DOCSLIB.ORG

Supplemental Table 1A: VACV-Derived Orfs Containing CD8+ T Cell Epitopes

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplemental Table 1A: VACV-Derived Orfs Containing CD8+ T Cell Epitopes Supplemental Table 1A: VACV-derived ORFs containing CD8+ T cell epitopes ORF # VACWR# (Name) GenBank accession # Size 9- and 10-mers Description 12 K ORF B 79 141 20 VACWR062(E6R) 66275859 567 1117 unknown 21 VACWR063(E7R) 66275860 166 315 soluble, myristylprotein has N-myristyltransferase target MGxxxS/T/A 25 VACWR077(I8R) 66275874 676 1335 RNA-helicase, DExH-NPH-II; DNA-helicase aided by L4R 26 VACWR080(G2R) 66275877 220 423 late transcription elongation factor 27 VACWR084(G6R) 66275881 165 313 unknown 29 VACWR086(G8R) 66275883 260 503 late gene transcription VLTF-1 30 VACWR087(G9R) 66275884 340 663 myristylprotein 31 VACWR091(L4R) 66275888 251 485 core protein vp8; microtubule-associated, ssRNA/ssDNA-binding protein 34 VACWR094(J2R) 66275891 177 337 thymidine kinase 35 VACWR095(J3R) 66275892 333 649 multifunctional poly-A polymerase subunit, cap methyltransferase, and transcription elongation factor 36 VACWR096(J4R) 66275893 185 353 DNA-dependent RNA polymerase subunit rpo22 37 VACWR098(J6R) 66275895 1287 2557 DNA-dependent RNA polymerase subunit rpo147 42 VACWR106(D1R) 66275903 844 1671 large subunit of mRNA capping enzyme; transcription termination factor VTF 45 VACWR109(D4R) 66275906 218 419 uracil-DNA glycosylase interacts with A20R; essential for DNA replication 46 VACWR110(D5R) 66275907 785 1553 NTPase interacts with A20R; essential for DNA replication 57 VACWR127(A8R) 66275924 288 559 32kDa small subunit of transcription factor VITF-3 used for intermediate gene expression 62 VACWR138(A18R) 66275935 493 969 DNA helicase; effects elongation and termination of postreplicative viral transcription 65 VACWR143(A23R) 66275940 382 747 45kDa large subunit of intermediate gene transcription factor VITF-3 66 VACWR144(A24R) 66275941 1164 2311 DNA-dependent RNA polymerase subunit rpo132 68 A ORF K 70 123 69 VACWR154(A31R) 66275951 124 231 unknown 71 VACWR156(A33R) 66275953 185 353 EEV membrane phosphoglycoprotein associates with A36R; involved in CEV-cell adherence and actin tail formation 72 VACWR157(A34R) 66275954 168 319 EEV glycoprotein involved in CEV cell adherence and actin tail formation 73 VACWR158(A35R) 66275955 176 335 unknown 74 VACWR159(A36R) 66275956 221 425 IEV transmembrane phosphoprotein interacts with A33R and used in actin tail formation 78 VACWR167(A42R) 66275964 133 249 profilin-like 82 VACWR172(A46R) 66275969 240 463 Toll/IL1-receptor [TIR]-like; suppresses TIR-dependent signal transduction; host defense modulator 84 VACWR176(A50R) 66275973 552 1087 DNA ligase 85 VACWR177(A51R) 66275974 334 651 unknown 86 VACWR178(A52R) 66275975 190 363 Toll/IL1-receptor [TIR]-like suppresses TIR-dependent signal transduction; host defense modulator 89 VACWR180(A55R) 66275977 564 1111 kelch-like 92 VACWR183(B1R) 66275980 300 583 ser/thr kinase essential for viral DNA replication 96 VACWR188(B6R) 66275985 173 329 ankyrin-like 98 VACWR190(B8R) 66275987 272 527 soluble interferon-gamma receptor-like; host defense modulator 100 VACWR192(B10R) 66275989 166 315 unknown 102 VACWR194(B12R) 66275991 283 549 ser/thr protein kinase-like 103 VACWR195(B13R) 66275992 345 673 SPI-2/CrmA inhibits Fas-mediated apoptosis, IL-1 convertase, lipoxygenase pathway 105 