Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

Tissue-specific disallowance of housekeeping genes:

the other face of cell differentiation

Lieven Thorrez1,2,4, Ilaria Laudadio3, Katrijn Van Deun4, Roel Quintens1,4, Nico Hendrickx1,4, Mikaela Granvik1,4, Katleen Lemaire1,4, Anica Schraenen1,4, Leentje Van Lommel1,4, Stefan Lehnert1,4, Cristina Aguayo-Mazzucato5, Rui Cheng-Xue6, Patrick Gilon6, Iven Van Mechelen4, Susan Bonner-Weir5, Frédéric Lemaigre3, and Frans Schuit1,4,$

1 Gene Expression Unit, Dept. Molecular Cell Biology, Katholieke Universiteit Leuven, 3000 Leuven, Belgium 2 ESAT-SCD, Department of Electrical Engineering, Katholieke Universiteit Leuven, 3000 Leuven, Belgium 3 Université Catholique de Louvain, de Duve Institute, 1200 Brussels, Belgium 4 Center for Computational Systems Biology, Katholieke Universiteit Leuven, 3000 Leuven, Belgium 5 Section of Islet Transplantation and Cell Biology, Joslin Diabetes Center, Harvard University, Boston, MA 02215, US 6 Unité d’Endocrinologie et Métabolisme, University of Louvain Faculty of Medicine, 1200 Brussels, Belgium

$ To whom correspondence should be addressed: Frans Schuit O&N1 Herestraat 49 - bus 901 3000 Leuven, Belgium Email: [email protected] Phone: +32 16 347227 , Fax: +32 16 345995

Running title: Disallowed genes Keywords: disallowance, tissue-specific, tissue maturation, gene expression, intersection-union test

Abbreviations: UTR UnTranslated Region H3K27me3 Histone H3 trimethylation at lysine 27 H3K4me3 Histone H3 trimethylation at lysine 4 H3K9ac Histone H3 acetylation at lysine 9 BMEL Bipotential Mouse Embryonic Liver

Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

Abstract

We report on a hitherto poorly characterized class of genes which are expressed in all tissues, except in one. Often, these genes have been classified as housekeeping genes, based on their nearly ubiquitous expression. However, the specific repression in one tissue defines a special class of “disallowed genes”. In this paper, we used the intersection-union test to screen for such genes in a multi-tissue panel of genome wide mRNA expression data. We propose that disallowed genes need to be repressed in the specific target tissue to ensure correct tissue function. We provide mechanistic data of repression with two metabolic examples, exercise- induced inappropriate insulin release and interference with ketogenesis in liver. Developmentally, this repression is established during tissue maturation in the early postnatal period involving epigenetic changes in histone methylation. In addition, tissue specific expression of microRNAs can further diminish these repressed mRNAs. Together, we provide a systematic analysis of tissue-specific repression of housekeeping genes, a phenomenon that has not been studied so far on a genome wide basis and when perturbed, can lead to human disease.

The microarray data have been submitted to Gene Expression Omnibus, with accession numbers

GSE24207 and GSE24940

Reviewer links: http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?token=htqtrgacsegoshg&acc=GSE24207 http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?token=jfezvgaqgmeckdy&acc=GSE24940

2 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

Introduction

Expression of housekeeping genes is generally believed to be required for the maintenance of general tasks that are common to all cells. For example, all living cells continuously need to produce sufficient ATP to stay alive. Most ATP is produced via oxidative phosphorylation in the mitochondrial inner membrane, a process requiring oxygen. When oxygen supply is low, such as during ischemia, cells can survive through ATP production via anaerobic glycolysis, which depends on lactate dehydrogenase (LDHA) (reducing pyruvate to lactate) and members of the monocarboxylic acid transporter (MCT) protein family to transport lactate and pyruvate across the plasma membrane. A remarkable exception is found in pancreatic insulin- producing beta cells in which glycolysis is exclusively aerobic (Schuit et al. 1997).

Biochemically, beta cells have vanishingly low expression levels of both the lactate/pyruvate transporter MCT1 (Zhao et al. 2001) and lactate dehydrogenases (Sekine et al. 1994; Schuit et al.

1997). Despite this tissue-specific repression, lactate dehydrogenase A (Ldha) for example appears in many published lists of housekeeping genes (Warrington et al. 2000; Hsiao et al. 2001;

Eisenberg and Levanon 2003; Tu et al. 2006). Inappropriate activation of a tissue-specifically repressed gene was previously demonstrated to be associated with human disease (Otonkoski et al. 2007). Gain-of-function mutation of the Mct1 promoter leads to uptake of lactate and pyruvate by the beta cells and disruption of correct glucose sensing. When large amounts of lactate and pyruvate are generated by muscles during physical exercise, insulin is secreted resulting in hypoglycemia and potential brain dysfunction (Otonkoski et al. 2003; Otonkoski et al. 2007).

In the present paper, we investigated whether tissue-specific repression of genes such as

Mct1 (= Slc16a1) and Ldha is a typical phenotypic trait of the differentiated beta cell or whether

3 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

this phenomenon can be extended to other tissues. Therefore, we assessed gene transcription in various differentiated tissues and integrated bioinformatic and statistical methods to identify these tissue-specifically repressed genes. Further, we investigated how this repression is established and when this occurs during tissue development. In this study, we show for the first time that a developmentally regulated process in pancreas and in liver involves the cell-selective inactivation of genes that are expressed everywhere else, a phenomenon we call “disallowance”.

4 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

Results

Identification of repressed genes

A multi-tissue mRNA expression panel was generated with Affymetrix MOE 430 2.0 microarrays and used to assess gene expression in 21 differentiated mouse tissues. In a first analysis we compared for each transcript its mRNA abundance in pancreatic islets versus each of the other tissues in the panel by t-tests. A sum score can then be calculated genewise by addition of the number of pairwise t-tests where expression in islets is significantly lower (-1) or higher

(+1) as compared to the other tissues. In addition to the expected existence of islet-specific genes

(significantly higher in islets than in each of the other tissues), we found evidence for genes of which expression was significantly lower in islets than in each of the other tissues, although they were less in number than the tissue-specific genes (Fig. 1A). This phenomenon was not restricted to islets but was also observed with other tissues, as illustrated by comparing liver (baseline) to the panel of other tissues (Fig. 1A). We next established a statistical framework to screen systematically for genes that are specifically lower in one tissue as compared to each of the others

(Fig. 1B). Both ANOVA and multiple comparison procedures (e.g. Dunnett or Bonferroni) are unsuitable because a significant result means that at least one pair of tissues differs significantly in expression, while we wanted evidence that expression in the baseline tissue is lower than in all other tissues. Therefore, we applied the intersection-union test (Berger 1982; Berger and Hsu

1996; Van Deun et al. 2009)(explained in greater detail in Methods). We did so for each of the

17,334 unique genes that are represented in the mRNA expression analysis and with each of the

21 tissues in turn acting as the baseline. This analysis largely confirmed the genes that were found repressed in pancreatic islets and liver in the sum score analysis (Fig. 1A), excluding the possibility that the outcome was an artifact of the filtering strategy. We used information from

5 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

redundant probe sets (present for >7750 genes) to reduce genes found repressed due to a probeset downstream of an alternative polyadenylation site. The distribution of the total number of 1074 repressed genes over the 21 mouse tissues is shown in Fig. 1C and a full list is provided in Table

S1. Testis accounts for about half of the genes that were selected as being tissue-specifically repressed. We performed a leave-one-out analysis, i.e. we assessed the effect of leaving one tissue out of the dataset on the extra number of genes found disallowed in the other tissues. Based on this, we generated a tissue association profile (Table S2). In rows, the baseline tissues are listed and columns are the tissues left out of the analysis. Omitting one tissue has the greatest effect on testis, which is not surprising as testis already represents the largest set of disallowed genes. A strong association is found between skeletal muscle and heart, which are functionally closely related as tissues composed mostly of striated muscle fibers and between components of the immune system (spleen and bone marrow). We tested this set of 1074 repressed genes for associations with cellular and molecular functions (Fig. 1D) and found significant enrichment for genes involved in processes determining tissue development and function.

Cross-platform validation

With the Affy MOE430 2.0 array, transcripts with a shorter 3’ UTR isoform or subject to alternative splicing might be falsely detected as disallowed (example in Fig. S1). For an independent confirmation, we performed a new analysis based on a different microarray platform for which we sampled new RNA from a mouse tissue panel. The Affymetrix GeneChip Mouse

Gene 1.0 ST Array has each gene represented by a median of 27 probes spread across the full length of the gene, providing a complementary view of gene expression to that generated with 3'- based expression array designs. As a result this array can more accurately detect the presence of transcripts even when alternative splicing or termination occurs. We examined a set of 13 tissues

6 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

(each n=3-5 replicates) on this platform. Since not all 21 tissues from the first analysis were represented, we could only test 900 out of 1074 repressed genes. Out of the 900, 560 (=62%) were also confirmed on this platform and genes passing this additional test were indicated in

Table S1. We based further studies only on genes which were found repressed on both platforms.

As an example, mRNA expression data on both platforms are shown for genes repressed in islets

(Fig. S2). When adding a second criterion for strong repression in the target tissue (at least 30- fold lower compared to the mean of the tissue panel), we identified 13 deeply repressed genes in

3 tissues (Table 1).

Next, we analysed the Novartis mouse GeneAtlas (which contains data from 91 tissues and cell lines in duplicate) with our method. This resulted in 280 genes that are repressed in one of 28 tissues (Table S3). Since the Novartis set has a small number of replications, the standard error on probeset signal is relatively high as compared to our dataset (Fig. S3). Also, the selection of tissues affects which genes are being found as disallowed (many samples are different parts of the same tissues or even time-series of the same cell type). For the few tissues that can be compared, a good overlap is observed. We find 6 genes repressed in liver for the Novartis set of which 3 (Oxct1, Lass5 and Slc15a36) appear in our set. When using MIN6 cells as a surrogate for islets, we still see 3 genes (out of 7 repressed in the Novartis set) in common (Ldha, Cat, Oat).

Interestingly, for testis, 71 out of 97 (=73%) genes found repressed in the Novartis set also appear in our analysis.

Disallowance in islets of Langerhans

One of the deeply repressed genes in islets of Langerhans is Mct1, encoding the monocarboxylate transporter MCT1 which mediates the transport of lactate and pyruvate across

7 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

cell membranes and is present in all tissues except adult beta cells (Otonkoski et al. 2007;

Quintens et al. 2008). Inadvertent expression of Mct1 in beta cells results in hypoglycemia after physical exercise due to inappropriate insulin release (Otonkoski et al. 2003). This example illustrates that loss of metabolic control can be caused by a failure of specific repression of a housekeeping gene in the beta cell. Therefore we propose to name these specifically repressed housekeeping genes “disallowed”. Besides Mct1, Ldha was the most strongly repressed gene in islets. LDHA catalyzes the conversion of lactate to pyruvate and repression in beta cells is an additional safeguard to ensure insulin release exclusively in response to glucose (Fig. 2B).

Cellular heterogeneity affects detection of disallowed genes

Because pancreatic islets are composed of several endocrine and non-endocrine cell types, the possibility exists that the data obtained from whole islets even underestimate the degree of repression in the beta cell. This was further investigated by comparing mRNA abundance of Mct1 in whole islets versus acinar cells and FACS-purified beta cells (>99% pure β-cells)(Fig. S4A,B).

Expression of Mct1 was determined by microarray (Fig. S4A) and Q-PCR (Fig. S4B). An even lower expression can be observed in purified beta cells versus whole islets. This indicates that for a number of repressed genes, a low-level expression may be due to contaminating cell types in which the gene is not repressed. This contamination is in the order of 1-5%, consistent with our observation that the expression of the acinar transcription factor Ptf1a in isolated islets is at 2% of expression in isolated acini (Fig. S4C).

Disallowance in liver

8 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

We further examined repression of 2-oxoacid CoA transferase mRNA (Oxct1) in mouse liver. The encoded protein is an enzyme that plays a key role in ketone body degradation which provides an alternative energy source to many tissues during fasting (Fig 2D). Disallowance in liver seems appropriate as this tissue is specialized in ketone production in the fasted state to support metabolism of other tissues (Cahill, Jr. and Veech 2003). In fact, the specific repression of Oxct1 in the mouse adult liver mirrors the expression of 3-hydroxy 3-methylglutaryl-CoA synthase 2 (Hmgcs2), which is required for ketogenesis and is highly expressed in adult liver, even in the fed state (Fig. 2C). Other enzymes necessary for ketogenesis (such as Acat1-3 and

Hmgcl) were also highly expressed in adult liver (data not shown).

Disallowance is established during tissue maturation

Next, we analyzed whether the tissue-specific disallowance of Mct1, Ldha and Oxct1 was linked to the development of islets and liver. As is shown in Fig. 3A, neonatal rat islets progressively induce expression of typical beta cell genes during the first month after birth. For instance, the expression of insulin (Ins2) as well as pyruvate carboxylase (Pc) rises five- to tenfold. In contrast, during neonatal beta cell maturation the mRNA expression of both Mct1 and

Ldha decreases progressively (Fig. 3B). Also the third deeply repressed gene in pancreatic islets , c-Maf, displays a similar neonatal time-dependent down regulation (Fig. S5A). The same time- course for establishing the tissue-specific repression is also observed in liver. In mouse embryonic and neonatal liver we observed a parallel pronounced upregulation of Hmgcs2 and progressive loss of expression of Oxct1 (Fig. 3C,D), again suggesting that during differentiation cell-specific genes are turned on while repressed housekeeping genes are turned off. The reduction of Hmgcs2 mRNA in rat liver after weaning (Fig. 3C) has been reported before in rodents (Serra et al. 1996).

9 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

Mechanisms for disallowance

Epigenetic mechanisms have been described to establish tissue-specific gene expression through chromatin modification and remodeling (Li 2002; Missaghian et al. 2009), and histone modifications are well known to be stably introduced during cellular differentiation (Li 2002; van

Arensbergen et al. 2010) and to profoundly alter the transcriptional activity of genes. Therefore we tested whether the differentiation-dependent repression of certain housekeeping genes is similarly dependent on changes in chromatin structure. Histone H3 trimethylation at lysine 27

(H3K27me3) is associated with dense packaging of the nucleosome and low transcriptional activity, while acetylation at lysine 9 (H3K9ac) is associated with loosely packaged DNA and enhanced transcriptional activity. To examine a relationship between nucleosome structure and tissue-specific repression, we tested H3K9ac and H3K27me3 of the Mct1 and Ldha promoter regions in chromatin from adult mouse islets and liver. As is shown in Figure 4(A,B), H3K27me3 content of chromatin associated with the Mct1 and Ldha genes was higher in islets than in liver.

For the Mct1 gene in islets we found a gradient of H3K27me3 along the length of the gene, with the highest level around the promoter (data not shown). In contrast, the signal for H3K9ac was significantly higher in liver than in islets for both genes. Therefore, the low Mct1 and Ldha mRNA levels in mature islets correlate to epigenetic silencing that is expected to be established when beta cells mature postnatally. Also c-Maf was associated with dense packaging

(H3K27me3) in pancreatic islets, in contrast to liver where an open nucleosome structure

(H3K9ac) was predominant (Fig. S5B). To gain insight in the temporal pattern of epigenetic modification, we examined histone modifications of immature pancreatic progenitors and ES cells versus mature islets, the MIN6 beta cell line and other mature tissues (Fig. S6). In immature pancreatic progenitors, no enrichment of H3K27me3 was detected for these genes. On the

10 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

contrary, in whole islets, beta cells and MIN6 cells, a clear H3K27me3 mark was detected.

Moreover, in ES cells either the inactivation mark was not present (Slc16a1 and Ldha) or a bivalent mark was observed (Maf) which serves to poise key developmental genes for lineage- specific activation or repression (Mikkelsen et al. 2007). This indicates a striking overlap between the acquired epigenetic inactivation in primary beta cells and our observation of disallowance in adult islets.

We next looked at the Oxct1 gene, which is repressed in the liver and highly expressed in many other tissues such as heart, kidney, muscles and brain (Fig. 2C). In line with the results found in islets, nucleosomal chromatin around the promoter of Oxct1 was more trimethylated and less acetylated in liver than in brain (Fig. 4C). In isolated livers from mice of age 1, 14 and 42 days we found that H3K27me3 histone modification of the Oxct1 promoter increases during the neonatal period, whereas H3K9ac initially follows the rise, reminiscent of bivalent genes, but then decreases again at day 42. These data further support the idea that histone modifications correlate with gene repression in the postnatal period when tissues mature. Together, these data show that epigenetic changes in chromatin structure are associated with the selective disallowance of housekeeping genes in specialized cell types.

Do other levels of control, besides epigenetic suppression, exist to induce disallowance? A possible mechanism could occur via microRNAs, short non-coding RNAs with widespread influence on mRNA stability and mRNA translation (Baek et al. 2008; Selbach et al. 2008). In line with this idea, the 3’ untranslated region (UTR) of mouse Oxct1 mRNA is a predicted target for miR-122 , which is specifically expressed in mouse liver and which is the most abundant liver microRNA species (Fig. S7)(Lagos-Quintana et al. 2002; Landgraf et al. 2007). During the course of mouse embryonic liver differentiation, miR-122 expression increased 12-fold between E15.5 and birth (Fig. 5A). In parallel, Oxct1 expression gradually decreased from E15.5 until 2 weeks

11 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

after birth (Fig. 3D). In order to assess whether the expression of miR-122 is responsible for repression of Oxct1 mRNA, we performed experiments with a bipotential mouse embryonic liver

(BMEL) cell line, which is derived from e14.5 hepatoblasts and can be differentiated to hepatocyte-like cells (Strick-Marchand et al. 2004). During differentiation of cultured BMEL cells, miR-122 expression increased 9-fold. Expression of miR-122 could be inhibited by the addition of miR-122 antagomir (Fig. 5B), which was specific since a mutated antagomir abolished the inhibition (Fig. 5B) and a nontarget microRNA (miR-20) was not affected by either antagomirs (data not shown). In differentiated BMEL cells, Oxct1 expression increased 1.6-fold by adding miR-122 antagomir, while the mutated control antagomir did not alter Oxct1 expression (Fig. 5B). To verify if miR-122 represses OXCT1 expression in vivo, we compared

RNA and protein levels in wild-type and transgenic mouse livers at E15.5. The transgenic embryos overexpressed miR-122 specifically in the liver under control of alpha-foetoprotein and albumin regulatory sequences (Laudadio et al. unpublished data). A 1.7 +/- 0.07 -fold overexpression of miR-122 (mean +/- SEM) was associated with repression of Oxct1 RNA and protein, as determined by Q-RT-PCR and western blotting (Fig. 5C). MiR-124 increases during differentiation of beta cells (Baroukh et al. 2007) and is highly expressed in MIN6 cells (Fig.

