou XF, Tillman K, Shemshedini L. p53
represses androgen-induced transactivation of prostate-specific antigen by
44 disrupting hAR amino- to carboxyl-terminal interaction. J Biol Chem.
2001;276(42):38472-38479.
19. Gao S, Hsieh CL, Bhansali M, Kannan A, Shemshedini L. A peptide against
soluble guanylyl cyclase alpha1: a new approach to treating prostate cancer. PLoS
One. 2013;8(5):e64189.
20. Wei N, Deng XW. Making sense of the COP9 signalosome. A regulatory protein
complex conserved from Arabidopsis to human. Trends Genet. 1999;15(3):98-
103.
21. Wei N, Deng XW. The COP9 signalosome. Annu Rev Cell Dev Biol.
2003;19:261-286.
22. Schwechheimer C, Isono E. The COP9 signalosome and its role in plant
development. Eur J Cell Biol. 2010;89(2-3):157-162.
23. Lykke-Andersen K, Schaefer L, Menon S, Deng XW, Miller JB, Wei N.
Disruption of the COP9 signalosome Csn2 subunit in mice causes deficient cell
proliferation, accumulation of p53 and cyclin E, and early embryonic death. Mol
Cell Biol. 2003;23(19):6790-6797.
24. Menon S, Chi H, Zhang H, Deng XW, Flavell RA, Wei N. COP9 signalosome
subunit 8 is essential for peripheral T cell homeostasis and antigen receptor-
induced entry into the cell cycle from quiescence. Nat Immunol. 2007;8(11):1236-
1245.
25. Tomoda K, Yoneda-Kato N, Fukumoto A, Yamanaka S, Kato JY. Multiple
functions of Jab1 are required for early embryonic development and growth
potential in mice. J Biol Chem. 2004;279(41):43013-43018.
45 26. Scheel H, Hofmann K. Prediction of a common structural scaffold for
proteasome lid, COP9-signalosome and eIF3 complexes. BMC Bioinformatics.
2005;6:71.
27. Bech-Otschir D, Seeger M, Dubiel W. The COP9 signalosome: at the interface
between signal transduction and ubiquitin-dependent proteolysis. J Cell Sci.
2002;115(Pt 3):467-473.
28. Cope GA, Deshaies RJ. COP9 signalosome: a multifunctional regulator of SCF
and other cullin-based ubiquitin ligases. Cell. 2003;114(6):663-671.
29. Richardson KS, Zundel W. The emerging role of the COP9 signalosome in
cancer. Mol Cancer Res. 2005;3(12):645-653.
30. Zhao R, Yeung SC, Chen J, Iwakuma T, Su CH, Chen B, Qu C, Zhang F,
Chen YT, Lin YL, Lee DF, Jin F, Zhu R, Shaikenov T, Sarbassov D, Sahin A,
Wang H, Wang H, Lai CC, Tsai FJ, Lozano G, Lee MH. Subunit 6 of the
COP9 signalosome promotes tumorigenesis in mice through stabilization of
MDM2 and is upregulated in human cancers. J Clin Invest. 2011;121(3):851-865.
31. Tomoda K, Kubota Y, Kato J. Degradation of the cyclin-dependent-kinase
inhibitor p27Kip1 is instigated by Jab1. Nature. 1999;398(6723):160-165.
32. Uhle S, Medalia O, Waldron R, Dumdey R, Henklein P, Bech-Otschir D,
Huang X, Berse M, Sperling J, Schade R, Dubiel W. Protein kinase CK2 and
protein kinase D are associated with the COP9 signalosome. EMBO J.
2003;22(6):1302-1312.
46 33. Harari-Steinberg O, Chamovitz DA. The COP9 signalosome: mediating
between kinase signaling and protein degradation. Curr Protein Pept Sci.
2004;5(3):185-189.
34. Henke W, Ferrell K, Bech-Otschir D, Seeger M, Schade R, Jungblut P,
Naumann M, Dubiel W. Comparison of human COP9 signalsome and 26S
proteasome lid'. Mol Biol Rep. 1999;26(1-2):29-34.
35. Bech-Otschir D, Kraft R, Huang X, Henklein P, Kapelari B, Pollmann C,
Dubiel W. COP9 signalosome-specific phosphorylation targets p53 to
degradation by the ubiquitin system. EMBO J. 2001;20(7):1630-1639.
36. Kapelari B, Bech-Otschir D, Hegerl R, Schade R, Dumdey R, Dubiel W.
Electron microscopy and subunit-subunit interaction studies reveal a first
architecture of COP9 signalosome. J Mol Biol. 2000;300(5):1169-1178.
37. Granata A, Koo SJ, Haucke V, Schiavo G, Warner TT. CSN complex controls
the stability of selected synaptic proteins via a torsinA-dependent process. EMBO
J. 2011;30(1):181-193.
38. Cai C, Hsieh CL, Shemshedini L. c-Jun has multiple enhancing activities in the
novel cross talk between the androgen receptor and Ets variant gene 1 in prostate
cancer. Mol Cancer Res. 2007;5(7):725-735.
39. Cai C, Hsieh CL, Omwancha J, Zheng Z, Chen SY, Baert JL, Shemshedini
L. ETV1 is a novel androgen receptor-regulated gene that mediates prostate
cancer cell invasion. Mol Endocrinol. 2007;21(8):1835-1846.
40. Tepper CG, Boucher DL, Ryan PE, Ma AH, Xia L, Lee LF, Pretlow TG,
Kung HJ. Characterization of a novel androgen receptor mutation in a relapsed
47 CWR22 prostate cancer xenograft and cell line. Cancer Res. 2002;62(22):6606-
6614.
41. Nadiminty N, Tummala R, Liu C, Yang J, Lou W, Evans CP, Gao AC. NF-
kappaB2/p52 induces resistance to enzalutamide in prostate cancer: role of
androgen receptor and its variants. Mol Cancer Ther. 2013;12(8):1629-1637.
42. Schwechheimer C. The COP9 signalosome (CSN): an evolutionary conserved
proteolysis regulator in eukaryotic development. Biochim Biophys Acta.
2004;1695(1-3):45-54.
43. Igawa T, Lin FF, Lee MS, Karan D, Batra SK, Lin MF. Establishment and
characterization of androgen-independent human prostate cancer LNCaP cell
model. Prostate. 2002;50(4):222-235.
44. Oh W, Lee EW, Sung YH, Yang MR, Ghim J, Lee HW, Song J. Jab1 induces
the cytoplasmic localization and degradation of p53 in coordination with Hdm2. J
Biol Chem. 2006;281(25):17457-17465.
45. Kato JY, Yoneda-Kato N. Mammalian COP9 signalosome. Genes Cells.
2009;14(11):1209-1225.
46. Kotiguda GG, Weinberg D, Dessau M, Salvi C, Serino G, Chamovitz DA,
Hirsch JA. The organization of a CSN5-containing subcomplex of the COP9
signalosome. J Biol Chem. 2012;287(50):42031-42041.
48 Figure 1-I: CSN4 is a novel binding partner for sGCα1 in prostate cancer cells.
LNCaP and CWR-22Rv1 cell extracts were subjected to (A) Immunoprecipitation (IP) using an (A) anti-sGCα1 antibody or (B) anit-CSN4 antibody. IgG was used as a control.
Western blotting was used to measure sGCα1 and CSN4 proteins. (C) LNCaP and CWR-
22Rv1 cells were subjected to immunocytochemistry using anti-sGCα1 and anti-CSN4 antibodies to measure sub-cellular localization of endogenous sGCα1 and CSN4. DAPI stains nuclei.
49
Figure 1-I
50
Figure 2-I: CSN4 positively regulates sGCα1 stability and is involved in sGCα1- dependent prostate cancer cell growth. (A) LNCaP, C81, CWR-22Rv1 and PC-3 cells were transfected with Control (Ctrl) siRNA or CSN4 siRNA or (B) LNCaP and CWR-
22Rv1 cells were transfected with Ctrl siRNA or CSN4 siRNA with or without
CSN4/CMV expression plasmid. (C) LNCaP and CWR-22Rv1 cells were transfected with Ctrl siRNA or CSN4 siRNA and treated with 50 µg/ml Cycloheximide (CHX) and
10 µM MG132. CSN4 and sGCα1 levels were measured by Western blotting. Numbers above represent protein quantification levels relative to the first condition, which was set to 1. In A, B, and C, β-actin was used as loading control and the molecular weights of the proteins are 77 kDa (sGCα1), 49 kDa (CSN4), and 42 kDa (β-actin). LNCaP and
CWR-22Rv1 cells were transfected with (D) Ctrl siRNA or CSN4 siRNA or (E) Ctrl siRNA or CSN4 siRNA with or without sGCα1 expression plasmid. Cell density was measured by MTT assay. Data points in D and E represents an average of three independent experiments plus standard deviations The Student T–test was performed to show statistical significance (p < 0.01), as indicated by asterisks.
51
Figure 2-I
52 Figure 3-I: CSN4 negatively regulates p53 stability and provides prostate cancer cells enhanced growth. (A) CWR-22Rv1 cell extracts were subjected to IP using antibody against p53 or sGCα1. IgG was used as negative control IP. Western blotting was used to measure p53, sGCα1, and CSN4. (B) LNCaP, C81, and CWR-22Rv1 cells were transfected with Ctrl siRNA or CSN4 siRNA and subjected to Western blotting to measure CSN4 and p53. (C) LNCaP and CWR-22Rv1 cells were transfected with
Control (Ctrl) siRNA, CSN4 siRNA, and CSN4/CMV expression plasmid and cell lysates were subjected to Western blotting to measure p53 and CSN4. (D) LNCaP cells were treated with Vehicle, Ctrl siRNA and 10 µM MG132, or CSN4 siRNA, in the absence or presence of 50 µg/ml CHX for different incubation periods, and Western blotting was used to measure p53 and CSN4. Numbers above represent protein quantification levels relative to the first condition, which was set to 1. In B, C, and D, β- actin was used as loading control and the molecular weights of the proteins are 77 kDa
(sGCα1), 49 kDa (CSN4), 53 kDa (p53), and 42 kDa (β-actin). (E) LNCaP and CWR-
22Rv1 cells were transfected with Ctrl siRNA or CSN4 siRNA, with or without p53 siRNA, and cell density was measured by MTT assay. (F) LNCaP cells were transfected with Ctrl siRNA or CSN4 siRNA, with or without p53 siRNA or sGCα1 expression plasmid, and cell density was measured by MTT assay. In E and F data points represents an average of three independent experiments plus standard deviations. The Student T–test was performed to show statistical significance (p < 0.03), as indicated by asterisks. 53
Figure 3-I
54 Figure 4-I: CSN4 affects p53 transcriptional activity and disrupts p53-dependent apoptosis. (A) LNCaP cells were transfected with p53-Luc and Ctrl siRNA or CSN4 siRNA, with or without CSN4 expression plasmid, and p53 transcriptional activity was measured by Luciferase assay. (B) LNCaP and CWR-22Rv1 cells were transfected with
Ctrl siRNA or CSN4 siRNA and survivin gene expression was measured by Q-RT-PCR or Western blotting. LNCaP and C81 cells were transfected with Ctrl siRNA or CSN4 siRNA and apoptosis was measured by (C) Caspase 3/7 activity or (D) Western blotting of cleaved PARP. (E) LNCaP and CWR-22Rv1 cells were transfected with Control siRNA or CSN4 siRNA, with or without p53 siRNA, and apoptosis was measured by
Western blotting of cleaved PARP. In B, D, and E, β-actin was used as loading control and the molecular weights of the proteins are 16 kDa (Survivin), 49 kDa (CSN4), 53 kDa
(p53), 116 kDa (PARP), 89 kDa (Cleaved PARP), and 42 kDa (β-actin). In A and C bar graphs represents an average of three independent experiments plus standard deviations.
The Student T-test was performed to show statistical significance (p< 0.005), as indicated by asterisks. Bar graphs represent averages of three independent experiments plus standard deviations.
55
Figure 4-I
56 Figure 5-I: CSN4 protein is over-expressed in prostate tumors and correlates directly with sGCα1 and inversely with p53 proteins. (A) Western blotting was used to measure expression of CSN4, sGCα1, and p53 proteins in normal prostate tissues or prostate tumors. (B) Expression of CSN4, sGCα1, and p53 proteins in prostate tumors were quantified and plotted relating CSN4 to either sGCα1 or p53. β-actin was used as loading control and the molecular weights of the proteins are 77 kDa (sGCα1), 49 kDa
(CSN4), 53 kDa (p53), and 42 kDa (β-actin). Linear regression analysis was done to compare protein levels of CSN4, and sGCα1 or CSN4 and p53, both of which were significant as represented by R2 values 0.73532 and 0.02379 and p values of 0.015 and
0.753, respectively.
57
Figure 5-I
58 Figure 6-I: CSN4 regulates CSN5 protein levels in prostate cancer cell lines. LNCaP and CWR-22Rv1 cells were transfected with (A) Ctrl siRNA or CSN4 siRNA or (B) Ctrl siRNA or CSN5 siRNA and Western blotting was used to measure CSN4 and CSN5. β- actin was used as loading control and the molecular weights of the proteins are 38 kDa
(CSN5), 49 kDa (CSN4), and 42 kDa (β-actin).
59
Figure 6-I
60 Figure 7-I: CSN5 antagonistically regulates p53 and sGCα1 proteins in prostate cancer. LNCaP and CWR-22Rv1 cells were transfected with Ctrl siRNA or CSN5 siRNA and Western blotting was used to measure (A) CSN5 and p53, (B) CSN5 and sGCα1, (E) CSN5 and p53 in cytosolic (C) or nuclear (N) fractions, or (F) p53 transcriptional activity using a Luciferase assay. β-actin was used as loading control and the molecular weights of the proteins are 53 kDa (p53), 38 kDa (CSN5), 49 kDa (CSN4),
42 kDa (β-actin), 50 kDa (β-tubulin) and 52 kDa (RARα). β-Tubulin and RARα were used as markers for cytosolic and nuclear fractions, respectively. LNCaP cell extracts were subjected to IP using antibody against (C) CSN5 or p53 or (D) CSN5 or sGCα1.
IgG was used as negative control IP. Western blotting was used to measure CSN5, p53, and sGCα1. CWR-22Rv1 and LNCaP cells were transfected with (G) Ctrl siRNA or
CSN5 siRNA, (H) Ctrl siRNA or CSN4 siRNA, with or without p53 siRNA, or (I) Ctrl siRNA or CSN5 siRNA, with or without sGCα1 expression plasmid. Cell density was measured by MTT assay. In F, G, H, and I data points represents an average of three independent experiments plus standard deviations. Asterisks indicate statistical significance (p < 0.004) in F and (p < 0.03) in G, H and I. The Student T-test was used to analyze the data.
61
Figure 7-I
62
Figure 8-I: CK2 associates with and regulates p53 and sGCα1 proteins in prostate cancer cells. LNCaP and CWR-22Rv1 cells were treated with (A) 40 µM Curcumin, (B)
40 µM Emodin, or (C) transfected with Ctrl siRNA or CK2 siRNA and Western blotting was used to measure CSN4, sGCα1, p53, and CK2. β-actin was used as loading control.
(D) LNCaP and CWR-22Rv1 cell extracts were subjected to IP using an antibody against
CK2. IgG was used as negative control IP. (E) LNCaP cells treated with ethanol (-) or 1 nM R1881 (+) for 24 hrs, then subjected to Western blotting to measure CK2, CSN4,
CSN5, p53, sGCα1 and AR (110kd). The molecular weights of the proteins are 45 kDa
(CK2), 53 kDa (p53), 38 kDa (CSN5), 49 kDa (CSN4), 53 kDa (p53), 77 kDa (sGCα1),
110 kDa (kDa), and 42 kDa (β-actin). (F) Schematic diagram showing the interaction of the CSN4/5proteins and CK2 with sGCα1 and p53 and the role of AR.
63
Figure 8-I
64 Figure S1-I: CSN4 does not affect mRNA expression of sGCα1, p53, or CSN5. (A)
LNCaP and (B) CWR-22Rv1 cells were transfected with Ctrl siRNA or CSN4 siRNA and Q-RT-PCR was used to measure mRNA expression of CSN4, sGCα1, p53, and
CSN5.
65
Figure S1-I
66
Figure S2-I: CSN4 affects the growth of AR-positive prostate cancer cells, but not
AR-negative cells. (A) LNCaP, C81, and PC-3 cells were transfected with Ctrl siRNA or
CSN4 siRNA, with or without CSN4 expression plasmid, and cell density was measured by MTT assay. Data points represents an average of three independent experiments plus standard deviations. T-test analysis is performed. Asterisks indicate statistical significance (p < 0.03). (B) LNCaP and CWR-22Rv1 cells were transfected with Ctrl siRNA (-) or CSN4 siRNA (+), with or without sGCα1 expression plasmid, and subjected to Western blotting to measure p53 (53kd), sGCα1 (77kd), and CSN4 (49kd). β-actin was used as loading control.
67
Figure S2-I
68
Figure S3-I: Cyclase-deficient sGCα1 rescues the growth of prostate cancer cells depleted for CSN4. LNCaP cells were transfected with Ctrl siRNA or CSN4 siRNA, with or without sGCα1 (D531A) expression plasmid, and (A) MTT assay was used to measure cell density or (B) Western blotting to measure expression of CSN4, sGCα1, and sGCα1 (D531A). T-test analysis is done. Asterisks indicate statistical significance (p <
0.05). (C) LNCaP and CWR-22Rv1 cells were transfected with Ctrl siRNA or CSN4 siRNA and subjected to Western blotting to measure sGCβ1, and CSN4. In B and C, β- actin was used as loading control.
69
Figure S3-I
70
Figure S4-I: p53 does not affect sGCα1 protein levels nor the growth of prostate cancer cells. (A) LNCaP and CWR-22Rv1 cells were transfected with Ctrl siRNA or
CSN4 siRNA, with or without p53 siRNA, and subjected to Western blotting to measure expression of sGCα1 and p53 or (B) Q-RT-PCR to measure expression of CSN4. LNCaP and CWR-22Rv1 cells were transfected with Ctrl siRNA or p53 siRNA, and subjected to
(C) MTT to measure cell density or (D) Q-RT-PCR to measure expression of p53. (E)
CWR-22Rv1 cell extracts were subjected to IP using antibody against sGCα1. IgG was used as negative control IP. Western blotting was used to measure sGCα1 (77kd), CSN4
(49kd), and CSN5 (38kd).
71
Figure S4-I
72
Figure S5-I: CSN4 mRNA is over-expressed in prostate tumors. (A) Q-RT-PCR was used to measure expression of CSN4 in normal prostate tissues or prostate tumors. (B)
LNCaP and CWR-22Rv1 cells were treated with 25µM or 50 µM CID and Western blotting was used to measure sGCα1 and p53. β-actin was used as loading control.
73
Figure S5-I
74 Chapter 3
Manuscript 2
TM4SF3 and AR: A Nuclear Complex that Stabilizes Both Proteins
Meenakshi Bhansali and Lirim Shemshedini
Department of Biological Sciences, The University of Toledo, Toledo, Ohio 43606
Corresponding Author: Lirim Shemshedini, Department of Biological Sciences,
University of Toledo, Toledo, Ohio 43606, Tel. (419) 530-1553; Fax. (419) 530-7737;
Email: [email protected]
Running Title: TM4SSF3 and AR exhibit a nuclear interaction.
Keywords: TM4SF3, AR, prostate cancer, cell proliferation, gene expression
Notes:
-This work was supported by grants from NIH.
-All authors have no conflict-of-interest to declare.
75
ABSTRACT
Transmembrane-4 Superfamily-3 (TM4SF3), a member of the Tetraspanin protein, was identified as a novel androgen-regulated gene in prostate cancer cells. Our data demonstrate that TM4SF3 is a target of complex androgen regulation, exhibiting androgen-induced repression of the TM4SF3 mRNA but up-regulation of the protein.
The androgen positive effect on the TM4SF3 protein is of significant interest in view of the pro-cancer functions of both androgens and Tetraspanin proteins, directing the focus of this study on the TM4SF3 protein. Androgen positively regulates TM4SF3 protein stability by inhibiting its proteasome-dependent degradation. This androgen stabilization of TM4SF3 is involved in promoting prostate cancer cell invasion, migration, and EMT in both androgen-dependent and androgen-independent prostate cancer cells. While confirming androgen up-regulation of the TM4SF3 protein, we observed that TM4SF3 is localized not only to the membrane, but also, surprisingly, the nuclei of prostate cancer cells. This novel nuclear localization of TM4SF3 depends on androgen-induced nuclear localization of Androgen Receptor (AR) in both androgen-dependent and androgen- independent prostate cancer cell lines. After confirming the TM4SF3 nuclear localization by cell fractionation, we determined that TM4SF3 interacts with AR in prostate cancer cells and directly associates with AR in vitro. This direct interaction between the two proteins is required for the stabilization of not only TM4SF3, but also remarkably AR, since down-regulation of TM4SF3 resulted in reduced AR protein levels. As would be expected of an important AR regulator, TM4SF3 regulates androgen-dependent gene expression in and proliferation of prostate cancer cells. Importantly, the direct correlation
76 between AR and TM4SF3 protein levels was also observed in prostate tumors, strongly showing that the mutual stabilization resulting from the AR-TM4SF3 interaction is found in tumors and suggesting that this interaction is important in prostate cancer biology. In short, our data provide a novel mechanism for regulating AR and TM4SF3 protein levels in prostate cancer, via their physical interaction, an interaction that represents a novel target for disruption to treat prostate cancer.