VACWR197(B16R) 66275994 326 635 IL-1-beta-inhibitor [VACWR-B15R]; prevents febrile response in VAC-mouse intranasal model; host defense modulator 107 VACWR200(B19R) 66275997 351 685 IFN-alpha/beta-receptor-like secreted glycoprotein; host defense modulator [VACWR-B18R] 111 VACWR205(C12L) 66276002 353 689 serine protease inhibitor-like SPI-1; host defense modulator 113 VACWR010(C10L) 66275807 331 645 IL-1 receptor antagonist (Kluczyk, 2002, Peptides, 23:823) 114 VACWR008(C19L) 66275805 112 207 [ITR] gene fragment, ankyrin-like 118 VACWR001(C23L)/VACWR218(B29R)66275798/66276015 244 471 [ITR] chemokine-binding protein; host defense modulator 125 VACWR013 66275810 68 119 interleukin-18-binding protein; host defense modulator; absent from VACCP 129 VACWR019(C9L) 66275816 634 1251 ankyrin-like 131 VACWR021(C7L) 66275818 150 283 host-range; possible host defense modulator 132 VACWR022(C6L) 66275819 151 285 unknown 133 VACWR023(C5L) 66275820 204 391 unknown 134 VACWR024(C4L) 66275821 315 613 unknown 135 VACWR025(C3L) 66275822 263 509 secreted complement binding [C3b/C4b]; host defense modulator 137 VACWR027(C1L) 66275824 229 441 unknown 139 VACWR029(N2L) 66275826 175 333 alpha-amanitin target 140 VACWR030(M1L) 66275827 420 823 ankyrin-like 141 VACWR031(M2L) 66275828 220 423 unknown 143 VACWR033(K2L) 66275830 369 721 serine protease inhibitor-like; SPI-3, prevents syncytia; host range determinant; host defense modulator 144 VACWR034(K3L) 66275831 88 159 interferon resistance; host defense modulator 148 VACWR040(F1L) 66275837 226 435 localizes to the mitochondria and inhibits apoptosis by interfering with the release of cytochrome c (Stewart, 2005, J.Virol, 79:1084) 149 VACWR041(F2L) 66275838 147 277 dUTPase 151 VACWR043(F4L) 66275840 319 621 ribonucleotide reductase small subunit 152 VACWR044(F5L) 66275841 322 627 unknown 157 VACWR049(F10L) 66275846 439 861 ser/thr kinase 158 VACWR051(F12L) 66275848 635 1253 involved in plaque and EEV formation; on IEV, not CEV, IV or IMV 159 VACWR052(F13L) 66275849 372 727 palmytilated EEV membrane protein; phospholipase motif, required for IEV formation 163 E ORF A 70 123 165 VACWR058(E2L) 66275855 737 1457 unknown 166 VACWR059(E3L) 66275856 190 363 double-stranded RNA binding protein; inhibits antiviral activities of interferon; host-range determinant; host defense modulator 170 VACWR065(E9L) 66275862 1006 1995 DNA polymerase 171 VACWR067(E11L) 66275864 129 241 virion core protein 172 VACWR068(O1L) 66275865 666 1315 unknown 174 VACWR070(I1L) 66275867 312 607 DNA-binding core protein 176 VACWR072(I3L) 66275869 269 521 ssDNA-binding phosphoprotein 177 VACWR073(I4L) 66275870 771 1525 ribonucleotide reductase large subunit 178 VACWR074(I5L) 66275871 79 141 IMV protein VP13 179 VACWR075(I6L) 66275872 382 747 unknown 183 VACWR085(G7L) 66275882 371 725 virion structural protein 188 VACWR102(H4L) 66275899 794 1571 RAP94; tightly associated with DNA-dependent RNA polymerase, aids early-stage transcription preinitiation and termination 196 VACWR117(D12L) 66275914 287 557 small subunit of mRNA capping enzyme; transcription termination factor VTF 197 VACWR118(D13L) 66275915 551 1085 rifampicin target associates with inner surface immature virus membrane 199 VACWR120(A2L) 66275917 224 431 late gene transcription factor VLTF-3 201 VACWR122(A3L) 66275919 643 1269 p4b precursor of core protein 4b 204 VACWR125(A6L) 66275922 371 725 unknown 205 