S8A) and mature islets (Fig. S8B). This microRNA has multiple predicted target sites on the

3’UTR of Mct1 which are conserved among human, rat, mouse, dog and chicken.

Downregulation of Mct1 by miR-124a has been experimentally validated by overexpression experiments (Lim et al. 2005; Wang and Wang 2006). In addition, other microRNAs abundant in islets (eg miR-27b, miR-29a) are also predicted to recognize the Mct1 3’UTR. This indicates that also for Mct1 an additional layer of posttranscriptional control is present to ensure an appropriate repression in islets. More generally, if repressed genes are downregulated by microRNAs, we expect to find binding sites for microRNAs in the 3’UTR of these genes. We would then expect

12 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

these binding sites to correspond to microRNAs which are abundant in the specific tissue.

Therefore, we checked for overrepresentation of tissue-specific microRNA binding sites in the 3’

UTRs of the repressed genes for the particular tissue (where such info was available). For several tissues, we found such strong overrepresentation (Table 2), indicating that at least a subset of the repressed genes can be downregulated by tissue-specific and abundant microRNAs.

Evolutionary conservation

We verified the expression of the most strongly repressed mouse genes in human tissue microarrays. A dataset was used encompassing 17 human tissues equivalent to the murine tissues.

Of the genes we find deeply repressed in liver and testis (islets are not present in the human set),

6 (out of 10) had the lowest expression in the same human tissue as the murine tissue in which it was found to be repressed (including Oxct1). Additionally, detection of protein by immunohistochemistry confirmed the absence of OXCT1 in human liver, and MCT1 and LDHA in human pancreatic islets (Human Protein Atlas -MCT1 2010; Human Protein Atlas -LDHA

2010; Human Protein Atlas -OXCT1 2010). In GEO, we did not find data from adult islets or pancreas in comparison to another tissues for species other than human and rodents. As for liver, data in pig and zebrafish (Fig. S9) illustrate that Oxct1 is also disallowed in the liver of these species. Taken together with a similar repression of Mct1 and Ldha in rat islets (Fig. 3B) these results suggest that tissue-specific repression of many of the genes identified in this study is evolutionary conserved.

13 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

Discussion

Unlike what is sometimes claimed, expression of housekeeping genes can widely differ among different tissues (Thorrez et al. 2008). In the present article, we propose that profound repression of certain housekeeping genes in specialized tissues is possible and necessary and that this repression is the opposite of expression of cell-specific genes. Traditionally, tissue function has mostly been investigated by studying genes with high tissue-specific expression; however we propose that the class of disallowed genes described in this paper provides additional important insights in tissue function. Tissue-specific gene repression is known to occur during development and requires the spatial and temporal organization of an interacting network of transcriptional repressors and activators. However, specific absence of one gene in a particular tissue has not been systematically studied so far.

By applying a custom statistical intersection-union test (Berger 1982; Berger and Hsu

1996; Van Deun et al. 2009) on a set of mouse tissue microarrays, we identified genes with significantly lower expression in one tissue versus all other (20) tissues. To avoid false-positives due to (3’ biased) microarray design, we used another microarray platform to confirm gene repression. Many of these genes are associated with tissue development and function. We show that his type of repression is conserved in several mammalian species such as mice, rats and human. A limitation of our screen is based on mRNA extracts from whole tissues that are composed of a number of different cell types. This mixed population may result in the situation that genes that are specifically repressed in a certain cell type are not detected in the screen because other cell types in the same tissue do express the gene(s) and thus mask the repression. If this phenomenon were re-examined at the level of primary differentiated cell types, a more extensive degree of repression may be found. The fact that we have underestimated the repression

14 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

of some of the islet genes is illustrated by the analysis of FACS-purified mouse beta cells which shows that the residual expression signal of disallowed genes in pancreatic islets derives from non-beta cells.

To demonstrate the functional relevance of the specific repression, we further focused on a few examples of disallowed genes related to metabolism in two different tissues. In pancreatic islets, lactate dehydrogenase (Ldha) and the lactate/pyruvate transporter Mct1 are disallowed since the inadvertent uptake of lactate or pyruvate would interfere with the glucose sensing by the beta cells. In liver, the key enzyme for ketone body utilization (Oxct1) is strongly repressed since the liver needs to synthesize and export ketone bodies which serve as an alternative energy source during starvation. A known example of a human disease illustrates that ignoring this disallowance can destroy specific tissue function (Otonkoski et al. 2007). However, association of disallowed genes with (human) disease is challenging since redundant mechanisms may be in use to protect the cell against inadvertent disallowed gene expression and because a clinical phenotype may only be observed in certain stress conditions. Indeed, exercise-induced hypoglycemia caused by the Mct1 promoter mutation only occurs during physical exercise and it is conceivable that Oxct1 mutations may only manifest in starvation conditions.

Other examples of disallowed genes outside the realm of metabolism likely exist. For instance in spleen, a lymphoid organ, ring finger protein 128 (Rnf128), also known as “gene related to anergy in lymphocytes” (GRAIL), is deeply repressed. Rnf128 encodes a ubiquitin ligase and is associated with T cell suppression (Kostianovsky et al. 2007; MacKenzie et al.

2007). Disallowance of Rnf128 in spleen and expression in other tissues may help to shape the balance in central and peripheral T-cell reactivity. In testis, Lpl (lipoprotein lipase) is repressed and a lack of LPL protein in Sertoli and Leydig cells has been described (Nielsen et al. 2010), which might be due to interference with a distinct function of LIPG, another (endothelial) lipase.

15 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

Another example in testis is Stag2, which is a component of cohesin complexes and is described to be mutually exclusive with other STAG proteins (STAG1 and STAG3)(Uniprot 2010).

STAG3, a subunit of the meiotic cohesin complex, is expressed specifically in testis (Pezzi et al.

2000), therefore it is not surprising to find Stag2 repressed in testis. Summarized, disallowed genes display the observed expression profile because presence of the gene product would interfere with correct tissue function. The physiological relevance of disallowance of individual tissue-specifically repressed genes might be explored further by transgenic mouse models.

In the pancreas, the beta cells expand rapidly in the first month of life (Bonner-Weir

2000) and only become truly functional in their response to glucose about weaning, when insulin release becomes controlled by oral food intake. Therefore, we might expect that establishment of pathways which mediate tissue-specific processes occurs at this time. Indeed, by means of Q-

PCR timeseries, we demonstrate that tissue-specific genes (such as insulin in the pancreatic islets and HMG CoA synthase 2 in liver) become highly upregulated in the late fetal/early postnatal period and reach mature expression levels at 1-1.5 months. In parallel, expression of the disallowed genes is shut down during this phase of tissue maturation and repression is subsequently maintained through adulthood.

Immature cells that are the direct precursors of the studied differentiated cells have not fully exercised the level of disallowance; therefore, specific elements that are induced during the developmental program are responsible for repression in the differentiated cell. Chromatin condensation and the resulting gene silencing plays a key role in differentiation. A hallmark for transcriptional silencing is trimethylation of lysine27 on histone H3 (H3K27me3), a process that is catalyzed by the methyl transferase activity of the Polycomb complex PCR2 (Vire et al. 2006;

Shen et al. 2008) and antagonized by the demethylases UTX and JMJD3 (Agger et al. 2007; Lee et al. 2007; De Santa F. et al. 2007; Lan et al. 2007). The group of tissue-specifically repressed

16 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

genes we present in this paper is expressed in embryonic stem cells and is distinct from the genes associated with polycomb complexes in embryonic stem (ES) cells (Boyer et al. 2006). Cell- specific combinations of transcription factors might activate the PCR2 complex specifically to repress expression of disallowed genes during tissue differentiation. We checked histone modifications at the promoter regions of Mct1, Ldha and Oxct1 and found them to be associated with H3K27me3 in the tissue where they are disallowed. Additionally, acetylation of histone H3 at lysine9 (H3K9ac), a mark of transcriptional activation, was found to be significantly lower around the promoter of these genes in the tissue of disallowance. Certain promoters in ES cells carry a bivalent mark, with large regions of H3K27me3 harboring smaller regions of H3 lysine 4 methylation (Bernstein et al. 2006). This mark serves to poise key developmental genes for lineage-specific activation or repression (Mikkelsen et al. 2007). Most promoters of the repressed genes in this paper were found to be negative for H3K27me3 in ES cells (Mikkelsen et al. 2007).

These data fit with our observations that the expression of the disallowed genes is turned off only during late fetal liver maturation and early postnatal islet maturation. Indeed, in immature pancreatic progenitors, no enrichment of H3K27me3 was detected for the genes we found deeply repressed in pancreatic islets. In addition, we observed an increase of H3K27me3 in the promoter of Oxct1 during postnatal liver development.

In a tissue in which transcription is low and mRNA is scarce, further repression by miRNAs could add additional control of disallowance. The most abundant microRNA in liver, miR-122 (Lagos-Quintana et al. 2002; Landgraf et al. 2007) is predicted to target Oxct1. We showed by Q-PCR that during the same time when Oxct1 is downregulated, miR-122 is upregulated. When miR-122 was inhibited by miR-122 antagomir, Oxct1 expression increased

1.6 fold. In a transgenic mouse model where miR-122 is overexpressed in liver, a similar decrease of Oxct1 mRNA and protein is observed at embryonic day E15.5. Although this is only

17 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

a modest effect, it is exactly what can be expected for the impact of a single microRNA (Baek et al. 2008; Selbach et al. 2008) and confirms that reduced protein output is mainly caused by destabilization of target mRNAs (Guo et al. 2010). This modest degree of repression may function as a secondary control level to further inhibit translation of mRNA that is strongly repressed by a first layer of epigenetic repression. When we generalized this analysis to other tissues, we found strong overrepresentation of tissue-specific microRNA binding sites in the 3’

UTRs of the genes repressed in that tissue, which indicates that tissue-specific microRNAs provide an additional level of control. We also investigated whether certain (tissue-specific) transcription factors might be responsible for downregulation of a subset of the repressed genes by network analysis and detection of common regulatory promoter elements, but could not find any evidence for such mechanism in any of the tissues.

Two papers previously reported on disallowance in islets (Quintens et al. 2008; Pullen et al.

2010), but the current paper is the first to analyse the phenomenon in a broad set of tissues and providing mechanistic insights. In summary, we propose that tissue-specific disallowance of housekeeping genes is required for the specialized function of differentiated tissues. Profound repression is maintained through a multi-tier mechanism comprising chromatin remodeling and microRNAs. We propose that this phenomenon has widespread consequences in cell biology and can lead to disease when disrupted.

18 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

Methods

Preparation of tissues and purified cells

All experiments based upon laboratory animals were approved by committees for animal welfare at the Katholieke Universiteit Leuven and Harvard University. Following tissues were hand dissected from 10-12 week old C57Bl6 mice: liver, gastrocnemius muscle, brain, heart, adrenal gland, eye, small intestine, thymus, epidydimal adipose tissue, pituitary gland, kidney, parotid gland, spleen, lung, bone marrow, testis, and seminal vesicles (males); ovary and placenta

(females). Fetal tissue was isolated at day 16. Tissues were rinsed in phosphate-buffered saline, frozen in liquid nitrogen and stored at -80ºC. Islets of Langerhans were isolated from the male and female adult (12 wk) mouse pancreata after injecting collagenase solution into the pancreatic duct. For adult rats, islets from one pancreas were used as a sample. For liver time series experiments, livers were isolated from CD1 mice, stored at 4°C overnight in RNAlater (Ambion) and then stored at -80°C. Mouse pure β-cells were purified from islets of RIPYY mice expressing

EYFP under the rat insulin promoter, i.e. specifically in β-cells (Quoix et al. 2007). Additional details on tissue preparation and RNA extraction in Supporting Information.

mRNA expression analysis via microarray

For the Affymetrix mouse MOE 430 2.0 arrays, two µg of total RNA was used to prepare biotinylated cRNA with IVT labeling kit (Affymetrix, Santa Clara, CA) according to the

Genechip expression analysis technical manual 701025 Rev.5, except for islets, adrenal gland and pituitary gland where 1 µg of total RNA was used. For the Affymetrix mouse Gene Arrays 1.0

ST, 100 ng total RNA was used according to manufacturer’s manual 701880Rev4 (Affymetrix,

Santa Clara, CA). The concentration of labeled cRNA was measured using the NanoDrop ND-

19 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

1000 spectrophotometer and quality was analyzed using the Agilent bioanalyzer 2100.

Fragmented cRNA was hybridized to the arrays during 16h at 45°C. The arrays were washed and stained in a fluidics station (Affymetrix) and scanned using the Affymetrix 3000 GeneScanner.

The MOE 430 2.0 (69 arrays) and Gene Array (40 arrays) sets consist of 21 and 13 different murine tissues respectively, with 3-5 replicates for each tissue. Quality controls of the arrays were according to manufacturer’s criteria. All CEL files were analyzed using GCOS (Affymetrix

GeneChip Operating Software) and the affy library (Gautier et al. 2004) of the BioConductor project (Gentleman et al. 2004). Data were processed with the Robust Multichip Average (RMA) algorithm with default parameters (RMA background correction, probe-level quantile normalization and average difference summarization). We independently applied the MAS5 algorithm using global scaling to 150. All data were log2 transformed for normalization and all further data analysis was performed on log2 transformed data. The data files are accessible through the NCBI Gene Expression Omnibus (GEO, http://www.ncbi.nlm.nih.gov/geo/) with accession numbers GSE24207 (430 2.0 arrays) and GSE24940 (1.0 ST gene arrays). For the human data, we selected 69 arrays from GSE7307, representing 17 human tissues (3-5 arrays/tissue) equivalent to the mouse tissues. Other GEO accession numbers of datasets used are:

GSE10246 (Novartis dataset), GSE10898 (pig) and GSE11107 (zebrafish).

Statistical analysis

To reduce multiple testing, we defined a core of 17334 probesets, each corresponding to a unique gene symbol, where only the probeset with the highest average expression was selected when multiple probesets were targeting the gene. To find those genes that are significantly repressed in a particular baseline tissue compared to each of the other 20 tissues, we initially used a sum score, which is the summation of the number of times the gene is more (+1), less (-1) or equally

20 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

(0) expressed in the baseline tissue versus the 20 other members in the tissue panel, using unpaired Student’s t-tests and P<0.001 as a threshold for significance. To control the type I error, we improved this test statistic by applying the testing procedure described by Berger (Berger

1982), also known as the intersection-union test (Berger and Hsu 1996). This tests the null hypothesis that at least one other tissue scores lower than or equal to the baseline against the alternative that expression in each of the other tissues is larger than in the baseline tissue (see

Supporting Information). When available, we used redundant probesets as an additional control by also requiring the redundant probesets to have the lowest expression in baseline tissue when not in background range. For significance testing in time course experiments, we used one-way

ANOVA with Dunnett post-hoc testing. *: p<0.05, **: p<0.01, ***: p<0.001. We also used contrasts to test for increasing or decreasing trends. The remaining comparisons were based on t- tests with the standard error from ANOVA. All statistical analysis was performed in SAS 9.2.

Bioinformatics

Benjamini Hochberg corrected p-values for associations with molecular and cellular functions were calculated with Ingenuity Pathway Analysis. Prediction of microRNA targets in 3’UTRs was based on context scoring (Grimson et al. 2007) performed with TargetScanMouse 5.0. We identified the most abundant microRNAs in various mouse tissues via a public microRNA expression database (Betel et al. 2008) or literature (Sood et al. 2006; Ro et al. 2007).

Overrepresentation of repressed genes in the target list was assessed with the hypergeometric test.

21 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

Chromatin immunoprecipitation

ChIP was performed according to a modified protocol of Upstate (Millipore) EZ-ChIP. Detailed method provided in Supporting Information. Precleared chromatin was incubated overnight at

4°C using rabbit anti-acetyl-histone H3 (Lys9), rabbit anti-trimethyl-histone H3 (Lys27) or normal rabbit IgG (Upstate). Antibody-chromatin complexes were collected by adding blocked protein A-TSK beads for 1 h at 4°C and washed. Immune complexes were eluted in 1% SDS,

0.1M NaHCO3 at room temperature. Samples were treated with RNase A and RNase T1

(Fermentas) for 30 min at 37°C and 0.6 U proteinase K (Fermentas) for 1 h 30 min at 45°C. DNA was purified using spin columns (Geneclean Turbo; Qbiogene) and eluted in 60 µl DNase-free water. ChIP samples were analyzed with probe-based quantitative PCR (Rotor-Gene 3000;

Corbett). PCRs were carried out in a 25 µl reaction volume containing ABsolute QPCR mix

(Abgene), 1.5 µl DNA, 300 nM or 900 nM forward and reverse primer and 50 nM dual-labeled fluorogenic probe. Primers and probes were obtained from Sigma-Aldrich. Amplification conditions: 15 min 95°C, 45 cycles of 20 s 95°C and 45 s 60°C. Enrichment of DNA was calculated using the equation: 2^(CtInput-CtAb), where Ct is mean threshold cycle of PCR done in triplicates. Input is 1% input sample and Ab is specific antibody or IgG sample.

Cell culture and antagomir treatment

BMEL cells were cultured as previously described (Plumb-Rudewiez et al. 2004) plus glutamine and hepatocyte-like differentiation was obtained by inducing the formation of floating aggregates of BMEL cells (Strick-Marchand et al. 2004). For miR-122 inhibition we used antagomirs

(Eurogentec). Antagomir sequences are in Supporting Information. BMEL cells cultured in aggregates were exposed to 10 µg/ml antagomirs and RNA was extracted after 3 days.