INTRODUCTION
Prostate cancer (PCa) is a commonly diagnosed male malignancy and second leading cause of cancer deaths in American men. The standard systemic treatment for
PCa is androgen deprivation therapy (ADT), which results in an early positive clinical response but usually relapses to the more aggressive stage called as castration-resistance
PCa (CRPC).1, 2 Androgen receptor (AR) is a master regulator in the development of normal prostate and PCa. One of the most important mechanisms for CRPC is the restoration of aberrant androgen signaling through the AR.3-5
AR, a member of nuclear receptor (NR) superfamily of transcription factors, regulates the expression of target genes in response to androgenic signals derived from testes that lead to differentiation, proliferation, and transformation of prostate cells.6, 7 As
AR is overexpressed and AR transcriptional activity is restored in CRPC, AR regulated genes play significant roles in the progression of this advanced stage of Pca.8-10
Importantly, AR gene amplification and gain-of-function mutations suggests that these advanced prostate tumors were under strong selective pressure to sustain AR transcriptional activity. Based on evidence from the xenograft tumors, AR expression and
77 activity is restored after castration3-5 Several studies have revealed that the AR transcriptional network is modified during development of CRPC, such as genes involved in androgen synthesis like AKR1C3 and SRD5A1,11-13 and M-phase checkpoint inactivator genes like CDC20, CDK1 promotes tumor growth in mouse models.14
Reactivation of TMPRSS2:ERG fusion gene expression by AR contribute to the tumor progression in CRPC,15 and thus promote invasion of tumors.16, 17
To shed more light on AR functions in the development of prostate cancer, we performed the gene profiling studies in prostate cancer cells and identified TM4SF3
(Transmembrane 4 Superfamily 3) as a novel androgen down-regulated gene. TM4SF3 belongs to Tetraspanin family, which consist of 33 mammalian proteins that are conserved from yeast to humans.18 These small proteins are characterized by presence of four hydrophobic trans-membrane domains and several conserved amino acids.19, 20
Identified as a tumor-associated antigen due to its high expression in different human carcinomas, TM4SF3 also known as C0-029 in humans and D6.1 in rats, promotes pro- invasive, pro-metastatic and pro–growth functions in different tumors.21, 22 It promotes pro-invasive, pro-metastatic and pro–growth functions in different tumors. For example,
TM4SF3 up-regulates the ADAM12m (A Disintegrin and Metalloproteinase) expression in esophageal carcinoma and enhances the esophageal cancer cell invasion.22 Up- regulation of TM4SF3 correlates with the progression of hepatocellular23 colon24and pancreatic carcinomas.25 However the role and regulation of TM4SF3 in PCa is not yet defined.
In the present study, we observed for the first time that TM4SF3 is a target of complex androgen regulation. Our findings showed that androgen represses the TM4SF3
78 mRNA but up-regulates protein levels by preventing proteasome-dependent degradation.
Androgen-mediated stabilization of TM4SF3 leads to invasion, migration and epithelial– to-mesenchymal transition (EMT) of prostate cancer cells. Most interestingly and perplexingly, in addition to being localized in the plasma membrane, TM4SF3 exhibits androgen-induced nuclear localization in prostate cancer cells and interaction with AR both in cells and in vitro. Moreover, our data show that the TM4SF3 protein up-regulates endogenous AR protein and its biological activities in prostate cancer cells. Importantly
TM4SF3 is over expressed in prostate tumors and positively correlates with AR.
RESULTS
TM4SF3 is a target of complex androgen regulation in prostate cancer cells
Utilizing gene microarray, our lab has identified several novel androgen-regulated genes. Most are androgen-induced and our published data show important biological roles for several genes, including sGCα1,26 ETV1,6 and MRP4.27 Among the fewer androgen-repressed genes, the TM4SF3 gene was unique in its androgen regulation: mRNA expression was reduced while protein expression induced. As shown in Fig. 1A, we were able to confirm the gene microarray data by performing Q-RT-PCR showing that androgen-repressed TM4SF3 mRNA expression in LNCaP cells. In contrast to the mRNA, the TM4SF3 protein level increased in response to R1881 treatment of LNCaP cells, as measured by Western blotting (Fig. 1B). To confirm these surprising results, we employed complementary approaches for the mRNA and protein.
We verified the down-regulated mRNA using four different primer pairs that cover different regions of the TM4SF3 mRNA, including the coding region and
79 untranslated regions (both 5’ and 3’ UTRs) (Fig. S1A). With respect to the TM4SF3 protein, we used two complementary approaches. First, a siRNA targeting TM4SF3 was transfected into LNCaP cells and this resulted in significant reduction in expression of the
TM4SF3 protein detected by our antibody (Fig. 1C). Second, we expressed exogenous
TM4SF3 from an expression plasmid, and this led to a significant increase in the
TM4SF3 protein detected by our antibody (Fig. 1D). These data, together with the correct predicted molecular weight based on our Western blot, confirmed that our antibody was indeed detecting the TM4SF3 protein. Subsequent time-course experiments revealed that androgen up-regulation of TM4SF3 protein (see Fig. 2C) occurs earlier than androgen down-regulation of TM4SF3 mRNA (Fig. S1B). It is likely that reduction of mRNA follows the translation process, thereby providing a mechanism of mRNA turnover after it has been used as a template in translation.
Androgen stabilizes the TM4SF3 protein
As expected, androgen up-regulation of protein depends on AR. Knockdown by siRNA of AR (Fig. 2A) or Casodex treatment (Fig. 2B) disrupted the androgen positive effect on the TM4SF3 protein in LNCaP cells. Interestingly, the TM4SF3 protein level was increased by androgen in LNCaP and VCaP cells but does not respond to R1881 in the hormone-refractory C81 and CWR-22Rv1 cells (Fig. 2C). Indeed, the TM4SF3 protein levels in C81 and CWR-22Rv1 cells without R1881 were comparable to those in
LNCaP and VCaP cells with hormone (Fig. 2C), mimicking what has been seen with AR expression.28 Yet, these elevated, unresponsive TM4SF3 protein levels are still dependent on AR, as AR knockdown dramatically reduced the levels in C81 cells (Fig. 2A).
80 TM4SF3 protein expression was also high in PC-3 cells, and obviously not affected by hormone (Fig. 2C). Importantly, TM4SF3 protein expression was barely detectable in
(primary prostate epithelial) PrEC cells29 (Fig. 2C), expected for a protein involved in cancer metastasis.
One possible mechanism for protein up-regulation is decreased degradation.
Therefore, we studied the stability of the endogenous TM4SF3 protein in LNCaP cells using Cycloheximide (CHX), which showed that the steady state levels of TM4SF3 protein levels decreased over 24 hrs, but only in the absence of R1881 (Fig. 2D). R1881 treatment maintained these steady state levels during the first 12 hrs and a small decrease was observed only after 24 hrs (Fig. 2D), consistent with the hypothesis that androgen disrupts TM4SF3 protein degradation.
These data suggest that the mechanism of androgen up-regulation of TM4SF3 protein is by enhancing its stability. This is further supported by a time-course experiment, which showed that androgen begins to have a positive effect on the TM4SF3 after 8 hrs of hormone treatment, during which time the TM4SF3 protein levels drop significantly without hormone (Fig. 2E). Collectively, these data suggest that androgen up-regulates TM4SF3 protein levels by decreasing proteasomal-dependent degradation.
As shown in Fig. 2F, the proteasome inhibitor MG132 was able to disrupt the time- dependent reduction in TM4SF3 protein, strongly suggesting that the protein reduction is due to proteasome-dependent degradation.
81 TM4SF3 promotes the migration, invasiveness, and EMT of prostate cancer cells
Since Tetraspanins are well known to function in metastasis,30 we studied the possibility that TM4SF3 serves this function in prostate cancer cells. Androgen treatment of LNCaP cells enhanced both invasion and migration, as expected,6 and, interestingly, knockdown of TM4SF3 completely eliminated both of these cell processes (Fig. 3A).
Importantly, these TM4SF3 siRNA-treated cells were completely rescued for invasion and migration by expressing a siRNA-resistant TM4SF3-His (Fig. 3A). The same findings were made in androgen-independent C81 cells (Fig. S2A). A strong effect was also observed in PC-3 cells (Fig. 3B), which express significant levels of TM4SF3 protein (see Fig. 2C); these cells only express membrane-bound TM4SF3 (see Fig. 5A).
Just as with LNCaP and C81 cells, PC-3 cells were completely rescued for invasion and migration by an adenovirus expressing a siRNA-resistant TM4SF3-His (Fig. 3B), clearly demonstrating that these metastatic processes are under TM4SF3 regulation. An initiating event in metastasis is epithelial-to-mesenchymal transition (EMT)31 and knockdown of
TM4SF3 expression disrupts EMT, as monitored by expression of E-cadherin, N- cadherin, and Vimentin, in both LNCaP (Fig. 3C) and PC-3 cells (Fig. 3D).
A nuclear TM4SF3 is found in prostate cancer cells that associates with AR
Immunocytochemistry was used to confirm the androgen-mediated up-regulation of TM4SF3 protein that was detected by Western blotting (see Figs. 1, 2). As shown in
Fig. 4A, androgen strongly enhanced endogenous TM4SF3 levels in LNCaP cells and the endogenous TM4SF3 signal was found through the cell. AR protein level was also greatly increased in response to androgen (Fig. 4A), as expected. Remarkably, a merge of
82 the two signals showed that a subset of endogenous TM4SF3 was nuclear in the presence of androgen, and this nuclear TM4SF3 was co-localized with nuclear AR in both LNCaP
(Fig. 4A). Interestingly, while C81 cells exhibit little effect of androgen on AR and
TM4SF3 protein levels, there is a hormone-induced nuclear co-localization of AR and
TM4SF3 in these hormone-refractory cells (Fig. S2B) that mimics what was observed in
LNCaP cells (see Fig. 4A). To confirm this surprising result, we performed cell fractionation followed by Western blotting. Without hormone, TM4SF3 was mainly localized in the membrane fraction with a small amount of nuclear protein in LNCaP
(Fig. 4B), while with hormone the nuclear levels of TM4SF3 increased significantly in
(Fig. 4B), completely supporting the immunocytochemistry. Note that androgen-induced the expected nuclear localization of AR in LNCaP cells (Fig. 4B). A similar androgen- dependent nuclear localization of AR and TM4SF3 finding was made in hormone- refractory C81 cells (Fig. S2C). Collectively, these data show that a fraction of endogenous TM4SF3 in prostate cancer cells is localized in the nucleus, and this nuclear fraction increases substantially when cells are treated with androgens and the AR is translocated into the nucleus. These findings represent the first demonstration of the
TM4SF3 protein being localized in the nucleus and open the possibility that this nuclear localization has biological functions in prostate cancer.
The co-localization data of Figs. 4A and 4B and S2B and S2C suggest that that
TM4SF3 interacts with AR in prostate cancer cells. To confirm this, we performed immunoprecipitation (IP) experiments with endogenous proteins. IP purification of AR resulted in co-purification of TM4SF3 in the presence of R1881 (Fig. 4C). The complementary experiment of TM4SF3 IP purification yielded some co-purified AR
83 without hormone and significantly more AR with hormone (Fig. 4C). We observed a similar hormone-dependent AR-TM4SF3 interaction in C81 cells (Fig. 4D). To determine if the AR-TM4SF3 interaction occurs in the cytoplasm, nucleus or both, LNCaP cells were treated with MG132, in the absence or presence of R1881, to block proteasomal- degradation and cell fractions were subjected to IP using an anti-AR antibody. As shown in Fig. 4E, significant levels TM4SF3 were co-purified with AR in both cytosolic and nuclear fractions with hormone, suggesting that the AR-TM4SF3 interaction may begin in the cytoplasm before AR has undergone an androgen-induced nuclear translocation.
The above results (see Figs. 4 and S2) show an R1881-dependent interaction and nuclear co-localization of AR and TM4SF3. To determine if exogenous proteins can exhibit the same interaction, transfected LNCaP and PC-3 cells were used. To study exogenous TM4SF3, we expressed a FLAG-tagged TM4SF3 protein in LNCaP cells, which exhibited a small, but reproducible increase in response to androgen treatment
(Fig. S3A). Equally important, cell fractionation in LNCaP cells treated with R1881 indicated that the exogenous TM4SF3 is distributed mainly in the membrane fraction and significant amount in the nuclear fraction (Fig. S3B), clearly demonstrate that the exogenous TM4SF3 protein behaves identically its endogenous counterpart. To study exogenous AR, we used PC-3 cells stably expressing AR (A103 cells).32 As expected,
A103 cells exhibited both a cytosolic and nuclear AR localization without hormone32 and exclusively nuclear and elevated levels with hormone (Fig. 5A, 5B), mimicking the androgen effects observed in AR-positive cells. With respect to TM4SF3, there was no evidence for nuclear localization in either PC-3 or A103 cells without hormone (Fig. 5A) and TM4SF3 was found exclusively in the membrane fraction of A103 cells (Fig. 5B).
84 Interestingly, however, addition of R1881 to A103 cells induced an increase in TM4SF3 protein levels (Fig. 5C) and a fraction of this protein co-localized with AR in the nucleus
(Fig. 5A), which was confirmed by fractionation experiments (Fig. 5B). The co- localization (Fig. 5A) suggests that AR and TM4SF3 interact in A103 cells, and this was confirmed by IP experiments. As shown in Fig. 5D, IP of AR resulted in co-purification of TM4SF3, with more AR and TM4SF3 co-purified in the presence of R1881.
Collectively, these results show that we have successfully reconstituted the AR-TM4SF3 interaction in PC-3 cells with exogenous AR, respectively, that mimics what we observed with endogenous proteins in AR-positive prostate cancer cells.
The above all results show an androgen-induced AR-TM4SF3 interaction in both hormone-dependent and hormone-independent prostate cancer cells and the immunocytochemistry and cell fractionation data suggest that this interaction takes place in the cell nucleus. While a cellular interaction exists between AR and TM4SF3, this assay does not show a direct, physical association. To study this possibility, we expressed both proteins in vitro using reticulocyte lysate. In vitro expressed AR and Flag-TM4SF3 were incubated together and then subjected to an AR IP, resulting in purification of AR and, importantly, co-purification of Flag-TM4SF3 using both anti-TM4SF3 and anti-Flag antibodies (Fig. 5E). These data demonstrate that AR and TM4SF3 interact directly, the
Flag tag at the N-terminus of TM4SF3 does not interfere with its association with AR, and R1881 is not required in vitro.
85 TM4SF3 regulates AR protein stability and activity in prostate cancer cells
To begin understanding what functions a nuclear TM4SF3 has, we focused on its new interaction partner, AR. First, we monitored AR protein levels when TM4SF3 expression was depleted by siRNA, and, to our surprise, this elicited a significant decrease in AR protein levels (Fig. 6A). To ensure that this effect was not due to some off-target effect of the TM4SF3 siRNA (a Blast search showed that the siRNA sequence is specific for TM4SF3), we used an adenovirus to express exogenous TM4SF3.
Adenovirus expression of TM4SF3 fully rescued AR protein levels (Fig. 6A), clearly demonstrating that the TM4SF3 protein is directly involved in regulating AR protein concentration. The same TM4SF3 positive effect on the AR protein was observed in the hormone-refractory C81 cells (Fig S4A). Using TM4SF3 siRNA (Fig. 6B) in the presence of CHX, we have determined that TM4SF3 affects the stability of the AR protein, mimicking the effect AR has on TM4SF3 protein (see Fig. 2D). Collectively, our data strongly suggest that the interaction between TM4SF3 and AR results in the mutual stabilization of both proteins in prostate cancer cells, and this may have importance consequences on prostate cancer biology.
To monitor a possible TM4SF3 function on AR activity, we measured transcriptional activity and cell proliferation in LNCaP cells. TM4SF3 knockdown markedly compromised AR transcriptional activity, as measured by both a reporter gene assay and expression of the endogenous target gene PSA (Fig. 6C). The same negative effect was observed on androgen-induced cell growth, as TM4SF3 depletion severely slows down LNCaP cell proliferation (Fig. 6D). Similar results were obtained in C81 cells, as TM4SF3 knockdown resulted in significantly compromised androgen-induced
86 AR transcriptional activity (Fig. S4B) and cell proliferation (S4C). Importantly, there is no effect of TM4SF3 knockdown on the growth of PC-3 cells (Fig. S4D), which are deficient in AR expression. Together, these data clearly demonstrate that the reduced AR protein levels resulting from TM4SF3 knockdown have significant consequences on AR- induced gene expression and cell proliferation only in AR-positive prostate cancer cells.
TM4SF3 is over-expressed in prostate tumors and correlates with AR over-expression
Validation of TM4SF3 importance in prostate cancer depends on demonstrating its expression in human tumor tissues. As shown in Fig. 7A, most prostate tumors expressed significantly higher levels of TM4SF3 protein than normal prostate tissues. To control for variability among different patients, we examined matched pairs of tissues, and in both cases studied TM4SF3 was significantly higher in prostate cancer than normal tissues (Fig. 7B). Since the tissues of Figs. 7A and 7B were no longer available to examine AR protein expression, we studied additional tissues and these too showed elevated levels of TM4SF3 in tumors as compared to normal (Fig. 7C). These tissues also exhibit over-expressed AR and, importantly, their AR expression levels correlated well with TM4SF3 levels (Fig. 7C). When protein levels were quantified in these latter tissues, we observed a direct correlation between TM4SF3 and AR. These expression data in tumors mimic what was observed in prostate cancer cells (see Figs. 2D and 4A) and suggest that co-stabilization of AR and TM4SF3 also occurs in prostate tumors.
DISCUSSION
AR is key to the development and progression of prostate cancer.26 Much of the research on AR in prostate cancer has focused on its regulation of gene expression, of
87 which several examples have shown important roles in prostate cancer.33, 34 In this study, we have identified a novel mechanism of AR action, regulating the stability of the
TM4SF3 protein. TM4SF3 is member of the Tetraspanin family of transmembrane proteins, whose functions in cancer are well established.21, 35 AR regulation of target protein stability is poorly understood, with the only published example being Cdc25C, which exhibits androgen-mediated protein stabilization. Interestingly, however, androgen up-regulates both Cdc25C mRNA and protein,36 while it positively affects only TM4SF3 protein.
Among the Tetraspanins, TM4SF3 is the most poorly understood with regard to its role in prostate cancer. TM4SF3 is highly expressed in various human cancers,22 including hepatocarcinoma,23 esophageal carcinoma,22 and pancreatic adenocarcinoma.21
The limited studies in these tumors have determined that TM4SF3 has metastasis- promoting activities.37 Importantly, our data here clearly demonstrate similar functions in prostate cancer, as knockdown of endogenous TM4SF3 significantly diminished cell migration and invasiveness. Consistent with these metastatic functions, TM4SF3 knockdown antagonizes EMT, supporting what has already been published for the related protein CD151 in hepatocellular carcinoma cells.38
While the pro-metastatic functions of TM4SF3 described above were expected, its nuclear interaction with AR was completely surprising. All Tetraspanin proteins thus far have shown to be localized to the cell surface, with the only exception being CD9, which exhibits a nuclear localization in melanoma cells.39 TM4SF3 is the first example of a
Tetraspanin exhibiting a nuclear localization in prostate cancer cells. Interestingly, our data suggest that the TM4SF3 nuclear localization depends on androgen binding to AR,
88 which is known to trigger nuclear localization of this receptor.40 More evidence for the necessity of AR in TM4SF3 nuclear localization came from our studies here with PC-3 cells, which show that TM4SF3 is localized to the cell surface in parental cells but becomes also localized to the nucleus in A103 cells, PC-3 cells expressing exogenous
AR, and just like LNCaP cells, TM4F3 nuclear localization depends on androgen treatment. Thus, in this report, we demonstrate this nuclear interaction in both LNCaP cells, with endogenous AR, and PC-3 cells, with exogenously expressed AR, strongly suggesting that the TM4SF3-AR interaction does not depend on endogenous AR or cell- specific factors. Indeed, our data strongly suggest a direct interaction between TM4SF3 and AR, since in vitro-translated proteins can interact. Thus, ligand binding induces, not only AR dimerization and nuclear localization, but also interaction with TM4SF3.
Therefore, it is possible that ligand binding induces a conformation on AR that allows it to interact with TM4SF3 in the cytoplasm and the complex then translocates into the cell nucleus. In support of this model, we were able to detect an AR-TM4SF3 interaction in, not only in the nucleus, but also the cytoplasm of prostate cancer cells. While we cannot rule out that TM4SF3 has a cryptic nuclear localization signal (NLS), our failure using bioinformatics analysis to identify a putative NLS and our finding that ligand-activated
AR is required for TM4SF3 nuclear localization strongly argue against this possibility.
Our working hypothesis is that TM4SF3 moves into the nucleus via its interaction with
AR. Such a “piggy-back” mechanism has been demonstrated for several proteins, including subunits of the heterotrimeric CCAAT-binding complex41 and several viral proteins.42
89 Post-translational modifications of AR affect its stability and enhance AR transactivation in response to androgen-depleted conditions in CRPC.43 It was recently published that CDK5-mediated serine phosphorylation of AR prevents its proteasome- dependent degradation and subsequent activation of AR.44 With regard to TM4SF3 protein turnover, there are no published data; in fact, our data here provide the first evidence for proteasomal-degradation of TM4SF3. While an Ubiquitination consensus site does not exist it is a well-established fact that Ubiquitin molecules are predominantly added to lysine residues on target proteins.45 Using this knowledge and the conservation found among human Tetraspanins, Lineberry et al.46 identified several lysines at the cytosolic amino terminus of CD151 and CD81 as Ubiquitination sites. Interestingly,
TM4SF3 has a lysine as residue 10, at a similar position to the ubiquitinated lysines on
CD151 and CD81;46 other lysines found are away from the amino terminus.