VACWR126(A7L) 66275923 710 1403 82kDa large subunit of early gene transcription factor VETF 207 VACWR129(A10L) 66275926 891 1765 precursor p4a of core protein 4a, complexes with A4L 208 VACWR131(A12L) 66275928 192 367 core protein 209 VACWR133(A14L) 66275930 90 163 phosphorylated IMV membrane protein required for morphogenesis 212 VACWR137(A17L) 66275934 203 389 IMV membrane protein undergoes phosphorylation and proteolytic processing; required for morphogenesis 213 VACWR139(A19L) 66275936 77 137 unknown 221 VACWR149(A26L) 66275946 213 409 gene fragment, cowpox A-type inclusion protein 229 VACWR162(A38L) 66275959 277 537 CD47-like putative membrane protein 234 VACWR173(A47L) 66275970 252 487 unknown 237 B ORF A 107 197 250 VACWR039(K7R) 66275836 149 281 unknown 252 VACWR064(E8R) 66275861 273 529 membrane protein may help wrap virosome; associates with IV/IMV and cores; F10L kinase substrate 254 VACWR082(G5R) 66275879 434 851 unknown 256 VACWR089(L2R) 66275886 92 167 unknown 258 VACWR184(B2R) 66275981 219 421 unknown 260 VACWR050(F11L) 66275847 348 679 unknown 263 VACWR090(L3L) 66275887 350 683 unknown, non-membrane protein packaged in mature virus particles. Role in infectivity.Essential gene.(Resch and Moss, J.Virol., 2005) 264 VACWR101(H3L) 66275898 324 631 IMV heparin binding surface protein involved in IMV maturation 269 VACWR170(A44L) 66275967 345 675 hydroxysteroid dehydrogenase; deletion attenuates intradermal lesion in VAC-mouse model; host defense modulator 270 VACWR174(A48R) 66275971 203 391 thymidylate kinase Total: 67150 Supplemental Table 1B. Binding affinities of known HLA class I epitopes Binding capacity (IC50 NOTES Epitope Source organism MHC restriction1 nM)2 1. Restriction as reported at either the LANL-HIV database, SYFPEITHI YLLEMLWRL EBV A*0201 0.46 database, or the Immune Epitope Database (IEDB), or Bihl et al., The Journal LLWTLVVLL EBV A*0201 1.6 of Immunology, 2006, 176: 4094-4101. Only epitopes for which restriction LMPIIPLINV EBV A*0201 2.7 mapping had been done at the allele level were included. TLFIGSHVV EBV A*0201 15 SLVIVTTFV EBV A*0201 17 2. Exact redundancies were removed (i.e., reduced to a single entry), and the LLWAARPRL EBV A*0201 21 most "representative" example was selected. When duplicates differed as to CLGGLLTMV EBV A*0201 35 GLCTLVAML EBV A*0201 110 whether the peptide was a binder or not (500 nM used to define a binder), a VLQWASLAV EBV A*0201 247 geometric average was taken, and the replicate falling on the same side of the LLSAWILTA EBV A*0203 104 bind/not bind divide as the geometric average was taken as the representative SLREWLLRI EBV A*0203 4247 sample. LTAGFLIFL EBV A*0206 - AVFDRKSDAK EBV A*0301 59 Also, as much as could be identified, single (or double, when differences ATIGTAMYK EBV A*1101 2.1 were very conserved chemically) differences were treated as redundancies. IVTDFSVIK EBV A*1101 4.3 Peptides of 12 residues or longer were removed from both analysis sets, as in AVFDRKSDAK
Load more

Recommended publications
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
    [Show full text]
  • Enzymatic Manufacture of Deoxythymidine-5'-Triphosphate with Permeable Intact Cells of E. Coli Coexpressing Thymidylate Kinase