22 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

Western blot

Proteins were extracted from embryonic livers at E15.5 with TriPure reagent (Roche) according to the manufacturer’s protocol. For western blot analysis protein extracts were subjected to electrophoresis on 7.5% polyacrylamide gel (SDS-PAGE) and transferred onto a nitrocellulose

Hybond-C membrane (Amersham). The membrane was revealed with anti OXCT1 antibody

(ProteiTech Group) (1:1.000 dilution in TBS/0.1%Tween, 5% BSA), or anti-beta actin (Santa

Cruz, 1:1.000) overnight at 4°C. The membrane was incubated with HRP-anti-rabbit (Santa Cruz,

1:5.000) or HRP-anti-goat (Santa Cruz, 1:10.000) antibodies for 2h at room temperature. Signals were visualized by chemiluminescence. The OXCT1 signals were quantified using Scion Image software and normalized for the beta actin signals.

Reverse transcription and Q-PCR

Rat islets

Reverse transcription was done in 25 μL containing 500 ng total RNA, 5 μL superscript buffer,

0.1 M dithiothreitol (DTT), 50 ng random hexanucleotide primers, 10 mM dNTP, 200 units of

RNAsin, and 200 U Superscript II reverse transcriptase (Invitrogen), incubated for 10 minutes at

25°C, 50 minutes at 42°C and 15 minutes at 72°C. cDNA was diluted to 3 ng/μl in nuclease-free water and stored at -20°C. Q-RT-PCR was performed using the ABI7000 (Applied Biosystems,

Foster City, CA). Primers were synthesized by MWG-Biotech (High Point, NC) and specificity was confirmed by dissociation curve analysis. Reaction mix contained 10 μL SYBR green master mix (Applied Biosystems), 1 μL of each 5´ and 3´ oligonucleotides (10 pmol/μL) and 1 μL cDNA. Reaction conditions for PCR were 15 s at 95°C, 30 s at 55-58 °C (depending on the primers) and 30 s at 72 °C for 40 cycles. After normalization of the gene of interest to a control

23 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

gene (S25) the comparative CT (threshold cycle) method was used to calculate relative gene expression levels for the selected genes.

Mouse islets

Quantitative RT-PCR was performed as earlier described (Otonkoski et al. 2007). mRNA expression levels were normalized using polymerase II alpha (RNA Pol II).

Mouse liver

Reverse transcription on total RNA was performed in 10-25 μl containing 1X First Strand Buffer

(Invitrogen), 10 mM DTT, 200 U M-MLV reverse transcriptase (Invitrogen), 20-40 U RnaseOUT

(Invitrogen), 4 mM dNTPs (Amersham Pharmacia Biotech) and 200-400 ng of random hexamers

(Roche) for 10 min at room temperature and 2 h at 37 °C (mRNA) or 1 h at 37°C and 5min at

85°C (18S RNA). For miR-122, 50nM stem-loop RT primer

(CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACAAACAC) was used instead of random hexamers and incubation was 30 min at 16°C, 30 min at 42°C and 5 min at 85°C. QPCR was performed with SYBR Green Master Mix Reagent (Invitrogen) on a IQ cycler (Bio-Rad).

Oxct1 and Hmgcs2 were normalized to β-actin and miR-122 to 18S RNA.

Acknowledgments

This study was supported by research grants from the K.U.Leuven (GOA/2004/11,

GOA/2005/04, GOA/2009/10, and CoE EF/05/007), from the Fonds voor Wetenschappelijk

Onderzoek Vlaanderen (FWO grant G.0733.09N), from the Belgian Science Policy

24 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

(Interuniversity Attraction Poles Program (PAI 6/20 and 6/40), from the D.G. Higher Education and Scientific Research of the French Community of Belgium, by the Juvenile Diabetes Research

Foundation (JDRF grants 2006-182, 2007-685) and by the National Institutes of Health (NIH R01

DK 66056). PG is Research Director at the FNRS and IL holds a fellowship from Télévie

(Belgium). We acknowledge Joris Van Arensbergen for providing data used in Fig. S6 and

Sabine Cordi for technical assistance. The authors declare no conflict of interest.

25 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

Figure legends

Figure 1. Tissue-specific repression of housekeeping genes. A: Frequency distribution of the sum score for islets (green) and liver (brown) as baseline. Sum score numbers are calculated genewise and are the addition of the number of pairwise t-tests where expression in baseline is significantly lower (-1) or higher (+1) as compared to the other tissues. Liver- and islet-specific genes reside in the category with the highest possible sum score (right), whereas genes of which expression is specifically repressed in islets and liver are found in the category with the lowest possible sum score (left). B: Strategy to identify genes that are selectively repressed in one tissue, based on mRNA profiling of 21 mouse tissues. Expression of a gene in a baseline tissue was compared to expression of that gene in all other tissues. When significantly lower compared to all other tissues, this gene was termed repressed in that tissue. This procedure was applied to all genes and repeated for all tissues in the panel. Statistical testing methods are described in materials and methods. C: Pie-chart distribution of the number of specifically repressed genes in tissues. D: Significant associations of specifically repressed genes (in all tissues) with molecular and cellular functions. The Benjamini-Hochberg corrected P-value threshold of 0.05 is indicated by a dashed line.

Figure 2. Allowed and disallowed genes. A: Microarray expression profiles of pyruvate carboxylase (Pcx) versus lactate dehydrogenase A (Ldha) which are, respectively highly expressed and deeply repressed in adult mouse pancreatic beta cells. Mean mRNA expression signals ± SEM of 3 to 5 biological replicate microarray experiments. B: Glucose levels in the blood are measured by the beta cell through conversion of glucose to pyruvate which is further metabolized in the mitochondria for ATP generation and anaplerosis. Downstream signals lead to

26 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

insulin secretion. In many other cells, pyruvate does not necessarily come from glucose uptake.

Extracellular pyruvate can be directly taken up by monocarboxylate transporter 1 (Mct1) or lactate can be converted to pyruvate by Ldha. However, when this happens in beta cells, the glucose sensing mechanism is disrupted, leading to inappropriate insulin release (Otonkoski et al.

2007). C: Microarray expression profiles of 3-hydroxy 3-methylglutaryl-CoA synthase 2

(Hmgcs2) versus 2-oxoacid CoA transferase (Oxct1) which are, respectively highly expressed and deeply repressed in adult liver. Mean mRNA expression signals ± SEM of 3 to 5 biological replicate microarray experiments. D: In the fasted state, ketone bodies are generated in the liver.

The first and rate-limiting enzyme for ketogenesis is Hmgcs2. Ketone bodies are transported in the blood and can be used by many organs as an alternative energy source. Oxct1 plays a central role in extrahepatic ketone body catabolism by catalyzing the reversible transfer of coenzyme A from succinyl-CoA to acetoacetate.

Figure 3. Tissue-specific gene expression and repression of certain housekeeping genes during maturation of rat islets (A,B) and mouse liver (C,D). A: mRNA expression level in extracts from rat pancreatic islets from age 1 day (P1) to 4 weeks (P28) after birth measured by real-time Q-PCR; data were normalized for signal in islets of adult animals (10 weeks; dashed line). Maturation-dependent upregulation of genes that are important for beta cells, such as insulin 2 (Ins2) and pyruvate carboxylase (Pc) was observed during this period. B: In parallel we observed maturation-dependent repression of monocarboxylate transporter 1 (Mct1) and lactate dehydrogenase (Ldha), genes which are profoundly repressed in adult mouse islets (Table 1).

C,D: mRNA expression level in extracts from mouse fetal and neonatal liver between embryonic day E15.5 and 6 weeks after birth. A progressive upregulation (linear increasing trend P<0.001) of Hmgcs2 (C) mirrors a progressive loss (linear decreasing trend P<0.001) of expression of

27 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

Oxct1 (D). Data in panels A-D are means ± SEM of 3-4 individual experiments. Statistical significance of the difference between postnatal and adult expression signal was calculated by one-way ANOVA with Dunnett post-hoc test. *: P<0.05; **: P<0.01; ***: P<0.001.

Figure 4. Epigenetic mechanism for islet- and liver-specific silencing of repressed genes.

Histone H3 lysine9-acetylation (green bars) and lysine27-trimethylation (red bars) of chromatin around promoter region of repressed genes were compared in adult mouse tissues with and without observed repression. A, B: For Ldha and Mct1, a high level of H3 lysine27- trimethylation is seen in islets but not in liver, whereas H3 lysine9-acetylation is more extensive in the liver. This difference parallels differences between liver and islets for mRNA expression

(see also Fig. 2). C: Histone modifications during postnatal liver maturation (age 1, 14 and 42 days and adult). Histone H3 trimethylation in the Oxct1 promoter increases during liver development and is significantly higher in adult liver than in adult brain, while acetylation at the lysine9 residue is lower for all liver timepoints versus brain. D: Nucleosomes of the beta actin

(Actb) promoter which is active in all tissues, display a high level of histone H3 lysine9 acetylation and a low level of histone 3 lysine 27 trimethylation in islets, brain and liver. Black bars represent IgG immunoprecipitation control. Data are means ± SEM of 3-4 QPCRs.

Figure 5. MicroRNA 122 (miR-122) contributes to liver-specific silencing of Oxct1 expression. A: Time course of miR-122 expression in vivo during liver maturation as measured by Q-PCR. MiR-122 increases with a linear trend, P=0.01. Statistical significance of the difference between P42 and other time points was calculated by one-way ANOVA with Dunnett post-hoc test. B: Treatment of in vitro differentiated BMEL cells with antagomiR-122 (α-miR-

122) or a mutated antagomiR (α-miR-122 mut) control. Changes in miR-122 expression (left) and

28 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

Oxct1 expression (right) were measured by Q-PCR. MiR-122 expression decreases 6-fold by treatment with antagomiR-122 (α-miR-122). A mutated antagomiR (α-miR-122 mut) control did not significantly influence miR-122 expression. Oxct1 expression is increased by miR-122 knockdown with antagomiR-122, indicating that miR-122 inhibits Oxct1 expression. A mutated antagomiR did not significantly alter Oxct1 expression. Data are means ± SEM of 3 individual experiments. C: Oxct1 RNA and protein expression in livers at E15.5 of wild-type versus liver- specific miR-122 overexpressing transgenic mice. A 1.7 +/- 0.07 -fold overexpression of miR-

122 (mean +/- SEM; n = 4 (wild-type) and n = 6 (transgenic)) was associated with a significant (t- test P<0.05) repression of Oxct1 RNA and protein, as determined by Q-RT-PCR (n = 4 or 6 for wild-type or transgenic, respectively) and western blotting (n = 3). *: P<0.05; **: P<0.01; ***:

P<0.001.

Table legends

Table 1. Subset of 13 tissue-specifically repressed genes with fold change >30 versus tissue panel. Data show average mRNA expression signals of the 13 mouse genes that are selectively and most deeply repressed in one target tissue. The mean expression signal averaged over the other 20 tissues in the panel is at least 30 times higher than in the tissue in which the gene is repressed (data from MOE 430 2.0 arrays). Fold change was calculated based on linear scale data.

Table 2. Overrepresentation of repressed genes in predicted target gene sets of microRNAs most abundant in tissues. We used only those tissues for which we obtained information on the most abundant microRNAs and had >5 repressed genes on both microarray platforms (7 tissues).

29 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

For 5 of these tissues, we found a significant overrepresentation of repressed genes within the set of predicted target genes for the most abundant microRNAs. p-value was calculated with the hypergeometric test. MicroRNA specificity information was obtained via microrna.org or literature, as specified in the last column.

30 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

Supporting information: Figures and Tables

Figure S1. Repressed genes versus alternative use of 3’ UTR. By screening on the probeset level, data can indicate that a gene is repressed, whereas alternative termination may be the real cause. For example, we initially found Fscn1 repressed in bone marrow based on the expression data of probeset 1416514_a_at. However, when taking other probesets into account, it is clear that Fscn1 transcript is present in bone marrow (even slightly higher than the average in other tissues). This indicates that in bone marrow, transcription of Fscn1 terminates before the binding region of probeset 1416514_a_at (alternative termination site indicated by green vertical bar). In subsequent analysis, we took the information of redundant probesets into account in order to filter out this alternative termination effect. Binding region of the probesets is indicated on the gene structure scheme in a corresponding color.

Figure S2. Expression of 14 repressed genes in pancreatic islets of Langerhans, compared to average expression of these genes in all other tissues. Expression data are based on 69 MOE

430 2.0 arrays (dark) and 40 Gene Arrays 1.0ST (light). Bars represent expression

(average±SEM) in islets (blue) versus all other tissues (red).

Figure S3. Standard errors of signals for all probe sets. Frequency of genes with an average standard error (calculated over tissues) in a certain range of values for the Novartis set versus our own data. These are used in the test statistics as an offset for the difference between tissue averages and give an impression of the technical variation between replications corrected for

31 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

sample size. Clearly, for most genes the standard error is lower in our data than in the Novartis data with the result of larger t-statistics and thus more significant results for our data.

Figure S4. Cell population purity impacts detection of repressed genes. Expression of Mct1 was measured in whole islets, FACS purified beta cells and acini by microarray (A) and QPCR

(B). QPCR expression levels are shown relative to pancreatic acini. The highest expression is observed in acini. Expression in pure beta cells is even lower than in islets since inherent to the isolation procedure islets are slightly (1-5% of cells) contaminated with acini. Two tailed t-tests were used to determine differences between expression in beta cells versus islets or acini. To demonstrate contamination with acini, expression of the exocrine marker Ptf1a is shown (C).

While expression of this marker in purified beta cells is negligible, a signal at about 2% of expression in acini can be observed for the whole islet preparations.

Figure S5 A: Timecourse of c-Maf mRNA expression in pancreatic islets from neonatal rats (1-

28 days old) measured by real-time Q-PCR; data were normalized for signal in islets of adult animals (10 weeks; dashed line). C-Maf expression displays a linear decreasing trend (P<0.001).

Statistical significance of the difference between postnatal and adult expression signal was calculated by one-way ANOVA with Dunnett post-hoc test (***: P<0.001). B: Histone H3 lysine9-acetylation (green bars) and lysine27-trimethylation (red bars) of the promoter region of c-Maf in mouse liver and pancreatic islets. A high level of H3 lysine27-trimethylation is seen in islets but not in liver, whereas H3 lysine9-acetylation is more extensive in the liver. Black bars represent IgG immunoprecipitation control. Data are means ± SEM of 4 QPCRs.

32 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

Figure S6. Histone modification during islet development compared to other tissues.

Promoter regions of 3 genes deeply repressed in pancreatic islets (c-Maf, Ldha and Mct1) are shown with for several tissues or cell lines (indicated at the right) enrichment profiles of

H3K4me3 (activation marker) and H3K9me3 (silencing marker) (van Arensbergen et al. 2010).

H3K9me3 is largely absent in adult adipose tissue, liver and pancreatic progenitor cells and appears in islets, beta-cells and MIN6 cells.

Figure S7. miR-122 is a liver specific microRNA. A: Expression profile of miR-122 in different tissues shows its liver-specificity. B: miR-122 is the most abundant liver microRNA.

Expression values are relative to the most abundant microRNA. Data obtained from microRNA.org.

Figure S8. MicroRNAs abundant in islets target islet-repressed genes. A: Expression of the most abundant microRNAs in islets, relative to miR-124, data obtained from microRNA.org. high miR124 is due to expression of this miRNA in the MIN6 cell line. B: microRNA abundance in adult islets versus MIN6 cells as measured by Exiqon miR microarrays. The abundance of miR-

124 is compared to the expression of mir-375 which is islet-specific.

Figure S9. Disallowance of Oxct1 in pig and zebrafish. GEO datasets GSE10898 (pig) and

GSE11107 (zebrafish) were analysed and Oxct1 expression in the different samples is shown.

The pig dataset contains 16 tissue samples, each in 4 replicates. The zebrafish dataset contains only 2 tissues: brain and liver, each in control or starved condition, with for each sample type 4-5 replicates. Oxct1 is very low in liver as compared to brain (t-test: p<0.001).

33 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

Table S1. Full list of tissue-specifically repressed genes. This table contains all 1074 genes which were found to be repressed in one of the 21 tissues studied.

Table S2. Leave-one-out analysis. We assessed the effect of leaving one tissue out of the (MOE

430 2.0) dataset on the extra number of genes found disallowed in the other tissues and generated a tissue association profile. In rows, the baseline tissues are listed and columns are the tissues left out of the analysis. Each cell of the matrix is the extra number of genes that are found disallowed on top of the number already found disallowed in the analysis with all tissues. Association, reflected by a large number in the matrix (both for a tissue as baseline or when the tissue is left out), is indicated between heart and muscle (red), spleen and bone marrow (orange) and testis vs other tissues (yellow).

Table S3. Disallowed genes in public data. We applied our methodology to the GNF Mouse

GeneAtlas V3 CEL files (GEO GSE10246). The GNF set consists of 182 CEL files which represent 91 tissues and cell lines in duplicate. This resulted in 280 genes that are found repressed in one of 28 tissues (31% of all tissues). Many samples are different parts of the same tissues or even time-series of the same cell type: 9 different brain regions, 25 samples from different immune-related cell types, 8 samples from eye, 5 from bone, 2 from adipose tissue, 2 from intestine and 2 from muscle cells.

34 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

Supporting information: Methods

Preparation of tissues and purified cells

Digestion of mouse pancreata was 3 min at 37°C after which islets and acini were separated at 0°C by three rounds of sedimentation (1 x g) and handpicking under a dissection microscope. For rat islet isolation , P1, P7, P15, P21, P28 and adult 10 week old rats were anesthesized and their islets isolated by collagenase digestion with rodent Liberase RI (Roche, Indianapolis IN). Islets of 10 animals were pooled as one sample for both P1 and P7; those from 2-3 animals were pooled for one sample for P15, P21 and P28. Rat islets from all ages were handpicked under a stereomicroscope to ensure high purity of islet preparations. Single cells from islets of RIPYY mice were obtained by dispersing the islets with trypsin, and a population containing > 99% pure β-cells was obtained by sorting the cells with a Beckton Dickinson FACSVantage SE (USA) (excit: 488 nm; emission: 530; 50 µm nozzle; 45 psi, 81 KHz).

