Supplementary Table 1

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Up-regulated accession # Development M93275 ADFP, adipose differentiation related protein D43694 MATH-1, homolog of atonal 1 M64068 Bmi-1, zinc finger protein AW124785 Midnolin, midbrain nucleolar protein AI843178 Cla3, Cerebellar ataxia 3 D10712 Nedd1, Neural precursor cell expressed, developmentally down-regulated gene 1 AB011678 Doublecortin, for neurogenesis M57683 mPDGF-alpha-R, PDGF alpha receptor U41626 DSS1, deleted in split hand/split foot 1 homolog (Dss1), for limb development AB010833 PTCH2, patched 2, Mouse homolog of yeast CDC46 NP_034226 Ebf3, early B-cell factor 3 AI846695 Qk, Quaking U63386 Edr1 Early development regulator 1 (homolog of polyhomeotic 1), Mph1 AI043016 Rnf2, Ring finger protein 2 X69942 Enhancer-trap-locus 1, for transcription regulation AF100694 Ruvbl1, Ruv-B like protein 1, DNA helicase AW123618 Fzd2, Frizzled homolog 2 U88566 Sfrp1, secreted frizzled related protein 1 AA681520 Geminin-pending, for embryogenesis and morphogenesis U88567 Sfrp2, secreted frizzled related protein 2 AB025922 Gli1, GLI-Kruppel family member 1 AF089721 Smo, Smoothened X99104 Gli2, GLI-Kruppel family member 2 AF009414 SOX11, SRY-box containing gene 11 U61362 Grg1, groucho-related gene 1, Tle1, transducin-like enhancer of split 1 U85614 SRG3, Smarcc1, SWI/SNF related, matrix associated, action dependent regulator of chromatin, subfamily, member 1 M97506 Hen1, helix-loop-helix protein AI837838 Tmeff1, Transmembrane protein with EGF-like and two follistatin-like domains 1 U79748 Madh4, MAD homolog 4, for transcription regulation AV109962 Traf4, TNF receptor associated factor 4 NM_007896 Mapre1, Microtubule-associated protein, RP/EB family, member 1 Y10026 Transcription factor TEF-1, Tead2, TEA domain family member 2 M60474 MARCKS, myristoylated alanine-rich C-kinase substrate, for brain development accession # Cell cycle/maintenance AV309347 Ki67, Antigen identified by monoclonal antibody Ki 67 D63784 MIDA1, mouse Id associate 1, Zrf2 Zuotin related factor 2 NM_008506 L-myc U83902 Mad2, Mitotic checkpoint component Mad2 L32751 (clone M1) GTPase (Ran) M12848 Myb, myeloblastosis oncogene, proto-oncogene mRNA encoding 71 kd myb protein AI842771 Anp32b, Acidic nuclear phosphoprotein 32 family, member B M12731 N-myc U80932 Ayk1, serine/threonine kinase Ayk1, Stk6, serine/threonine kinase 6 AI843682 Nras, neuroblastoma ras oncogene U32446 Brca1 M38724 p34 Cdc2, Cdc2a, AF002823 Bud1, mitotic checkpoint protein kinase AA764261 Pim1, Proviral integration site 1, protein kinase L16926 Cdc25c, cell division cycle 25 homolog c U01063 pLK, serine/threonine kinase, Polo-like kinase homolog, protein serine/threonine kinase AW061324 Cdc20, cell division cycle 20 AF069051 Pttg1, Pituitary tumor-transforming 1 AJ223087 Cdc6, Cell division cycle 6 homolog CAC14659 Retinoblastoma-associated protein homolog p107 L01640 Cdk4, Cyclin-dependent kinase 4, D-type G1 cyclin catalytic subunit (PSK-J3/CDK4) M34094 MK, retinoic acid-responsive protein AF011644 Cdkap1, CDK2 (cyclin-dependent kinase 2)-asscoaited protein 1 AW048730 Sgpl1, Sphingosine phosphate lyase 1, sphinganine-1-phosphate aldolase AF016583 Chk1, checkpoint kinase chk1 