    J. Microbiol. Biotechnol. (2015), 25(12), 2034–2042 http://dx.doi.org/10.4014/jmb.1506.06020 Research Article Review jmb Enzymatic Manufacture of Deoxythymidine-5’-Triphosphate with Permeable Intact Cells of E. coli Coexpressing Thymidylate Kinase and Acetate Kinase Jiao Zhang, Yahui Qian, Qingbao Ding*, and Ling Ou* State Key Laboratory of Bioreactor Engineering, East China University of Science and Technology, Shanghai 200237, P.R. China Received: June 8, 2015 Revised: July 26, 2015 A one-pot process of enzymatic synthesis of deoxythymidine-5’-triphosphate (5’-dTTP) Accepted: September 11, 2015 employing whole cells of recombinant Escherichia coli coexpressing thymidylate kinase (TMKase) and acetate kinase (ACKase) was developed. Genes tmk and ack from E. coli were First published online cloned and inserted into pET28a(+), and then transduced into E. coli BL21 (DE3) to form September 15, 2015 recombinant strain pTA in which TMKase and ACKase were simultaneously overexpressed. It *Corresponding authors was found that the relative residual specific activities of TMKase and ACKase, in pTA Q.D. pretreated with 20 mM ethylene diamine tetraacetic acid (EDTA) at 25oC for 30 min, were 94% Phone: +86-21-64250676; Fax: +86-21-64250676; and 96%, respectively. The yield of 5’-dTTP reached above 94% from 5 mM deoxythymidine E-mail: [email protected] 5’-monophosphate (5’-dTMP) and 15 mM acetyl phosphate catalyzed with intact cells of pTA L.O. Phone: +86-21-64253257; pretreated with EDTA. The process was so effective that only 0.125 mM adenosine-5’- Fax: +86-21-64253257; triphosphate was sufficient to deliver the phosphate group from acetyl phosphate to dTMP E-mail: [email protected] and dTDP.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Overexpression of DNA Polymerase @Jsensitizes Mammalian Cells to 2',3'
    ICANCERRESEARCH57.I10-I 16,JanuaryI. I997J Overexpression of DNA Polymerase @JSensitizesMammalian Cells to 2',3'-Deoxycytidine and 3'-Azido-3' .deoxythymidine' Khalil Bouayadi, Jean-Sébastien Hoffmann, Pascal Fons, Michele Tiraby, Jean-Paul Reynes, and Christophe Cazaux2 Laboratoire de Microbiologic et de Génétique,UniversitéPaul Sabatier, 118 route de Narbonne, 31062 Toulouse cédex(K. B., P. F., C. C.]; Institut de Pharmacologic et Biologic Structurale. Centre National de Ia Recherche ScienujIque, UPR 9062, 205 route de Narbonne, 31077 Toulouse cédexfl. S. H.!; and Laboratoire CAYLA, ZI. Montaudran, 5 rue J. Rodier, 3/400 Toulouse (M. T., J. P. R.J ABSTRACT nator AZT-MP was also observed (10, 11). In vivo, AZT-MP is incorporated into cellular DNA (12), and it has been suggested that Mammalian DNA polymerase @3is a DNA repair enzyme expressed polymerase 13may play a role in this process (1 1). @ constitutively at a low level. In vitro, purified DNA polymerase (Pol) incorporates the nucleotide analogues 2'-3' deoxycytidine (ddC)-triphos AZT and ddC are antiviral agents currently used in the treatment phate and 3'-azido-3'-deoxythymidine (AZT)-triphosphate Into DNA, of AIDS. These chemotherapeutic drugs target HIV reverse tran causing chain termination. We have tested the possibility ofenhancing the scriptase which incorporates them into HIV DNA, terminating cytotoxicity of these chain terminators against mammalian cells by in DNA polymerization (13). In this study, we hypothesized that creasing the level of Pol (I. Chinese hamster ovary AA8 and murine overexpression of Pol f3, a cellular target of ddC and AZT, might melanoma B16 cell lines were stably transfected with rat pol fi cDNA render these analogues effective also against tumor cells.