RNA extraction

Total RNA was extracted using TRIzol Reagent according to the manufacturer’s protocol

(Invitrogen, Carlsbad, CA), followed by a cleanup procedure with RNeasy columns (Qiagen,

Cologne, Germany). Total RNA from pituitary gland, adrenal gland and islets was extracted using the Absolutely RNA microprep from Stratagene (CA). RNA quantity and quality was determined using the NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, DW) and the 2100 Bioanalyzer (Agilent, Waldbronn, Germany), respectively. Total RNA profiles of all tested samples were similar with sharp 18S and 28S rRNA peaks on a flat baseline. Total RNA of rat islets was isolated using the picoRNA extraction kit from Arcturus or QIAGEN RNeasy Plus

Mini Kit depending on the quantity of islets.

35 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

Intersection-union test

According to this test, a gene is declared specifically repressed (with type I error at level α) in a baseline tissue if it holds that the null hypothesis of equal or higher expression in the baseline tissue can be rejected at level α for each of the 20 baseline tissue – other tissue pairs. The test statistic we used is the t-test as calculated within an ANOVA setting (which implies using the information of all 21 tissues for the calculation of the mean squared error) and we calculated this statistic on the log 2 transformed expression levels obtained after RMA pre-processing. To account for the fact that we perform Berger’s test 17344 times (once for each gene), we used

Sidak’s multiple comparison procedure. For an overall error rate (αEW) of .05 the procedure sets

1/17344 the significance level for each probeset at αCW=1-(1-(αEW ) , meaning that Berger’s procedure was performed for each gene at a significance level of 2.96e-06.

Antagomir treatment

The sequences of antagomir-122 (α-miR-122) and control antagomir (α-miR-122-mut) were: 5'- a*c*aaacaccauugucacacu*c*c*a*-Chol-3' and 5'-a*c*acacaacacugucacauu*c*c*a*-Chol-3', respectively. All the bases were 2' OMe modified; the star indicates phosphorothioate linkage; Chol represents 3’-TEG Cholesteryl.

Chromatin immunoprecipitation

ChIP was performed according to a modified protocol of Upstate (Millipore) EZ-ChIP. Tissue was cross-linked in 1% formaldehyde for 10 min at room temperature. The reaction was stopped by addition of glycine to a final concentration of 0.125 M and samples were washed once with cold PBS. Cell membranes were lysed by pestle homogenization and incubation for 15 min on ice in cell lysis buffer (5mM PIPES [pH 8.0], 85 mM KCl, 0.5% NP-40) supplemented with 1 mM

PMSF and protease inhibitors (Complete protease inhibitor cocktail; Roche). Nuclei were isolated

36 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

by centrifugation at 3000 x g for 5 min at 4°C and incubated on ice for 15 min in nuclei lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris-HCl, [pH 8.1], 1mM PMSF, protease inhibitors).

Isolated DNA was sheared by sonication for 20 cycles of 30 sec on/off at 200 W (Bioruptor;

Diagenode) to an average length of 200-500 bp and centrifuged at 20 000 x g for 30 min at 4°C.

DNA in supernatant was diluted 10-fold in dilution buffer. Chromatin was precleared for 1h at

4°C by addition of protein A-TSK (Affiland) beads blocked with salmon sperm DNA (1 mg/ml) and BSA (1 mg/ml). 1% of total input (10 µl of precleared chromatin) was set aside at 4°C until elution. Precleared chromatin (5 µg DNA per ml) was incubated overnight at 4°C using 2 µg of rabbit anti-acetyl-histone H3 (Lys9), rabbit anti-trimethyl-histone H3 (Lys27) or normal rabbit

IgG (all antibodies purchased from Upstate). Antibody-chromatin complexes were collected by adding blocked protein A-TSK beads for 1 h at 4°C and washed sequentially in low-salt buffer, high-salt buffer, LiCl buffer and twice in TE buffer. Immune complexes were eluted 2 times for

15 min in 100 µl 1% SDS, 0.1M NaHCO3 at room temperature and cross-links were reversed by overnight incubation at 65°C with 200 mM NaCl. Samples were treated with 10 U RNase A and

5 U RNase T1 (RNase A/T1 mix; Fermentas) for 30 min at 37°C and 0.6 U proteinase K

(Fermentas) for 1 h 30 min at 45°C. DNA was purified using spin columns (Geneclean Turbo;

Qbiogene) and eluted in 60 µl DNase-free water. For assays involving islets samples (Mct1,

Ldha), input was 5 µl of precleared chromatin, 650 ng DNA was incubated in 500 µl and 1 µg antibody was used and elution was in 30 µl DNase-free water.

Q-PCR primers

Rat islets

Forward primer Reverse primer S25 GTGGTCCACACTACTCTCTGAGTTTC GACTTTCCGGCATCCTTCTTC Ins2 TCTTCTACACACCCATGTCCC GGTGCAGCACTGATCCAC Pc TTGAAGGATGTGAAGGGCC ACCTTTCGGATAGTGCCCTC

37 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

Ldha AGACTTGGCCGAGAGCATAATG ATAGAGACCCTTAATCATGGTGGAA Mct1 AGTGCAACGACCAGTGAAGTGT AGGACCTCCGGCATACATGA

Mouse islets

RNA Pol II FW GCACCACGTCCAATGATATTGTG Rev GGAGATGACATGGTACAGTTCTCG Probe (6-Fam)CTTCCGCACAGCCTCAATGCCCAGT(Tamra) Mct1 FW GCTTGGTGACCATTGTGGAATG Rev CCCAGTACGTGTATTTGTAGTCTCC Probe (6-Fam)CCCTGTCCTCCTAGGGCCACCACT(Tamra)

Mouse liver

Forward primer Reverse primer Oxct1 GAGCCATGCAGGTTTCTAAGTATG GCTCCTCCCATTCCTTTCAC Hmgcs2 TGGTGGATGGGAAGCTGTCTA TTCTTGCGGTAGGCTGCATAG Actb TCCTGAGCGCAAGTACTCTGT CTGATCCACATCTGCTGGAAG miR-122 ACACTCCAGCTGGGTAACACTGTCT CTCAACTGGTGTCGTGGAGTCGGCA GGTAA ATTCAGTTGAGCTACCTGC 18S GGCGCCCCCTCGATGCTCTTAG GCTCGGGCCTGCTTTGAACACTCT

ChIP Primers/probes:

Amplicon Gene location Oligonucleotide sequence (5' to 3') Mct1 -324 to -233 TTTCTCCTCCAGAGCCTGA ACATCCTTATCAGCGCTCTGA (6-FAM)GGACGCCATCGTGGGCCTCA(Tamra) Ldha -109 to -39 CCAGCCTACACGTGGGTT TTAAATGGAAGCTCCGCGCT (6-FAM)TCCGCTGGGCTCCCACTCTGA(Tamra) Actb +29 to +134 CTTCTTTGCAGCTCCTTCGTTG CCCTGCAGTGAGGTACTAGC (6-FAM)CCACACCCGCCACCAGGTAAGCAG(Tamra) Oxct1 -121 to -2 TCTCGCTTCTTGACAAGCCA AAGAGAGAAGGCAAGGCGA (6-FAM)ACCGCTCTGAGGTCCCGAGGAC(Tamra) c-Maf -133 to -7 GTG TGC ACG TTC GAG CTT TC CAG ATG GGC TGC AGG AGA (6-FAM)CCG CTG GCC ACC CAG CAC AG(Tamra)

38 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

Reference List

1. Agger, K., Cloos, P.A., Christensen, J., Pasini, D., Rose, S., Rappsilber, J., Issaeva, I., Canaani, E., Salcini, A.E., and Helin, K. 2007. UTX and JMJD3 are histone H3K27 demethylases involved in HOX gene regulation and development. Nature 449:731-734

2. Baek, D., Villen, J., Shin, C., Camargo, F.D., Gygi, S.P., and Bartel, D.P. 2008. The impact of microRNAs on protein output. Nature 455:64-71

3. Baroukh, N., Ravier, M.A., Loder, M.K., Hill, E.V., Bounacer, A., Scharfmann, R., Rutter, G.A., and Van, O.E. 2007. MicroRNA-124a regulates Foxa2 expression and intracellular signaling in pancreatic beta-cell lines. J Biol Chem 282:19575-19588

4. Berger, R.L. 1982. Multi-Parameter Hypothesis-Testing and Acceptance Sampling. Technometrics 24:295-300

5. Berger, R.L. and Hsu, J.C. 1996. Bioequivalence trials, intersection-union tests and equivalence confidence sets. Statistical Science 11:283-302

6. Bernstein, B.E., Mikkelsen, T.S., Xie, X., Kamal, M., Huebert, D.J., Cuff, J., Fry, B., Meissner, A., Wernig, M., Plath, K., et al. 2006. A bivalent chromatin structure marks key developmental genes in embryonic stem cells. Cell 125:315-326

7. Betel, D., Wilson, M., Gabow, A., Marks, D.S., and Sander, C. 2008. The microRNA.org resource: targets and expression. Nucleic Acids Res 36:D149-D153

8. Bonner-Weir, S. 2000. Perspective: Postnatal pancreatic beta cell growth. Endocrinology 141:1926-1929

9. Boyer, L.A., Plath, K., Zeitlinger, J., Brambrink, T., Medeiros, L.A., Lee, T.I., Levine, S.S., Wernig, M., Tajonar, A., Ray, M.K., et al. 2006. Polycomb complexes repress developmental regulators in murine embryonic stem cells. Nature 441:349-353

10. Cahill, G.F., Jr. and Veech, R.L. 2003. Ketoacids? Good medicine? Trans Am Clin Climatol Assoc 114:149-161

11. De Santa F., Totaro, M.G., Prosperini, E., Notarbartolo, S., Testa, G., and Natoli, G. 2007. The histone H3 lysine-27 demethylase Jmjd3 links inflammation to inhibition of polycomb-mediated gene silencing. Cell 130:1083-1094

12. Eisenberg, E. and Levanon, E.Y. 2003. Human housekeeping genes are compact. Trends Genet 19:362-365

13. Gautier, L., Cope, L., Bolstad, B.M., and Irizarry, R.A. 2004. affy--analysis of Affymetrix GeneChip data at the probe level. Bioinformatics 20:307-315

39 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

14. Gentleman, R.C., Carey, V.J., Bates, D.M., Bolstad, B., Dettling, M., Dudoit, S., Ellis, B., Gautier, L., Ge, Y., Gentry, J., et al. 2004. Bioconductor: open software development for computational biology and bioinformatics. Genome Biol 5:R80

15. Grimson, A., Farh, K.K., Johnston, W.K., Garrett-Engele, P., Lim, L.P., and Bartel, D.P. 2007. MicroRNA targeting specificity in mammals: determinants beyond seed pairing. Mol Cell 27:91-105

16. Guo, H., Ingolia, N.T., Weissman, J.S., and Bartel, D.P. 2010. Mammalian microRNAs predominantly act to decrease target mRNA levels. Nature 466:835-840

17. Hsiao, L.L., Dangond, F., Yoshida, T., Hong, R., Jensen, R.V., Misra, J., Dillon, W., Lee, K.F., Clark, K.E., Haverty, P., et al. 2001. A compendium of gene expression in normal human tissues. Physiol Genomics 7:97-104

18. http://www.proteinatlas.org/normal_unit.php?antibody_id=15336&mainannotation_id=14 73283.

19. http://www.proteinatlas.org/normal_unit.php?antibody_id=3324&mainannotation_id=506 755.

20. http://www.proteinatlas.org/normal_unit.php?antibody_id=12047&mainannotation_id=11 69580.

21. Kostianovsky, A.M., Maier, L.M., Baecher-Allan, C., Anderson, A.C., and Anderson, D.E. 2007. Up-regulation of gene related to anergy in lymphocytes is associated with Notch-mediated human T cell suppression. J Immunol 178:6158-6163

22. Lagos-Quintana, M., Rauhut, R., Yalcin, A., Meyer, J., Lendeckel, W., and Tuschl, T. 2002. Identification of tissue-specific microRNAs from mouse. Curr Biol 12:735-739

23. Lan, F., Bayliss, P.E., Rinn, J.L., Whetstine, J.R., Wang, J.K., Chen, S., Iwase, S., Alpatov, R., Issaeva, I., Canaani, E., et al. 2007. A histone H3 lysine 27 demethylase regulates animal posterior development. Nature 449:689-694

24. Landgraf, P., Rusu, M., Sheridan, R., Sewer, A., Iovino, N., Aravin, A., Pfeffer, S., Rice, A., Kamphorst, A.O., Landthaler, M., et al. 2007. A mammalian microRNA expression atlas based on small RNA library sequencing. Cell 129:1401-1414

25. Lee, M.G., Villa, R., Trojer, P., Norman, J., Yan, K.P., Reinberg, D., Di, C.L., and Shiekhattar, R. 2007. Demethylation of H3K27 regulates polycomb recruitment and H2A ubiquitination. Science 318:447-450

26. Li, E. 2002. Chromatin modification and epigenetic reprogramming in mammalian development. Nat Rev Genet 3:662-673

40 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

27. Lim, L.P., Lau, N.C., Garrett-Engele, P., Grimson, A., Schelter, J.M., Castle, J., Bartel, D.P., Linsley, P.S., and Johnson, J.M. 2005. Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs. Nature 433:769-773

28. MacKenzie, D.A., Schartner, J., Lin, J., Timmel, A., Jennens-Clough, M., Fathman, C.G., and Seroogy, C.M. 2007. GRAIL is up-regulated in CD4+ CD25+ T regulatory cells and is sufficient for conversion of T cells to a regulatory phenotype. J Biol Chem 282:9696- 9702

29. Mikkelsen, T.S., Ku, M., Jaffe, D.B., Issac, B., Lieberman, E., Giannoukos, G., Alvarez, P., Brockman, W., Kim, T.K., Koche, R.P., et al. 2007. Genome-wide maps of chromatin state in pluripotent and lineage-committed cells. Nature 448:553-560

30. Missaghian, E., Kempna, P., Dick, B., Hirsch, A., ikhani-Koupaei, R., Jegou, B., Mullis, P.E., Frey, B.M., and Fluck, C.E. 2009. Role of DNA methylation in the tissue-specific expression of the CYP17A1 gene for steroidogenesis in rodents. J Endocrinol. 202:99- 109

31. Nielsen, J.E., Lindegaard, M.L., Friis-Hansen, L., Almstrup, K., Leffers, H., Nielsen, L.B., and Rajpert-De, M.E. 2010. Lipoprotein lipase and endothelial lipase in human testis and in germ cell neoplasms. Int J Androl 33:e207-e215

32. Otonkoski, T., Jiao, H., Kaminen-Ahola, N., Tapia-Paez, I., Ullah, M.S., Parton, L.E., Schuit, F., Quintens, R., Sipila, I., Mayatepek, E., et al. 2007. Physical exercise-induced hypoglycemia caused by failed silencing of monocarboxylate transporter 1 in pancreatic beta cells. Am J Hum Genet 81:467-474

33. Otonkoski, T., Kaminen, N., Ustinov, J., Lapatto, R., Meissner, T., Mayatepek, E., Kere, J., and Sipila, I. 2003. Physical exercise-induced hyperinsulinemic hypoglycemia is an autosomal-dominant trait characterized by abnormal pyruvate-induced insulin release. Diabetes 52:199-204

34. Pezzi, N., Prieto, I., Kremer, L., Perez Jurado, L.A., Valero, C., Del, M.J., Martinez, A., and Barbero, J.L. 2000. STAG3, a novel gene encoding a protein involved in meiotic chromosome pairing and location of STAG3-related genes flanking the Williams-Beuren syndrome deletion. FASEB J 14:581-592

35. Plumb-Rudewiez, N., Clotman, F., Strick-Marchand, H., Pierreux, C.E., Weiss, M.C., Rousseau, G.G., and Lemaigre, F.P. 2004. Transcription factor HNF-6/OC-1 inhibits the stimulation of the HNF-3alpha/Foxa1 gene by TGF-beta in mouse liver. Hepatology 40:1266-1274

36. Pullen, T.J., Khan, A.M., Barton, G., Butcher, S., Sun, G., and Rutter, G. 2010. Identification of genes selectively disallowed in the pancreatic islet. Islets 2:89-95

37. Quintens, R., Hendrickx, N., Lemaire, K., and Schuit, F. 2008. Why expression of some genes is disallowed in beta-cells. Biochem Soc Trans 36:300-305

41 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

38. Quoix, N., Cheng-Xue, R., Guiot, Y., Herrera, P.L., Henquin, J.C., and Gilon, P. 2007. The GluCre-ROSA26EYFP mouse: a new model for easy identification of living pancreatic alpha-cells. FEBS Lett 581:4235-4240

39. Ro, S., Park, C., Sanders, K.M., McCarrey, J.R., and Yan, W. 2007. Cloning and expression profiling of testis-expressed microRNAs. Dev Biol 311:592-602

40. Schuit, F., De Vos, A., Farfari, S., Moens, K., Pipeleers, D., Brun, T., and Prentki, M. 1997. Metabolic fate of glucose in purified islet cells. Glucose-regulated anaplerosis in beta cells. J Biol Chem 272:18572-18579

41. Sekine, N., Cirulli, V., Regazzi, R., Brown, L.J., Gine, E., Tamarit-Rodriguez, J., Girotti, M., Marie, S., MacDonald, M.J., Wollheim, C.B., et al. 1994. Low lactate dehydrogenase and high mitochondrial glycerol phosphate dehydrogenase in pancreatic beta-cells. Potential role in nutrient sensing. J Biol Chem 269:4895-4902

42. Selbach, M., Schwanhausser, B., Thierfelder, N., Fang, Z., Khanin, R., and Rajewsky, N. 2008. Widespread changes in protein synthesis induced by microRNAs. Nature 455:58-63

43. Serra, D., Bellido, D., Asins, G., Arias, G., Vilaro, S., and Hegardt, F.G. 1996. The expression of mitochondrial 3-hydroxy-3-methylglutaryl-coenzyme-A synthase in neonatal rat intestine and liver is under transcriptional control. Eur J Biochem 237:16-24

44. Shen, X., Liu, Y., Hsu, Y.J., Fujiwara, Y., Kim, J., Mao, X., Yuan, G.C., and Orkin, S.H. 2008. EZH1 mediates methylation on histone H3 lysine 27 and complements EZH2 in maintaining stem cell identity and executing pluripotency. Mol Cell 32:491-502

45. Sood, P., Krek, A., Zavolan, M., Macino, G., and Rajewsky, N. 2006. Cell-type-specific signatures of microRNAs on target mRNA expression. Proc Natl Acad Sci U S A 103:2746-2751

46. Strick-Marchand, H., Morosan, S., Charneau, P., Kremsdorf, D., and Weiss, M.C. 2004. Bipotential mouse embryonic liver stem cell lines contribute to liver regeneration and differentiate as bile ducts and hepatocytes. Proc Natl Acad Sci U S A 101:8360-8365

47. Thorrez, L., Van Deun, K., Tranchevent, L.C., Van Lommel, L., Engelen, K., Marchal, K., Moreau, Y., Van, M., I, and Schuit, F. 2008. Using ribosomal protein genes as reference: a tale of caution. PLoS ONE 3:e1854

48. Tu, Z., Wang, L., Xu, M., Zhou, X., Chen, T., and Sun, F. 2006. Further understanding human disease genes by comparing with housekeeping genes and other genes. BMC Genomics 7:31

49. http://www.uniprot.org/uniprot/Q8N3U4.