AF062378 SHA1, Calmbp1, calmodulin-binding protein 1 AF086905 Chk2, Rad53, protein serine/threonine kinase AB025409 sid1334p, Cks1, CDC28 protein kinase 1 L00039 c-Myc AF038848 Sin3B, tnrascriptional repressor Sin3B, X75483 Cyclin A2 AF008914 sst2A, somatostatin receptor type 2 X64713 Cyclin B1 L29480 Stk18, Serine/threonine kinase 18 X66032 Cyclin B2 AW209238 Tacc3, Transforming, acidic coiled-coil containing protein 3 AI849928 Cyclin D1, cyclin-like protein, induced by colony-stimulating factor 1 AJ249987 TAFII30, Taf10 TAF10 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 30 kDa M83749 Cyclin D2 X02891 Growth hormone NM_007900 Ect2, oncogene Ect2 AK002576 Int6, mammary tumor integration site 6 M21828 Gas2, Growth arrest specific 2 accession # Checkpoint/repair 1 NM_009687 APEX nuclease, Apurinic/apyrimidinic endonuclease U93583 RAD51-binding protein U89652 Brca2 D13803 RecA-like protein MmRad51 X66323 p80 Ku autoantigen AF069519 T:G mismatch-specific thymine-DNA glycosylase TDGb isoform accession # Apoptosis U54803 Caspase 3 AB013819 TIAP, Birc5, Baculoviral IAP repeat-containing 5 AF027707 Mtd, Bok, Bcl-2 related ovarian killer protein X06407 Tpt1 Tumor protein, translationally-controlled 1 AF033115 Siva accession # Signal transduction L32752 (clone M2) GTPase (Ran), Rasl2-9 RAS-like, family 2, locus 9 X69722 Insulin receptor substrate 1 AB020202 Ak2, adenylate kinase isozyme 2 AI317205 MAP3K1, mitogen activated protein kinase kinase kinase 1 M86377 Esk kinase, Ttk protein kinase U88984 MAP4K4, Mitogen-activated protein kinase kinase kinase kinase 4 AW123850 F2r, Coagulation factor II (thrombin) receptor L21707 MRK, receptor tyrosine kinase mrk, Ryk Receptor-like tyrosine kinase X61399 F52 for a novel protein, Mlp, MARCKS-like protein AW047978 Prss25, Protease, serine, 25, serine-type endopeptidase D29802 Gnb2-rs1, Guanine nucleotide binding protein, beta 2, related sequence 1 AW122347 Racgap1, Rac GTPase-activating protein 1 AI957190 Gnai3, guanine nucleotide binding protein, alpha inhibiting 3 XP_122425 Smoc1, secreted modular calcium binding protein 1 AI843396 Gng10, Guanine nucleotide binding protein (G protein), gamma 10 AI840130 Srcasm, Src activating and signaling molecule AW123750 Gng2, Guanine nucleotide binding protein (G protein), gamma 2 subunit L09562 PTPRG, protein tyrosine phosphatase, receptor type, G AI841654 Gpr56, G protein-coupled receptor 56 AB006141 IGFBP-like protein, insulin-like growth factor binding protein like protein accession # DNA/RNA processing D00812 Rpa2, 30-kDa subunit of replication protein A AF022465 HMG-4, Hmgb3, high mobility group box 3 L32836 Ahcy, S-adenosylhomocysteine hydrolase AF031568 hnRNPG, heterogeneous nuclear ribonucleoprotein G AF041476 Baf53a-pending, BRG1/brm-associated factor 53A AAM14132 Hnrpd, Heterogeneous nuclear ribonucleoprotein D AB025349 Bcrp1-pending, Breakpoint cluster region protein 1, BAF M33934 IMP dehydrogenase (EC 1.2.1.14 Z35401 C3H gene for histone H2A.X, H2afx H2A histone family, member X AA823653 Incenp, inner centromere protein AF012710 Cenp-a, centromere protein A , histone H3 variant AA929330 Mcmd, Mini chromosome maintenance deficient, P1 protein X77731 Deoxycytidine kinase D26089 Mcmd4, Mini chromosome