    [Show full text]
  • The Metabolic Building Blocks of a Minimal Cell Supplementary
    The metabolic building blocks of a minimal cell Mariana Reyes-Prieto, Rosario Gil, Mercè Llabrés, Pere Palmer and Andrés Moya Supplementary material. Table S1. List of enzymes and reactions modified from Gabaldon et. al. (2007). n.i.: non identified. E.C. Name Reaction Gil et. al. 2004 Glass et. al. 2006 number 2.7.1.69 phosphotransferase system glc + pep → g6p + pyr PTS MG041, 069, 429 5.3.1.9 glucose-6-phosphate isomerase g6p ↔ f6p PGI MG111 2.7.1.11 6-phosphofructokinase f6p + atp → fbp + adp PFK MG215 4.1.2.13 fructose-1,6-bisphosphate aldolase fbp ↔ gdp + dhp FBA MG023 5.3.1.1 triose-phosphate isomerase gdp ↔ dhp TPI MG431 glyceraldehyde-3-phosphate gdp + nad + p ↔ bpg + 1.2.1.12 GAP MG301 dehydrogenase nadh 2.7.2.3 phosphoglycerate kinase bpg + adp ↔ 3pg + atp PGK MG300 5.4.2.1 phosphoglycerate mutase 3pg ↔ 2pg GPM MG430 4.2.1.11 enolase 2pg ↔ pep ENO MG407 2.7.1.40 pyruvate kinase pep + adp → pyr + atp PYK MG216 1.1.1.27 lactate dehydrogenase pyr + nadh ↔ lac + nad LDH MG460 1.1.1.94 sn-glycerol-3-phosphate dehydrogenase dhp + nadh → g3p + nad GPS n.i. 2.3.1.15 sn-glycerol-3-phosphate acyltransferase g3p + pal → mag PLSb n.i. 2.3.1.51 1-acyl-sn-glycerol-3-phosphate mag + pal → dag PLSc MG212 acyltransferase 2.7.7.41 phosphatidate cytidyltransferase dag + ctp → cdp-dag + pp CDS MG437 cdp-dag + ser → pser + 2.7.8.8 phosphatidylserine synthase PSS n.i. cmp 4.1.1.65 phosphatidylserine decarboxylase pser → peta PSD n.i.
    [Show full text]
  • Direct Induction of Gj-Specific Transcripts Following Reactivation of the Cdc28 Kinase in the Absence of De Novo Protein Synthesis
    Downloaded from genesdev.cshlp.org on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press Direct induction of Gj-specific transcripts following reactivation of the Cdc28 kinase in the absence of de novo protein synthesis Nicholas J. Marini and Steven I. Reed* The Scripps Research Institute, Department of Molecular Biology, La Jolla, California 92037 USA In Saccharomyces cerevisiae, the genes encoding the HO endonuclease, G,-specific cyclins CLNl and CLN2, as well as most proteins involved in DNA synthesis, are periodically transcribed with maximal levels reached in late G,. For HO and the DNA replication genes, cell cycle stage-specific expression has been shown to be dependent on the Cdc28 kinase and passage through START. Here, we show that cells released from cdc28*^ arrest in the presence of cycloheximide show wild-type levels of induction for HO, CLNl, and CDC9 (DNA ligase). Induction is gradual with a significant lag not seen in untreated cells where transcript levels fluctuate coordinately with the cell cycle. This lag may be due, at least in part, to association of the Cdc28 peptide with Gj cyclins to form an active kinase complex because overexpression of CLN2 prior to release in cycloheximide increases the rate of induction for CDC9 and HO. Consistent with this, release from pheromone arrest (where CLNl and CLN2 are not expressed) in cycloheximide shows no induction at all, Transcriptonal activation of CDC9 is likely to be mediated through a conserved promoter element also present in genes for other DNA synthesis enzymes similarly cell cycle regulated. The element contains an intact Mlul restriction enzyme recognition site (consensus ~5'-A/TPuACGCGTNA/T-3'), Insertion of a 20-bp fragment from the CDC9 promoter (containing a Mlul element) upstream of LacZ confers both periodic expression and transcriptional induction in cycloheximide following release from cdc28"' arrest.