The mutual stabilization exhibited by AR and TM4SF3 is uncommon for interacting proteins. There are only a few examples published, including the interaction between LZAP and NLBP in liver cancer cells47 and between STRA13 and MSP58 in mammalian cells.48 While the AR-TM4SF3 interaction may be rare for interacting proteins, the mutual stabilization resulting from it provides prostate cancer with enhanced ability to survive, grow, and undergo metastasis, three essential steps for the deadly form of this disease. Since the interaction between AR and TM4SF3 is direct, as our data show, further studying this interaction in the future will shed light on a novel regulation of these two proteins and provide a means by which to disrupt the complex and thus destabilize both proteins. Thus, this would provide a new therapeutic mechanism for targeting AR, distinct from both the recently published small molecules that inhibit AR
90 interaction with Bromodomain-containing proteins49 and the long-used anti-androgen therapy that has limited in efficacy in CRPC.50
MATERIALS AND METHODS
Cell Culture, siRNA Transfection and Androgen Treatment
LNCaP, C81, CWR-22Rv1, A103 and PC-3 cells were grown as previously described51 (from ATCC, passage 15-30 for all cell lines). For androgen treatment, cells were grown in medium containing 2% FBS extracted with dextran-coated charcoal
(DCC) and ethanol or 1 nM R1881 was added 48 hrs later. TM4SF3 On-Target Plus
Smart Pool siRNA, TM4SF3 (3’UTR) (CAGAUAUCUUCUAGACAUAUU), control siRNA, and AR siRNA (Dharmacon),26 were transfected at 50 nM final concentration into cells using Lipofectamine siMAX (Invitrogen) or Lipofectamine 2000 (Invitrogen).
Cell extracts were prepared using 2% SDS and then subjected to Western blotting.
Reporter Assay and Plasmid Transfection
LNCaP cells were grown to 70-80% confluence in RPMI-1640 with 2% DCC- stripped serum. After 24 hrs, cells were transiently transfected with 0.1 µg ARE-Luc reporter plasmid, control siRNA, or TM4SF3 (3’UTR-specific) siRNA, and pCH110, which encodes β-Galactosidase and used to control for transfection efficiency.52
Lipofectamine 2000 (Invitrogen) was used for transfection and Luciferase activity was measured using the Luciferase assay system from Promega. LNCaP and C81cells were transiently transfected with TM4SF3 siRNA, control siRNA, 2 µg TM4SF3/myc-DDK
91 (Origene), and 48 hrs after transfection, cell extracts were prepared using 2% SDS and subjected to Western blotting.
Cell Proliferation
For proliferation, LNCaP, C81 and PC-3 cells were transfected with TM4SF3 siRNA and control siRNA using 2% DCC stripped serum then 72 hrs after transfection,
20,000 cells were seeded in 24-well plates. The MTT assay (Sigma) was used as before53 to determine cell number.
Cell Invasion and Migration Assay and Adenovirus Infection
Cell invasion was measured using the Cell CytoSelect™ 24-Well Cell Migration and Invasion Assay Combo Kit, 8 µm (fluorometric quantitation) (Cell Biolabs) following the manufacturer’s protocol. Briefly, cell suspensions containing 100,000 cells/ml (in serum-free medium), which had been treated with or without 1 nM R1881 and transfected TM4SF3 siRNA (3’UTR-specific) or control siRNA in the absence or presence of TM4SF3 adenovirus hTSPAN8-His-adenovirus (Abcam). LNCaP, C81, and
PC-3 cells were infected with 20 multiplicity of infection (MOI) of virus. Cells were used to monitor cell invasion into a lower chamber containing RPMI1640 medium with 10%
DCC-stripped serum. After 72 h of incubation at 37o C, cells were quantified by measuring the fluorescence using a micro-plate reader.
92 Prostate tissues
Prostate tumors (12 normal and 21 tumors tissues and 2 matched pairs with Gleason scores between 6-7) were obtained from the Cooperative Human Tissue Network
(CHTN). Protein extracts were prepared by boiling tissues in 3X SDS buffer and then subjected to Western blotting to measure TM4SF3 and AR protein levels.
Semi-Quantitative RT-PCR and QRT-PCR
Total mRNA was isolated from LNCaP or PC-3 cells using the Trizol reagent following the manufacturer’s protocol (Invitrogen) and subjected to quantitative real-time polymerase chain reaction (Q-RT-PCR) analyses as described.6 The PCR upstream and downstream primers, respectively, used for each gene were: PSA, 5’-
GCAGCATTGAACCAGAGGAG-3’ and 5’- CCCATGACGTGATACCTTGA-3’; AR,
5’-CAATGAGTACCGCATGCAC-3’ and 5’-GCCCATCCACTGGAATAATG-3’;
TM4SF3 5’UTR, 5’TGCCCCAGGAGCTATGACAAGCA-3’ and 5’-TGCTCTGGA
GCAACTTGCCTGC-3’; TM4SF3 5’UTR+CDS 5’-CTGGGCTTCCTGGGATGCTGC-
3’ and 5’TACCTGTCGCCACCTGCAGG-3’; TM4SF3 (CDS) 5’GCAGGCAAGTTGC
TCCAGAGCA-3’ and 5’-ACCTGTCGCCACCTGCAGGA-3’; TM4SF3 3’UTR + CDS
5’-TGGTCCTGTATTGCCAGATCGGGA-3’ and 5’-TCTGTGGTCTAGCTAGCCGA
GACA-3’; GAPDH, 5’-CGACCACTTTGTCAAGCTCA-3’ and 5’-AGGGGAGATT
CAGTGTGGTG-3’; E-cadherin, 5’-TGCCCAGAAAATGAAAAAGG-3’ and 5’-GTGT
ATGTGGCAATGCGTTC-3’; N-cadherin, 5’-GACAATGCCCCTCAAGTGTT-3’ and
5’-CCATTAAGCCGAGTGATGG-3’; Vimentin, 5’-GAGAACTTTGCCGTTGA AGC-
3’ and 5’-TCCAGCAGCTTCCTGTAGGT-3’
93 Western Blotting and Cell Fractionation
Western blotting was performed as described26 using antibodies against TM4SF3
(Abcam), AR (Abcam and Santa Cruz Biotechnology), Lamin A (Sigma Aldirich), β-
Tubulin (Abcam), RARα (Santa Cruz Biotechnology), Na/K ATPase (Cell Signaling),
Flag (Origene), and β-Actin (Abcam). LNCaP, C81, A103 and PC-3 cells treated with 1 nM R1881 or ethanol using DCC-stripped serum were washed with cold PBS and harvested, and 10% of the cells were saved as Input and the remaining portion was subjected to cell fractionation into cytosolic, membrane, and nuclear fractions using subcellular Fractionation Kit (Thermo scientific). The fractions were subjected to
Western blotting to measure AR and TM4SF3 protein levels.
Immunoprecipitation
IP experiments were performed as described previously.51, 53 Whole-cell extracts from LNCaP and C81cells were subjected to IP using Protein A/G plus Agarose (Santa
Cruz). IP antibodies used were against TM4SF3 (Bioss), AR (Santa Cruz Biotechnology), or rabbit or mouse IgG (Santa Cruz Biotechnology) as controls.
For in vitro interaction, we used TNT coupled reticulocyte lysate systems from
(Promega). The plasmids used were 1 µg AR/CMV and TM4SF3/myc-DDK tag
(Origene). The protocol was followed as per the manufacture’s manual. Antibodies were against TM4SF3 (Bioss), AR (Santa Cruz) Flag (Origene) followed by Western blotting to detect AR and TM4SF3.
94 Immunocytochemistry
Immunocytochemistry was used to study the subcellular localization of TM4SF3 and
AR in LNCaP and C81, PC-3 and A103 cells as described.52 Reagents used were anti-
TM4SF3 antibody (Abcam) and AR antibody (Santa Cruz Biotechnology). Note that all micrographs were taken at the same microscope settings.
ACKNOWLEDGMENTS
This work was supported by grants from National Institutes of Health and internal money from the University of Toledo.
REFERENCES
1 Huggins C, Stevens RE, Jr., Hodges CV. Prostatic cancer. II. The effects of
castration on advanced carcinoma of the prostate gland. Arch Surg (Chicago, IL,
U S) 1941; 43: 209-223.
2 Ross RW, Xie W, Regan MM, Pomerantz M, Nakabayashi M, Daskivich TJ,
Sartor O, Taplin ME, Kantoff PW, Oh WK. Efficacy of androgen deprivation
therapy (ADT) in patients with advanced prostate cancer: association between
Gleason score, prostate-specific antigen level, and prior ADT exposure with
duration of ADT effect. Cancer 2008; 112: 1247-1253.
3 Gregory CW, Hamil KG, Kim D, Hall SH, Pretlow TG, Mohler JL, French FS.
Androgen receptor expression in androgen-independent prostate cancer is
associated with increased expression of androgen-regulated genes. Cancer Res
1998; 58: 5718-5724.
95 4 Chen CD, Welsbie DS, Tran C, Baek SH, Chen R, Vessella R, Rosenfeld MG,
Sawyers CL. Molecular determinants of resistance to antiandrogen therapy. Nat
Med 2004; 10: 33-39.
5 Thalmann GN, Anezinis PE, Chang SM, Zhau HE, Kim EE, Hopwood VL,
Pathak S, von Eschenbach AC, Chung LW. Androgen-independent cancer
progression and bone metastasis in the LNCaP model of human prostate cancer.
Cancer Res 1994; 54: 2577-2581.
6 Cai C, Hsieh CL, Omwancha J, Zheng Z, Chen SY, Baert JL, Shemshedini L.
ETV1 is a novel androgen receptor-regulated gene that mediates prostate cancer
cell invasion. Mol Endocrinol 2007; 21: 1835-1846.
7 Gaughan L, Logan IR, Neal DE, Robson CN. Regulation of androgen receptor
and histone deacetylase 1 by Mdm2-mediated ubiquitylation. Nucleic Acids Res
2005; 33: 13-26.
8 Ruizeveld de Winter JA, Janssen PJ, Sleddens HM, Verleun-Mooijman MC,
Trapman J, Brinkmann AO, Santerse AB, Schroder FH, van der Kwast TH.
Androgen receptor status in localized and locally progressive hormone refractory
human prostate cancer. Am J Pathol 1994; 144: 735-746.
9 Taplin ME, Bubley GJ, Shuster TD, Frantz ME, Spooner AE, Ogata GK, Keer
HN, Balk SP. Mutation of the androgen-receptor gene in metastatic androgen-
independent prostate cancer. N Engl J Med 1995; 332: 1393-1398.
10 Holzbeierlein J, Lal P, LaTulippe E, Smith A, Satagopan J, Zhang L, Ryan C,
Smith S, Scher H, Scardino P, Reuter V, Gerald WL. Gene expression analysis of
human prostate carcinoma during hormonal therapy identifies androgen-
96 responsive genes and mechanisms of therapy resistance. Am J Pathol 2004; 164:
217-227.
11 Montgomery RB, Mostaghel EA, Vessella R, Hess DL, Kalhorn TF, Higano CS,
True LD, Nelson PS. Maintenance of intratumoral androgens in metastatic
prostate cancer: a mechanism for castration-resistant tumor growth. Cancer Res
2008; 68: 4447-4454.
12 Hofland J, van Weerden WM, Dits NF, Steenbergen J, van Leenders GJ, Jenster
G, Schroder FH, de Jong FH. Evidence of limited contributions for intratumoral
steroidogenesis in prostate cancer. Cancer Res 2010; 70: 1256-1264.
13 Cai C, Wang H, Xu Y, Chen S, Balk SP. Reactivation of androgen receptor-
regulated TMPRSS2:ERG gene expression in castration-resistant prostate cancer.
Cancer Res 2009; 69: 6027-6032.
14 Wang Q, Li W, Zhang Y, Yuan X, Xu K, Yu J, Chen Z, Beroukhim R, Wang H,
Lupien M, Wu T, Regan MM, Meyer CA, Carroll JS, Manrai AK, Janne OA,
Balk SP, Mehra R, Han B, Chinnaiyan AM, Rubin MA, True L, Fiorentino M,
Fiore C, Loda M, Kantoff PW, Liu XS, Brown M. Androgen receptor regulates a
distinct transcription program in androgen-independent prostate cancer. Cell
2009; 138: 245-256.
15 Tomlins SA, Rhodes DR, Perner S, Dhanasekaran SM, Mehra R, Sun XW,
Varambally S, Cao X, Tchinda J, Kuefer R, Lee C, Montie JE, Shah RB, Pienta
KJ, Rubin MA, Chinnaiyan AM. Recurrent fusion of TMPRSS2 and ETS
transcription factor genes in prostate cancer. Science 2005; 310: 644-648.
97 16 Tomlins SA, Laxman B, Varambally S, Cao X, Yu J, Helgeson BE, Cao Q,
Prensner JR, Rubin MA, Shah RB, Mehra R, Chinnaiyan AM. Role of the
TMPRSS2-ERG gene fusion in prostate cancer. Neoplasia 2008; 10: 177-188.
17 Yu J, Yu J, Mani RS, Cao Q, Brenner CJ, Cao X, Wang X, Wu L, Li J, Hu M,
Gong Y, Cheng H, Laxman B, Vellaichamy A, Shankar S, Li Y, Dhanasekaran
SM, Morey R, Barrette T, Lonigro RJ, Tomlins SA, Varambally S, Qin ZS,
Chinnaiyan AM. An integrated network of androgen receptor, polycomb, and
TMPRSS2-ERG gene fusions in prostate cancer progression. Cancer Cell 2010;
17: 443-454.
18 Huang S, Yuan S, Dong M, Su J, Yu C, Shen Y, Xie X, Yu Y, Yu X, Chen S,
Zhang S, Pontarotti P, Xu A. The phylogenetic analysis of tetraspanins projects
the evolution of cell-cell interactions from unicellular to multicellular organisms.
Genomics 2005; 86: 674-684.
19 Stipp CS, Kolesnikova TV, Hemler ME. Functional domains in tetraspanin
proteins. Trends Biochem Sci 2003; 28: 106-112.
20 Seigneuret M, Delaguillaumie A, Lagaudriere-Gesbert C, Conjeaud H. Structure
of the tetraspanin main extracellular domain. A partially conserved fold with a
structurally variable domain insertion. J Biol Chem 2001; 276: 40055-40064.
21 Gesierich S, Berezovskiy I, Ryschich E, Zoller M. Systemic induction of the
angiogenesis switch by the tetraspanin D6.1A/CO-029. Cancer Res 2006; 66:
7083-7094.
98 22 Zhou Z, Ran YL, Hu H, Pan J, Li ZF, Chen LZ, Sun LC, Peng L, Zhao XL, Yu L,
Sun LX, Yang ZH. TM4SF3 promotes esophageal carcinoma metastasis via
upregulating ADAM12m expression. Clin Exp Metastasis 2008; 25: 537-548.
23 Kanetaka K, Sakamoto M, Yamamoto Y, Yamasaki S, Lanza F, Kanematsu T,
Hirohashi S. Overexpression of tetraspanin CO-029 in hepatocellular carcinoma. J
Hepatol 2001; 35: 637-642.
24 Greco C, Bralet MP, Ailane N, Dubart-Kupperschmitt A, Rubinstein E, Le Naour
F, Boucheix C. E-cadherin/p120-catenin and tetraspanin Co-029 cooperate for
cell motility control in human colon carcinoma. Cancer Res 2010; 70: 7674-7683.
25 Gesierich S, Paret C, Hildebrand D, Weitz J, Zgraggen K, Schmitz-Winnenthal
FH, Horejsi V, Yoshie O, Herlyn D, Ashman LK, Zoller M. Colocalization of the
tetraspanins, CO-029 and CD151, with integrins in human pancreatic
adenocarcinoma: impact on cell motility. Clin Cancer Res 2005; 11: 2840-2852.
26 Cai C, Chen SY, Zheng Z, Omwancha J, Lin MF, Balk SP, Shemshedini L.
Androgen regulation of soluble guanylyl cyclasealpha1 mediates prostate cancer
cell proliferation. Oncogene 2007; 26: 1606-1615.
27 Cai C, Omwancha J, Hsieh CL, Shemshedini L. Androgen induces expression of
the multidrug resistance protein gene MRP4 in prostate cancer cells. Prostate
Cancer Prostatic Dis 2007; 10: 39-45.
28 Karan D, Kelly DL, Rizzino A, Lin MF, Batra SK. Expression profile of
differentially-regulated genes during progression of androgen-independent growth
in human prostate cancer cells. Carcinogenesis 2002; 23: 967-975.
99 29 Sobel RE, Wang Y, Sadar MD. Molecular analysis and characterization of PrEC,
commercially available prostate epithelial cells. In Vitro Cell Dev Biol Anim
2006; 42: 33-39.
30 Hemler ME. Tetraspanin proteins promote multiple cancer stages. Nat Rev
Cancer 2014; 14: 49-60.
31 Tsai JH, Yang J. Epithelial-mesenchymal plasticity in carcinoma metastasis.
Genes Dev 2013; 27: 2192-2206.
32 Yuan S, Trachtenberg J, Mills GB, Brown TJ, Xu F, Keating A. Androgen-
induced inhibition of cell proliferation in an androgen-insensitive prostate cancer
cell line (PC-3) transfected with a human androgen receptor complementary
DNA. Cancer Res 1993; 53: 1304-1311.
33 Tran C, Ouk S, Clegg NJ, Chen Y, Watson PA, Arora V, Wongvipat J, Smith-
Jones PM, Yoo D, Kwon A, Wasielewska T, Welsbie D, Chen CD, Higano CS,
Beer TM, Hung DT, Scher HI, Jung ME, Sawyers CL. Development of a second-
generation antiandrogen for treatment of advanced prostate cancer. Science 2009;
324: 787-790.
34 Yuan X, Cai C, Chen S, Chen S, Yu Z, Balk SP. Androgen receptor functions in
castration-resistant prostate cancer and mechanisms of resistance to new agents
targeting the androgen axis. Oncogene 2014; 33: 2815-2825.
35 Berthier-Vergnes O, Kharbili ME, de la Fouchardiere A, Pointecouteau T,
Verrando P, Wierinckx A, Lachuer J, Le Naour F, Lamartine J. Gene expression
profiles of human melanoma cells with different invasive potential reveal
TSPAN8 as a novel mediator of invasion. Br J Cancer 2011; 104: 155-165.
100 36 Chou YW, Zhang L, Muniyan S, Ahmad H, Kumar S, Alam SM, Lin MF.
Androgens upregulate Cdc25C protein by inhibiting its proteasomal and
lysosomal degradation pathways. PLoS One 2013; 8: e61934.
37 Hemler ME. Tetraspanin functions and associated microdomains. Nat Rev Mol
Cell Biol 2005; 6: 801-811.
38 Ke AW, Shi GM, Zhou J, Huang XY, Shi YH, Ding ZB, Wang XY, Devbhandari
RP, Fan J. CD151 amplifies signaling by integrin alpha6beta1 to PI3K and
induces the epithelial-mesenchymal transition in HCC cells. Gastroenterology
2011; 140: 1629-1641 e1615.
39 Fan J, Zhu GZ, Niles RM. Expression and function of CD9 in melanoma cells.
Mol Carcinog 2010; 49: 85-93.
40 Cutress ML, Whitaker HC, Mills IG, Stewart M, Neal DE. Structural basis for the
nuclear import of the human androgen receptor. J Cell Sci 2008; 121: 957-968.
41 Steidl S, Tuncher A, Goda H, Guder C, Papadopoulou N, Kobayashi T,
Tsukagoshi N, Kato M, Brakhage AA. A single subunit of a heterotrimeric
CCAAT-binding complex carries a nuclear localization signal: piggy back
transport of the pre-assembled complex to the nucleus. J Mol Biol 2004; 342:
515-524.
42 Arnoys EJ, Wang JL. Dual localization: proteins in extracellular and intracellular
compartments. Acta Histochem 2007; 109: 89-110.
43 Gioeli D, Paschal BM. Post-translational modification of the androgen receptor.
Mol Cell Endocrinol 2012; 352: 70-78.
101 44 Hsu FN, Chen MC, Chiang MC, Lin E, Lee YT, Huang PH, Lee GS, Lin H.
Regulation of androgen receptor and prostate cancer growth by cyclin-dependent
kinase 5. J Biol Chem 2011; 286: 33141-33149.
45 Mattiroli F, Sixma TK. Lysine-targeting specificity in ubiquitin and ubiquitin-like
modification pathways. Nat Struct Mol Biol 2014; 21: 308-316.
46 Lineberry N, Su L, Soares L, Fathman CG. The single subunit transmembrane E3
ligase gene related to anergy in lymphocytes (GRAIL) captures and then
ubiquitinates transmembrane proteins across the cell membrane. J Biol Chem
2008; 283: 28497-28505.
47 Kwon J, Cho HJ, Han SH, No JG, Kwon JY, Kim H. A novel LZAP-binding
protein, NLBP, inhibits cell invasion. J Biol Chem 2010; 285: 12232-12240.