50. van Arensbergen, J., Garcia-Hurtado, J., Moran, I., Maestro, M.A., Xu, X., Van de, C.M., Skoudy, A.L., Palassini, M., Heimberg, H., and Ferrer, J. 2010. Derepression of

42 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

Polycomb targets during pancreatic organogenesis allows insulin-producing beta-cells to adopt a neural gene activity program. Genome Res 20:722-732

51. Van Deun, K., Hoijtink, H., Thorrez, L., Van Lommel, L., Schuit, F., and Van Mechelen, I. 2009. Testing the hypothesis of tissue selectivity: the intersection-union test and a Bayesian approach. Bioinformatics 25:2588-2594

52. Vire, E., Brenner, C., Deplus, R., Blanchon, L., Fraga, M., Didelot, C., Morey, L., Van, E.A., Bernard, D., Vanderwinden, J.M., et al. 2006. The Polycomb group protein EZH2 directly controls DNA methylation. Nature 439:871-874

53. Wang, X. and Wang, X. 2006. Systematic identification of microRNA functions by combining target prediction and expression profiling. Nucleic Acids Res 34:1646-1652

54. Warrington, J.A., Nair, A., Mahadevappa, M., and Tsyganskaya, M. 2000. Comparison of human adult and fetal expression and identification of 535 housekeeping/maintenance genes. Physiol Genomics 2:143-147

55. Zhao, C., Wilson, M.C., Schuit, F., Halestrap, A.P., and Rutter, G.A. 2001. Expression and distribution of lactate/monocarboxylate transporter isoforms in pancreatic islets and the exocrine pancreas. Diabetes 50:361-366

43 C B D A Downloaded from

-log(p-value) Number of probe sets 1000 2000 3000 4000 0 1 2 3 0

Cell morphology GENENOT REPRESSED

-20 genome.cshlp.org vs 20othertissues Post-translational p< inbaselinetissue modification α p≥α -16 Cell death

p≥α p< -12

Cellular growth onSeptember29,2021-Publishedby

and proliferation α p<

Cellular movement α -8

Amino acid

metabolism Sum Score -4 Small molecule biochemistry 0 placenta fetus vesicle seminal thymus spleen pituitary eye kidney adipose lung Gene expression

p< GENE REPRESSED vs 20othertissues

inbaselinetissue 4 α Cell cycle p<α Cold SpringHarborLaboratoryPress p<α 8

Cell signalling

p<

α 12

p< liver islets testis testis heart bone marrow brain salivary liver islets muscle intestine small α 16 Figure 1

20

Liver B D C A expression Islets 1000 2000 3000 4000 5000 6000 Exercise Physical

Ketogenesis Hmgcs2 expression 1000 2000 3000 4000 5000 0 0 adipose tissue Downloaded from adrenal gland bone marrow adipose tissue adrenal gland

brain release Insulin

pyruvate bone marrow

eye lactate fetus brain heart eye genome.cshlp.org Hmgcs2

food intake food fetus Beta-hydroxybutyrate islets (Slc16a1) Mct1 heart

Ketone bodies Ketone kidney Acetoacetate Allowed Acetone liver islets lung kidney Pcx muscle lactate liver lung ovary Ldha muscle

pituitary gland onSeptember29,2021-Publishedby placenta ovary pituitary gland pyruvate

salivary gland glucose source source energy energy alternative seminal vesicle placenta small intestine salivary gland spleen seminal vesicle small intestine

testis acetate thymus oxalo spleen testis NADPH Pc thymus pyruvate expression ATP 1000 2000 3000 4000 5000 6000 7000 breakdown ofketonebodies Oxct1

expression 10000 CoA acetyl 2000 4000 6000 8000 0 Pdh adipose tissue 0 adrenal gland adipose tissue

bone marrow Cold SpringHarborLaboratoryPress brain adrenal gland eye bone marrow fetus brain heart eye islets fetus

heart Disallowed kidney Oxct1 liver islets kidney Figure 2 lung Ldha muscle liver ovary lung pituitary gland muscle placenta ovary salivary gland pituitary gland placenta

seminal vesicle small intestine salivary gland spleen seminal vesicle testis small intestine thymus spleen testis thymus Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor LaboratoryFigure Press 3 A B Pancreatic islets Pancreatic islets 1.0 30

Ins2 *** Ldha 25 0.8 Pc Mct1 20 0.6 * 15 0.4 ** ** 10 *** **

0.2 *** 5 Fold change (relative to adult) to (relative Foldchange *** adult) to (relative Foldchange 0 0 P1 P7 P15 P21 P28 P1 P7 P15 P21 P28 C Liver D Liver 2.5 12 *** Hmgcs2 *** Oxct1 2.0 10 8 1.5 6 * 1.0 4

0.5 *** 2 *** Fold change (relative to adult) to (relative Fold change 0 adult) to (relative Fold change 0 E 15.5 E 17.5 P1 P14 P42 E 15.5 E 17.5 P1 P14 P42 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

Figure 4

A B C D Ldha Mct1 Oxct1 Actb 8 10 6 12 ** * * 6 8 4 8 6 4 4 2 4 2 % precipitated 2 0 0 0 0 islets liver islets liver P1 P14 P42 adult brain islets liver brain liver ** 16 6 ** 4 2.0 H3K9ac 12 3 ** 1.5 H3K27me3 4 IgG 8 2 1.0 2 4 1 0.5 % precipitated 0 0 0 0 islets liver islets liver P1 P14 P42 adult brain islets liver brain liver Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor LaboratoryFigure Press 5

A 1.4 miR-122 (liver) 1.2 1.0 0.8 0.6 0.4 ** 0.2 ***

Fold change (relative to adult) 0 E15.5 E17.5 P1 P14 P42

B miR-122 (BMEL) Oxct1 (BMEL) 2.5 ** 2.0 ** * 2.0 1.5 1.5 ** 1.0 1.0 0.5 0.5 fold change expression fold change expression 0 0

untreateda-miR-122a -miR-122mut untreateda-miR-122a -miR-122mut C Oxct1 (E15.5 liver) 1.2 * *

1.0 WT 0.8 TG 0.6

0.4

fold change expression 0.2

0 mRNA protein Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press Table 1

Repressed Gene Affymetrix Expression in Expression in Fold in Symbol ID baseline tissue other tissues change pancreatic islets Slc16a1 1415802_at 19 1206 63 pancreatic islets Maf 1456060_at 23 1142 49 pancreatic islets Ldha 1419737_a_at 81 2692 33 liver Oxct1 1449059_a_at 45 1837 41 liver Scd2 1415822_at 44 2275 51 liver Enah 1424800_at 18 916 50 liver Slc25a4 1424562_a_at 80 3395 42 liver Tspan13 1418643_at 23 1582 70 testis Malat1 1418189_s_at 37 2757 74 testis Lpl 1415904_at 52 3464 67 testis Atrx 1433537_at 14 571 40 testis Stag2 1421849_at 26 857 33 testis Birc4 1437533_at 25 787 31 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

Table 2

Tissue Abundant microRNA(s) # genes targeted # repressed genesoverlap p-value Specificity evidence Brain miR-9 742 48 7 0.004 second most abundant miR in mouse brain, in human brain-specific (Sood et al. 2006) Liver miR-122 83 29 2 0.008 miR-122 most abundant in mouse and human liver Muscle miR-1 436 13 2 0.041 miR-1 and miR-133a are specific miRs in human heart and muscle (Sood et al. 2006) Testis miR-16, miR-143, miR-26a, miR-21 690,155,516,143 428 31,8,30,9 all <0.05 next to the let-family (which are not specific), the 5 most abundant miRs in mouse testis miR-204 284 428 19 0.0001 specific in human testis miR-464, miR-470, miR-741 84,115,60 428 7,8,5 all <0.05 mouse testis-specific (Ro et al. 2007) Thymus miR-16 689 7 2 0.027 second most abundant miR in mouse thymus Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

Figure S1

900

800 bone marrow 700 other tissues 600

500

400 mRNA expression mRNA 300

200

100

0 1416516_at 1416515_at 1448378_at 1416514_a_at

Fscn1 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

Figure S2

5000 islets (430 2.0) islets (GA) 4000 other tissues (430 2.0) other tissues (GA) 3000

2000 mRNA expression 1000

0 Cat Zyx Oat Maf Itih5 Ldha Lmo4 Igfbp4 Pdgfra Cxcl12 Smad3 Zfp36l1 Arhgdib Slc16a1 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press Figure S3

our set Novartis set frequency 0 1000 2000 3000 4000 0.0 0.1 0.2 0.3 0.4 0.5 0.6 standard error Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

Figure S4 A B C Mct1 Mct1 Ptf1a (microarray) (Q-PCR) (microarray) 120 P<0.001 7000 P<0.001 1.2 P<0.001 100 12 P=0.12 0.04 P=0.015 6000 150 P<0.001 1.0 0.03 80 8 5000 100 0.8 0.02 4000 4 0.01 50 60 0.6 0 0.00 3000 0 beta beta beta 40 islets islets islets cells 0.4 cells 2000 cells mRNA expression mRNA

20 0.2 expression mRNA mRNA expression mRNA 1000 0 0 0 islets beta cells acini islets beta cells acini islets beta cells acini Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press Figure S5

A *** 14 *** 12 c-Maf 10 8 6 4 2

Fold change (rel. to adult) to (rel. Fold change 0 1 7 15 21 28

B c-Maf *** 10 ***

8 H3K9ac H3K27me3 6 IgG

4 % precipitated 2

0 islets liver Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press Figure S6

Maf Mct1 Ldha

ES cell

Adipose

Liver

Pancreatic progenitor

Acinar

Islet

FACS beta-cell

Min6

5Kb H3K4me3 H3K27me3 CpG island Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press Figure S7

miR-122 A 1.0 0.8

0.6 0.4

0.2 miR expression (a.u.) 0 Eye Liver Lung Brain Heart Ovary Testis Kidney Spleen Thymus Placenta Pancreas Adipocytes Embryo D11 Embryo Smallintestine B 1.0 miRs in liver 0.8

0.6 0.4

0.2

miR expression (a.u.) 0 let-7f let-7b let-7c let-7a let-7d miR-1 miR-16 miR-21 miR-22 miR-122 miR-192 miR-29a miR-143 miR-26a miR-26b miR-15a miR-126-3p miR-126-5p miR-142-3p Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press Figure S8

A

1

0.8

0.6

0.4

miR expression (a.u.) 0.2

0 mmu-let-7c mmu-let-7b mmu-miR-16 mmu-miR-24 mmu-miR-124 mmu-miR-375 mmu-miR-26a mmu-miR-27b mmu-miR-127 mmu-miR-29a mmu-miR-26b mmu-miR-29b

B 32000 miR-124

5000

4000

3000 miR-375 miR expression (a.u.) 2000 miR-375

1000 miR-124

0 islets MIN6 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor FigureLaboratory Press S9

Zebrafish

*** 3000 *** 2500

2000

1500

1000

Oxct1 expression Oxct1 500

0 Brain control Brain starved Liver control Liver starved

Pig

1800 1600 1400 1200 1000 800 600 400 Oxct1 expression Oxct1 200 0 Liver Blood Ileum Biceps Back fat Back Stomach Diaphragm Pineal gland Thyroid gland Olfactory bulb fat Abdominal Hypothalamus Adrenal cortex Adrenal medulla Neurohypophisis Adenohypophisis Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press Table S1