    [Show full text]
  • A Review of Isozymes in Cancer1
    Cancer Research VOLUME31 NOVEMBER 1971 NUMBER11 [CANCER RESEARCH 31, 1523-1542, November 1971] A Review of Isozymes in Cancer1 Wayne E. Criss Department of Obstetrics and Gynecology, University of Florida College of Medicine, Gainesville, Florida 32601 TABLE OF CONTENTS postulated role for that particular isozymic system in cellular metabolism. Summary 1523 Introduction 1523 Normal enzyme differentiation 1523 INTRODUCTION Tumor enzyme differentiation 1524 Isozymes 1524 Normal Enzyme Differentiation DNA polymerase 1524 Enzyme differentiation is the process whereby, during the Hexokinase 1525 Fructose 1,6-diphosphatase 1525 development of an organ in an animal, the organ acquires the quantitative and qualitative adult enzyme patterns (122). Key Aldolase 1526 pathway enzymes in several metabolic processes have been Pyruvate kinase 1527 found to undergo enzymatic differentiation. The enzymes Láclatedehydrogenase 1527 Isocitrate dehydrogenase 1527 involved in nitrogen metabolism, and also in urea cycle Malate dehydrogenase 1528 metabolism (180), are tyrosine aminotransferase (123, 151, Glycerol phosphate dehydrogenase 1529 330, 410), tryptophan pyrrolase (261), serine dehydratase Glutaminase 1529 (123, 410), histidine ammonia lyase (11), and aspartate Aspartate aminotransferase 1530 aminotransferase (337, 388). The enzymes involved in nucleic Adenylate kinase 1531 acid metabolism are DNA polymerase (156, 277) and RNase (52). In glycolysis the enzymes are hexokinase-glucokinase Carbamyl phosphate synthetase 1531 Lactose synthetase 1533 (98, 389), galactokinase 30, aldolase (267, 315), pyruvate Discussion 1533 kinase (73, 386), and lactate dehydrogenase (67, 69). In References 1533 mitochondrial oxidation they are NADH oxidase, succinic oxidase, a-glycero-P oxidase, ATPase, cytochrome oxidase, and flavin content (84, 296). In glycogen metabolism the SUMMARY enzymes involved are UDPG pyrophosphorylase and UDPG glucosyltransferase (19).
    [Show full text]
  • Identification and Purification of a Factor That Binds to the Mlu I Cell Cycle Box of Yeast DNA Replication Genes
    Proc. Nati. Acad. Sci. USA Vol. 88, pp. 7155-7159, August 1991 Biochemistry Identification and purification of a factor that binds to the Mlu I cell cycle box of yeast DNA replication genes (Saccharomyces cerevisiae/G, phase/S phase/periodic transcription/DNA polymerase a) RATI VERMA, ARDEM PATAPOUTIAN, COLIN B. GORDON*, AND JUDITH L. CAMPBELL Braun Laboratories, California Institute of Technology, Pasadena, CA 91125 Communicated by John D. Roberts, May 15, 1991 ABSTRACT In Saccharomyces cerevisiae, the genes encod- that are a mixture of the sequences adjacent to both sites in ing at least 10 enzymes involved in DNA replication are the natural promoter confers periodicity (18). The Mlu I site periodically expressed in the late GI and S phases of the cell is necessary for the periodic expression of the CDC21 and cycle. All of these genes have one copy or more of the sequence CDC9 promoters as well (16, 17), suggesting coordinate ACGCGT, which conforms to the recognition site for the Mlu regulation of the entire set of periodic replication genes I restriction endonuclease. For the CDC21, CDC9, and POLl through Mlu I sites. We have designated the UAS that is genes, the Mlu I site has been shown to be absolutely required involved the Mlu I cell cycle box (MCB). for periodic transcription. Using nuclear extracts fractionated The MCB is a potential target for a trans-acting factor that by conventional and oligonucleotide affinity chromatography, responds either directly or indirectly to Start. Identification we have purified a 17-kDa protein that recognizes the Ml4 I of such a factor in an organism such as yeast should facilitate motif.