48 Ivanova AV, Ivanov SV, Lerman ML. Association, mutual stabilization, and
transcriptional activity of the STRA13 and MSP58 proteins. Cell Mol Life Sci
2005; 62: 471-484.
49 Asangani IA, Dommeti VL, Wang X, Malik R, Cieslik M, Yang R, Escara-Wilke
J, Wilder-Romans K, Dhanireddy S, Engelke C, Iyer MK, Jing X, Wu YM, Cao
X, Qin ZS, Wang S, Feng FY, Chinnaiyan AM. Therapeutic targeting of BET
bromodomain proteins in castration-resistant prostate cancer. Nature 2014; 510:
278-282.
50 Karantanos T, Corn PG, Thompson TC. Prostate cancer progression after
androgen deprivation therapy: mechanisms of castrate resistance and novel
therapeutic approaches. Oncogene 2013; 32: 5501-5511.
102 51 Cai C, Hsieh CL, Gao S, Kannan A, Bhansali M, Govardhan K, Dutta R,
Shemshedini L. Soluble guanylyl cyclase alpha1 and p53 cytoplasmic
sequestration and down-regulation in prostate cancer. Mol Endocrinol 2012; 26:
292-307.
52 Cai C, Hsieh CL, Shemshedini L. c-Jun has multiple enhancing activities in the
novel cross talk between the androgen receptor and Ets variant gene 1 in prostate
cancer. Mol Cancer Res 2007; 5: 725-735.
53 Gao S, Hsieh CL, Bhansali M, Kannan A, Shemshedini L. A peptide against
soluble guanylyl cyclase alpha1: a new approach to treating prostate cancer. PLoS
One 2013; 8: e64189.
103 Figure 1-II: Androgen down-regulates TM4SF3 mRNA and up-regulates the protein. LNCaP cells were treated with either ethanol (-) or 1 nM R1881 (+) and measured for expression of TM4SF3 (A) mRNA by Q-RT-PCR or (B) protein by
Western blotting. LNCaP cells were transfected with (C) control or TM4SF3 siRNA or
(D) empty vector or TM4SF3-Flag vector and protein expression was measured by
Western blotting using an anti-TM4SF3 or anti-Flag antibody. Asterisks indicate statistical significance (p <0.05). Note that β-actin (B, C, D) was used as a loading control.
104
Figure 1-II
105 Figure 2-II: AR is required for androgen up-regulation of TM4SF3 protein. Western blotting was used to measure TM4SF3 and AR expression in LNCaP or C81 cells transfected with (A) AR siRNA or (B) LNCaP cells treated with 10 mM Casodex, (C) or various other prostate cancer cells. CWR represents CWR-22Rv1 cells and PrEC primary prostate epithelial cells. Cells were treated with either ethanol (-) or 1 nM R1881 (+).
LNCaP cells, in the presence of either ethanol (-) or 1 nM R1881 (+), were grown for (D)
0-24 hours or (E) 2-24 hours or treated with (F) 50 mg/ml cycloheximide (CHX), and 10 mM MG132 and measured for expression of TM4SF3 or AR by Western blotting. Note that β-actin was used as a loading control.
106
Figure 2-II
107 Figure 3-II: TM4SF3 induces invasion, migration, and EMT of prostate cancer cells.
(A, C) LNCaP cells, treated with either ethanol (-) or 1 nM R1881 (+) or (B, D) PC-3 cells were transfected with control (C) or TM4SF3 (T) siRNA and infected with Empty
(E) or TM4SF3-His adenovirus (T) and monitored for (A, B) invasion and migration or
(C, D) EMT, as measured by expressions of E-cadherin, N-cadherin, and Vimentin using
Q-RT-PCR. Bar graphs represent averages of three independent experiments plus standard deviations. The Student T-test was performed to show statistical significance
(p< 0.005), as indicated by asterisks.
108
Figure 3-II
109 Figure 4-II: TM4SF3 co-localizes and interacts with AR in prostate cancer cells.
LNCaP cells were treated with either ethanol (-) or 1 nM R1881 (+) and measured for expression of TM4SF3 and AR by (A) immunocytochemistry or (B) Western blotting of cell fractions [cytosol (C), membrane (M), and nuclear (N)]. Note that β-tubulin is a cytosolic marker, Na+/K+ ATPase is a membrane marker, Lamin A is a nuclear marker, and β-actin controls for protein loading. (C) LNCaP or (D) C81 cells treated with ethanol
(-) or 1 nM R1881 (+) and whole-cell extracts were subjected to IP using antibodies against AR or TM4SF3, or IgG. (E) AR and TM4SF3 were expressed in vitro using TNT system, mixed, and subjected to IP using anti-AR antibody. Western blotting was used to measure levels of AR and TM4SF3 in C, D, and E. DAPI was used to stain the nuclei.
110
Figure 4-II
111 Figure 5-II: TM4SF3 co-localizes and interacts with AR in AR-expressing PC-3 cells. PC-3 or A103 cells were treated with either ethanol (-) or 1 nM R1881 (+) and measured for expression of TM4SF3 and AR by (A) immunocytochemistry or (B)
Western blotting of (B) A103 cell fractions [cytosol (C), membrane (M), and nuclear (N)] or (C) whole-cell extracts. Note that β-tubulin is a cytosolic marker, Na+/K+ ATPase is a membrane marker, Lamin A is a nuclear marker, and β-actin controls for protein loading
(B, C). IP experiments were performed with (D) whole cells extracts from A103 cells treated with ethanol (-) or 1 nM R1881 (+) or (E) in vitro expressed AR and TM4SF3, using antibodies against AR, TM4SF3 (TM4), or IgG. Western blotting was used to measure levels of co-purified AR and TM4SF3. DAPI was used to stain the nuclei in A.
112
Figure 5-II
113 Figure 6-II: TM4SF3 up-regulates the AR protein and androgen signaling. LNCaP cells were transfected with TM4SF3 siRNA or control and (A) infected with Empty or
TM4SF3 adenovirus in the presence of ethanol (-) or 1 nM R1881 (+) or (B) treated with
50 mg/ml cycloheximide (CHX) for the indicated times. Expression of TM4SF3 and AR was measured by Western blotting. Note that β-actin was used as loading control. LNCaP cells were transfected with control or TM4SF3 siRNA and treated with ethanol (-) or 1 nM R1881 (+) and then measured for (C) activity of transfected luciferase or expression of endogenous PSA or TM4SF3, or (D) cell proliferation using the MTT assay. Bar graphs represent averages of three independent experiments plus standard deviations. The
Student T-test was performed to show statistical significance (p < 0.05), when comparing cells transfected with TM4SF3 siRNA to control siRNA as indicated by asterisks.
114
Figure 6-II
115 Figure 7-II: TM4SF3 and AR are over-expressed in prostate cancer. Western blotting was used to measure TM4SF3 and AR expression in (A, C) normal and tumor tissues and
(B) matched pairs of normal (N) and tumor (C) from same patients. Note that β-actin was used as a loading control. Linear regression analysis was done to compare protein levels of TM4SF3 and AR, which were significant as represented by R2 values 0.55655 and p values of 0.03.
116
Figure 7-II
117 Figure S1-II: Androgen down-regulates TM4SF3 mRNA
(A) LNCaP cells were treated with either ethanol (-) or 1 nM R1881 (+) and measured for expression of (A) TM4SF3 mRNA by Q-RT-PCR using four different sets of primers or
(B) expression of either TM4SF3 or PSA mRNA by Q-RT-PCR. Diagram in A below shows the regions of the TM4SF3 mRNA that the primers cover. Data points represent averages of three independent experiments plus standard deviations. The Student T–test was performed to show statistical significance (p <0.05) as indicated by asterisks.
118
Figure S1-II
119 Figure S2-II: TM4SF3 induces invasion and migration of prostate cancer cells. (A)
C81 cells, treated with either ethanol (-) or 1 nM R1881 (+), were transfected with control (C) or TM4SF3 (T) siRNA and infected with Empty (E) or TM4SF3-His adenovirus (T) and monitored for invasion and migration. Bar graphs represents averages of three independent experiments plus standard deviations. The Student T-test was performed to show statistical significance (p< 0.05), as indicated by asterisks. (B, C) C81 cells were treated with either ethanol (-) or 1 nM R1881 (+) and measured for expression of TM4SF3 and AR by (B) immunocytochemistry or (C) Western blotting of cell fractions [cytosol (C), membrane (M), and nuclear (N)]. Note that β-tubulin was used as a cytosolic marker, Na+/K+ ATPase as a membrane marker, Lamin A as a nuclear marker, and β-actin to control for protein loading.
120
Figure S2-II
121 Figure S3-II: Androgen up-regulates and induces nuclear localization of exogenous
TM4SF3 in prostate cancer. LNCaP cells, treated with either ethanol (-) or 1 nM R1881
(+), were transfected with Empty vector or TM4SF3-Flag and Western blotting was used to measure expression of (A) total TM4SF3 and Flag-tagged exogenous TM4SF3 and (B)
Flag-TM4SF3 in different cell fractions [Cytosol (C), membrane (M), and nuclear (N)] using antibodies against TM4SF3 and Flag. Note that β-actin was used as a loading control.
122
Figure S3-II
123 Figure S4-II: TM4SF3 up-regulates the AR protein and androgen signaling. (A) C81 cells were transfected with control or TM4SF3 siRNA and infected with empty or
TM4SF3 adenovirus in the presence of ethanol (-) or 1 nM R1881 (+) and measured for expression of TM4SF3 and AR by Western blotting. (B, C) C81 cells were transfected with Control or TM4SF3 siRNA and treated with ethanol (-) or 1 nM R1881 (+) and then measured for (B) reporter activity of transfected Luciferase or expression of endogenous
PSA or TM4SF3 by Q-RT-PCR or (C) cell proliferation. (D) PC-3 cells were transfected with control or TM4SF3 siRNA and measured for cell proliferation or TM4SF3 mRNA expression by Q-RT-PCR. In B, C and D, bar graphs represents averages of three independent experiments plus standard deviations. The Student T-test was performed to show statistical significance when comparing cells transfected with TM4SF3 siRNA to control siRNA (p<0.03), as indicated by asterisks.
124
Figure S4-II
125
Chapter 4
Additional Results
CSN6 functions down-stream of CSN4 in prostate cancer cells:
CSN4 is one of the component of COP9 signalosome complex (68). Our previous results showed that CSN5 acts downstream of CSN4. (Figure 6-I). There is also evidence of formation of CSN5–containing cytoplasmic CSN4-5-6-7 sub-complex (163). To study this sub-complex in prostate cancer, we disrupted CSN4 in LNCaP and CWR-22Rv1 cells and measured CSN6. Interestingly CSN4 knock-down led a to strong decrease in
CSN6 protein expression. CSN6 depletion did not have any effect on CSN4 protein expression in both prostate cancer cell lines (Figure 1A-III) suggesting that CSN6 functions downstream of CSN4.
We have shown previously CSN5 is involved in negatively regulating the p53 protein stability (Figure 7-I). Interestingly it has been known that CSN5 effect on p53 is dependent on MDM2-mediated ubiquitination, and CSN5 is involved in positively regulating MDM2 protein stability (88). To show the possible involvement of MDM2 in
CSN5-mediated p53 regulation, we performed the siRNA targeted depletion of CSN4 in
LNCaP cells, leading to markedly reduced levels of MDM2 protein (Figure1B-III), consistent with the earlier published work.
126 Androgen down-regulates TM4SF3 mRNA in AR-positive prostate cancer cells:
As shown in (Figure 1A-II) TM4SF3 is under complex androgen regulation, with
TM4SF3 mRNA is repressed and protein is up-regulated. To verify that the down- regulation of mRNA is indeed through the TM4SF3 gene, we performed Q-RT-PCR using 4 different primer pairs that cover different regions of the TM4SF3 mRNA, including the coding and UTR regions. Interestingly, all four pairs exhibited androgen- dependent TM4SF3 mRNA down-regulation. After confirming the specificity of the
TM4SF3 mRNA, we measured the androgen-induced TM4SF3 mRNA repression in different prostate cancer cell lines. As observed in Figure 2A-III, in wild –type AR expressing (164) VCaP cells and two androgen–independent cell lines, C81 and CWR-
22RV1, TM4SF3 mRNA is androgen-repressed. In contrast, androgen has no effect on
TM4SF3 mRNA in AR-negative PC-3 or A103 cells (Figure 2B-III). Based on these results we conclude that androgen down-regulates TM4SF3 mRNA in AR-positive prostate cancer cells.
AR is required for androgen down-regulation of TM4SF3 mRNA in androgen - dependent and androgen-independent cells:
To confirm that AR is required for the androgen negative effect on the TM4SF3 mRNA, we used siRNA to knockdown AR (Figure 3A-III), in LNCaP, cells resulting in complete elimination of the androgen negative effect on TM4SF3 mRNA (Figure 3A-III).
Interestingly, when AR is over-expressed in these cells, androgen-dependent repression on TM4SF3 mRNA is restored (Figure 3B-III) and comparable with ctrl siRNA or empty-virus treated cells. The complementary approach utilized is the use of anti-
127 androgen casodex, which had a similar disruption effect on androgen-mediated repression on TM4SF3 mRNA (Figure 3C-III), and the androgen induction of PSA (Figure 3C-III) was used as a positive control.
Consistent with above results, knock-down of AR in CWR-22RV1 cells led to disruption of androgen-induced repression of TM4SF3 mRNA, mimicking what was observed in androgen-dependent LNCaP cells. These data collectively demonstrate that endogenous AR is required for the androgen down-regulation of TM4SF3 mRNA in both androgen-dependent and independent prostate cancer cells.
Androgen down-regulates endogenous, but not exogenous, TM4SF3 mRNA:
Androgen induces the repression of endogenous TM4SF3 mRNA in AR-positive prostate cancer cells. We were curious to see if androgen can repress exogenous
TM4SF3. To address this question, we cloned full-length TM4SF3 cDNA into the mammalian expression plasmid pCMV6, which has Myc-Flag tag at the 3’ end. The
Myc-Flag tag was used to differentiate between exogenous and endogenous mRNA and protein. Two plasmids were constructed, expressing either full-length TM4SF3 (with untranslated regions) or only the coding sequence of TM4SF3. Interestingly, androgen has no effect on the levels of exogenous mRNAs, CDS TM4SF3 (Figure 4A-III) or full- length TM4SF3 (Figure 4B-III), while the endogenous mRNA showed the expected down-regulation, without or with expression of the exogenous TM4SF3 (Figure 4A,B-
III). These results suggested that neither UTRs or CDS of TM4SF3 mRNA is the target of androgen down-regulation and open the possibility that the TM4SF3 promoter is involved in androgen-mediated repression of TM4SF3 mRNA.
128 Transcription and translation are required for androgen down-regulation of
TM4SF3 mRNA:
Above results suggest that the TM4SF3 promoter is likely a target for androgen - mediated repression on TM4SF3 mRNA. To get more evidence whether AR is directly or indirectly regulating a TM4SF3 mRNA, we treated the LNCaP cells with transcriptional inhibitor actinomycin D, which significantly eliminated androgen-mediated repression on
TM4SF3 mRNA after 24 hrs. (Figure 5A-III). This finding suggests that the transcription process is required for the androgen effect on TM4SF3 mRNA, perhaps through the transcription of a novel AR target gene. Also consistent with an indirect effect, we observed that the translational inhibitor cycloheximide, which strongly disrupted the androgen-dependent down-regulation of TM4SF3 mRNA and also caused significant increases in mRNA levels in both the absence and presence of androgen (Figure 5C-III).
These data suggest that androgen down-regulation of TM4SF3 requires the synthesis of a new protein, perhaps the product of an AR target gene. Finally, the absence of an effect in AR-expressing PC-3 cells (A103 cells) ((Figure 2B-III) is also consistent with AR indirect effect on the TM4SF3 mRNA. Down-regulation of TM4SF3 mRNA requires maintenance of AR protein levels. In the above experiments, AR protein levels are significantly reduced by actinomycin D (Figure 5E-III) and cycloheximide treatment
(Figure 5F-III) suggestive of endogenous AR expression is required for androgen down- regulation of TM4SF3 mRNA.
129 Down-regulation of TM4SF3 protein results in reduced expression of AGR2:
Based on the literature, the TM4SF3 protein associates with other tetraspanins, integrins and non-tetraspanin proteins involved in intracellular signaling pathways (110).
To identify a novel protein, which is involved in the TM4SF3-mediated cell invasion and migration in prostate cancer, we started to focus on the androgen up-regulated gene
AGR2 (anterior gradient 2) (165), which is shown to promote breast cancer cell migration
(146). To test our hypothesis directly, we diminished TM4SF3 in LNCaP and PC-3 cells.
Interestingly, TM4SF3 knock-down led to a significant decrease in androgen-induced expression of AGR2 protein in LNCaP cells and in PC-3 cells (Figure 6A,B-III).
However, there was no effect on AGR2 mRNA levels (Figure 6E,F-III). AGR2 is androgen-induced in AR-positive and constitutively expressed in PC-3 cells (Figure 6C-
III), consistent with the expression of TM4SF3 in these cells. All these results suggest that TM4SF3 might be involved in regulating AGR2 protein stability. To test this directly, we performed the time-course experiment in cycloheximide (CHX) treated PC-3 cells after knockdown of TM4SF3, and measured the AGR2 protein levels. We observed that TM4SF3 disruption resulted in a time dependent decrease in endogenous AGR2 protein levels compared to control siRNA-treated cells (Figure 6D-III), suggesting that
TM4SF3 has a positive effect on AGR2 protein stability in prostate cancer.
AGR2 acts down-stream of TM4SF3 and involved in PC-3 cell invasion and migration:
AGR2 is overexpressed in prostate cancer (165), positively regulated by TM4SF3 and involved in promoting metastasis in breast cancer (146). Considering all these studies
130 about AGR2, we directly tested AGR2 pro-metastatic function in PC-3 cells, which exhibit, constitutive expression of AGR2 (Figure 2C-II). Consistent with the earlier published data, disruption of AGR2 in PC-3 cells, resulted in a dramatic decrease in PC-3 cell invasion and migration (Figure 7A,B-III), similar to the TM4SF3 knock down in PC-
3 cells (see Figure 3B-II). Most importantly, AGR2 knockdown did not affect TM4SF3 protein (Figure 7C-III) suggesting that AGR2 acts down-stream of TM4SF3. Above all results suggest that TM4SF3 is involved in positively regulating AGR2 protein stability that leads to the pro-metastatic functions of AGR2 in prostate cancer by acting down- stream of TM4SF3.
Down-regulation of TM4SF3 leads to decrease in AKT and disruption of AKT down-regulates TM4SF3 in PC-3 cells:
Recently, it has been published that CD81 protein increases melanoma cell invasion by up-regulating AKT-dependent MT1-MMP expression (166). It was also published that TM4SF3 (TSPAN8) is a novel mediator of melanoma cell invasion (137).
AKT is involved in promoting prostate cancer cell invasion and migration (167). Based on all these results, we hypothesized that the AKT signaling pathway could be a key signaling pathway in facilitating TM4SF3-dependent cell invasion and migration. We started our study in PC-3 cells, as PC-3 cells have strong TM4SF3 expression and
TM4SF3 significantly promotes cell invasion and migration of these cells. To address our hypothesis, we disrupted TM4SF3 using a TM4SF3-specific siRNA, resulted in markedly reduced levels of total AKT protein and AKT S473 phosphorylation in PC-3 cells (Figure
8A-III). Most importantly when TM4SF3 was exogenously expressed in TM4SF3 siRNA
131 treated-cells, AKT protein expression was rescued (Figure 8B-III). Interestingly AKT mRNA levels were unaffected in TM4SF3 knockdown cells (Figure 8E-III). The complementary experiment in which AKT knockdown by siRNA and AKT kinase inhibitor LY293002, did significantly affect TM4SF3 protein (Figure 8C,D-III), TM4SF3 mRNA did not change in response to AKT knock-down in PC-3 measured by Q-RT-PCR
(Figure 8F-III), suggesting that TM4SF3 and AKT act together and are probably involved in regulating mutual stability of each other. Based on our earlier results, AGR2 functions down-stream of TM4SF3 (Figure 7C-III). It has been also published that the AKT signaling pathway regulates the AGR2 protein levels in breast cancer (168). Thus future experiments will study the role of AKT in regulating AGR2 in prostate cancer.
TM4SF3 Palmitoylation affects endogenous TM4SF3 protein expression and its function:
Palmitoylation of intracellular cysteines plays a central role in the assembly of
TEMs (169), and affects subcellular distribution, stability, cell signaling and motility of different tetraspanins (170). For example, inhibition of palmitoylation of CD9 and
CD151 resulted in their protein degradation and affected their functions (170). To study the role of palmitoylation in the context of TM4SF3, we used the palmitoylation inhibitor
2-bromopalmitate (2-BP) in PC-3 and LNCaP cells. Interestingly, inhibition of palmitoylation of TM4SF3 markedly reduced endogenous TM4SF3 protein expression
(Figure 9A-III). To correlate the results in terms of pro-invasive role of TM4SF3, we used the TM4SF3 siRNA and 2-BP in PC-3 cells. Inhibition of palmitoylation of
TM4SF3 resulted in significant decrease in TM4SF3 dependent cell invasion consistent
132 with TM4SF3 knock-down in these cells (Figure 9B-III). These results suggest that
TM4SF3 palmitoylation is required for maintaining the endogenous levels of TM4SF3 and its pro-invasive functions in prostate cancer.