Repressedin GeneSymbol AffymetrixID Gene Array adipose Bdh1 1452257_at 0 adipose Hook1 1438018_at 1 bonemarrow 0610010E21Rik 1433936_at / bonemarrow 1600012F09Rik 1419660_at / bonemarrow 2310022M17Rik 1428293_at / bonemarrow 2610507B11Rik 1426820_at / bonemarrow AA536717 1434269_at / bonemarrow Abcd3 1416679_at / bonemarrow Agpat3 1450504_a_at / bonemarrow Aldh6a1 1448104_at / bonemarrow Amacr 1417208_at / bonemarrow Ankrd25 1460559_at / bonemarrow Arhgap29 1454745_at / bonemarrow Arhgap5 1450897_at / bonemarrow Bpnt1 1449211_at / bonemarrow Brwd2 1452820_at / bonemarrow Cfl2 1418067_at / bonemarrow Cobll1 1454795_at / bonemarrow Col4a1 1452035_at / bonemarrow Col4a2 1424051_at / bonemarrow Commd9 1438644_x_at / bonemarrow Cryab 1434369_a_at / bonemarrow D0H4S114 1436736_x_at / bonemarrow Dag1 1426778_at / bonemarrow Ddr1 1435820_x_at / bonemarrow Ddt 1417103_at / bonemarrow Dexi 1460174_at / bonemarrow Dhx32 1420427_a_at / bonemarrow Dip2c 1429064_at / bonemarrow Dusp16 1418401_a_at / bonemarrow Dync1h1 1416648_at / bonemarrow Dynll2 1418258_s_at / bonemarrow Eif2b5 1433886_at / bonemarrow Enpp2 1448136_at / bonemarrow Errfi1 1416129_at / bonemarrow Etl4 1426880_at / bonemarrow Fdx1 1449108_at / bonemarrow Fkbp9 1437687_x_at / bonemarrow Frap1 1417592_at / bonemarrow Fyttd1 1424342_at / bonemarrow Gcap14 1453240_a_at / bonemarrow Gkap1 1417594_at / bonemarrow Golga4 1417674_s_at / bonemarrow Hibadh 1435967_s_at / bonemarrow Hsbp1 1451162_at / bonemarrow Insig2 1417981_at / bonemarrow Ipo4 1436420_a_at / bonemarrow Laptm4b 1438365_x_at / bonemarrow Large 1417435_at / bonemarrow Lrrc41 1427125_s_at / Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press bonemarrow Maged1 1450062_a_at / bonemarrow Map4k3 1426759_at / bonemarrow Mccc2 1454840_at / bonemarrow Nckap1 1452196_a_at / bonemarrow Ndufa12 1455806_x_at / bonemarrow Neo1 1447693_s_at / bonemarrow Nkiras1 1428503_a_at / bonemarrow Pfn2 1418209_a_at / bonemarrow Phlpp 1426994_at / bonemarrow Pigp 1436038_a_at / bonemarrow Pkd2 1441870_s_at / bonemarrow Pkp4 1452209_at / bonemarrow Plekhc1 1434180_at / bonemarrow Pls3 1423725_at / bonemarrow Pogk 1447864_s_at / bonemarrow Ppp1r13b 1434895_s_at / bonemarrow Ptk2 1423059_at / bonemarrow Ptprg 1434360_s_at / bonemarrow Sec22a 1416320_at / bonemarrow Sec31l1 1453014_a_at / bonemarrow Smad1 1459843_s_at / bonemarrow Snx19 1427078_at / bonemarrow Spg20 1451520_at / bonemarrow Spna2 1427888_a_at / bonemarrow St13 1436113_a_at / bonemarrow Tjp1 1417749_a_at / bonemarrow Tm2d1 1426254_at / bonemarrow Tmcc3 1435554_at / bonemarrow Tmed4 1448422_at / bonemarrow Tmem66 1424039_at / bonemarrow Tmem85 1418124_at / bonemarrow Tnfaip1 1448863_a_at / bonemarrow Tulp4 1448548_at / bonemarrow Ube2e2 1424358_at / bonemarrow Wsb2 1421847_at / bonemarrow Yes1 1449090_a_at / bonemarrow Zmat3 1449353_at / brain 1110007C09Rik 1431359_a_at 1 brain 2310016E02Rik 1435522_a_at 0 brain 2310039H08Rik 1417348_at 0 brain 2900073G15Rik 1420820_at 1 brain Actl6a 1456730_x_at 1 brain Aga 1434665_at 1 brain Agxt2l2 1424745_at 1 brain Anxa4 1421223_a_at 1 brain Apeh 1426030_a_at 0 brain Arbp 1419441_at 1 brain Arhgef5 1452304_a_at 0 brain Arpc1b 1416226_at 0 brain Atf1 1417296_at 1 brain Atp6v0e 1416328_a_at 1 brain B4galt1 1418014_a_at 1 brain C3 1423954_at 0 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press brain Cd151 1437670_x_at 1 brain Chrac1 1459859_x_at 0 brain Clic1 1416656_at 1 brain Cpt2 1416772_at 1 brain D430028G21Rik 1439185_x_at 1 brain Dap 1451112_s_at 1 brain Dera 1424047_at 1 brain Echdc3 1418862_at 0 brain Eef1d 1449506_a_at 0 brain Elf1 1417540_at 1 brain Gng5 1436946_s_at 1 brain Heatr5a 1435241_at 1 brain ICRFP703B1614Q5.6 1450959_at 0 brain Ifi30 1422476_at 1 brain Katna1 1450949_at 1 brain Krcc1 1424621_at 1 brain Limd1 1422731_at 1 brain Map2k3 1451714_a_at 0 brain Mcl1 1448503_at 0 brain Mtfr1 1451536_at 1 brain Nedd1 1450899_at 1 brain Nfatc3 1419976_s_at 1 brain Nfkb1 1427705_a_at 0 brain Nkiras2 1424416_at 0 brain Nt5dc1 1460615_at 1 brain Pon3 1419298_at 1 brain Pxn 1456135_s_at 1 brain Reep4 1428478_at 0 brain Rela 1419536_a_at 1 brain Rnaset2b 1452734_at 1 brain Rps27l 1435429_x_at 1 brain Samhd1 1418131_at 0 brain Scamp2 1416611_at 0 brain Scnn1a 1417291_at 0 brain Septin2 1423472_at 0 brain Serf2 1455236_x_at 0 brain Serhl 1421938_at 0 brain Serping1 1416625_at 1 brain Shc1 1422854_at 1 brain Slc12a7 1418257_at 1 brain Slc30a7 1450697_at 0 brain Surf4 1434589_x_at 1 brain Syngr2 1417081_a_at 1 brain Tax1bp3 1455871_s_at 0 brain Tmem106a 1425025_at 1 brain Tmem112b 1454619_at 1 brain Tmem123 1448623_at 1 brain Tmem39a 1423316_at 1 brain Trim25 1419879_s_at 1 brain Triobp 1427447_a_at 0 brain Tspo 1416695_at 0 brain Ttf2 1428522_at 0 brain Txnip 1415996_at 1 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press brain Vamp8 1420624_a_at 1 brain Wasf2 1454673_at 1 brain Zfp217 1437414_at 1 brain Zfp568 1435091_at 1 brain Znrf2 1434016_at 1 eye 1110032A13Rik 1428520_at / eye Htatip2 1451814_a_at / eye Txndc4 1423247_at / fetus 4930420K17Rik 1436337_at / fetus AK159419 1428442_at / fetus Cbx7 1433557_at / fetus Crebl2 1435085_at / fetus D12Ertd647e 1452956_a_at / fetus Fbxo6 1417501_at / fetus Hist2h2aa1 1418367_x_at / fetus Isoc2b 1418537_at / fetus Laptm4a 1423368_at / fetus Lmbrd1 1451622_at / fetus S100a1 1419814_s_at / heart 1110037F02Rik 1427906_at 0 heart 1700123O20Rik 1416917_at 0 heart 2310036O22Rik 1428201_at 0 heart 2400003C14Rik 1423838_s_at 0 heart 4931406C07Rik 1416607_at 0 heart 5430411K18Rik 1428419_at 0 heart Acp1 1450721_at 0 heart Adss 1460726_at 0 heart AK029097 1460573_at 0 heart Alg11 1434187_at 0 heart Ampd2 1438941_x_at 0 heart Ap2s1 1433612_at 0 heart Ap3s1 1422593_at 0 heart Asl 1448350_at 0 heart Atp6v0d1 1415671_at 0 heart Atp6v1a 1450634_at 0 heart Atp6v1c1 1419545_a_at 0 heart BC005624 1423789_at 0 heart Becn1 1439405_x_at 0 heart Brd2 1437210_a_at 0 heart Bscl2 1437345_a_at 0 heart Ccdc101 1451166_a_at 0 heart Cct2 1433535_x_at 0 heart Cdk8 1460389_at 0 heart Cdk9 1417269_at 0 heart Chfr 1433550_at 0 heart Clk3 1423849_a_at 0 heart Commd7 1426765_at 0 heart Copz1 1451825_a_at 0 heart Edc3 1433710_at 0 heart Eif3c 1456374_x_at 0 heart Elof1 1423820_at 0 heart Ewsr1 1417238_at 0 heart Frg1 1417253_at 0 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press heart Fuca1 1416109_at 0 heart Gfpt1 1428715_at 0 heart Gosr2 1419371_s_at 0 heart H2afz 1416415_a_at 0 heart Hnrpd 1425142_a_at 0 heart Itgb4bp 1427578_a_at 0 heart Lrrc40 1448720_at 0 heart Lrrc59 1416234_at 0 heart Mettl6 1432384_a_at 0 heart Mosc2 1416766_at 0 heart Nanp 1417941_at 0 heart Nsun2 1423850_at 0 heart Nudcd1 1433547_s_at 0 heart Pabpn1 1422849_a_at 0 heart Pdcd4 1418840_at 0 heart Pes1 1416172_at 0 heart Plrg1 1448282_at 0 heart Psip1 1460403_at 0 heart Puf60 1416438_at 0 heart Rabif 1419927_s_at 0 heart Rbm10 1423740_a_at 0 heart Rbm34 1429587_at 0 heart Rffl 1434432_at 0 heart Rnf138 1454064_a_at 0 heart Rnf145 1452769_at 0 heart Rpe 1416706_at 0 heart Rpl27a 1426661_at 0 heart Rpn1 1439257_x_at 0 heart Sc5d 1451457_at 0 heart Sec11c 1460698_a_at 0 heart Sec61b 1417083_at 0 heart Senp2 1425466_at 0 heart Sfrs9 1417727_at 0 heart Snip1 1459773_x_at 0 heart Spcs1 1448258_a_at 0 heart Spg21 1451036_at 0 heart Ssr2 1449930_a_at 0 heart Stt3b 1426342_at 0 heart Sumo3 1422457_s_at 0 heart Supt4h2 1422418_s_at 0 heart Tmem183a 1417200_at 0 heart Tor2a 1438547_x_at 0 heart Ugcgl1 1455839_at 0 heart Usp7 1419920_s_at 0 heart Vcpip1 1434706_at 0 heart Wbp5 1451230_a_at 0 heart Wdsof1 1435442_at 0 heart Wipi2 1429367_at 0 heart Yipf2 1438415_s_at 0 heart Yipf5 1418576_at 0 heart Yy1 1422569_at 0 heart Zcchc2 1434401_at 0 heart Zcchc8 1423755_at 0 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press heart Zfp35 1417778_at 0 heart Zfp622 1438000_x_at 0 islets Arhgdib 1426454_at 1 islets Bloc1s1 1422614_s_at 0 islets C1qbp 1455821_x_at 0 islets Cat 1416429_a_at 1 islets Cd302 1448919_at 0 islets Cox5a 1415933_a_at 0 islets Crlz1 1417583_a_at 0 islets Cxcl12 1448823_at 1 islets Fcgrt 1416978_at 0 islets Higd1a 1416480_a_at 0 islets Igfbp4 1437405_a_at 1 islets Islr 1418450_at 0 islets Itih5 1429159_at 1 islets Ldha 1419737_a_at 1 islets Lmo4 1420981_a_at 1 islets Maf 1456060_at 1 islets Mgst1 1415897_a_at 0 islets Mylk 1425506_at 0 islets Nola2 1416606_s_at 0 islets Oat 1416452_at 1 islets Ogn 1419663_at 0 islets Parp3 1451969_s_at 0 islets Pcolce 1437165_a_at 0 islets Pdgfra 1421917_at 1 islets Rpl24 1460201_a_at 0 islets Rpl36 1416519_at 0 islets Selenbp1 1450699_at 0 islets Slc16a1 1415802_at 1 islets Smad3 1454960_at 1 islets Tgm2 1433428_x_at 0 islets Uqcrb 1455997_a_at 0 islets Zfp36l1 1450644_at 1 islets Zyx 1417240_at 1 kidney AI597468 1433897_at 0 kidney Cugbp2 1451154_a_at 0 liver 1190002H23Rik 1438511_a_at 0 liver 1700047I17Rik 1460466_at 1 liver 2610208M17Rik 1423870_at 1 liver 3110050N22Rik 1428418_s_at 1 liver Abcc1 1452233_at 1 liver Add3 1423298_at 1 liver Arl2bp 1417112_at 1 liver Ccdc34 1449345_at 0 liver Cd200 1448788_at 0 liver Cd34 1416072_at 1 liver Cdc42ep3 1450700_at 1 liver Ckb 1455106_a_at 0 liver Csrp1 1425811_a_at 0 liver Ctbp2 1434705_at 0 liver Dctn1 1435414_s_at 1 liver Dnajc8 1452683_at 0 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press liver Dyrk1a 1428299_at 0 liver Emb 1415857_at 1 liver Enah 1424800_at 1 liver Garnl4 1434754_at 0 liver Gnpda2 1426524_at 0 liver Gsn 1456312_x_at 0 liver Hmgn2 1433507_a_at 0 liver Hmgn3 1434875_a_at 1 liver Ift57 1418929_at 1 liver Igf1r 1452982_at 1 liver Itga6 1422445_at 1 liver Klf4 1417394_at 0 liver Lass5 1451209_at 1 liver Lsm8 1448703_at 0 liver Map4k4 1434184_s_at 1 liver Mcrs1 1416535_at 0 liver Mllt11 1416313_at 0 liver Morf4l1 1455077_a_at 0 liver Oxct1 1449059_a_at 1 liver Pkm2 1417308_at 1 liver Pspc1 1423192_at 0 liver Rcn2 1422449_s_at 1 liver Rps23 1460175_at 0 liver S100a6 1421375_a_at 0 liver Scand1 1448868_at 0 liver Scd2 1415822_at 1 liver Sgcb 1419668_at 1 liver Sh3bgrl3 1416528_at 0 liver Slc25a24 1452717_at 0 liver Slc25a36 1419657_a_at 0 liver Slc25a4 1424562_a_at 1 liver Slc7a1 1454991_at 1 liver St3gal6 1449079_s_at 1 liver Stk24 1426248_at 0 liver Taf9b 1434960_at 1 liver Tspan13 1418643_at 1 liver Tspan3 1416009_at 1 liver Tspan5 1417179_at 1 liver Ubb 1435643_x_at 0 liver Vamp3 1437708_x_at 0 lung Psmd6 1423696_a_at 0 muscle 2610002J02Rik 1431003_a_at 0 muscle 3110003A17Rik 1426964_at 0 muscle Actn4 1423449_a_at 0 muscle AI413782 1438983_x_at 0 muscle Armet 1428112_at 0 muscle Cep164 1435676_at 0 muscle Cfl1 1455138_x_at 1 muscle Chka 1450264_a_at 0 muscle Coro1b 1448351_at 1 muscle Cox6a1 1417417_a_at 1 muscle E330016A19Rik 1424635_at 0 muscle Fam18b 1452953_at 1 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press muscle Glb1 1416205_at 1 muscle Hsp90aa1 1438902_a_at 1 muscle Hspa5 1416064_a_at 1 muscle Mylc2b 1428608_at 1 muscle Nipsnap3a 1448967_at 0 muscle Nudt5 1448651_at 0 muscle Os9 1426974_at 1 muscle Pgam1 1426554_a_at 1 muscle Ptma 1423455_at 0 muscle Rogdi 1451421_a_at 0 muscle Rpl3 1449323_a_at 1 muscle Sf3b4 1424619_at 0 muscle Slc9a3r1 1438115_a_at 0 muscle Spint2 1438968_x_at 1 muscle Ssr1 1417763_at 0 muscle Stmn1 1415849_s_at 0 muscle Vps33b 1427933_at 1 pituitary 4930402E16Rik 1459869_x_at 0 pituitary Ddx39 1438168_x_at 0 pituitary Litaf 1416303_at 0 pituitary Mtx1 1418521_a_at 0 pituitary Nudt4 1418505_at 1 pituitary Setd8 1426406_at 1 pituitary Zdhhc14 1438619_x_at 1 placenta 1500011K16Rik 1438678_at 0 placenta 1810014B01Rik 1429259_a_at 0 placenta 2410018G20Rik 1452591_a_at 0 placenta Aldh2 1448143_at 0 placenta Atp5e 1416567_s_at 0 placenta Bphl 1424242_at 0 placenta Gstt1 1418186_at 0 placenta Mrpl13 1424204_at 0 placenta Ndufa6 1448427_at 0 placenta Pank1 1418715_at 1 placenta Park7 1416526_a_at 1 placenta Prps1 1416052_at 1 placenta Sdhb 1418005_at 0 placenta Tarsl2 1434738_at 1 placenta Tmem141 1435259_s_at 0 placenta Uqcrh 1453229_s_at 0 placenta Zfp367 1433623_at 1 salivary 0610012D17Rik 1428972_at / salivary 1110005A23Rik 1439438_a_at / salivary 1110059E24Rik 1416841_at / salivary 2610209M04Rik 1460697_s_at / salivary 2700059D21Rik 1428237_at / salivary 2900042B11Rik 1453016_at / salivary 2900092E17Rik 1449618_s_at / salivary 4921524J17Rik 1454136_a_at / salivary 5230400G24Rik 1456736_x_at / salivary 8430410A17Rik 1423786_at / salivary 9530068E07Rik 1427108_at / salivary Atp6v1g1 1423256_a_at / Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press salivary Cops8 1415934_at / salivary Coq7 1416665_at / salivary Cryzl1 1451473_a_at / salivary Cstf2t 1415920_at / salivary D030070L09Rik 1433859_at / salivary Dtnbp1 1431619_a_at / salivary Fads1 1423680_at / salivary Fdft1 1438322_x_at / salivary Gns 1433488_x_at / salivary Hmox2 1416399_a_at / salivary Hnrpa1 1430019_a_at / salivary Kctd10 1423694_at / salivary Kras 1451979_at / salivary Mfap3 1424721_at / salivary Moap1 1448787_at / salivary Mrps22 1416595_at / salivary Mrps36 1423242_at / salivary Ndufa7 1450818_a_at / salivary Nup54 1438951_x_at / salivary Papd1 1452749_at / salivary Pcmt1 1431085_a_at / salivary Pdcd5 1450638_at / salivary Pkig 1434820_s_at / salivary Ppid 1417057_a_at / salivary Psma3 1448442_a_at / salivary Ptpla 1457434_s_at / salivary Rab2b 1452667_at / salivary Ran 1433569_x_at / salivary Ranbp9 1456199_x_at / salivary Rcbtb2 1416389_a_at / salivary Sdhd 1428235_at / salivary Sec23a 1423347_at / salivary Sirt1 1418640_at / salivary Slc44a2 1438559_x_at / salivary Snhg8 1456204_at / salivary Snw1 1429002_at / salivary Sugt1 1426425_at / salivary Tbcel 1434330_at / salivary Tprkb 1425682_a_at / salivary Trappc4 1415674_a_at / salivary Trub2 1424611_x_at / salivary Txndc14 1437454_a_at / salivary Txndc9 1436951_x_at / salivary Usp14 1416208_at / salivary Vdac3 1416175_a_at / salivary Vps29 1417660_s_at / salivary Zfp236 1455153_at / seminalvesicle 1810073N04Rik 1456241_a_at / seminalvesicle BC100355 1437985_a_at / seminalvesicle D2hgdh 1437840_s_at / seminalvesicle Hexa 1449024_a_at / seminalvesicle Hmga1 1416184_s_at / seminalvesicle Polrmt 1437377_a_at / Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press seminalvesicle Scpep1 1455908_a_at / seminalvesicle Stk4 1436015_s_at / seminalvesicle Zfand5 1416085_s_at / smallintestine 2610301B20Rik 1429451_at 0 smallintestine Apip 1418254_at 0 smallintestine Arl3 1450706_a_at 0 smallintestine Atxn10 1438653_x_at 1 smallintestine Clu 1437689_x_at 0 smallintestine Glul 1426236_a_at 1 smallintestine Ikbkap 1451254_at 0 smallintestine Lancl1 1427011_a_at 0 smallintestine Lonrf1 1455665_at 1 smallintestine Man2a2 1435203_at 1 smallintestine Mgll 1426785_s_at 0 smallintestine Qk 1451179_a_at 0 smallintestine Rab6ip1 1424015_at 1 smallintestine Rabac1 1427773_a_at 1 smallintestine Reps1 1440822_x_at 1 smallintestine Srpk2 1417135_at 1 smallintestine Tacc1 1454909_at 1 smallintestine Tceal8 1418171_at 1 smallintestine Trim23 1426969_at 0 smallintestine Ttc7b 1433460_at 1 smallintestine Wrb 1460446_at 0 smallintestine Ypel3 1426624_a_at 1 spleen Fbxw8 1426944_at / spleen Hras1 1422407_s_at / spleen Prdx6 1423223_a_at / spleen Rnf128 1418318_at / spleen Tfg 1415887_at / spleen Tmem41b 1437402_x_at / spleen Trp53inp2 1452646_at / testis March6 1433834_at 0 testis 1110019J04Rik 1415733_a_at 0 testis 1110067D22Rik 1451313_a_at 1 testis 1200003I07Rik 1429473_at 1 testis 1200013P24Rik 1415721_a_at 0 testis 1600012H06Rik 1428217_at 0 testis 1700065O13Rik 1434675_at 0 testis 1810022K09Rik 1436523_s_at 0 testis 1810030O07Rik 1433867_at 1 testis 1810037C20Rik 1428202_at 0 testis 2010106G01Rik 1452225_at 0 testis 2410002O22Rik 1435377_at 1 testis 2410005O16Rik 1418658_at 1 testis 2410129H14Rik 1455052_a_at 1 testis 2610029I01Rik 1428897_at 0 testis 2610030H06Rik 1452607_at 0 testis 2700038C09Rik 1428381_a_at 1 testis 2700089E24Rik 1453208_at 1 testis 2810008M24Rik 1452737_at 1 testis 2810407C02Rik 1452167_at 1 testis 2810474O19Rik 1429588_at 1 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press testis 2810485I05Rik 1452268_at 0 testis 3110001I20Rik 1450642_at 1 testis 3300001P08Rik 1424802_a_at 1 testis 4732479N06Rik 1433672_at 1 testis 4932432K03Rik 1424738_at 1 testis 5730601F06Rik 1434084_at 1 testis 5830434P21Rik 1433624_at 0 testis 6030458C11Rik 1433860_at 1 testis 8430410K20Rik 1424993_at 1 testis 9030612M13Rik 1433784_at 1 testis A230046K03Rik 1436353_at 1 testis A430093A21Rik 1434841_at 1 testis Abcb7 1435006_s_at 1 testis Abce1 