    [Show full text]
  • Monitoring of Successive Phosphorylations of Thymidine
    Monitoring of successive phosphorylations of thymidine using free and immobilized human nucleoside/nucleotide kinases by Flow Injection Analysis with High-Resolution Mass Spectrometry Justine Ferey, David da Silva, Cyril Colas, Reine Nehmé, Pierre Lafite, Vincent Roy, Philippe Morin, Richard Daniellou, Luigi Agrofoglio, Benoît Maunit To cite this version: Justine Ferey, David da Silva, Cyril Colas, Reine Nehmé, Pierre Lafite, et al.. Monitoring of successive phosphorylations of thymidine using free and immobilized human nucleoside/nucleotide kinases by Flow Injection Analysis with High-Resolution Mass Spectrometry. Analytica Chimica Acta, Elsevier Masson, 2019, 1049, pp.115-122. 10.1016/j.aca.2018.10.032. hal-02090335 HAL Id: hal-02090335 https://hal.archives-ouvertes.fr/hal-02090335 Submitted on 29 Nov 2019 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Monitoring of successive phosphorylations of thymidine using free and immobilized human nucleoside/nucleotide kinases by Flow Injection Analysis with High-Resolution Mass Spectrometry Justine Ferey1, David Da Silva*1, Cyril Colas1,2, Reine Nehmé*1, Pierre Lafite1, Vincent Roy1, Philippe Morin1, Richard Daniellou1, Luigi Agrofoglio1, Benoît Maunit1. 1 Univ. Orléans, CNRS, ICOA, UMR 7311, F-45067 Orléans, France.
    [Show full text]
  • Supplementary Table 1
    Up-regulated accession # Development M93275 ADFP, adipose differentiation related protein D43694 MATH-1, homolog of atonal 1 M64068 Bmi-1, zinc finger protein AW124785 Midnolin, midbrain nucleolar protein AI843178 Cla3, Cerebellar ataxia 3 D10712 Nedd1, Neural precursor cell expressed, developmentally down-regulated gene 1 AB011678 Doublecortin, for neurogenesis M57683 mPDGF-alpha-R, PDGF alpha receptor U41626 DSS1, deleted in split hand/split foot 1 homolog (Dss1), for limb development AB010833 PTCH2, patched 2, Mouse homolog of yeast CDC46 NP_034226 Ebf3, early B-cell factor 3 AI846695 Qk, Quaking U63386 Edr1 Early development regulator 1 (homolog of polyhomeotic 1), Mph1 AI043016 Rnf2, Ring finger protein 2 X69942 Enhancer-trap-locus 1, for transcription regulation AF100694 Ruvbl1, Ruv-B like protein 1, DNA helicase AW123618 Fzd2, Frizzled homolog 2 U88566 Sfrp1, secreted frizzled related protein 1 AA681520 Geminin-pending, for embryogenesis and morphogenesis U88567 Sfrp2, secreted frizzled related protein 2 AB025922 Gli1, GLI-Kruppel family member 1 AF089721 Smo, Smoothened X99104 Gli2, GLI-Kruppel family member 2 AF009414 SOX11, SRY-box containing gene 11 U61362 Grg1, groucho-related gene 1, Tle1, transducin-like enhancer of split 1 U85614 SRG3, Smarcc1, SWI/SNF related, matrix associated, action dependent regulator of chromatin, subfamily, member 1 M97506 Hen1, helix-loop-helix protein AI837838 Tmeff1, Transmembrane protein with EGF-like and two follistatin-like domains 1 U79748 Madh4, MAD homolog 4, for transcription regulation
    [Show full text]
  • Genome-Wide Analysis of Vaccinia Virus Protein–Protein Interactions