Androgen down-regulates BARD1 mRNA and protein in androgen-dependent prostate cancer cells:
Our gene microarray study identified BARD1 as an androgen-repressed gene. To confirm the gene microarray data we performed Q-RT-PCR in LNCaP cells treated with
R1881, and observed that BARD1 mRNA is androgen-repressed (Figure 10A-III).
Interestingly, androgen-induced down-regulation of BARD1 mRNA was time-dependent as observed in (Figure 10B-III), and occurring 8 hrs after androgen treatment, with optimal activity observed after 24 hrs. After confirming the androgen-mediated mRNA down-regulation, we measured the protein expression in LNCaP cells by Western blotting, consistent with mRNA, androgen strongly represses BARD1 protein in LNCaP cells (Figure 10C-III). Based on these results we conclude that BARD1 mRNA and protein are androgen-repressed in prostate cancer cells.
AR is required for androgen down-regulation of BARD1 mRNA in androgen- dependent prostate cancer cells:
As BARD1 mRNA is androgen-regulated, we were interested to see the requirement of AR in regulating BARD1. Endogenous depletion of AR (Figure 11A-III), resulted in significant elimination of androgen-dependent negative effect on BARD1
133 mRNA in LNCaP cells, treated with R1881 as measured by both RT-PCR and Q-RT-
PCR (Figure 11B-III).
BARD1 is involved in regulating endogenous AR expression and activity in prostate cancer cells:
To elucidate the potential function of BARD1 in prostate cancer, we overexpressed BARD1 in LNCaP cells (Figure 12A-III), exogenous expression of
BARD1 resulted in a decrease in androgen-dependent AR protein expression (Figure
12A-III). Interestingly, AR mRNA did not have any effect on BARD1 over-expression
(Figure 12C-III), suggestive of regulation of AR protein stability by BARD1. TM4SF3 serves as a positive control (Figure 12A-III), as reduced levels of AR directly resulted in reduced TM4SF3 protein expression. To monitor BARD1 function on AR activity, we measured AR transcriptional activity and AR regulated gene expression in LNCaP cells, overexpression of BARD1 resulted in marked reduction of AR transcriptional activity as measured by reporter gene assay (Figure 12D-III), and expression of the endogenous gene PSA. (Figure 12E-III).
134 Figure Legends for Additional Results
Figure 1-III: CSN4 regulates CSN6 protein levels in prostate cancer cell lines.
LNCaP and CWR-22Rv1 cells were transfected with (A) Ctrl siRNA or CSN4 siRNA or
(B) Ctrl siRNA or CSN6 siRNA and Western blotting was used to measure CSN4 and Q-
RT-PCR was performed to measure CSN6. β-actin was used as loading control.
135 Figure 1-III
136 Figure 2-III: Androgen down-regulates TM4SF3 mRNA in AR-positive prostate cancer cells. (A) AR- positive or (B) AR-negative prostate cancer cells were treated with either ethanol (-) or 1nM R1881 (+) and measured for expression of TM4SF3 using Q-
RT-PCR. Asterisk indicate statistical significance (p<0.05)
137
Figure 2-III
138 Figure 3-III: AR is required for androgen down-regulation of TM4SF3 mRNA. (A)
LNCaP cells were transfected with control or AR siRNA treated with either ethanol (-) or
1nM R1881 (+) and (B) infected empty or AR lenti virus (C) without (-) or with 10 uM casodex (+) (D) CWR22Rv1 cells were transfected with control or AR siRNA treated with either ethanol (-) or 1 nM R1881 (+) and measured for expression of TM4SF3 and
AR using Q-RT-PCR.
139
Figure 3-III
140 Figure 4-III: Androgen down- regulates endogenous, but not exogenous, TM4SF3 mRNA. LNCaP cells were transfected with empty vector or TM4SF3-CDS/pCMV (A) or
TM4SF3 FL/pCMV (B) and treated with either ethanol (-) or 1nM R1881 (+) and measured for expression of endogenous (A), exogenous (A, B), or only exogenous
TM4SF3 (B) using Q-RT-PCR. Asterisk indicates statistical significance (p<0.05).
141 Figure 4-III
142 Figure 5-III: Transcription and translation are required for androgen down- regulation of TM4SF3 mRNA.
LNCaP cells grown in either ethanol (-) or 1 nM R1881 (+) were treated with either
(A,B) 10 ug/ml actinomycin D (Act-D) without (-) or (C,D) 50ug/ml cycloheximide
(CHX) and measured for expression of TM4SF3 or PSA using Q-RT-PCR. Asterisk indicates statistical significance (p<0.05) AR protein levels were measured in LNCaP cells treated as above with actinomycin D (E) or cycloheximide (F). β-actin was used as loading control.
143 Figure 5-III
144 Figure 6-III: Down-regulation of TM4SF3 protein results in reduced expression of
AGR2. (A) LNCaP cells treated with either ethanol (-) or 1nM R1881 (+) or (B,D) PC-3 cells transfected with control or TM4SF3 siRNA and expression of TM4SF3 and AGR2 were measured by western blotting or (E,F) measured by Q-RT-PCR for TM4SF3 and
AGR2 mRNA. (C) Different prostate cancer cells like LNCaP, VCaP, C81 and PC-3 cells were treated with either ethanol (-) or 1 nM R1881 (+) and expression of AGR2 measured by western blotting. In (D) 50ug/ml Cycloheximide (CHX) was used. β-actin was used as loading control. Asterisk indicates statistical significance (p<0.05).
145
Figure 6-III
146 Figure 7-III: AGR2 acts down-stream of TM4SF3 and involved in PC-3 cell invasion and migration. PC-3 cells transfected with either Control or AGR2 siRNA and measured for (A) cell invasion or (B) migration (C) expression of AGR2 and TM4SF3 by western blotting. β-Actin was used as loading control Bar graphs represents an average of three independent experiments plus standard deviations. The Student T–test was performed to show statistical significance (p < 0.03), as indicated by asterisks.
147
Figure 7-III
148 Figure 8-III: Down-regulation of TM4SF3 leads to decrease in AKT and disruption of AKT down-regulates TM4SF3 in PC-3 cells. PC-3 cells treated with either control
(C) or TM4SF3 siRNA (T) (A) or (B) Empty (E) or TM4SF3 adenovirus (T) (C) AKT siRNA (D) AKT kinase inhibitor LY293002 and measured for PAN-AKT, S473AKT and
TM4SF3, or (E,F) measured for TM4SF3 and AKT mRNAs by Q-RT-PCR.
149
Figure 8-III
150 Figure 9-III: Palmitoylation of TM4SF3 affects its stability and function. (A) LNCaP and PC-3 cells are treated with increasing concentration (25 uM and 50 uM) of 2-BP for
24 hrs, measured for expression of TM4SF3. (B) PC-3 cells treated with either control or
TM4SF3 siRNA or with 2-BP 25 uM or 50 uM, measured for cell invasion and TM4SF3 protein expression. Note that β-actin was used as loading controls.
151
Figure 9-III
152 Figure 10-III: Androgen down-regulates BARD1 mRNA and protein in prostate cancer. LNCaP cells were treated with either ethanol (-) or 1 nM R1881 (+) and measured for expression of TM4SF3 mRNA by quantitative RT-PCR (A) or BARD1 protein by western blot (C) (B) LNCaP cells were treated with either ethanol (-) or 1 nM
R1881 (+) for 2-24 hrs and measured for expression of either BARD1 mRNA by Q-RT-
PCR.
153
Figure 10-III
154 Figure 11-III: AR is required for androgen down-regulation of BARD1 mRNA in androgen-dependent prostate cancer cells. LNCaP cells were transfected with control or AR siRNA treated with either ethanol (-) or 1 nM R1881 (+) measured for expression of (A, B) AR and BARD1 mRNAs using QRT-PCR and (B) BARD1 RT-PCR.
155
Figure 11-III
156 Figure 12-III: BARD1 is involved in regulating endogenous AR expression and activity in prostate cancer cells. LNCaP cells were transfected with empty or BARD1 expression plasmid in the presence of ethanol (-) or 1 nM R1881 (+) and measured for expression of (A) AR, TM4SF3 and BARD1 by Western blotting Note that β-actin was used as loading control. (B) BARD1 and AR mRNAs by Q-RT-PCR (C) activity of transfected luciferase or expression of endogenous PSA.
157
Figure 12-III
158 Chapter 5
Discussion
Androgen signaling via AR plays an essential role in prostate cancer initiation and progression. Disruption of AR activity leads to a significant decrease in proliferation of prostate cancer cells (18). AR is overexpressed in and its transcriptional activity is restored through the multiple stages of prostate cancer including CRPC. Multiple mechanisms are responsible for functional AR in prostate cancer. During the progression of CRPC, AR activity is modified and there is aberrant regulation of different genes, which promote the cell proliferation, and survival (171, 172). To study and identify novel androgen-regulated genes in prostate cancer, we performed Affymetrix gene micro-array analysis and identified sGCα1as a novel androgen up-regulated gene while TM4SF3 and
BARD1 were found to be androgen-repressed genes.
We published that androgen up-regulation of sGCα1 is required for androgen- dependent and androgen-independent prostate cancer cell growth and survival. Recently, we published that sGCα1 directly associates with p53, sequesters it in cytoplasm and thus prevents prostate cancer cells from undergoing p53-dependent apoptosis (18, 50). Most importantly pro-growth and pro-survival functions of sGCα1 are independent of classical
NO signaling as well as association with sGCβ1 (18). In order to better understand the mechanisms by which sGCα1 exerts its pro-proliferative role in prostate cancer, we performed MS analysis and discovered CSN4, as a novel sGCα1 binding-partner. IP and
IF experiments confirmed this interaction between these two important proteins in AR-
159 positive prostate cancer cells. To elucidate the importance of this interaction in PCa cells, we disrupted CSN4 expression using CSN4 specific siRNA, and observed that sGCα1 protein expression reduced significantly in AR-positive LNCaP, C81 and CWR22Rv1
PCa cell lines. Consistent with this, over-expression of CSN4 in CSN4 knock-down cells resulted in rescuing the sGCα1 protein levels which can be comparable with control siRNA treated cells. Thus endogenous expression of CSN4 directly correlates with endogenous sGCα1 levels in PCa cells. Most interestingly PC-3 cells which have very weak expression of CSN4, do not express sGCα1, consistent with our findings that CSN4 may be required for endogenous levels of sGCα1. Both these proteins were over- expressed and showed positive correlations in prostate tumors as observed in PCa cell lines. Q-RT-PCR analysis showed that CSN4 does not affect sGCα1 mRNA level.
Further, detailed analysis revealed that CSN4 prevents proteasome-dependent degradation of this pro-growth protein in both androgen-dependent and androgen- independent cell lines. Thus CSN4 positively regulates the stability of sGCα1. For the first time, we are showing that sGCα1 protein degradation is proteasome-dependent and prevented by CSN4 in PCa. Earlier published work on CSN suggested that the CSN complex is involved in positively regulating c-Jun protein stability by preventing its proteasome-dependent degradation (96), consistent with our finding about sGCα1 in prostate cancer. Most importantly this positive regulation of sGCα1 protein by CSN4 directly correlates with its pro-growth function, as knock-down of CSN4 led to a significant decrease in PCa cell growth mediated by sGCα1 in AR-positive PCa cell lines. As observed earlier (18), this pro-growth function of sGCα1 is also independent of the NO signaling pathway. Though CSN4 knock-down cells are rescued significantly by
160 sGCα1 overexpression, the rescue was incomplete, opening the possibility of additional targets for CSN4. Our previously published data showed a direct interaction between sGCα1 and p53 in the cytoplasm of prostate cancer cells (50). In addition, all our current findings showed cytoplasmic association of sGCα1 with CSN4. Considering all these findings, we hypothesized that p53 may be an additional target for CSN4. Indeed, complementary IP experiments showed that p53 is associated with CSN4 and sGCα1 in
PCa cells. p53, a tumor suppressor is frequently mutated in multiple cancers including
PCa. Recently, it was published that Tp53R270H mutation of p53 is required for prostate cancer initiation. Further investigation suggests that this mutation also plays significant role in CRPC progression (58). Disruption of wild-type p53 pro-apoptotic functions is required for tumor progression (173). However, the exact mechanisms by which p53 are inactivated in prostate cancer are unknown. We show for the first time, CSN4-dependent regulation and inactivation of p53 in prostate cancer. Our findings show that p53 is a part of an endogenous CSN4-sGCα1 cytoplasmic complex. Interestingly, contradictory to sGCα1, knock-down of CSN4 led to increase in p53 protein expression. Importantly, this positive effect on p53 protein was abolished by CSN4 overexpression in prostate cancer cells clearly demonstrate that CSN4 is involved in regulating endogenous p53 protein levels and keeps it low in prostate tumor cells. Detailed investigations showed that CSN4 promotes p53 proteasomal-degradation and thus negatively regulates p53 protein stability that leading to lower accumulation of p53 in prostate cancer cells. p53 is a strong pro- apoptotic protein and so, it is necessary to keep extremely low levels of this protein under normal conditions. In response to multiple stresses like DNA damage, hypoxia and oncogenic activation, p53 protein is accumulated in the cell nucleus and induces
161 expression of pro-apoptotic genes. Ultimately cells undergo p53-dependent apoptosis (60,
61). Thus, CSN4-mediated negative regulation of p53 protein, maintains p53 at minimum levels and prevents prostate cancer cells from undergoing p53-dependent apoptosis thereby facilitating tumor cell growth.
Consistent with the important function of p53 to inhibit cell growth (174), we observed that elevated levels of p53 are involved in the negative effect of CSN4 siRNA on cell growth. Most importantly, we observed nearly a complete rescue of CSN4 knock- down prostate cancer cells when combined with p53 disruption and sGCα1 overexpression. This could be the possible explanation for incomplete rescue with either overexpression of only sGCα1 or p53 knock-down alone. Thus CSN4 positively regulates the stability of pro-growth protein sGCα1 and maintains low levels of endogenous anti-growth protein p53. These combined effect leads to prostate cancer cells enhanced survival and growth. As expected, in prostate tumors, p53 protein expression is very low compared to high levels of CSN4 and sGCα1 expression, consistent with what we observed in prostate cancer cells.
Knock-down of CSN4 led to a decrease in CSN5 protein. However, since CSN5 disruption did not effect CSN4 protein, we conclude that CSN5 functions downstream of
CSN4 and mediates CSN4 effects on p53 and sGCα1. Interestingly CSN5 acting down- stream of CSN4, leading to sGCα1 stabilization, is a completely novel finding in prostate cancer. CSN5 has been shown to associate with p53, induce its nuclear export and subsequent proteasome-dependent degradation (88).
The CSN complex is made up of eight different subunits (69). Our data showed the involvement of two subunits CSN4 and CSN5 in regulating sGCα1 and p53. Based on
162 our preliminary data, diminished levels of CSN4 directly correlate to low expression of
CSN6. There is the evidence for the formation of CSN5-containing CSN4-5-6-7 cytoplasmic sub-complex (163). Consistent with this, our data suggest the same sub- complex exists in prostate cancer cells. Our future study will focus on studying the CSN7 protein in the context of this sub-complex and role of CSN6 and CSN7 in regulating the stability of sGCα1 and p53.
Previously it has been published that kinase activity is associated with the CSN complex due to its interaction with two important kinases, PKD and CK2, known to phosphorylate different CSN subunits and are involved in regulating the stability of multiple proteins, like oncogene c-Jun and p53 (98, 99). In our study we showed that
CK2 kinase is also part of the endogenous complex containing sGCα1, p53, CSN4, and
CSN5. Disruption of CK2 kinase activity by siRNA or using chemical inhibitors like curcumin and emodin resulted in down-regulation of sGCα1 and up-regulation of p53, mimicking what we was observed with CSN4 knock-down. Thus, we discovered CK2 as an important regulator of sGCα1 and p53. With respect to p53 it has been noted that CK2 phosphorylates p53 and mediates its proteasome-dependent degradation (98), which may be occurring in prostate cancer cells. However, there is no evidence of regulation of sGCα1 by CK2 in prostate cancer. In our future work, we are interested to show whether sGCα1 is a direct or indirect target of CK2 by performing kinase assays. It has been published that CK2 kinase is involved in phosphorylating CSN2 and CSN7 subunits
(101). Our future studies will be directed to see whether CSN4/5/6/7 could be the potential substrates for CK2.
163 We have published that sGCα1 interacts with p53, sequesters p53 in the cytoplasm and thus forms a sGCα1-p53 cytoplasmic complex (50). Interestingly, our current study showed that CSN4, CSN5 and CK2 are also key members of this complex. Thus, CSN4 may function as a docking site for the recruitment of sGCα1, p53 and CK2 and regulates the stability of these pro-growth and anti-growth proteins in opposite ways. Our future work will characterize the interaction among these proteins, perform mapping of interacting domains, and determine the important components, which maintain the stability of this big complex.
Based on all our results, we introduced a model showing all components of this complex. CSN4 along with CK2 kinase and CSN5, which is downstream of CSN4, either prevent and promote the proteasome-dependent degradation of sGCα1 and p53, respectively. Thus, opposite regulation of the stability of these two proteins provides the prostate cancer cells with an enhanced potential to grow and survive. Interestingly, while androgen up-regulates sGCα1 (18), it has no effect on the other proteins in this complex.
AR is a central regulator of prostate tumorogenesis, through a variety of mechanisms that are not fully understood. The role of AR in regulating different androgen-repressed genes and their function in prostate cancer is a wide area of research
(175). In this dissertation, we demonstrate the complex regulation of the trans-membrane protein TM4SF3 by androgens, its role in prostate cancer development and a novel interaction and localization of TM4SF3 with AR. As mentioned earlier, TM4SF3 is a novel androgen-repressed gene identified through a gene microarray study, unique in its androgen regulation as mRNA is androgen-repressed while its protein is up-regulated.
We confirmed the microarray results by doing Q-RT-PCR in LNCaP cells, which showed
164 strong androgen-repression on TM4SF3 mRNA. Contradictory to the mRNA, TM4SF3 protein is up-regulated by androgen. Earlier it was published that there was a discrepancy between the AR-V (AR variants) mRNAs and AR-FL reported in clinical specimens of prostate cancer patients. Western analysis in CRPC bone metastases showed that AR-V proteins were expressed at levels comparable to AR-FL protein levels even though the corresponding variant transcripts were found at relatively very low levels compared to
AR-FL mRNA levels consistent with what we observed in our data (176). We further verified the specificity of mRNA, by performing Q-RT-PCR using additional primers, which cover the different regions of TM4SF3 mRNA including coding and both untranslated regions. As expected, all four primer pairs exhibited androgen-mediated
TM4SF3 mRNA down-regulation. This confirms that the down-regulated mRNA we were measuring was indeed coming from the TM4SF3 gene.
After verifying the specificity of the mRNA, we measured the TM4SF3 mRNA in different prostate cancer cell lines: VCaP, C81 and CWR22Rv1. Consistent with LNCaP cells, all these other AR-positive cells showed androgen down-regulation of TM4SF3 mRNA. In contrast, androgen has no effect on TM4SF3 mRNA in the AR-negative PC-3 cells. We confirmed the requirement of AR for the androgen negative effect on TM4SF3 mRNA by using two approaches. First, endogenous knock-down of AR in LNCaP and
CWR22Rv1 showed strong elimination of androgen repression of TM4SF3 mRNA. In the second approach, use of anti-androgen casodex exhibited similar results. These results confirm the requirement of AR and AR transcriptional activity for androgen-mediated down-regulation of TM4SF3 mRNA. Further, we observed no effect of androgen on exogenous full-length TM4SF3 mRNA expressed through FL-TM4SF3/pCMV. This
165 result suggested that TM4SF3 mRNA is not the target of androgen down-regulation. actinomycin D and cycloheximide experiments in LNCaP cells were consistent with our hypothesis that AR regulates TM4SF3 mRNA at a transcriptional level, as androgen regulation of new protein synthesis is required for AR to act on the TM4SF3 promoter.
Future studies will include studying the role of AR in regulating TM4SF3 promoter and possible functions of TM4SF3 mRNA in prostate cancer.
To verify the specificity of the androgen positive effect on the protein we used two complementary approaches. First, knock-down of TM4SF3 using a specific pool siRNA, includes three different siRNAs against the coding region of TM4SF3, successfully reduced the TM4SF3 protein in LNCaP and PC-3 cells. A second approach was to express TM4SF3 protein exogenously using an expression plasmid, which resulted in a significant increase in total endogenous TM4SF3 protein, at the expected molecular weight on Western blot, confirming the protein.
TM4SF3 is a novel target of androgen with regard to the protein as androgen up- regulates TM4SF3 by inhibiting its proteasomal-degradation, induces its nuclear localization, and promotes nuclear interaction with AR in different prostate cancer cells.
In this dissertation, we demonstrate and discuss novel functions of androgens in regulating this transmembrane protein and promoting its dual localization in prostate cancer. As expected siRNA-mediated knock-down of AR or casodex treatment eliminated the androgen positive effect on TM4SF3 protein in LNCaP cells. However, in contrast to the mRNA, which is down-regulated by androgen in both androgen-dependent and androgen-independent cells, TM4SF3 protein is up-regulated in androgen-dependent
LNCaP and VCaP cells and androgen-independent expression in hormone-refractory
166 prostate cancer cells in C81 and CWR22Rv1. As expected, the protein expression in these cells is comparable with the levels of TM4SF3 in LNCaP and VCaP cells with androgen. Although the TM4SF3 protein expression is independent in hormone– refractory cells, AR still is required for TM4SF3 expression.