1416015_s_at 0 testis Abhd13 1436516_at 1 testis Acaa1a 1416947_s_at 1 testis Acbd5 1428236_at 1 testis Actn1 1428585_at 1 testis Actr2 1452587_at 1 testis Actr3 1434968_a_at 1 testis Adam10 1428103_at 1 testis Agps 1454918_at 1 testis Ahr 1422631_at 1 testis AK086768 1437868_at 1 testis AK129128 1435568_at 1 testis Akap13 1433722_at 0 testis Akap9 1435769_at 1 testis Alg6 1439007_at 1 testis Ankrd26 1436071_at 1 testis Anxa7 1416138_at 1 testis Ap3m1 1448308_at 1 testis Apc 1420956_at 1 testis Arfgef1 1415711_at 1 testis Arfrp2 1433642_at 0 testis Arhgap21 1428369_s_at 1 testis Arid1b 1455979_at 1 testis Arl5a 1433951_at 1 testis Arl6ip5 1417225_at 1 testis Asb13 1449459_s_at 1 testis Ash1l 1420985_at 1 testis Atad1 1448763_at 0 testis Atad2b 1428982_at 1 testis Atf4 1448135_at 0 testis Atg4a 1434662_at 1 testis Atg5 1415684_at 1 testis Atp11b 1451388_a_at 0 testis Atp11c 1455083_at 0 testis Atp13a3 1434513_at 1 testis Atp2b1 1428936_at 1 testis Atp5f1 1433562_s_at 1 testis Atp5g2 1415980_at 0 testis Atp5g3 1454661_at 0 testis Atp6ap1 1449622_s_at 1 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press testis Atrx 1433537_at 1 testis AW557046 1426459_s_at 0 testis Azi2 1431822_a_at 0 testis Azin1 1450714_at 0 testis B230219D22Rik 1424005_at 1 testis B230380D07Rik 1436842_at 1 testis Bach1 1440831_at 1 testis Baz1b 1434824_at 1 testis BC010304 1433572_a_at 1 testis BC010304_OS 1429264_at 0 testis BC031748 1434294_at 1 testis BC043098 1434018_at 0 testis Bcap31 1451049_at 1 testis Bccip 1448542_at 1 testis Bdp1 1434284_at 1 testis Bfar 1426489_s_at 1 testis Birc4 1437533_at 1 testis Birc6 1419562_at 1 testis Bmpr2 1434310_at 1 testis Brcc3 1452128_a_at 1 testis C1d 1448505_at 1 testis C1galt1c1 1416655_at 1 testis C330007P06Rik 1451202_at 0 testis C330011K17Rik 1434171_at 1 testis Cab39 1418433_at 0 testis Calcrl 1425814_a_at 1 testis Capn2 1416257_at 1 testis Capn7 1423097_s_at 1 testis Capza2 1423057_at 1 testis Casd1 1451980_at 1 testis Cbfb 1460716_a_at 0 testis Ccdc22 1418347_at 0 testis Ccdc47 1424637_s_at 1 testis Ccdc90a 1438024_at 1 testis Ccng1 1420827_a_at 1 testis Ccnt1 1456477_at 0 testis Cd2ap 1420907_at 1 testis Cd47 1449507_a_at 1 testis Centb2 1433561_at 1 testis Cep350 1455072_at 0 testis Cept1 1416471_at 1 testis Cetn2 1438647_x_at 0 testis Chd9 1457672_at 1 testis Chm 1439824_at 1 testis Chmp1b 1418817_at 1 testis Chmp5 1432270_a_at 0 testis Chordc1 1460645_at 1 testis Chuk 1417091_at 0 testis Cisd2 1428441_at 1 testis Clint1 1452152_at 0 testis Clk1 1426124_a_at 1 testis Clta 1421062_s_at 1 testis Cltc 1454626_at 1 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press testis Cmpk 1423073_at 1 testis Cnih 1423727_at 1 testis Cnn3 1436836_x_at 1 testis Cnot6l 1425480_at 0 testis Commd8 1430129_a_at 1 testis Cox6b1 1416565_at 0 testis Cpne3 1435450_at 1 testis Creb1 1452901_at 0 testis Crot 1450966_at 1 testis Ctbp1 1415702_a_at 0 testis Ctcf 1418330_at 1 testis Ctla2a 1416811_s_at 0 testis Ctnnb1 1420811_a_at 1 testis Ctsb 1417490_at 1 testis Ctsd 1448118_a_at 1 testis Cwf19l2 1456019_at 0 testis Cyld 1429618_at 1 testis D030074E01Rik 1428969_at 1 testis D0HXS9928E 1419516_at 1 testis D12Ertd551e 1428408_a_at 0 testis D4Wsu53e 1417001_a_at 1 testis Ddi2 1435536_at 1 testis Ddx3x 1423043_s_at 1 testis Ddx50 1417875_at 1 testis Degs1 1423346_at 1 testis Dek 1452659_at 1 testis Dicer1 1460571_at 1 testis Dirc2 1454654_at 1 testis Dlg1 1415691_at 1 testis Dmxl1 1424672_at 1 testis Dnajc13 1434038_at 1 testis Dpy19l4 1434860_at 1 testis Dynlrb1 1428257_s_at 1 testis E130014J05Rik 1455300_at 1 testis E430025E21Rik 1434132_at 1 testis Edem3 1460401_at 1 testis Ehmt1 1454776_at 1 testis Eif2s3x 1423744_x_at 1 testis Eif3f 1427021_s_at 0 testis Eif3s1 1452052_s_at 0 testis Eif3s10 1448425_at 1 testis Eif4a2 1450934_at 1 testis Eif4b 1426380_at 0 testis Elk4 1427162_a_at 1 testis ENSMUST00000074813.4 1435891_x_at 0 testis Epc2 1455317_at 1 testis Erbb2ip 1428011_a_at 1 testis Esd 1417825_at 1 testis Esf1 1434942_at 1 testis Ethe1 1417203_at 0 testis Etohi1 1429712_at 1 testis Ets1 1452163_at 0 testis Ets2 1416268_at 1 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press testis Exoc5 1436817_at 1 testis Fcho2 1437200_at 0 testis Fiat 1434681_at 1 testis Fkrp 1436812_at 1 testis Fth1 1448771_a_at 1 testis Ftl1 1418364_a_at 0 testis Fundc1 1424215_at 1 testis Gabpa 1450664_at 0 testis Galnact2 1424431_at 1 testis Gcc2 1429081_at 1 testis Gdi1 1451070_at 1 testis Glud1 1416209_at 1 testis Gm608 1428681_at 1 testis Gnas 1450186_s_at 1 testis Gnl3l 1439009_at 1 testis Golph4 1428875_at 1 testis Got2 1417715_a_at 1 testis Gpd1l 1438195_at 0 testis Gpkow 1434344_at 0 testis Gpr175 1460276_a_at 1 testis Gse1 1455476_a_at 0 testis H2-T10 1449875_s_at 0 testis Heca 1434478_at 0 testis Hectd1 1424141_at 1 testis Hiatl1 1416369_at 1 testis Hibch 1451512_s_at 1 testis Hif1a 1427418_a_at 1 testis Hist1h2bc 1418072_at 0 testis Hltf 1450889_at 1 testis Hnrpa3 1428262_s_at 0 testis Hnrph2 1415963_at 1 testis Hnrpk 1460547_a_at 0 testis Hp1bp3 1415751_at 1 testis Hprt1 1448736_a_at 1 testis Hps3 1450647_at 0 testis Hrsp12 1428326_s_at 1 testis Hsp90ab1 1416364_at 1 testis Hspd1 1426351_at 1 testis Hspe1 1450668_s_at 1 testis Idh3g 1416789_at 1 testis Ids 1455481_at 1 testis Ikbkg 1454690_at 1 testis Impad1 1437288_at 0 testis Ipo7 1454955_at 1 testis Ipo8 1426760_at 1 testis Ireb2 1433527_at 0 testis Irf2bp2 1433634_at 1 testis Isoc1 1425052_at 0 testis Itch 1415769_at 1 testis Itgav 1452784_at 1 testis Jak1 1433805_at 1 testis Jak2 1421066_at 1 testis Jhdm1d 1456150_at 0 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press testis Jmjd1c 1426900_at 1 testis Jmjd2c 1424458_at 1 testis Jtb 1424283_at 1 testis Kif13a 1455746_at 1 testis Kif5b 1418429_at 1 testis Klf3 1454666_at 1 testis Klhl9 1433442_at 0 testis Kpna3 1450386_at 1 testis Ktelc1 1426535_at 1 testis Ktn1 1455434_a_at 1 testis Lactb2 1425140_at 1 testis Lamp2 1434503_s_at 1 testis Larp4 1439010_at 1 testis Larp5 1434598_at 1 testis Lcor 1443779_s_at 1 testis Lims1 1418232_s_at 0 testis Lman1 1452671_s_at 0 testis Lmbrd2 1429771_at 0 testis Lnpep 1433747_at 1 testis LOC626832 1427174_at 0 testis Lpl 1415904_at 1 testis Lpp 1436714_at 0 testis Lrp6 1428500_at 1 testis Lrrfip1 1433842_at 0 testis Lyrm5 1418996_a_at 1 testis Malat1 1418189_s_at 1 testis Man1a 1417111_at 1 testis Map2k1 1416351_at 1 testis Map2k4 1451982_at 1 testis Map3k2 1455597_at 1 testis Map3k7ip2 1423462_at 1 testis Mapbpip 1422797_at 0 testis Mapk14 1416703_at 1 testis Mbnl1 1416904_at 1 testis Mbnl2 1433754_at 1 testis Mbtps2 1436883_at 1 testis Mcart1 1433816_at 1 testis Mcts1 1425018_at 1 testis Mdh1 1436834_x_at 1 testis Mdh2 1433984_a_at 1 testis Med13 1453160_at 1 testis Med14 1437632_at 1 testis Mettl9 1438171_x_at 0 testis Mfhas1 1429005_at 0 testis Mier1 1433755_at 1 testis Mll3 1434178_at 1 testis Mobkl1a 1455184_at 0 testis Mobkl3 1423167_at 1 testis Mospd2 1424124_at 1 testis Mpp1 1450919_at 1 testis Mrpl23 1416948_at 1 testis Msl31 1448645_at 0 testis Mt-Nd6 1426088_at 1 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press testis Myadm 1439389_s_at 1 testis Myh9 1420172_at 1 testis Nab1 1417624_at 1 testis Nars 1452866_at 1 testis Nat13 1428409_at 1 testis Cdkn1b 1434045_at 0 testis Nbeal1 1453174_at 1 testis Ncor1 1423201_at 1 testis Ndst1 1460436_at 0 testis Ndufa1 1422241_a_at 0 testis Ndufa4 1424085_at 1 testis Ndufb11 1455911_x_at 1 testis Nedd4 1450431_a_at 1 testis Nek7 1416816_at 1 testis Neu1 1416831_at 1 testis Nhlrc2 1429145_at 0 testis Nisch 1452156_a_at 1 testis Nkap 1435662_at 1 testis Nono 1448103_s_at 1 testis Notch1 1418634_at 1 testis Npc1 1423086_at 1 testis Nptn 1415821_at 1 testis Nr3c1 1460303_at 1 testis Nrp1 1448943_at 1 testis Nsbp1 1418152_at 0 testis Nucks1 1433519_at 1 testis Ogt 1460631_at 1 testis Ormdl1 1451219_at 0 testis Osbp 1460350_at 0 testis Ostm1 1428334_at 1 testis Otud6b 1428277_at 1 testis Oxsr1 1426933_at 1 testis P2ry5 1428615_at 1 testis Pabpc4 1451296_x_at 1 testis Pbrm1 1426877_a_at 1 testis Pcbd2 1452621_at 0 testis Pcmtd1 1455388_at 1 testis Pcnp 1428314_at 1 testis Pcyox1 1447277_s_at 1 testis Pdcl 1425149_a_at 1 testis Pdcl3 1424002_at 1 testis Pdgfrb 1436970_a_at 1 testis Pdha1 1418560_at 1 testis Pds5a 1434215_at 1 testis Pdzd8 1435440_at 0 testis Pggt1b 1438229_at 1 testis Pgk1 1417864_at 1 testis Phc3 1455312_at 1 testis Phip 1429004_at 1 testis Phkb 1434511_at 1 testis Phlda1 1418835_at 0 testis Picalm 1451316_a_at 0 testis Pik3ca 1460326_at 1 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press testis Pik3r1 1438682_at 1 testis Plekha2 1417288_at 1 testis Pnpla8 1417768_at 0 testis Pnpt1 1452676_a_at 1 testis Pnrc1 1433668_at 0 testis Pnrc2 1416187_s_at 1 testis Polr3f 1439075_at 1 testis Ppp1ca 1460165_at 1 testis Ppp1cb 1426205_at 1 testis Ppp2ca 1417367_at 1 testis Ppp2r1a 1438383_x_at 0 testis Ppp3cb 1428473_at 1 testis Ppp3r1 1433591_at 1 testis Ppp4r2 1433850_at 0 testis Pqbp1 1456086_x_at 1 testis Prkacb 1420611_at 1 testis Prkcbp1 1426614_at 1 testis Prpf4b 1455696_a_at 1 testis Psma1 1415695_at 1 testis Psmc6 1417771_a_at 1 testis Ptp4a1 1438657_x_at 0 testis Ptpn11 1451225_at 1 testis Ptprc 1422124_a_at 0 testis Pts 1450660_at 1 testis Pum2 1418016_at 1 testis Pura 1420628_at 0 testis Rab1 1416082_at 1 testis Rab10 1453095_at 1 testis Rab14 1419246_s_at 1 testis Rab18 1420900_a_at 1 testis Rab5a 1416426_at 1 testis Rab7 1415734_at 1 testis Rab9 1448391_at 1 testis Rabggtb 1419553_a_at 1 testis Rac1 1451086_s_at 1 testis Rag1ap1 1448948_at 1 testis Ranbp2 1450690_at 1 testis Rap1a 1424139_at 1 testis Rap1gds1 1425266_a_at 1 testis Rap2c 1437016_x_at 1 testis Rapgef2 1452833_at 1 testis Raph1 1434302_at 0 testis Rbbp5 1428886_at 1 testis Rbm18 1420608_at 1 testis Rbm39 1426671_a_at 1 testis Rbm41 1456027_at 1 testis Rc3h2 1426924_at 0 testis Reep3 1424780_a_at 1 testis Rell1 1452359_at 1 testis Rheb 1416636_at 1 testis Rhoq 1427918_a_at 1 testis Rmnd5a 1426884_at 1 testis Rnf13 1451074_at 1 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press testis Rock1 1450994_at 1 testis Rock2 1451041_at 1 testis Rod1 1455819_at 0 testis Rpl10 1448157_s_at 1 testis Rpl10a 1431177_a_at 0 testis Rpl17 1435791_x_at 1 testis Rpl36a 1416807_at 1 testis Rpl39 1450840_a_at 1 testis Rpl5 1423665_a_at 1 testis Rps3 1435151_a_at 1 testis Rps3a 1422475_a_at 1 testis Rps4x 1416276_a_at 1 testis Rps6ka3 1455206_at 1 testis Rps6kb1 1454956_at 1 testis Rpsa 1448245_at 0 testis Rrm2b 1433773_at 0 testis Rsf1 1438062_at 1 testis S100a10 1456642_x_at 1 testis Sacm1l 1416500_at 1 testis Sat1 1420502_at 1 testis Scp2 1449686_s_at 0 testis Sdf2 1416857_at 1 testis Seh1l 1424200_s_at 1 testis Senp6 1452627_at 1 testis Senp7 1436860_at 0 testis Sepp1 1452141_a_at 1 testis Septin11 1429234_s_at 1 testis Septin7 1454610_at 1 testis Serinc1 1448108_at 1 testis Setd2 1428555_at 1 testis Sfrs2ip 1452884_at 1 testis Sh3bgrl 1436997_x_at 1 testis Skil 1452214_at 1 testis Slc17a5 1429116_at 1 testis Slc25a12 1428440_at 1 testis Slc25a15 1420967_at 0 testis Slc25a3 1416300_a_at 1 testis Slc25a37 1417750_a_at 0 testis Slc25a46 1418134_at 0 testis Slc35a1 1417538_at 1 testis Slc35e1 1434103_at 1 testis Slc38a2 1426722_at 1 testis Slc44a1 1433645_at 1 testis Slc9a6 1435008_at 1 testis Slk 1433999_at 1 testis Smad4 1422486_a_at 1 testis Smarcad1 1452276_at 1 testis Smc1a 1417830_at 1 testis Snx2 1460224_at 1 testis Snx5 1448791_at 1 testis Socs6 1435492_at 1 testis Sorbs1 1436737_a_at 0 testis Sp3 1431804_a_at 1 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press testis Spag9 1433648_at 0 testis Spnb2 1452143_at 1 testis Spop 1416524_at 1 testis Sr140 1454914_at 1 testis Sri 1450878_at 1 testis Ssbp1 1427965_at 1 testis Ssr3 1447053_x_at 1 testis Stag2 1421849_at 1 testis Stat5b 1422103_a_at 1 testis Stat6 1426353_at 0 testis Strn3 1423535_at 1 testis Stxbp5 1435398_at 0 testis Suhw4 1426556_at 0 testis Suv420h1 1434999_at 1 testis Sybl1 1426269_at 1 testis Taok1 1424657_at 1 testis Taz 1416207_at 1 testis Tbc1d2b 1428508_at 0 testis Tbc1d8b 1430133_at 1 testis Tcf12 1427670_a_at 1 testis Tcf4 1416723_at 1 testis Tgfbr2 1426397_at 1 testis Tgs1 1421904_at 1 testis Them2 1417316_at 1 testis Thoc2 1444004_at 1 testis Tigd2 1429194_at 1 testis Tmed2 1455968_x_at 1 testis Tmed5 1424573_at 1 testis Tmem106b 1435074_at 1 testis Tmem160 1460424_at 1 testis Tmem32 1436705_at 1 testis Tmem50a 1453155_at 1 testis Tmem55a 1424293_s_at 1 testis Tmem77 1453731_a_at 1 testis Tnks2 1428388_at 1 testis Tnrc6a 1439244_a_at 1 testis Tnrc6b 1436982_at 0 testis Top1 1423474_at 1 testis Top2b 1416731_at 1 testis Tpm4 1433883_at 1 testis Tpp1 1448313_at 1 testis Tpr 1426949_s_at 1 testis Tpt1 1416642_a_at 0 testis Traf3 1418587_at 1 testis Trak2 1435016_at 1 testis Trappc2 1432158_a_at 1 testis Trim2 1459860_x_at 0 testis Trove2 1436534_at 1 testis Trpm7 1416799_at 1 testis Ttc14 1437878_s_at 1 testis Ttc17 1428862_at 1 testis Ttc33 1423958_a_at 1 testis Txn1 1416119_at 1 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press testis Txndc10 1419925_s_at 1 testis Txnl1 1436947_a_at 1 testis Txnl4 1433698_a_at 1 testis Ube1c 1435164_s_at 1 testis Ube1dc1 1435247_at 1 testis Ube2g1 1415688_at 1 testis Ubl4 1424539_at 1 testis Ubp1 1455222_a_at 0 testis Ubr2 1429515_at 1 testis Ubxd4 1425020_at 0 testis Ugdh 1416308_at 1 testis Upf2 1435030_at 0 testis Uprt 1435822_at 1 testis Usp25 1448939_at 0 testis Usp33 1426709_a_at 1 testis Usp45 1427991_s_at 0 testis Usp9x 1428194_at 1 testis Utp6 1424501_at 1 testis Utx 1427235_at 1 testis Vbp1 1421750_a_at 1 testis Vdac1 1436992_x_at 1 testis Vdp 1424274_at 1 testis Vezf1 1429085_at 1 testis Vps13c 1439616_at 1 testis Vps35 1415783_at 0 testis Vps4b 1417007_a_at 0 testis Vps54 1418479_at 1 testis Wdr44 1435051_at 1 testis Wwp1 1452299_at 0 testis Xbp1 1437223_s_at 1 testis Yipf6 1455111_at 0 testis Ythdf3 1426840_at 1 testis Zbtb20 1437598_at 0 testis Zbtb33 1434022_at 1 testis Zbtb41 1428779_at 1 testis Zc3h11a 1415764_at 1 testis Zcchc6 1433910_at 1 testis Zcchc9 1424557_at 1 testis Zdhhc6 1439057_x_at 0 testis Zfml 1417791_a_at 1 testis Zfp106 1425332_at 1 testis Zfp120 1421519_a_at 1 testis Zfp131 1428616_at 0 testis Zfp148 1449069_at 1 testis Zfp160 1452126_at 1 testis Zfp161 1420865_at 0 testis Zfp26 1427120_at 0 testis Zfp260 1419165_at 1 testis Zfp292 1449515_at 1 testis Zfp322a 1452374_at 1 testis Zfp364 1437009_a_at 1 testis Zfp445 1454774_at 1 testis Zfp52 1426471_at 0 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press testis Zfp617 1449546_a_at 1 testis Zfp655 1428341_at 1 testis Zfp68 1448760_at 1 testis Zfp758 1451902_at 0 testis Zfp790 1426292_at 1 testis Zfx 1425972_a_at 1 testis Zkscan3 1415689_s_at 1 testis Zmpste24 1427923_at 1 testis Zranb2 1454652_at 0 testis Zzz3 1434332_at 0 thymus Cgrrf1 1434565_at 1 thymus Cpeb2 1434272_at 1 thymus Evi5 1417513_at 1 thymus Gstm5 1416842_at 1 thymus Ppap2a 1422619_at 1 thymus Prkce 1452878_at 1 thymus Scamp1 1426775_s_at 1 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press Table S2 adipose adrenalgland bonemarrow brain eye fetus heart islets kidney liver lung muscle ovary pituitary placenta salivary seminalvesicle smallintestine spleen testis thymus adipose 2 3 1 1 1 3 1 1 2 1 0 1 0 0 0 0 0 0 2 1 adrenalgland 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 bonemarrow 18 13 20 13 15 19 13 14 27 19 0 0 0 2 5 0 21 35 37 17 brain 9 9 17 19 11 17 14 8 18 14 1 0 6 2 0 1 3 3 51 1 eye 0 1 3 8 0 5 0 0 2 1 0 0 0 1 1 0 0 0 1 0 fetus 2 3 3 6 2 2 2 3 2 3 0 2 1 1 1 0 0 1 0 1 heart 20 13 21 25 22 13 6 16 31 24 65 0 0 0 16 0 16 0 32 0 islets 3 4 9 12 2 2 3 4 12 3 0 0 1 0 1 0 4 0 1 0 kidney 0 0 0 1 1 0 3 0 0 0 0 0 0 0 0 0 0 0 1 0 liver 14 13 20 16 11 10 22 10 20 13 4 1 0 2 17 3 15 8 26 1 lung 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 muscle 3 2 6 7 3 2 63 3 3 7 5 0 0 0 2 1 4 0 14 0 ovary 3 1 2 2 0 3 0 0 0 1 3 0 0 0 0 0 1 0 0 0 pituitary 2 3 3 3 3 2 2 4 2 2 3 0 0 0 1 1 0 1 1 0 placenta 0 1 7 4 0 0 0 3 0 3 1 0 0 2 2 1 2 4 13 1 salivary 13 9 20 10 12 8 22 12 9 33 14 0 0 0 0 9 13 5 28 0 seminalvesicle 0 2 1 4 0 0 1 2 0 6 2 2 0 0 2 5 0 1 4 0 smallintestine 4 4 14 5 4 4 6 1 3 12 10 0 0 0 0 6 1 3 17 1 spleen 6 5 27 5 5 5 7 3 5 9 8 0 0 3 1 2 3 2 3 3 testis 55 47 111 83 47 42 97 37 44 89 70 0 0 0 4 21 0 41 5 7 thymus 2 1 17 2 2 2 3 1 2 5 4 2 0 1 1 0 0 6 4 8 Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press Table S3