    Genome-wide analysis of vaccinia virus protein–protein interactions Stephen McCraith*, Ted Holtzman†, Bernard Moss‡, and Stanley Fields*§¶ *Departments of Genetics and Medicine, Box 357360, †Locke Computer Center, and §Howard Hughes Medical Institute, University of Washington, Seattle, WA 98195; and ‡Laboratory of Viral Diseases, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892-0445 Contributed by Bernard Moss, February 23, 2000 To detect interactions between proteins of vaccinia virus, we Materials and Methods carried out a comprehensive two-hybrid analysis to assay every Construction of pOBD2-20. A new DNA-binding domain vector was pairwise combination. We constructed an array of yeast transfor- generated containing Gal4 residues 1 to 147 and a small portion mants that contained each of the 266 predicted viral ORFs as Gal4 of the activation domain plasmid pOAD (11) that encodes Gal4 activation domain hybrid proteins. The array was individually mated to transformants containing each ORF as a Gal4–DNA- residues 866 to 881 along with a shared multicloning site (Fig. 1A). PCR was used to amplify the Gal4 DNA-binding domain binding domain hybrid, and diploids expressing the two-hybrid Ј reporter gene were identified. Of the Ϸ70,000 combinations, we from the plasmid pCPL2 (12) by using primer P1 5 - Ј found 37 protein–protein interactions, including 28 that were (GTTCTCGTTCCCTTTCTTCCTTGT)-3 located in the previously unknown. In some cases, e.g., late transcription factors, ADH1 promoter region and primer P2 5Ј-CGATCTCTTTTT- both proteins were known to have related roles although there TTGGGTTTGGTGGGGTATCTTCATCATCGAATAGAT- was no prior evidence of physical associations.
    [Show full text]
  • Periodic Expression of Nuclear and Mitochondrial DNA Replication Genes During the Trypanosomatid Cell Cycle
    Journal of Cell Science 107, 3515-3520 (1994) 3515 Printed in Great Britain © The Company of Biologists Limited 1994 Periodic expression of nuclear and mitochondrial DNA replication genes during the trypanosomatid cell cycle Sally G. Pasion, Grant W. Brown, Lisa M. Brown and Dan S. Ray* Molecular Biology Institute and Department of Biology, University of California, Los Angeles, California 90024, USA *Author for correspondence SUMMARY In trypanosomatids, DNA replication in the nucleus and in drial topoisomerase, was disrupted by the insertion of a the single mitochondrion (or kinetoplast) initiates nearly NEO drug-resistance cassette was found to express both a simultaneously, suggesting that the DNA synthesis (S) truncated TOP2 mRNA and a truncated topoisomerase phases of the nucleus and the mitochondrion are coordi- polypeptide. The truncated mRNA was also expressed peri- nately regulated. To investigate the basis for the temporal odically coordinate with the expression of the endogenous link between nuclear and mitochondrial DNA synthesis TOP2 mRNA indicating that cis elements necessary for phases the expression of the genes encoding DNA ligase I, periodic expression are contained within cloned sequences. the 51 and 28 kDa subunits of replication protein A, dihy- The expression of both TOP2 and nuclear DNA replication drofolate reductase and the mitochondrial type II topoiso- genes at the G1/S boundary suggests that regulated merase were analyzed during the cell cycle progression of expression of these genes may play a role in coordinating synchronous cultures of Crithidia fasciculata. These DNA nuclear and mitochondrial S phases in trypanosomatids. replication genes were all expressed periodically, with peak mRNA levels occurring just prior to or at the peak of DNA synthesis in the synchronized cultures.
    [Show full text]