One of the possible mechanisms for androgen up-regulation of TM4SF3 is inhibition of its protein degradation by the classical proteasome pathway. It has been published that the tetraspanins like CD151 and CD82 can be degraded through proteasome-dependent degradation (177). However, nothing has been documented about
TM4SF3. For the first time, we show that androgen up-regulates TM4SF3 protein by inhibiting its proteasome-dependent degradation. Interestingly, it has been published that
Cdc25c, a cell cycle protein of the dual specificity phosphatase is up-regulated by androgens by preventing its proteasomal-degradation (178), consistent with our observations on TM4SF3. An ubiquitin E3 ligase gene related to anergy in lymphocytes
(GRAIL) or Rnf128 is involved in the ubiqutination of cytosolic lysines within the amino terminus of tetraspanins like CD151 and CD81. GRAIL promoted ubiqutination of these tetraspanins resulting in the proteasomal-degradation via Lys-48 linkages (177). We have identified a single lysine residue in the cytosolic amino terminus of TM4SF3 protein, similar to CD151 and CD82 (177). It is possible that androgen may prevent the ubiquitination of this lysine residue, blocking TM4SF3 proteasomal-degradation. In our future studies we will examine the ubiquitination of TM4SF3 and involvement of the
GRAIL E3 ligase in TM4SF3 ubiquitination.
Our time course experiment in the LNCaP cells showed that TM4SF3 up regulation occurs around 8 hrs after androgen treatment, which is earlier than androgen down-
167 regulation of TM4SF3 mRNA. This suggests that the translation process may begin before the degradation of mRNA, leading to TM4SF3 up-regulation by androgen.
Palmitoylation involves addition of palmitic acid, a 16 carbon fatty acid chain, to the intracellular cysteine of tetraspanins that results in inhibition of their subsequent degradation (120, 170). It has been published that palmitoylation of CD151 and CD9 is involved in positively regulating their stability by inhibiting their lysosomal degradation and functions (170). Consistent with this published work, we observed that palmitoylation of TM4SF3 affects endogenous levels of TM4SF3 and its functions in prostate cancer. Specifically we observed that use of palmitoylation inhibitor in LNCaP and PC-3 cells resulted in a significant decrease in endogenous TM4SF3 protein and strongly inhibited PC-3 cell invasion, similar to TM4SF3 disruption in these cells. In our future work we will study whether androgen induces the palmitoylation of TM4SF3 and thus prevents its degradation.
TM4SF3 belongs to the tetraspanins family of proteins involved in different functions, including cell adhesion, cell–cell fusion, invasion and migration, cell proliferation and survival (169, 179, 180). TM4SF3 is involved in the metastasis of different cancers and its overexpression directly correlates with the progression of gastrointestinal and hepatocellular carcinomas (137). Importantly, androgen regulation of
TM4SF3 and its role in prostate cancer progression is still unknown. Based on the positive regulation of TM4SF3 protein stability by androgen, its overexpression and a positive correlation with AR protein levels in prostate cancer cell lines and prostate tumors, inclined towards its pro-cancerous role in prostate cancer. Indeed, we found that
TM4SF3 is required for androgen-dependent cell invasion and migration in LNCaP cells.
168 Furthermore, this function of TM4SF3 is androgen-independent in hormone refractory prostate cancer cell lines consistent with its androgen-independent expression in these cells. Interestingly, we observed that in AR-negative PC-3 cells TM4SF3 is constitutively expressed and strongly affects PC-3 cell invasion and migration. EMT is a process of loss of epithelial markers (E-cadherin) and gain of mesenchymal markers (N-cadherin), associated with progression to metastasis of the prostate tumors (181). TM4SF3 is involved in promoting EMT in prostate cancer cells, as observed with the change in corresponding markers after knock-down of TM4SF3, providing a mechanism for supporting metastasis in prostate cancer cells. While most prostate tumors express AR, there is a subset of PC-3 like tumors which do not express AR (182). Considering
TM4SF3 expression and its function in both AR- positive and AR-negative cell lines,
TM4SF3 is an important protein for the progression of both types of prostate tumors and could serve as a useful biomarker for progression of prostate tumors.
We found AGR2, as the potential interacting partner for TM4SF3, functions down-stream of TM4SF3 in prostate cancer cells. Most importantly, TM4SF3 positively regulates AGR2 protein stability as seen in a time-course experiment performed in PC-3 cells, which showed a decrease in AGR2 protein levels in response to knock-down of
TM4SF3. However, AGR2 mRNA was unaffected by TM4SF3 disruption. This positive regulation of AGR2 protein stability by TM4SF3, AGR2 constitutive expression in PC-3 cells and androgen-induced up-regulation of AGR2 in prostate cancer cells supports its pro-cancer function in prostate cancer. AGR2 is overexpressed in breast cancer, promoting its metastasis (146). Consistent with this, siRNA targeted disruption of AGR2 resulted in a significant decrease in PC-3 cell invasion and migration. In future studies,
169 we will measure the pro-invasive role of AGR2 in AR-positive prostate cancer cells and determine whether AGR2 is directly involved in TM4SF3-dependent prostate cancer cell invasion and migration.
Our preliminary data suggested that knock-down of TM4SF3 in PC-3 cells resulted in a strong decrease in total AKT protein level and AKT phosphorylation at S473.
Importantly both siRNA-mediated endogenous AKT down-regulation and use of AKT kinase inhibitor led to reduced TM4SF3 expression in PC-3 cells. This suggests that
TM4SF3 and AKT function together and mutually regulate the stability of each other.
The AKT/PI3K signaling pathway has been shown to promote prostate cancer cell invasion (156). To directly show the involvement of AKT in TM4SF3-mediated cell invasion, we will rescue the TM4SF3 knock-down prostate cancer cells with overexpression of AKT and measure cell invasion and migration. It has been published that, in breast cancer cells, AKT regulates the protein levels of AGR2 (168). In our future studies, we will determine whether AKT is involved in regulating AGR2 protein levels in prostate cancer cells. Based on our preliminary data, we are proposing that AKT and its downstream target AGR2 as a potential signaling pathway, are involved in mediating
TM4SF3-dependent prostate cancer cell invasion and migration.
The highlight of our findings is androgen-induced nuclear localization of
TM4SF3 in AR-positive prostate cancer cell lines. Most importantly, the significance of this localization is nuclear interaction of TM4SF3 with AR, was observed by co- localization studies in LNCaP and C81 using the immune-fluorescence. Cell fractionation data confirmed the androgen-induced presence of TM4SF3 in the nuclear fraction, in addition to being localized in the membrane fraction of the prostate cancer cells. Earlier
170 published work suggested that CD9, a member of tetraspanin family showed nuclear localization in WM238 and SbCl2 metastatic melanoma cells (134). There are several examples of proteins showing dual subcellular localizations, like cytokines, growth factors, G-protein coupled receptors and heat shock protein 70. In general, proteins which show dual localization are categorized in four different ways: 1) proteins have a signal sequence but no NLS 2) proteins contain both sequences 3) proteins have NLS but no signal sequence 4) proteins have neither of these signals (183). TM4SF3 has a sorting motif Yxxφ (Y is tyrosine X is a amino acid and φ is a amino acid with bulky hydrophobic side chain) located close to the trans-membrane region (184) but no NLS, suggesting that TM4SF3 is included in first category. Other examples of such proteins are
Fibroblast Growth Factor Receptor-1, Epidermal Growth Factor (EGF) family EGF, G-
Protein Coupled Receptors (GPCR) (183).
Based on our findings, TM4SF3 nuclear localization is androgen-induced and dependent on an interaction with AR. Mechanistically a protein can be imported into the nucleus by three different ways: 1) If the protein has a nuclear localization signal (NLS);
2) Its molecular weight is below 60 kDa, so it can diffuse through the nuclear pores; 3) It can associate with another protein which has NLS (183). As TM4SF3 does not have the classical NLS, the first way is not possible. The second possible mechanism of TM4SF3 nuclear import is diffusion of TM4SF3 through nuclear pores as its molecular weight is below 60kDa. However, PC-3 cells do not show the nuclear localization of TM4SF3, suggesting that molecular weight is not the key for nuclear import of TM4SF3. However, our findings showing co-purification of TM4SF3 with AR in cytoplasmic and nuclear fractions of androgen-treated LNCaP cells suggest that TM4SF3 may bind to AR in the
171 cytoplasm in an androgen-dependent manner and be transported to the nucleus along with
AR in a “piggy back” ride way as AR itself has a well defined NLS. Further supporting data comes from LNCaP, C81 and A103, which showed androgen-induced nuclear co- localization of TM4SF3 and AR. However, in AR-negative PC-3 cells, androgen does not have any effect on TM4SF3 localization as most of the endogenous TM4SF3 is localized in the plasma membrane as seen in IF. Additionally, we had in our cell fractionation experiments in AR- positive cells where in absence of ligand, TM4SF3 is mostly present in membrane fraction and addition of hormone induced significant increase in nuclear
TM4SF3, consistent with nuclear co-localization in these cells. Based on all these findings we propose that androgen-induced interaction of TM4SF3 with AR in the cytoplasm, and subsequent nuclear import of TM4SF3 with AR could be a potential mechanism of TM4SF3 nuclear import in prostate cancer cells.
TM4SF3 co-localization with AR suggested the novel interaction between a nuclear receptor and a trans-membrane protein. As expected, our IP experiments confirmed this interaction in androgen-treated LNCaP, C81 and A103 cells. Most importantly, our in vitro study showed the direct interaction between AR and TM4SF3.
In order to understand the functions of nuclear TM4SF3, we directed our focus on
AR, the interacting partner of TM4SF3. We measured AR protein levels in TM4SF3 knock-down LNCaP and C81 cells, which to our surprise, led to a significant decrease in
AR protein levels since this can be rescued by overexpression of TM4SF3, an effect on
AR protein levels that is specifically mediated by TM4SF3. Further time-course experiments in cycloheximide and TM4SF3-siRNA treated LNCaP, suggested the involvement of TM4SF3 in regulating AR protein stability similar to the effect of AR on
172 TM4SF3 protein levels and suggesting a mutual stability between AR and TM4SF3 in prostate cancer. In prostate tumors, both TM4SF3 and AR were over-expressed and thus showed expected strong positive correlation, consistent with their mutual stabilization observed in prostate cancer cells. There are a few documented examples of mutual stabilization of two proteins, LXXLL/leucine zipper-containing Alternative Reading
Frame (ARF) binding protein (LZAP) associates with a Novel LZAP-Binding Protein
(NLBP) in hepatocellular carcinoma. This interaction between these two proteins inhibits the ubiquitination of each other and thus regulates their mutual stability leading to inhibition of cell invasion in hepatocellular carcinoma. Most importantly, LZAP is localized to the different cell compartments like nucleus, nucleolus or cytoplasm.
However NLBP protein co-localized with LZAP in cytoplasm (185). Another example of such an interaction is between STRA13, a hypoxia inducible bHLH transcription factor associating with MSP58, a cell cycle associated transcription factor. Both proteins co- localize in the nucleus. The complex formation between these two proteins prevent their proteasome-dependent degradation, extending their half-life significantly (186), similar to the TM4SF3 and AR nuclear interaction and mutual stabilization.
As expected, TM4SF3-dependent regulation of endogenous AR levels in prostate cancer cells affects AR trans-activation. Indeed, we observed that TM4SF3 regulates AR transcriptional activity as measured by luciferase reporter gene assay and expression of the endogenous PSA gene. Significantly, androgen-induced cellular proliferation is dramatically decreased in LNCaP and C81 cells, supporting the androgen-induced nuclear interaction between TM4SF3 and AR. PC-3 cells did not show any effect on cell growth after endogenous TM4SF3 depletion, strongly supporting the importance of
173 androgen-induced co-localization and the subsequent effects of this interaction on prostate cancer cell growth.
TM4SF3 is involved in multiple functions in prostate cancer including promoting cell invasion and migration, interacting with AR and affecting AR-regulated gene expression and cell proliferation. The question is which TM4SF3, membrane-bound or nuclear or both are involved in promoting these diverse functions. Based on our findings, we propose that membrane-bound TM4SF3 may be involved in pro-metastasis of prostate cancer cells, as in PC-3 cells, siRNA-mediated disruption of TM4SF3 led to a significant decrease in cell invasion and migration, consistent with its constitutive expression in these cells. Published work on TM4SF3 reported that the trans-membrane TM4SF3 promotes cell invasion and migration in different carcinomas (137), consistent with our findings that membrane-associated TM4SF3 is involved in prostate cancer cell invasion and migration. TM4SF3 is not nuclear in R1881 treated PC-3 cells and TM4SF3 knock- down in PC-3 did not affect PC-3 cell growth. However, androgen-dependent-cell growth is affected by TM4SF3 disruption in AR-positive prostate cancer cells. Furthermore, interaction of TM4SF3 with AR is required for TM4SF3 nuclear import, as addition of
R1881 induces nuclear co-localization of AR and TM4SF3 in AR-positive prostate cancer cells, including A103 cells. Changes in endogenous AR levels affects prostate cancer cell growth (187). TM4SF3 nuclear interaction with AR inhibits its degradation and thus resulted in increased AR protein levels and positive effects on cellular proliferation, which was not observed in PC-3 cells. Based on all these supportive data, we conclude that nuclear TM4SF3 affects androgen-dependent cell growth and
174 membrane-associated TM4SF3 promotes cell invasion and migration of prostate cancer cells.
AR is a central key player in both early development and progression of prostate cancer. Deregulated and modified transactivation and overexpression of AR is one important mechanism in the progression of CRPC (188). Disruption of AR transcriptional activity and thus inhibiting the AR functions are at the center of drug design for prostate cancer. Our studies indicate the direct interaction of TM4SF3 with AR results in increased endogenous AR protein levels, and regulation of AR-mediated gene expression and proliferation of prostate cancer cells. Understanding the significance of this interaction in prostate cancer, our future studies will be focused on mapping the interaction domains between AR and TM4SF3. This would allow us to design peptides, which can disrupt the interaction between these two proteins that would lead to destabilization of both AR and TM4SF3. Recently it has been published that bromodomain containing protein 4 (BRD4) physically interacts with the N-terminal domain of AR and can be disrupted by small molecules like JQ1, a small molecule inhibitors targets amino terminus of BRD4 and provides a novel therapeutic drug for the treatment of CRPC (189).
175 Consistent with gene microarray study, BARD1 mRNA and protein are androgen- repressed in LNCaP cells. Most importantly our findings showed that overexpression of
BARD1 in LNCaP cells is involved in negatively regulating endogenous AR protein levels, AR transactivation and endogenous expression of PSA. It has been published that
BRCA1/BARD1 is involved in poly-ubiquitination of Progesterone Receptor and inducing its proteasome-dependent degradation and mono-ubiquitination of estrogen receptor (162). Based on our results and considering the published work, we propose that
BRCA1/BARD1 may be involved in regulating ubiquitination of AR and promoting proteasomal-degradation of AR. Our future work will focus on understanding and exploring the role of the BRCA1/BARD1 complex in prostate cancer.
In our study, we found two novel endogenous protein complexes, one containing
CSN4, CSN5, sGCα1, p53, and CK2 and the other AR and TM4SF3. While these are distinct complexes in prostate cancer cells, they have one common function, regulation of protein stability. Based on our results, the CSN4 containing endogenous complex is formed in the cytoplasm of prostate cancer cells, while the AR-TM4SF3 complex appears to form in the cytoplasm and translocates into the nucleus. Our proposed model suggests that CK2-induced phosphorylation of p53, a known substrate of this kinase (98), and possibly sGCα1 affects their protein stability. In future work, we will determine sGCα1 is a direct target of CK2 and confirm p53 is a substrate for CK2 in prostate cancer cells.
Based on our results, the TM4SF3-AR complex forms in androgen-dependent manner. It is known that phosphorylation of AR at serine 81 stabilizes AR and enhances its transactivation (38). It is possible that these two endogenous protein complexes may cross-talk with each other. CK2 kinase may affect the phosphorylation state of AR and/or
176 TM4SF3 in prostate cancer cells and thus regulate the stability of these two proteins.
Future work will study the possibility that AR and TM4SF3 are potential targets for CK2 and the CSN4-containing complex.
177 REFERENCES
1. Cai C, Hsieh CL, Omwancha J, Zheng Z, Chen SY, Baert JL, Shemshedini L.
ETV1 is a novel androgen receptor-regulated gene that mediates prostate cancer
cell invasion. Mol Endocrinol. 2007;21(8):1835-1846.
2. Cai C, Balk SP. Intratumoral androgen biosynthesis in prostate cancer
pathogenesis and response to therapy. Endocr Relat Cancer. 2011;18(5):R175-
182.
3. Cai C, Chen S, Ng P, Bubley GJ, Nelson PS, Mostaghel EA, Marck B,
Matsumoto AM, Simon NI, Wang H, Balk SP. Intratumoral de novo steroid
synthesis activates androgen receptor in castration-resistant prostate cancer and is
upregulated by treatment with CYP17A1 inhibitors. Cancer Res.
2011;71(20):6503-6513.
4. Belandia B, Parker MG. Nuclear receptors: a rendezvous for chromatin
remodeling factors. Cell. 2003;114(3):277-280.
5. Centenera MM, Harris JM, Tilley WD, Butler LM. The contribution of different
androgen receptor domains to receptor dimerization and signaling. Mol
Endocrinol. 2008;22(11):2373-2382.
178 6. Bevan CL, Hoare S, Claessens F, Heery DM, Parker MG. The AF1 and AF2
domains of the androgen receptor interact with distinct regions of SRC1. Mol Cell
Biol. 1999;19(12):8383-8392.
7. Bubulya A, Chen SY, Fisher CJ, Zheng Z, Shen XQ, Shemshedini L. c-Jun
potentiates the functional interaction between the amino and carboxyl termini of
the androgen receptor. J Biol Chem. 2001;276(48):44704-44711.
8. Eisenberger MA, Blumenstein BA, Crawford ED, Miller G, McLeod DG, Loehrer
PJ, Wilding G, Sears K, Culkin DJ, Thompson IM, Jr., Bueschen AJ, Lowe BA.
Bilateral orchiectomy with or without flutamide for metastatic prostate cancer. N
Engl J Med. 1998;339(15):1036-1042.
9. Massard C, Fizazi K. Targeting continued androgen receptor signaling in prostate
cancer. Clin Cancer Res. 2011;17(12):3876-3883.
10. Claessens F, Denayer S, Van Tilborgh N, Kerkhofs S, Helsen C, Haelens A.
Diverse roles of androgen receptor (AR) domains in AR-mediated signaling. Nucl
Recept Signal. 2008;6:e008.
11. Quigley CA, De Bellis A, Marschke KB, el-Awady MK, Wilson EM, French FS.
Androgen receptor defects: historical, clinical, and molecular perspectives.
Endocr Rev. 1995;16(3):271-321.
12. Brinkmann AO, Blok LJ, de Ruiter PE, Doesburg P, Steketee K, Berrevoets CA,
Trapman J. Mechanisms of androgen receptor activation and function. J Steroid
Biochem Mol Biol. 1999;69(1-6):307-313.
13. Nazareth LV, Weigel NL. Activation of the human androgen receptor through a
protein kinase A signaling pathway. J Biol Chem. 1996;271(33):19900-19907.
179 14. McKenna NJ, Lanz RB, O'Malley BW. Nuclear receptor coregulators: cellular
and molecular biology. Endocr Rev. 1999;20(3):321-344.
15. Greenlee RT, Murray T, Bolden S, Wingo PA. Cancer statistics, 2000. CA Cancer
J Clin. 2000;50(1):7-33.
16. Kaarbo M, Klokk TI, Saatcioglu F. Androgen signaling and its interactions with
other signaling pathways in prostate cancer. Bioessays. 2007;29(12):1227-1238.
17. Evans MJ, Smith-Jones PM, Wongvipat J, Navarro V, Kim S, Bander NH, Larson
SM, Sawyers CL. Noninvasive measurement of androgen receptor signaling with
a positron-emitting radiopharmaceutical that targets prostate-specific membrane
antigen. Proc Natl Acad Sci U S A. 2011;108(23):9578-9582.
18. Cai C, Chen SY, Zheng Z, Omwancha J, Lin MF, Balk SP, Shemshedini L.
Androgen regulation of soluble guanylyl cyclasealpha1 mediates prostate cancer
cell proliferation. Oncogene. 2007;26(11):1606-1615.
19. Huggins C, Stevens RE, Jr., Hodges CV. Prostatic cancer. II. The effects of
castration on advanced carcinoma of the prostate gland. Arch. Surg. (Chicago, IL,
U. S.). 1941;43:209-223.
20. Denis LJ, Griffiths K. Endocrine treatment in prostate cancer. Semin Surg Oncol.
2000;18(1):52-74.
21. Chen M, Feuerstein MA, Levina E, Baghel PS, Carkner RD, Tanner MJ,
Shtutman M, Vacherot F, Terry S, de la Taille A, Buttyan R. Hedgehog/Gli
supports androgen signaling in androgen deprived and androgen independent
prostate cancer cells. Mol Cancer. 2010;9:89.
180 22. Visakorpi T, Hyytinen E, Koivisto P, Tanner M, Keinanen R, Palmberg C, Palotie
A, Tammela T, Isola J, Kallioniemi OP. In vivo amplification of the androgen
receptor gene and progression of human prostate cancer. Nat Genet.