maintenance deficient 4 homolog AB013912 Ruvbl2, RuvB-like protein 2, DNA helicase D26090 Mcmd5, mini chromosome maintenance deficient 5, CDC46 D13546 Pola2, Polymerase (DNA directed), alpha 2 D26091 Mcmd7, Mini chromosome maintenance deficient 7 D13543 Pola1, Polymerase (DNA directed), alpha 1 D86725 mMCM2, Mini chromosome maintenance deficient 2 AF036008 DNMT1, DNA (cytosine-5)-methyltransferase (Dnmt1) AW107230 Nap1l1, Nucleosome assembly protein 1-like 1 AI845934 Ebp2, EBNA1 binding protein 2 AF034610 NASP, nuclear autoantigenic sperm protein (histone binding) AB025015 Elongin A, Tceb3 Transcription elongation factor B (SIII), polypeptide 3 (110kD) AI836205 Nme4, expressed in non-metastatic cells 4 NM_007971 Ezh2, ehnancer of zeste homolog 2, transcriptional regulator AI846392 Nsap1-pending, NS1-associated protein 1 Z22593 Fibrillarin X68193 Nme2, Expressed in non-metastatic cells 2, protein (NM23B) (nucleoside diphosphate kinase) AF073993 hnRNP A2/B1, Heterogenous nuclear ribonucleoprotein A2/B1 D14336 Paf53, RNA polymerase I associated factor (PAF53) AW120557 Lsm4-pending, U6 snRNA-associated SM-like protein 4 X57800 PCNA, proliferating cell nuclear antigen AI837853 Snrpd2, Small nuclear ribonucleoprotein D2 AF024570 Pold1, DNA polymerase delta catalytic X67668 High mobility group 2 protein NM_008774 poly(A) binding protein, cytoplasmic 1 M29260 histone 1-0 J04620 Prim1, DNA primase, p49 subunit M33988 Histone H2A.1 D13545 Prim2, DNA primase, p58 subunit U62674 Histone H2a.2-615 (H2a-615), and histone H3.2-615 (H3-615 AA690061 Rbm8, RNA binding motif protein U70494 Histone H2A.Z, H2afz H2A histone family, member Z NM_009103 Rrm1, Ribonucleotide reductase subunit M1 2 X53476 HMG-14, Hmgn1, high mobility group nucleosomal binding domain 1 L32836 S-adenosyl homocysteine hydrolase (ahcy), copper binding protein X12944 HMG-17, Hmgn2, high mobility group nucleosomal binding domain 2 AI838274 Slc29a1, solute carrier family 29 (nucleoside transporters), member 1 U01915 Topo-2a, DNA topoisomerase II alpha X65704 Small nuclear ribonucleoprotein E AU044050 Tyms, Thymidylate synthase X60980 TK1, thymidine kinase 1 X96767 Snrp1c, U1 small nuclear ribonucleoprotein 1C U1 snRNP-specific protein C AA624336 Tmk, Thymidylate kinase X63020 Snrpb2 U2 small nuclear ribonucleoprotein B accession # Gene expression AAD28370 ATFx , Activating transcription factor 5 U31758 Hdac2, Histone deacetylase 2 AI844392 2e2, General transcription factor IIE, polypeptide 2 (beta subunit, 34kD BAA92776 Mlt1, IA-1, insulinoma-associated protein 1 U89876 Aly, transcriptional coactivator ALY X89749 mTGIF, TG interacting factor M88301 brain-4 class III POU-domain Y07686 NfiB3-protein, nuclear factor I/B, splice variant, splice variant, missing exons 9,10 & 11, 12 is in different ORF AAM20126 Cebpa-rs1, CCAAT/enhancer binding protein alpha (C/EBP), related sequence 1 U28656 PHAS-1, Eif4ebp1, eukaryotic translation initiation factor 4E (eIF-4E) binding protein1 L03279 Core-binding factor beta AB001927 G3bp-pending, ras-GTPase-activating protein SH3-domain binding protein X72310 DRTF-polypeptide-1 (DP-1), Tfdp1 Transcription factor Dp 1 L35032 SOX18,
Recommended publications
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB

    Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB

    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
  • Machine-Learning and Chemicogenomics Approach Defi Nes and Predicts Cross-Talk of Hippo and MAPK Pathways

    Machine-Learning and Chemicogenomics Approach Defi Nes and Predicts Cross-Talk of Hippo and MAPK Pathways

    Published OnlineFirst November 18, 2020; DOI: 10.1158/2159-8290.CD-20-0706 RESEARCH ARTICLE Machine -Learning and Chemicogenomics Approach Defi nes and Predicts Cross-Talk of Hippo and MAPK Pathways Trang H. Pham 1 , Thijs J. Hagenbeek 1 , Ho-June Lee 1 , Jason Li 2 , Christopher M. Rose 3 , Eva Lin 1 , Mamie Yu 1 , Scott E. Martin1 , Robert Piskol 2 , Jennifer A. Lacap 4 , Deepak Sampath 4 , Victoria C. Pham 3 , Zora Modrusan 5 , Jennie R. Lill3 , Christiaan Klijn 2 , Shiva Malek 1 , Matthew T. Chang 2 , and Anwesha Dey 1 ABSTRACT Hippo pathway dysregulation occurs in multiple cancers through genetic and non- genetic alterations, resulting in translocation of YAP to the nucleus and activation of the TEAD family of transcription factors. Unlike other oncogenic pathways such as RAS, defi ning tumors that are Hippo pathway–dependent is far more complex due to the lack of hotspot genetic alterations. Here, we developed a machine-learning framework to identify a robust, cancer type–agnostic gene expression signature to quantitate Hippo pathway activity and cross-talk as well as predict YAP/TEAD dependency across cancers. Further, through chemical genetic interaction screens and multiomics analyses, we discover a direct interaction between MAPK signaling and TEAD stability such that knockdown of YAP combined with MEK inhibition results in robust inhibition of tumor cell growth in Hippo dysregulated tumors. This multifaceted approach underscores how computational models combined with experimental studies can inform precision medicine approaches including predictive diagnostics and combination strategies. SIGNIFICANCE: An integrated chemicogenomics strategy was developed to identify a lineage- independent signature for the Hippo pathway in cancers.
  • Fibrillarin from Archaea to Human

    Fibrillarin from Archaea to Human

    Biol. Cell (2015) 107, 1–16 DOI: 10.1111/boc.201400077 Review Fibrillarin from Archaea to human Ulises Rodriguez-Corona*, Margarita Sobol†, Luis Carlos Rodriguez-Zapata‡, Pavel Hozak† and Enrique Castano*1 *Unidad de Bioquımica´ y Biologıa´ molecular de plantas, Centro de Investigacion´ Cientıfica´ de Yucatan,´ Colonia Chuburna´ de Hidalgo, Merida,´ Yucatan, Mexico, †Department of Biology of the Cell Nucleus, Institute of Molecular Genetics of the Academy of Sciences of the Czech Republic, Prague 14220, Czech Republic, and ‡Unidad de Biotecnologıa,´ Centro de Investigacion´ Cientıfica´ de Yucatan,´ Colonia Chuburna´ de Hidalgo, Merida,´ Yucatan, Mexico Fibrillarin is an essential protein that is well known as a molecular marker of transcriptionally active RNA polyme- rase I. Fibrillarin methyltransferase activity is the primary known source of methylation for more than 100 methylated sites involved in the first steps of preribosomal processing and required for structural ribosome stability. High expression levels of fibrillarin have been observed in several types of cancer cells, particularly when p53 levels are reduced, because p53 is a direct negative regulator of fibrillarin transcription. Here, we show fibrillarin domain conservation, structure and interacting molecules in different cellular processes as well as with several viral proteins during virus infection. Additional supporting information may be found in the online version of this article at the publisher’s web-site Introduction progression, senescence and biogenesis of small nu- The nucleolus is the largest visible structure inside clear RNA and tRNAs proliferation and many forms the cell nucleus. It exists both as a dynamic and sta- of stress response (Andersen et al., 2005; Hinsby ble region depending of the nature and amount of et al., 2006; Boisvert et al., 2007; Shaw and Brown, the molecules that it is made of.
  • New Approaches to Functional Process Discovery in HPV 16-Associated Cervical Cancer Cells by Gene Ontology