Repressed in Gene Symbol Affymetrix ID 3T3-L1 Rnf113a2 1428415_at 3T3-L1 Fam134b 1424683_at Baf3 Lpgat1 1424349_a_at Baf3 Lyst 1434674_at Baf3 Snx18 1416359_at Baf3 Klraq1 1428655_at Baf3 Hadh 1455972_x_at Baf3 Aco1 1456728_x_at Baf3 LOC100046855 1454666_at Baf3 Evi5 1417513_at Baf3 Ccdc90b 1428505_at Baf3 Prdx4 1416167_at C2C12 Zfp263 1447432_s_at C2C12 Bscl2 1437345_a_at C3H_10T1_2 1810013D10Rik 1454614_at cerebellum Akap13 1433722_at cornea Ctsz 1417868_a_at embryonic_stem_line_Bruce4_p13 --- 1426819_at eyecup Atp6v1h 1415826_at eyecup Stk16 1426160_a_at eyecup Cops8 1415934_at eyecup Cops5 1460171_at eyecup Dars 1423800_at eyecup Atp5b 1416829_at eyecup Smarcb1 1416045_a_at eyecup Rnf167 1430527_a_at eyecup Prpf8 1422453_at eyecup Mrpl10 1418112_at eyecup Psmc5 1415740_at eyecup Psmd12 1448492_a_at eyecup Ccdc104 1451442_at eyecup LOC100048812Spag7 1433940_at eyecup Cltc 1454626_at eyecup Srp68 1433708_at eyecup Scfd1 1428335_a_at eyecup Actr10 1417157_at eyecup Ahsa1 1424147_at eyecup Psmc1 1416005_at eyecup Golga5 1418447_at eyecup LOC100047588Mark3 1418316_a_at eyecup Dld 1423159_at eyecup Nsun2 1423850_at eyecup Rab24 1421872_at eyecup Rad17 1448762_at eyecup Vdac2 1415990_at eyecup Med4 1417844_at eyecup Copz1 1451825_a_at eyecup Eif3d 1416100_at eyecup Eif2b5 1433886_at eyecup Usp16 1431951_a_at Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press eyecup Cct8 1415785_a_at eyecup Brp44l 1453651_a_at eyecup 1300018I05Rik 1423681_at eyecup Hnrnpm 1426698_a_at eyecup Csnk2b 1416728_at eyecup 2410015M20Rik 1427909_at eyecup Lrpprc 1424353_at eyecup Pik3c3 1425580_a_at eyecup Smad2 1420634_a_at eyecup Mtx2 1430500_s_at eyecup Psmc3 1416282_at eyecup Ccndbp1 1420745_a_at eyecup Mrps5 1448488_at eyecup Rpn2 1418896_a_at eyecup Prpf18 1429614_at eyecup 2900010J23Rik 1433480_at eyecup Psmb7 1416240_at eyecup Atf2LOC100047997 1426583_at eyecup Ndufs3 1423737_at eyecup Eif3m 1451076_s_at eyecup Ciao1 1450953_at eyecup Pcna 1417947_at eyecup Psma7 1423567_a_at eyecup Plrg1 1448282_at eyecup Ssr2 1449930_a_at eyecup sep/15 1448903_at eyecup Cog6 1426216_at eyecup Bxdc5 1431784_a_at eyecup Sf3a3 1423811_at eyecup Cpsf3l 1423964_at eyecup Dctn3 1416247_at eyecup Stoml2 1448774_at eyecup 0610007C21Rik 1428380_at eyecup Exoc1 1451142_at eyecup Uso1 1424274_at eyecup Cops4 1416163_at eyecup Pop5 1417972_s_at eyecup Rnf34 1415791_at eyecup Arpc1a 1416079_a_at eyecup Commd8 1430129_a_at eyecup Rchy1 1432144_a_at eyecup Sec31a 1453014_a_at eyecup Mepce 1424288_at eyecup Ruvbl1 1416585_at eyecup Jagn1 1417064_at eyecup Copg2 1448761_a_at eyecup Raf1 1425419_a_at eyecup Ngrn 1416709_a_at eyecup 1110004F10Rik 1423335_at eyecup Chmp2a 1425591_a_at eyecup Psmd8 1423296_at eyecup Cyth2 1450103_a_at eyecup l7Rn6 1419352_at Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press eyecup Spcs2 1423215_at eyecup Copb1 1423301_at eyecup Psma1 1415695_at eyecup Xpo6 1422759_a_at eyecup Ppp4c 1460288_a_at eyecup LOC100044385Ppp2cb 1421823_a_at eyecup Ufsp2 1418319_at eyecup Lonp2 1460178_at eyecup Nip7 1448480_at eyecup D030016E14Rik 1433752_s_at eyecup Abce1 1416015_s_at eyecup Itfg1 1419041_at eyecup 2310065K24Rik 1417243_at eyecup Cnot1 1434251_at eyecup KarsLOC631033 1416068_at eyecup Fam76b 1452268_at eyecup 2010321M09Rik 1426347_at eyecup Clpx 1423447_at eyecup Tusc4 1417046_at eyecup Exosc7 1448365_at eyecup Clk3 1423849_a_at eyecup Snx14 1456039_at eyecup Nck1 1421487_a_at eyecup Uba1 1448116_at follicular_B-cells Itm2c 1415961_at follicular_B-cells Scamp1 1426775_s_at follicular_B-cells Hnrpll 1425255_s_at granulocytes_mac1+gr1+ Dnaja3 1449935_a_at granulocytes_mac1+gr1+ Cdc16 1425554_a_at lens AI428898Ccnl2 1432195_s_at liver Fam20b 1451668_at liver Oxct1 1449059_a_at liver Lass5 1451209_at liver Ankrd12Ankrd12-like 1440193_at liver Btbd10LOC100047893 1438578_a_at liver Slc25a36 1419657_a_at macrophage_bone_marrow_24h_LPS Arglu1 1433597_at macrophage_peri_LPS_thio_1hrs Zfp422-rs1 1434896_at macrophage_peri_LPS_thio_7hrs 2700094K13Rik 1436349_at macrophage_peri_LPS_thio_7hrs Cbx3 1416884_at macrophage_peri_LPS_thio_7hrs Acat1 1424183_at mast_cells 100040836EG665957Hmgn1LOC100044391OTTMUSG00000003181 1438940_x_at mast_cells Ahcyl2 1452703_at mast_cells_IgE Mrps34 1421971_a_at mega_erythrocyte_progenitor Spna2 1427888_a_at min6 Fam107b 1416892_s_at min6 Rbms1 1434005_at min6 Cat 1416429_a_at min6 Ldha 1419737_a_at min6 Oat 1416452_at min6 ENSMUSG00000044330Higd1aLOC100045763 1416480_a_at min6 Mospd1 1424280_at neuro2a Fam174a 1419170_at Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press neuro2a Rdh14 1417438_at neuro2a Klhl22 1426481_at neuro2a Dscr3 1415745_a_at neuro2a Svil 1460694_s_at neuro2a Fam122a 1430769_s_at neuro2a 5730494N06Rik 1452773_at neuro2a Suhw4 1426556_at neuro2a Diap2 1442003_at neuro2a BC023829LOC100045774 1435228_at nih_3T3 Sumo3 1422457_s_at nih_3T3 Cdyl 1418071_s_at pancreas Wdr82 1452189_at RAW_264_7 Mfap1aMfap1b 1449445_x_at RAW_264_7 Decr1 1419367_at retina Acadl 1448987_at retina 0610007L01Rik 1428544_at retina Arpc1b 1416226_at retina Lpcat3 1423960_at skeletal_muscle ENSMUSG00000074747 1428128_at skeletal_muscle LOC636537Ssr1 1417763_at T-cells_CD8+ Aldh2 1448143_at testis Pcmtd1 1455388_at testis Pdcl3 1424002_at testis Nucks1 1433519_at testis Edem3 1460401_at testis Fam168b 1434018_at testis Actr3 1434968_a_at testis Nek7 1416816_at testis Stx7 1418436_at testis Ostm1 1428334_at testis EG545124ENSMUSG00000051559Tdg 1435715_x_at testis Cnpy2 1437783_x_at testis Xbp1 1437223_s_at testis Ube2g1 1415688_at testis Sdf2 1416857_at testis Vezf1 1429085_at testis Actr2 1452587_at testis Ccng1 1420827_a_at testis 1200003C05Rik 1424106_at testis EG621629Ubxn2a 1425020_at testis Pcbd2 1452621_at testis 2810008M24RikLOC100046418 1452737_at testis Fam120a 1433572_a_at testis Hiatl1 1416369_at testis ENSMUSG00000072684 1435740_at testis Esd 1417825_at testis Slc25a37 1417750_a_at testis 1200011I18Rik 1454998_at testis Ttc33 1423958_a_at testis E430025E21Rik 1434132_at testis --- 1420172_at testis Bach1 1440831_at testis Ktelc1 1426535_at Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press testis Pcnp 1428314_at testis Arid1b 1455979_at testis Rab5a 1416426_at testis 9030612M13Rik 1433784_at testis Phax 1450778_a_at testis LOC100048076Smad4 1422486_a_at testis Pdzd8 1435440_at testis Pdcl 1425149_a_at testis Arl5a 1433951_at testis Slc25a12 1428440_at testis 2310001A20Rik 1452159_at testis Prkcbp1 1426614_at testis Ythdf3 1426840_at testis Jtb 1424283_at testis Rnf115 1437009_a_at testis Tmem77 1453731_a_at testis Gyg 1459522_s_at testis Ssr3 1447053_x_at testis Rapgef2 1452833_at testis Rag1ap1 1448948_at testis Rap1a 1424139_at testis Cept1 1416471_at testis Chmp5 1432270_a_at testis Mcart1 1433816_at testis Cmpk1 1423073_at testis Zmpste24 1427923_at testis Eif2c1 1434331_at testis Tmem50a 1453155_at testis ENSMUSG00000074460Tmed2 1455968_x_at testis LOC100047161Rheb 1416636_at testis Ctbp1LOC100045360 1415702_a_at testis Ugdh 1416308_at testis B230308N11Rik 1434215_at testis Tmem160 1460424_at testis 2400001E08RikEG433216 1417463_a_at testis Smpd1 1448621_a_at testis Tpp1 1448313_at testis 8430410K20RikLOC100044209 1424993_at testis --- 1439616_at testis Shisa5 1437503_a_at testis Sacm1l 1416500_at testis Ei24 1416555_at testis Map2k1 1416351_at testis Atp6ap2 1437688_x_at testis Zbtb33 1434022_at testis Mcts1 1425018_at testis Xiap 1437533_at testis Atp6ap1 1449622_s_at testis Gdi1 1451070_at testis Fam50a 1419516_at testis Vbp1 1421750_a_at testis Nono 1448103_s_at testis Pgk1 1417864_at Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press testis 100040331EG624713EG666243EG667549LOC100048339OTTMUSG00000005111OTTMUSG00000009278Rpl36aRpl36al 1416807_at testis Smc1a 1417830_at testis Ccdc22 1418347_at testis Rpl39 1450840_a_at testis C1galt1c1 1416655_at testis Thoc2 1444004_at testis Mmgt1 1436705_at testis Rps4x 1416276_a_at testis Abcb7 1435006_s_at testis Mbtps2 1436883_at testis Pdha1 1418560_at testis Rab9 1448391_at testis Msl3 1448645_at testis Vamp7 1426269_at thymocyte_DP_CD4+CD8+ Vti1b 1449003_a_at thymocyte_DP_CD4+CD8+ Dci 1418321_at thymocyte_DP_CD4+CD8+ Itfg3 1434387_at thymocyte_DP_CD4+CD8+ Tmem126a 1451000_at Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press

Tissue-specific disallowance of housekeeping genes: the other face of cell differentiation

Lieven Thorrez, Ilaria Laudadio, Katrijn Van Deun, et al.

Genome Res. published online November 18, 2010 Access the most recent version at doi:10.1101/gr.109173.110

Supplemental http://genome.cshlp.org/content/suppl/2010/11/19/gr.109173.110.DC1 Material

P

Accepted Peer-reviewed and accepted for publication but not copyedited or typeset; accepted Manuscript manuscript is likely to differ from the final, published version.

Open Access Freely available online through the Genome Research Open Access option.

License This manuscript is Open Access.

Email Alerting Receive free email alerts when new articles cite this article - sign up in the box at the Service top right corner of the article or click here.

Advance online articles have been peer reviewed and accepted for publication but have not yet appeared in the paper journal (edited, typeset versions may be posted when available prior to final publication). Advance online articles are citable and establish publication priority; they are indexed by PubMed from initial publication. Citations to Advance online articles must include the digital object identifier (DOIs) and date of initial publication.

To subscribe to Genome Research go to: https://genome.cshlp.org/subscriptions

Copyright © 2010, Cold Spring Harbor Laboratory Press