1995;9(4):401-406.
23. Edwards J, Krishna NS, Grigor KM, Bartlett JM. Androgen receptor gene
amplification and protein expression in hormone refractory prostate cancer. Br J
Cancer. 2003;89(3):552-556.
24. Gregory CW, Johnson RT, Jr., Mohler JL, French FS, Wilson EM. Androgen
receptor stabilization in recurrent prostate cancer is associated with
hypersensitivity to low androgen. Cancer Res. 2001;61(7):2892-2898.
25. Palmberg C, Koivisto P, Kakkola L, Tammela TL, Kallioniemi OP, Visakorpi T.
Androgen receptor gene amplification at primary progression predicts response to
combined androgen blockade as second line therapy for advanced prostate cancer.
J Urol. 2000;164(6):1992-1995.
26. Taplin ME, Bubley GJ, Shuster TD, Frantz ME, Spooner AE, Ogata GK, Keer
HN, Balk SP. Mutation of the androgen-receptor gene in metastatic androgen-
independent prostate cancer. N Engl J Med. 1995;332(21):1393-1398.
27. Hu R, Isaacs WB, Luo J. A snapshot of the expression signature of androgen
receptor splicing variants and their distinctive transcriptional activities. Prostate.
2011;71(15):1656-1667.
28. Chan SC, Li Y, Dehm SM. Androgen receptor splice variants activate androgen
receptor target genes and support aberrant prostate cancer cell growth independent
181 of canonical androgen receptor nuclear localization signal. J Biol Chem.
2012;287(23):19736-19749.
29. Hu R, Lu C, Mostaghel EA, Yegnasubramanian S, Gurel M, Tannahill C,
Edwards J, Isaacs WB, Nelson PS, Bluemn E, Plymate SR, Luo J. Distinct
transcriptional programs mediated by the ligand-dependent full-length androgen
receptor and its splice variants in castration-resistant prostate cancer. Cancer Res.
2012;72(14):3457-3462.
30. Feldman BJ, Feldman D. The development of androgen-independent prostate
cancer. Nat Rev Cancer. 2001;1(1):34-45.
31. Nabhan C, Parsons B, Touloukian EZ, Stadler WM. Novel approaches and future
directions in castration-resistant prostate cancer. Ann Oncol. 2011;22(9):1948-
1957.
32. Heemers HV, Tindall DJ. Androgen receptor (AR) coregulators: a diversity of
functions converging on and regulating the AR transcriptional complex. Endocr
Rev. 2007;28(7):778-808.
33. Taylor BS, Schultz N, Hieronymus H, Gopalan A, Xiao Y, Carver BS, Arora VK,
Kaushik P, Cerami E, Reva B, Antipin Y, Mitsiades N, Landers T, Dolgalev I,
Major JE, Wilson M, Socci ND, Lash AE, Heguy A, Eastham JA, Scher HI,
Reuter VE, Scardino PT, Sander C, Sawyers CL, Gerald WL. Integrative genomic
profiling of human prostate cancer. Cancer Cell. 2010;18(1):11-22.
34. Gioeli D, Paschal BM. Post-translational modification of the androgen receptor.
Mol Cell Endocrinol. 2012;352(1-2):70-78.
182 35. Mahajan NP, Liu Y, Majumder S, Warren MR, Parker CE, Mohler JL, Earp HS,
Whang YE. Activated Cdc42-associated kinase Ack1 promotes prostate cancer
progression via androgen receptor tyrosine phosphorylation. Proc Natl Acad Sci
U S A. 2007;104(20):8438-8443.
36. Guo Z, Dai B, Jiang T, Xu K, Xie Y, Kim O, Nesheiwat I, Kong X, Melamed J,
Handratta VD, Njar VC, Brodie AM, Yu LR, Veenstra TD, Chen H, Qiu Y.
Regulation of androgen receptor activity by tyrosine phosphorylation. Cancer
Cell. 2006;10(4):309-319.
37. Kraus S, Gioeli D, Vomastek T, Gordon V, Weber MJ. Receptor for activated C
kinase 1 (RACK1) and Src regulate the tyrosine phosphorylation and function of
the androgen receptor. Cancer Res. 2006;66(22):11047-11054.
38. Hsu FN, Chen MC, Chiang MC, Lin E, Lee YT, Huang PH, Lee GS, Lin H.
Regulation of androgen receptor and prostate cancer growth by cyclin-dependent
kinase 5. J Biol Chem. 2011;286(38):33141-33149.
39. Montgomery RB, Mostaghel EA, Vessella R, Hess DL, Kalhorn TF, Higano CS,
True LD, Nelson PS. Maintenance of intratumoral androgens in metastatic
prostate cancer: a mechanism for castration-resistant tumor growth. Cancer Res.
2008;68(11):4447-4454.
40. Hofland J, van Weerden WM, Dits NF, Steenbergen J, van Leenders GJ, Jenster
G, Schroder FH, de Jong FH. Evidence of limited contributions for intratumoral
steroidogenesis in prostate cancer. Cancer Res. 2010;70(3):1256-1264.
183 41. Cai C, Wang H, Xu Y, Chen S, Balk SP. Reactivation of androgen receptor-
regulated TMPRSS2:ERG gene expression in castration-resistant prostate cancer.
Cancer Res. 2009;69(15):6027-6032.
42. Wang Q, Li W, Zhang Y, Yuan X, Xu K, Yu J, Chen Z, Beroukhim R, Wang H,
Lupien M, Wu T, Regan MM, Meyer CA, Carroll JS, Manrai AK, Janne OA,
Balk SP, Mehra R, Han B, Chinnaiyan AM, Rubin MA, True L, Fiorentino M,
Fiore C, Loda M, Kantoff PW, Liu XS, Brown M. Androgen receptor regulates a
distinct transcription program in androgen-independent prostate cancer. Cell.
2009;138(2):245-256.
43. Tomlins SA, Rhodes DR, Perner S, Dhanasekaran SM, Mehra R, Sun XW,
Varambally S, Cao X, Tchinda J, Kuefer R, Lee C, Montie JE, Shah RB, Pienta
KJ, Rubin MA, Chinnaiyan AM. Recurrent fusion of TMPRSS2 and ETS
transcription factor genes in prostate cancer. Science. 2005;310(5748):644-648.
44. Tomlins SA, Laxman B, Varambally S, Cao X, Yu J, Helgeson BE, Cao Q,
Prensner JR, Rubin MA, Shah RB, Mehra R, Chinnaiyan AM. Role of the
TMPRSS2-ERG gene fusion in prostate cancer. Neoplasia. 2008;10(2):177-188.
45. Yu J, Yu J, Mani RS, Cao Q, Brenner CJ, Cao X, Wang X, Wu L, Li J, Hu M,
Gong Y, Cheng H, Laxman B, Vellaichamy A, Shankar S, Li Y, Dhanasekaran
SM, Morey R, Barrette T, Lonigro RJ, Tomlins SA, Varambally S, Qin ZS,
Chinnaiyan AM. An integrated network of androgen receptor, polycomb, and
TMPRSS2-ERG gene fusions in prostate cancer progression. Cancer Cell.
2010;17(5):443-454.
46. Isaacs JT. Role of androgens in prostatic cancer. Vitam Horm. 1994;49:433-502.
184 47. Krumenacker JS, Hanafy KA, Murad F. Regulation of nitric oxide and soluble
guanylyl cyclase. Brain Res Bull. 2004;62(6):505-515.
48. Sinnaeve P, Chiche JD, Nong Z, Varenne O, Van Pelt N, Gillijns H, Collen D,
Bloch KD, Janssens S. Soluble guanylate cyclase alpha(1) and beta(1) gene
transfer increases NO responsiveness and reduces neointima formation after
balloon injury in rats via antiproliferative and antimigratory effects. Circ Res.
2001;88(1):103-109.
49. Garthwaite G, Bartus K, Malcolm D, Goodwin D, Kollb-Sielecka M, Dooldeniya
C, Garthwaite J. Signaling from blood vessels to CNS axons through nitric oxide.
J Neurosci. 2006;26(29):7730-7740.
50. Cai C, Hsieh CL, Gao S, Kannan A, Bhansali M, Govardhan K, Dutta R,
Shemshedini L. Soluble guanylyl cyclase alpha1 and p53 cytoplasmic
sequestration and down-regulation in prostate cancer. Mol Endocrinol.
2012;26(2):292-307.
51. Gao S, Hsieh CL, Bhansali M, Kannan A, Shemshedini L. A peptide against
soluble guanylyl cyclase alpha1: a new approach to treating prostate cancer. PLoS
One. 2013;8(5):e64189.
52. Levine AJ, Momand J, Finlay CA. The p53 tumour suppressor gene. Nature.
1991;351(6326):453-456.
53. Finlay CA, Hinds PW, Levine AJ. The p53 proto-oncogene can act as a
suppressor of transformation. Cell. 1989;57(7):1083-1093.
185 54. Donehower LA, Harvey M, Slagle BL, McArthur MJ, Montgomery CA, Jr., Butel
JS, Bradley A. Mice deficient for p53 are developmentally normal but susceptible
to spontaneous tumours. Nature. 1992;356(6366):215-221.
55. Hollstein M, Shomer B, Greenblatt M, Soussi T, Hovig E, Montesano R, Harris
CC. Somatic point mutations in the p53 gene of human tumors and cell lines:
updated compilation. Nucleic Acids Res. 1996;24(1):141-146.
56. Hollstein M, Hergenhahn M, Yang Q, Bartsch H, Wang ZQ, Hainaut P. New
approaches to understanding p53 gene tumor mutation spectra. Mutat Res.
1999;431(2):199-209.
57. Vousden KH, Lu X. Live or let die: the cell's response to p53. Nat Rev Cancer.
2002;2(8):594-604.
58. Vinall RL, Chen JQ, Hubbard NE, Sulaimon SS, Shen MM, Devere White RW,
Borowsky AD. Initiation of prostate cancer in mice by Tp53R270H: evidence for
an alternative molecular progression. Dis Model Mech. 2012;5(6):914-920.
59. Chen Z, Trotman LC, Shaffer D, Lin HK, Dotan ZA, Niki M, Koutcher JA, Scher
HI, Ludwig T, Gerald W, Cordon-Cardo C, Pandolfi PP. Crucial role of p53-
dependent cellular senescence in suppression of Pten-deficient tumorigenesis.
Nature. 2005;436(7051):725-730.
60. Sionov RV, Haupt Y. The cellular response to p53: the decision between life and
death. Oncogene. 1999;18(45):6145-6157.
61. Prives C, Hall PA. The p53 pathway. J Pathol. 1999;187(1):112-126.
62. El-Deiry WS. The role of p53 in chemosensitivity and radiosensitivity. Oncogene.
2003;22(47):7486-7495.
186 63. Lacroix M, Toillon RA, Leclercq G. p53 and breast cancer, an update. Endocr
Relat Cancer. 2006;13(2):293-325.
64. Kubbutat MH, Jones SN, Vousden KH. Regulation of p53 stability by Mdm2.
Nature. 1997;387(6630):299-303.
65. Rodriguez MS, Desterro JM, Lain S, Lane DP, Hay RT. Multiple C-terminal
lysine residues target p53 for ubiquitin-proteasome-mediated degradation. Mol
Cell Biol. 2000;20(22):8458-8467.
66. Dornan D, Bheddah S, Newton K, Ince W, Frantz GD, Dowd P, Koeppen H,
Dixit VM, French DM. COP1, the negative regulator of p53, is overexpressed in
breast and ovarian adenocarcinomas. Cancer Res. 2004;64(20):7226-7230.
67. Leng RP, Lin Y, Ma W, Wu H, Lemmers B, Chung S, Parant JM, Lozano G,
Hakem R, Benchimol S. Pirh2, a p53-induced ubiquitin-protein ligase, promotes
p53 degradation. Cell. 2003;112(6):779-791.
68. Wei N, Deng XW. Making sense of the COP9 signalosome. A regulatory protein
complex conserved from Arabidopsis to human. Trends Genet. 1999;15(3):98-
103.
69. Wei N, Deng XW. The COP9 signalosome. Annu Rev Cell Dev Biol.
2003;19:261-286.
70. Schwechheimer C, Isono E. The COP9 signalosome and its role in plant
development. Eur J Cell Biol. 2010;89(2-3):157-162.
71. Lykke-Andersen K, Schaefer L, Menon S, Deng XW, Miller JB, Wei N.
Disruption of the COP9 signalosome Csn2 subunit in mice causes deficient cell
187 proliferation, accumulation of p53 and cyclin E, and early embryonic death. Mol
Cell Biol. 2003;23(19):6790-6797.
72. Menon S, Chi H, Zhang H, Deng XW, Flavell RA, Wei N. COP9 signalosome
subunit 8 is essential for peripheral T cell homeostasis and antigen receptor-
induced entry into the cell cycle from quiescence. Nat Immunol.
2007;8(11):1236-1245.
73. Tomoda K, Yoneda-Kato N, Fukumoto A, Yamanaka S, Kato JY. Multiple
functions of Jab1 are required for early embryonic development and growth
potential in mice. J Biol Chem. 2004;279(41):43013-43018.
74. Hofmann K, Bucher P. The PCI domain: a common theme in three multiprotein
complexes. Trends Biochem Sci. 1998;23(6):204-205.
75. Schwechheimer C, Serino G, Callis J, Crosby WL, Lyapina S, Deshaies RJ, Gray
WM, Estelle M, Deng XW. Interactions of the COP9 signalosome with the E3
ubiquitin ligase SCFTIRI in mediating auxin response. Science.
2001;292(5520):1379-1382.
76. Claret FX, Hibi M, Dhut S, Toda T, Karin M. A new group of conserved
coactivators that increase the specificity of AP-1 transcription factors. Nature.
1996;383(6599):453-457.
77. Bech-Otschir D, Kraft R, Huang X, Henklein P, Kapelari B, Pollmann C, Dubiel
W. COP9 signalosome-specific phosphorylation targets p53 to degradation by the
ubiquitin system. EMBO J. 2001;20(7):1630-1639.
188 78. Bech-Otschir D, Seeger M, Dubiel W. The COP9 signalosome: at the interface
between signal transduction and ubiquitin-dependent proteolysis. J Cell Sci.
2002;115(Pt 3):467-473.
79. Cope GA, Deshaies RJ. COP9 signalosome: a multifunctional regulator of SCF
and other cullin-based ubiquitin ligases. Cell. 2003;114(6):663-671.
80. Richardson KS, Zundel W. The emerging role of the COP9 signalosome in
cancer. Mol Cancer Res. 2005;3(12):645-653.
81. Zhao R, Yeung SC, Chen J, Iwakuma T, Su CH, Chen B, Qu C, Zhang F, Chen
YT, Lin YL, Lee DF, Jin F, Zhu R, Shaikenov T, Sarbassov D, Sahin A, Wang H,
Wang H, Lai CC, Tsai FJ, Lozano G, Lee MH. Subunit 6 of the COP9
signalosome promotes tumorigenesis in mice through stabilization of MDM2 and
is upregulated in human cancers. J Clin Invest. 2011;121(3):851-865.
82. Tomoda K, Kubota Y, Kato J. Degradation of the cyclin-dependent-kinase
inhibitor p27Kip1 is instigated by Jab1. Nature. 1999;398(6723):160-165.
83. Cardozo T, Pagano M. The SCF ubiquitin ligase: insights into a molecular
machine. Nat Rev Mol Cell Biol. 2004;5(9):739-751.
84. Yeh ET, Gong L, Kamitani T. Ubiquitin-like proteins: new wines in new bottles.
Gene. 2000;248(1-2):1-14.
85. Duda DM, Borg LA, Scott DC, Hunt HW, Hammel M, Schulman BA. Structural
insights into NEDD8 activation of cullin-RING ligases: conformational control of
conjugation. Cell. 2008;134(6):995-1006.
189 86. Lyapina S, Cope G, Shevchenko A, Serino G, Tsuge T, Zhou C, Wolf DA, Wei
N, Shevchenko A, Deshaies RJ. Promotion of NEDD-CUL1 conjugate cleavage
by COP9 signalosome. Science. 2001;292(5520):1382-1385.
87. Choi HH, Gully C, Su CH, Velazquez-Torres G, Chou PC, Tseng C, Zhao R,
Phan L, Shaiken T, Chen J, Yeung SC, Lee MH. COP9 signalosome subunit 6
stabilizes COP1, which functions as an E3 ubiquitin ligase for 14-3-3sigma.
Oncogene. 2011;30(48):4791-4801.
88. Zhang XC, Chen J, Su CH, Yang HY, Lee MH. Roles for CSN5 in control of
p53/MDM2 activities. J Cell Biochem. 2008;103(4):1219-1230.
89. Schweitzer K, Bozko PM, Dubiel W, Naumann M. CSN controls NF-kappaB by
deubiquitinylation of IkappaBalpha. EMBO J. 2007;26(6):1532-1541.
90. Rhodes DR, Kalyana-Sundaram S, Mahavisno V, Varambally R, Yu J, Briggs
BB, Barrette TR, Anstet MJ, Kincead-Beal C, Kulkarni P, Varambally S, Ghosh
D, Chinnaiyan AM. Oncomine 3.0: genes, pathways, and networks in a collection
of 18,000 cancer gene expression profiles. Neoplasia. 2007;9(2):166-180.
91. Rhodes DR, Kalyana-Sundaram S, Mahavisno V, Barrette TR, Ghosh D,
Chinnaiyan AM. Mining for regulatory programs in the cancer transcriptome. Nat
Genet. 2005;37(6):579-583.
92. Rhodes DR, Yu J, Shanker K, Deshpande N, Varambally R, Ghosh D, Barrette T,
Pandey A, Chinnaiyan AM. ONCOMINE: a cancer microarray database and
integrated data-mining platform. Neoplasia. 2004;6(1):1-6.
190 93. Adler AS, Littlepage LE, Lin M, Kawahara TL, Wong DJ, Werb Z, Chang HY.
CSN5 isopeptidase activity links COP9 signalosome activation to breast cancer
progression. Cancer Res. 2008;68(2):506-515.
94. Denti S, Fernandez-Sanchez ME, Rogge L, Bianchi E. The COP9 signalosome
regulates Skp2 levels and proliferation of human cells. J Biol Chem.
2006;281(43):32188-32196.
95. Bashir T, Pagan JK, Busino L, Pagano M. Phosphorylation of Ser72 is
dispensable for Skp2 assembly into an active SCF ubiquitin ligase and its
subcellular localization. Cell Cycle. 2010;9(5):971-974.
96. Seeger M, Kraft R, Ferrell K, Bech-Otschir D, Dumdey R, Schade R, Gordon C,
Naumann M, Dubiel W. A novel protein complex involved in signal transduction
possessing similarities to 26S proteasome subunits. FASEB J. 1998;12(6):469-
478.
97. Wilson MP, Sun Y, Cao L, Majerus PW. Inositol 1,3,4-trisphosphate 5/6-kinase is
a protein kinase that phosphorylates the transcription factors c-Jun and ATF-2. J
Biol Chem. 2001;276(44):40998-41004.
98. Uhle S, Medalia O, Waldron R, Dumdey R, Henklein P, Bech-Otschir D, Huang
X, Berse M, Sperling J, Schade R, Dubiel W. Protein kinase CK2 and protein
kinase D are associated with the COP9 signalosome. EMBO J. 2003;22(6):1302-
1312.
99. Harari-Steinberg O, Chamovitz DA. The COP9 signalosome: mediating between
kinase signaling and protein degradation. Curr Protein Pept Sci. 2004;5(3):185-
189.
191 100. Henke W, Ferrell K, Bech-Otschir D, Seeger M, Schade R, Jungblut P, Naumann
M, Dubiel W. Comparison of human COP9 signalsome and 26S proteasome lid'.
Mol Biol Rep. 1999;26(1-2):29-34.
101. Kapelari B, Bech-Otschir D, Hegerl R, Schade R, Dumdey R, Dubiel W. Electron
microscopy and subunit-subunit interaction studies reveal a first architecture of
COP9 signalosome. J Mol Biol. 2000;300(5):1169-1178.
102. Granata A, Koo SJ, Haucke V, Schiavo G, Warner TT. CSN complex controls the
stability of selected synaptic proteins via a torsinA-dependent process. EMBO J.
2011;30(1):181-193.
103. Huang S, Yuan S, Dong M, Su J, Yu C, Shen Y, Xie X, Yu Y, Yu X, Chen S,
Zhang S, Pontarotti P, Xu A. The phylogenetic analysis of tetraspanins projects
the evolution of cell-cell interactions from unicellular to multicellular organisms.
Genomics. 2005;86(6):674-684.
104. Claas C, Wahl J, Orlicky DJ, Karaduman H, Schnolzer M, Kempf T, Zoller M.
The tetraspanin D6.1A and its molecular partners on rat carcinoma cells. Biochem
J. 2005;389(Pt 1):99-110.
105. Hemler ME. Tetraspanin proteins promote multiple cancer stages. Nat Rev
Cancer. 2014;14(1):49-60.
106. Stipp CS, Kolesnikova TV, Hemler ME. Functional domains in tetraspanin
proteins. Trends Biochem Sci. 2003;28(2):106-112.
107. Seigneuret M, Delaguillaumie A, Lagaudriere-Gesbert C, Conjeaud H. Structure
of the tetraspanin main extracellular domain. A partially conserved fold with a
structurally variable domain insertion. J Biol Chem. 2001;276(43):40055-40064.