    New Approaches to Functional Process Discovery in HPV 16-Associated Cervical Cancer Cells by Gene Ontology

    Cancer Research and Treatment 2003;35(4):304-313 New Approaches to Functional Process Discovery in HPV 16-Associated Cervical Cancer Cells by Gene Ontology Yong-Wan Kim, Ph.D.1, Min-Je Suh, M.S.1, Jin-Sik Bae, M.S.1, Su Mi Bae, M.S.1, Joo Hee Yoon, M.D.2, Soo Young Hur, M.D.2, Jae Hoon Kim, M.D.2, Duck Young Ro, M.D.2, Joon Mo Lee, M.D.2, Sung Eun Namkoong, M.D.2, Chong Kook Kim, Ph.D.3 and Woong Shick Ahn, M.D.2 1Catholic Research Institutes of Medical Science, 2Department of Obstetrics and Gynecology, College of Medicine, The Catholic University of Korea, Seoul; 3College of Pharmacy, Seoul National University, Seoul, Korea Purpose: This study utilized both mRNA differential significant genes of unknown function affected by the display and the Gene Ontology (GO) analysis to char- HPV-16-derived pathway. The GO analysis suggested that acterize the multiple interactions of a number of genes the cervical cancer cells underwent repression of the with gene expression profiles involved in the HPV-16- cancer-specific cell adhesive properties. Also, genes induced cervical carcinogenesis. belonging to DNA metabolism, such as DNA repair and Materials and Methods: mRNA differential displays, replication, were strongly down-regulated, whereas sig- with HPV-16 positive cervical cancer cell line (SiHa), and nificant increases were shown in the protein degradation normal human keratinocyte cell line (HaCaT) as a con- and synthesis. trol, were used. Each human gene has several biological Conclusion: The GO analysis can overcome the com- functions in the Gene Ontology; therefore, several func- plexity of the gene expression profile of the HPV-16- tions of each gene were chosen to establish a powerful associated pathway, identify several cancer-specific cel- cervical carcinogenesis pathway.
  • Enzymatic Manufacture of Deoxythymidine-5'-Triphosphate with Permeable Intact Cells of E. Coli Coexpressing Thymidylate Kinase

    Enzymatic Manufacture of Deoxythymidine-5'-Triphosphate with Permeable Intact Cells of E. Coli Coexpressing Thymidylate Kinase

    J. Microbiol. Biotechnol. (2015), 25(12), 2034–2042 http://dx.doi.org/10.4014/jmb.1506.06020 Research Article Review jmb Enzymatic Manufacture of Deoxythymidine-5’-Triphosphate with Permeable Intact Cells of E. coli Coexpressing Thymidylate Kinase and Acetate Kinase Jiao Zhang, Yahui Qian, Qingbao Ding*, and Ling Ou* State Key Laboratory of Bioreactor Engineering, East China University of Science and Technology, Shanghai 200237, P.R. China Received: June 8, 2015 Revised: July 26, 2015 A one-pot process of enzymatic synthesis of deoxythymidine-5’-triphosphate (5’-dTTP) Accepted: September 11, 2015 employing whole cells of recombinant Escherichia coli coexpressing thymidylate kinase (TMKase) and acetate kinase (ACKase) was developed. Genes tmk and ack from E. coli were First published online cloned and inserted into pET28a(+), and then transduced into E. coli BL21 (DE3) to form September 15, 2015 recombinant strain pTA in which TMKase and ACKase were simultaneously overexpressed. It *Corresponding authors was found that the relative residual specific activities of TMKase and ACKase, in pTA Q.D. pretreated with 20 mM ethylene diamine tetraacetic acid (EDTA) at 25oC for 30 min, were 94% Phone: +86-21-64250676; Fax: +86-21-64250676; and 96%, respectively. The yield of 5’-dTTP reached above 94% from 5 mM deoxythymidine E-mail: [email protected] 5’-monophosphate (5’-dTMP) and 15 mM acetyl phosphate catalyzed with intact cells of pTA L.O. Phone: +86-21-64253257; pretreated with EDTA. The process was so effective that only 0.125 mM adenosine-5’- Fax: +86-21-64253257; triphosphate was sufficient to deliver the phosphate group from acetyl phosphate to dTMP E-mail: [email protected] and dTDP.
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • Supplementary Materials

    Supplementary Materials

    1 Supplementary Materials: Supplemental Figure 1. Gene expression profiles of kidneys in the Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice. (A) A heat map of microarray data show the genes that significantly changed up to 2 fold compared between Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice (N=4 mice per group; p<0.05). Data show in log2 (sample/wild-type). 2 Supplemental Figure 2. Sting signaling is essential for immuno-phenotypes of the Fcgr2b-/-lupus mice. (A-C) Flow cytometry analysis of splenocytes isolated from wild-type, Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice at the age of 6-7 months (N= 13-14 per group). Data shown in the percentage of (A) CD4+ ICOS+ cells, (B) B220+ I-Ab+ cells and (C) CD138+ cells. Data show as mean ± SEM (*p < 0.05, **p<0.01 and ***p<0.001). 3 Supplemental Figure 3. Phenotypes of Sting activated dendritic cells. (A) Representative of western blot analysis from immunoprecipitation with Sting of Fcgr2b-/- mice (N= 4). The band was shown in STING protein of activated BMDC with DMXAA at 0, 3 and 6 hr. and phosphorylation of STING at Ser357. (B) Mass spectra of phosphorylation of STING at Ser357 of activated BMDC from Fcgr2b-/- mice after stimulated with DMXAA for 3 hour and followed by immunoprecipitation with STING. (C) Sting-activated BMDC were co-cultured with LYN inhibitor PP2 and analyzed by flow cytometry, which showed the mean fluorescence intensity (MFI) of IAb expressing DC (N = 3 mice per group). 4 Supplemental Table 1. Lists of up and down of regulated proteins Accession No.
  • Glioblastoma Stem Cells Induce Quiescence in Surrounding Neural Stem Cells Via Notch Signalling

    Glioblastoma Stem Cells Induce Quiescence in Surrounding Neural Stem Cells Via Notch Signalling

    bioRxiv preprint doi: https://doi.org/10.1101/856062; this version posted November 29, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Glioblastoma stem cells induce quiescence in surrounding neural stem cells via Notch signalling. Katerina Lawlor1, Maria Angeles Marques-Torrejon2, Gopuraja Dharmalingham3, Yasmine El-Azhar1, Michael D. Schneider1, Steven M. Pollard2§ and Tristan A. Rodríguez1§ 1National Heart and Lung Institute, Imperial College London, Hammersmith Hospital Campus, Du Cane Road, London W12 0NN, United Kingdom. 2 MRC Centre for Regenerative Medicine & Edinburgh Cancer Research UK Centre, University of Edinburgh, Edinburgh, UK. 3MRC London Institute of Medical Sciences, Institute of Clinical Sciences, Imperial College London, UK §Authors for correspondence: [email protected] and [email protected] Running title: Glioblastoma stem cell competition Keyword: Neural stem cells, quiescence, glioblastoma, Notch, cell competition 1 bioRxiv preprint doi: https://doi.org/10.1101/856062; this version posted November 29, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Abstract 2 There is increasing evidence suggesting that adult neural stem cells (NSCs) are a cell of 3 origin of glioblastoma, the most aggressive form of malignant glioma. The earliest stages of 4 hyperplasia are not easy to explore, but likely involve a cross-talk between normal and 5 transformed NSCs. How normal cells respond to this cross-talk and if they expand or are 6 outcompeted is poorly understood.
  • Proteomics Provides Insights Into the Inhibition of Chinese Hamster V79