192 108. Higginbottom A, Takahashi Y, Bolling L, Coonrod SA, White JM, Partridge LJ,
Monk PN. Structural requirements for the inhibitory action of the CD9 large
extracellular domain in sperm/oocyte binding and fusion. Biochem Biophys Res
Commun. 2003;311(1):208-214.
109. Kaji K, Oda S, Miyazaki S, Kudo A. Infertility of CD9-deficient mouse eggs is
reversed by mouse CD9, human CD9, or mouse CD81; polyadenylated mRNA
injection developed for molecular analysis of sperm-egg fusion. Dev Biol.
2002;247(2):327-334.
110. Gesierich S, Paret C, Hildebrand D, Weitz J, Zgraggen K, Schmitz-Winnenthal
FH, Horejsi V, Yoshie O, Herlyn D, Ashman LK, Zoller M. Colocalization of the
tetraspanins, CO-029 and CD151, with integrins in human pancreatic
adenocarcinoma: impact on cell motility. Clin Cancer Res. 2005;11(8):2840-
2852.
111. Boucheix C, Rubinstein E. Tetraspanins. Cell Mol Life Sci. 2001;58(9):1189-
1205.
112. Bradbury LE, Kansas GS, Levy S, Evans RL, Tedder TF. The CD19/CD21 signal
transducing complex of human B lymphocytes includes the target of
antiproliferative antibody-1 and Leu-13 molecules. J Immunol.
1992;149(9):2841-2850.
113. Todd SC, Lipps SG, Crisa L, Salomon DR, Tsoukas CD. CD81 expressed on
human thymocytes mediates integrin activation and interleukin 2-dependent
proliferation. J Exp Med. 1996;184(5):2055-2060.
193 114. Bradbury LE, Goldmacher VS, Tedder TF. The CD19 signal transduction
complex of B lymphocytes. Deletion of the CD19 cytoplasmic domain alters
signal transduction but not complex formation with TAPA-1 and Leu 13. J
Immunol. 1993;151(6):2915-2927.
115. Kolesnikova TV, Stipp CS, Rao RM, Lane WS, Luscinskas FW, Hemler ME.
EWI-2 modulates lymphocyte integrin alpha4beta1 functions. Blood.
2004;103(8):3013-3019.
116. Stipp CS, Kolesnikova TV, Hemler ME. EWI-2 is a major CD9 and CD81 partner
and member of a novel Ig protein subfamily. J Biol Chem. 2001;276(44):40545-
40554.
117. Tu L, Sun TT, Kreibich G. Specific heterodimer formation is a prerequisite for
uroplakins to exit from the endoplasmic reticulum. Mol Biol Cell.
2002;13(12):4221-4230.
118. Charrin S, Manie S, Oualid M, Billard M, Boucheix C, Rubinstein E. Differential
stability of tetraspanin/tetraspanin interactions: role of palmitoylation. FEBS Lett.
2002;516(1-3):139-144.
119. Yang X, Claas C, Kraeft SK, Chen LB, Wang Z, Kreidberg JA, Hemler ME.
Palmitoylation of tetraspanin proteins: modulation of CD151 lateral interactions,
subcellular distribution, and integrin-dependent cell morphology. Mol Biol Cell.
2002;13(3):767-781.
120. Yang X, Kovalenko OV, Tang W, Claas C, Stipp CS, Hemler ME. Palmitoylation
supports assembly and function of integrin-tetraspanin complexes. J Cell Biol.
2004;167(6):1231-1240.
194 121. Levy S, Shoham T. Protein-protein interactions in the tetraspanin web.
Physiology (Bethesda). 2005;20:218-224.
122. Waterhouse R, Ha C, Dveksler GS. Murine CD9 is the receptor for pregnancy-
specific glycoprotein 17. J Exp Med. 2002;195(2):277-282.
123. Pileri P, Uematsu Y, Campagnoli S, Galli G, Falugi F, Petracca R, Weiner AJ,
Houghton M, Rosa D, Grandi G, Abrignani S. Binding of hepatitis C virus to
CD81. Science. 1998;282(5390):938-941.
124. Lee D, Suh YL, Park TI, Do IG, Seol HJ, Nam DH, Kim ST. Prognostic
significance of tetraspanin CD151 in newly diagnosed glioblastomas. J Surg
Oncol. 2013;107(6):646-652.
125. Minner S, De Silva C, Rink M, Dahlem R, Chun F, Fisch M, Hoppner W, Wagner
W, Bokemeyer C, Terracciano L, Simon R, Sauter G, Wilczak W. Reduced
CD151 expression is related to advanced tumour stage in urothelial bladder
cancer. Pathology. 2012;44(5):448-452.
126. Sadej R, Romanska H, Baldwin G, Gkirtzimanaki K, Novitskaya V, Filer AD,
Krcova Z, Kusinska R, Ehrmann J, Buckley CD, Kordek R, Potemski P,
Eliopoulos AG, Lalani el N, Berditchevski F. CD151 regulates tumorigenesis by
modulating the communication between tumor cells and endothelium. Mol Cancer
Res. 2009;7(6):787-798.
127. Deng X, Li Q, Hoff J, Novak M, Yang H, Jin H, Erfani SF, Sharma C, Zhou P,
Rabinovitz I, Sonnenberg A, Yi Y, Zhou P, Stipp CS, Kaetzel DM, Hemler ME,
Yang XH. Integrin-associated CD151 drives ErbB2-evoked mammary tumor
onset and metastasis. Neoplasia. 2012;14(8):678-689.
195 128. Sachs N, Secades P, van Hulst L, Song JY, Sonnenberg A. Reduced susceptibility
to two-stage skin carcinogenesis in mice with epidermis-specific deletion of
CD151. J Invest Dermatol. 2014;134(1):221-228.
129. Detchokul S, Newell B, Williams ED, Frauman AG. CD151 is associated with
prostate cancer cell invasion and lymphangiogenesis in vivo. Oncol Rep.
2014;31(1):241-247.
130. Miyake M, Nakano K, Ieki Y, Adachi M, Huang CL, Itoi S, Koh T, Taki T.
Motility related protein 1 (MRP-1/CD9) expression: inverse correlation with
metastases in breast cancer. Cancer Res. 1995;55(18):4127-4131.
131. Cajot JF, Sordat I, Silvestre T, Sordat B. Differential display cloning identifies
motility-related protein (MRP1/CD9) as highly expressed in primary compared to
metastatic human colon carcinoma cells. Cancer Res. 1997;57(13):2593-2597.
132. Takeda T, Hattori N, Tokuhara T, Nishimura Y, Yokoyama M, Miyake M.
Adenoviral transduction of MRP-1/CD9 and KAI1/CD82 inhibits lymph node
metastasis in orthotopic lung cancer model. Cancer Res. 2007;67(4):1744-1749.
133. Copeland BT, Bowman MJ, Boucheix C, Ashman LK. Knockout of the
tetraspanin Cd9 in the TRAMP model of de novo prostate cancer increases
spontaneous metastases in an organ-specific manner. Int J Cancer.
2013;133(8):1803-1812.
134. Fan J, Zhu GZ, Niles RM. Expression and function of CD9 in melanoma cells.
Mol Carcinog. 2010;49(1):85-93.
196 135. Takeda Y, Kazarov AR, Butterfield CE, Hopkins BD, Benjamin LE, Kaipainen
A, Hemler ME. Deletion of tetraspanin Cd151 results in decreased pathologic
angiogenesis in vivo and in vitro. Blood. 2007;109(4):1524-1532.
136. Zhou Z, Ran YL, Hu H, Pan J, Li ZF, Chen LZ, Sun LC, Peng L, Zhao XL, Yu L,
Sun LX, Yang ZH. TM4SF3 promotes esophageal carcinoma metastasis via
upregulating ADAM12m expression. Clin Exp Metastasis. 2008;25(5):537-548.
137. Berthier-Vergnes O, Kharbili ME, de la Fouchardiere A, Pointecouteau T,
Verrando P, Wierinckx A, Lachuer J, Le Naour F, Lamartine J. Gene expression
profiles of human melanoma cells with different invasive potential reveal
TSPAN8 as a novel mediator of invasion. Br J Cancer. 2011;104(1):155-165.
138. Gesierich S, Berezovskiy I, Ryschich E, Zoller M. Systemic induction of the
angiogenesis switch by the tetraspanin D6.1A/CO-029. Cancer Res.
2006;66(14):7083-7094.
139. Kanetaka K, Sakamoto M, Yamamoto Y, Yamasaki S, Lanza F, Kanematsu T,
Hirohashi S. Overexpression of tetraspanin CO-029 in hepatocellular carcinoma. J
Hepatol. 2001;35(5):637-642.
140. Bick RL. Coagulation abnormalities in malignancy: a review. Semin Thromb
Hemost. 1992;18(4):353-372.
141. Greco C, Bralet MP, Ailane N, Dubart-Kupperschmitt A, Rubinstein E, Le Naour
F, Boucheix C. E-cadherin/p120-catenin and tetraspanin Co-029 cooperate for
cell motility control in human colon carcinoma. Cancer Res. 2010;70(19):7674-
7683.
197 142. Benham AM. The protein disulfide isomerase family: key players in health and
disease. Antioxid Redox Signal. 2012;16(8):781-789.
143. Aberger F, Weidinger G, Grunz H, Richter K. Anterior specification of
embryonic ectoderm: the role of the Xenopus cement gland-specific gene XAG-2.
Mech Dev. 1998;72(1-2):115-130.
144. Kuang WW, Thompson DA, Hoch RV, Weigel RJ. Differential screening and
suppression subtractive hybridization identified genes differentially expressed in
an estrogen receptor-positive breast carcinoma cell line. Nucleic Acids Res.
1998;26(4):1116-1123.
145. Thompson DA, Weigel RJ. hAG-2, the human homologue of the Xenopus laevis
cement gland gene XAG-2, is coexpressed with estrogen receptor in breast cancer
cell lines. Biochem Biophys Res Commun. 1998;251(1):111-116.
146. Salmans ML, Zhao F, Andersen B. The estrogen-regulated anterior gradient 2
(AGR2) protein in breast cancer: a potential drug target and biomarker. Breast
Cancer Res. 2013;15(2):204.
147. Chevet E, Fessart D, Delom F, Mulot A, Vojtesek B, Hrstka R, Murray E, Gray T,
Hupp T. Emerging roles for the pro-oncogenic anterior gradient-2 in cancer
development. Oncogene. 2013;32(20):2499-2509.
148. Dubrovska A, Kim S, Salamone RJ, Walker JR, Maira SM, Garcia-Echeverria C,
Schultz PG, Reddy VA. The role of PTEN/Akt/PI3K signaling in the maintenance
and viability of prostate cancer stem-like cell populations. Proc Natl Acad Sci U S
A. 2009;106(1):268-273.
198 149. Liu P, Cheng H, Roberts TM, Zhao JJ. Targeting the phosphoinositide 3-kinase
pathway in cancer. Nat Rev Drug Discov. 2009;8(8):627-644.
150. Majumder PK, Sellers WR. Akt-regulated pathways in prostate cancer. Oncogene.
2005;24(50):7465-7474.
151. Courtney KD, Corcoran RB, Engelman JA. The PI3K pathway as drug target in
human cancer. J Clin Oncol. 2010;28(6):1075-1083.
152. Sarbassov DD, Guertin DA, Ali SM, Sabatini DM. Phosphorylation and
regulation of Akt/PKB by the rictor-mTOR complex. Science.
2005;307(5712):1098-1101.
153. Jung SJ, Kim CI, Park CH, Chang HS, Kim BH, Choi MS, Jung HR. Correlation
between Chemokine Receptor CXCR4 Expression and Prognostic Factors in
Patients with Prostate Cancer. Korean J Urol. 2011;52(9):607-611.
154. Salmena L, Carracedo A, Pandolfi PP. Tenets of PTEN tumor suppression. Cell.
2008;133(3):403-414.
155. Bitting RL, Armstrong AJ. Targeting the PI3K/Akt/mTOR pathway in castration-
resistant prostate cancer. Endocr Relat Cancer. 2013;20(3):R83-99.
156. Lim M, Chuong CM, Roy-Burman P. PI3K, Erk signaling in BMP7-induced
epithelial-mesenchymal transition (EMT) of PC-3 prostate cancer cells in 2- and
3-dimensional cultures. Horm Cancer. 2011;2(5):298-309.
157. Lepore I, Dell'Aversana C, Pilyugin M, Conte M, Nebbioso A, De Bellis F,
Tambaro FP, Izzo T, Garcia-Manero G, Ferrara F, Irminger-Finger I, Altucci L.
HDAC inhibitors repress BARD1 isoform expression in acute myeloid leukemia
cells via activation of miR-19a and/or b. PLoS One. 2013;8(12):e83018.
199 158. Henderson BR. Regulation of BRCA1, BRCA2 and BARD1 intracellular
trafficking. Bioessays. 2005;27(9):884-893.
159. Irminger-Finger I, Jefford CE. Is there more to BARD1 than BRCA1? Nat Rev
Cancer. 2006;6(5):382-391.
160. Brzovic PS, Meza JE, King MC, Klevit RE. BRCA1 RING domain cancer-
predisposing mutations. Structural consequences and effects on protein-protein
interactions. J Biol Chem. 2001;276(44):41399-41406.
161. Hashizume R, Fukuda M, Maeda I, Nishikawa H, Oyake D, Yabuki Y, Ogata H,
Ohta T. The RING heterodimer BRCA1-BARD1 is a ubiquitin ligase inactivated
by a breast cancer-derived mutation. J Biol Chem. 2001;276(18):14537-14540.
162. Eakin CM, Maccoss MJ, Finney GL, Klevit RE. Estrogen receptor alpha is a
putative substrate for the BRCA1 ubiquitin ligase. Proc Natl Acad Sci U S A.
2007;104(14):5794-5799.
163. Kotiguda GG, Weinberg D, Dessau M, Salvi C, Serino G, Chamovitz DA, Hirsch
JA. The organization of a CSN5-containing subcomplex of the COP9
signalosome. J Biol Chem. 2012;287(50):42031-42041.
164. Korenchuk S, Lehr JE, L MC, Lee YG, Whitney S, Vessella R, Lin DL, Pienta
KJ. VCaP, a cell-based model system of human prostate cancer. In Vivo.
2001;15(2):163-168.
165. Zhang JS, Gong A, Cheville JC, Smith DI, Young CY. AGR2, an androgen-
inducible secretory protein overexpressed in prostate cancer. Genes
Chromosomes Cancer. 2005;43(3):249-259.
200 166. Hong IK, Byun HJ, Lee J, Jin YJ, Wang SJ, Jeoung DI, Kim YM, Lee H. The
Tetraspanin CD81 Protein Increases Melanoma Cell Motility by Up-regulating
Metalloproteinase MT1-MMP Expression through the Pro-oncogenic Akt-
dependent Sp1 Activation Signaling Pathways. J Biol Chem.
2014;289(22):15691-15704.
167. Shukla S, Maclennan GT, Hartman DJ, Fu P, Resnick MI, Gupta S. Activation of
PI3K-Akt signaling pathway promotes prostate cancer cell invasion. Int J Cancer.
2007;121(7):1424-1432.
168. Hrstka R, Murray E, Brychtova V, Fabian P, Hupp TR, Vojtesek B. Identification
of an AKT-dependent signalling pathway that mediates tamoxifen-dependent
induction of the pro-metastatic protein anterior gradient-2. Cancer Lett.
2013;333(2):187-193.
169. Hemler ME. Tetraspanin functions and associated microdomains. Nat Rev Mol
Cell Biol. 2005;6(10):801-811.
170. Sharma C, Yang XH, Hemler ME. DHHC2 affects palmitoylation, stability, and
functions of tetraspanins CD9 and CD151. Mol Biol Cell. 2008;19(8):3415-3425.
171. Tran C, Ouk S, Clegg NJ, Chen Y, Watson PA, Arora V, Wongvipat J, Smith-
Jones PM, Yoo D, Kwon A, Wasielewska T, Welsbie D, Chen CD, Higano CS,
Beer TM, Hung DT, Scher HI, Jung ME, Sawyers CL. Development of a second-
generation antiandrogen for treatment of advanced prostate cancer. Science.
2009;324(5928):787-790.
201 172. Yuan X, Cai C, Chen S, Chen S, Yu Z, Balk SP. Androgen receptor functions in
castration-resistant prostate cancer and mechanisms of resistance to new agents
targeting the androgen axis. Oncogene. 2014;33(22):2815-2825.
173. Haupt S, Berger M, Goldberg Z, Haupt Y. Apoptosis - the p53 network. J Cell
Sci. 2003;116(Pt 20):4077-4085.
174. Marchetti A, Cecchinelli B, D'Angelo M, D'Orazi G, Crescenzi M, Sacchi A,
Soddu S. p53 can inhibit cell proliferation through caspase-mediated cleavage of
ERK2/MAPK. Cell Death Differ. 2004;11(6):596-607.
175. Svensson C, Ceder J, Iglesias-Gato D, Chuan YC, Pang ST, Bjartell A, Martinez
RM, Bott L, Helczynski L, Ulmert D, Wang Y, Niu Y, Collins C, Flores-Morales
A. REST mediates androgen receptor actions on gene repression and predicts
early recurrence of prostate cancer. Nucleic Acids Res. 2014;42(2):999-1015.
176. Hornberg E, Ylitalo EB, Crnalic S, Antti H, Stattin P, Widmark A, Bergh A,
Wikstrom P. Expression of androgen receptor splice variants in prostate cancer
bone metastases is associated with castration-resistance and short survival. PLoS
One. 2011;6(4):e19059.
177. Lineberry N, Su L, Soares L, Fathman CG. The single subunit transmembrane E3
ligase gene related to anergy in lymphocytes (GRAIL) captures and then
ubiquitinates transmembrane proteins across the cell membrane. J Biol Chem.
2008;283(42):28497-28505.
178. Chou YW, Zhang L, Muniyan S, Ahmad H, Kumar S, Alam SM, Lin MF.
Androgens upregulate Cdc25C protein by inhibiting its proteasomal and
lysosomal degradation pathways. PLoS One. 2013;8(4):e61934.
202 179. Bandyopadhyay S, Zhan R, Chaudhuri A, Watabe M, Pai SK, Hirota S, Hosobe S,
Tsukada T, Miura K, Takano Y, Saito K, Pauza ME, Hayashi S, Wang Y,
Mohinta S, Mashimo T, Iiizumi M, Furuta E, Watabe K. Interaction of KAI1 on
tumor cells with DARC on vascular endothelium leads to metastasis suppression.
Nat Med. 2006;12(8):933-938.
180. Yanez-Mo M, Barreiro O, Gordon-Alonso M, Sala-Valdes M, Sanchez-Madrid F.
Tetraspanin-enriched microdomains: a functional unit in cell plasma membranes.
Trends Cell Biol. 2009;19(9):434-446.
181. Sun Y, Wang BE, Leong KG, Yue P, Li L, Jhunjhunwala S, Chen D, Seo K,
Modrusan Z, Gao WQ, Settleman J, Johnson L. Androgen deprivation causes
epithelial-mesenchymal transition in the prostate: implications for androgen-
deprivation therapy. Cancer Res. 2012;72(2):527-536.
182. Li ZG, Mathew P, Yang J, Starbuck MW, Zurita AJ, Liu J, Sikes C, Multani AS,
Efstathiou E, Lopez A, Wang J, Fanning TV, Prieto VG, Kundra V, Vazquez ES,
Troncoso P, Raymond AK, Logothetis CJ, Lin SH, Maity S, Navone NM.
Androgen receptor-negative human prostate cancer cells induce osteogenesis in
mice through FGF9-mediated mechanisms. J Clin Invest. 2008;118(8):2697-2710.
183. Arnoys EJ, Wang JL. Dual localization: proteins in extracellular and intracellular
compartments. Acta Histochem. 2007;109(2):89-110.
184. Nakatsu F, Ohno H. Adaptor protein complexes as the key regulators of protein
sorting in the post-Golgi network. Cell Struct Funct. 2003;28(5):419-429.
185. Kwon J, Cho HJ, Han SH, No JG, Kwon JY, Kim H. A novel LZAP-binding
protein, NLBP, inhibits cell invasion. J Biol Chem. 2010;285(16):12232-12240.
203 186. Ivanova AV, Ivanov SV, Lerman ML. Association, mutual stabilization, and
transcriptional activity of the STRA13 and MSP58 proteins. Cell Mol Life Sci.
2005;62(4):471-484.
187. Snoek R, Cheng H, Margiotti K, Wafa LA, Wong CA, Wong EC, Fazli L, Nelson
CC, Gleave ME, Rennie PS. In vivo knockdown of the androgen receptor results
in growth inhibition and regression of well-established, castration-resistant
prostate tumors. Clin Cancer Res. 2009;15(1):39-47.
188. Grossmann ME, Huang H, Tindall DJ. Androgen receptor signaling in androgen-
refractory prostate cancer. J Natl Cancer Inst. 2001;93(22):1687-1697.
189. Asangani IA, Dommeti VL, Wang X, Malik R, Cieslik M, Yang R, Escara-Wilke
J, Wilder-Romans K, Dhanireddy S, Engelke C, Iyer MK, Jing X, Wu YM, Cao
X, Qin ZS, Wang S, Feng FY, Chinnaiyan AM. Therapeutic targeting of BET
bromodomain proteins in castration-resistant prostate cancer. Nature.
2014;510(7504):278-282.
204