    Proteomics Provides Insights Into the Inhibition of Chinese Hamster V79

    www.nature.com/scientificreports OPEN Proteomics provides insights into the inhibition of Chinese hamster V79 cell proliferation in the deep underground environment Jifeng Liu1,2, Tengfei Ma1,2, Mingzhong Gao3, Yilin Liu4, Jun Liu1, Shichao Wang2, Yike Xie2, Ling Wang2, Juan Cheng2, Shixi Liu1*, Jian Zou1,2*, Jiang Wu2, Weimin Li2 & Heping Xie2,3,5 As resources in the shallow depths of the earth exhausted, people will spend extended periods of time in the deep underground space. However, little is known about the deep underground environment afecting the health of organisms. Hence, we established both deep underground laboratory (DUGL) and above ground laboratory (AGL) to investigate the efect of environmental factors on organisms. Six environmental parameters were monitored in the DUGL and AGL. Growth curves were recorded and tandem mass tag (TMT) proteomics analysis were performed to explore the proliferative ability and diferentially abundant proteins (DAPs) in V79 cells (a cell line widely used in biological study in DUGLs) cultured in the DUGL and AGL. Parallel Reaction Monitoring was conducted to verify the TMT results. γ ray dose rate showed the most detectable diference between the two laboratories, whereby γ ray dose rate was signifcantly lower in the DUGL compared to the AGL. V79 cell proliferation was slower in the DUGL. Quantitative proteomics detected 980 DAPs (absolute fold change ≥ 1.2, p < 0.05) between V79 cells cultured in the DUGL and AGL. Of these, 576 proteins were up-regulated and 404 proteins were down-regulated in V79 cells cultured in the DUGL. KEGG pathway analysis revealed that seven pathways (e.g.
  • Glucocorticoid Receptor Signaling Activates TEAD4 to Promote Breast

    Glucocorticoid Receptor Signaling Activates TEAD4 to Promote Breast

    Published OnlineFirst July 9, 2019; DOI: 10.1158/0008-5472.CAN-19-0012 Cancer Molecular Cell Biology Research Glucocorticoid Receptor Signaling Activates TEAD4 to Promote Breast Cancer Progression Lingli He1,2, Liang Yuan3,Yang Sun1,2, Pingyang Wang1,2, Hailin Zhang4, Xue Feng1,2, Zuoyun Wang1,2, Wenxiang Zhang1,2, Chuanyu Yang4,Yi Arial Zeng1,2,Yun Zhao1,2,3, Ceshi Chen4,5,6, and Lei Zhang1,2,3 Abstract The Hippo pathway plays a critical role in cell growth and to the TEAD4 promoter to boost its own expression. Func- tumorigenesis. The activity of TEA domain transcription factor tionally, the activation of TEAD4 by GC promoted breast 4 (TEAD4) determines the output of Hippo signaling; how- cancer stem cells maintenance, cell survival, metastasis, and ever, the regulation and function of TEAD4 has not been chemoresistance both in vitro and in vivo. Pharmacologic explored extensively. Here, we identified glucocorticoids (GC) inhibition of TEAD4 inhibited GC-induced breast cancer as novel activators of TEAD4. GC treatment facilitated gluco- chemoresistance. In conclusion, our study reveals a novel corticoid receptor (GR)-dependent nuclear accumulation and regulation and functional role of TEAD4 in breast cancer and transcriptional activation of TEAD4. TEAD4 positively corre- proposes a potential new strategy for breast cancer therapy. lated with GR expression in human breast cancer, and high expression of TEAD4 predicted poor survival of patients with Significance: This study provides new insight into the role breast cancer. Mechanistically, GC activation promoted GR of glucocorticoid signaling in breast cancer, with potential for interaction with TEAD4, forming a complex that was recruited clinical translation.
  • The Nucleolus – a Gateway to Viral Infection? Brief Review

    The Nucleolus – a Gateway to Viral Infection? Brief Review

    Arch Virol (2002) 147: 1077–1089 DOI 10.1007/s00705-001-0792-0 The nucleolus – a gateway to viral infection? Brief Review J. A. Hiscox School of Animal and Microbial Sciences, University of Reading, U.K. Received August 24, 2001; accepted December 26, 2001 Published online March 18, 2002, © Springer-Verlag 2002 Summary. A number of viruses and viral proteins interact with a dynamic sub- nuclear structure called the nucleolus. The nucleolus is present during interphase in mammalian cells and is the site of ribosome biogenesis, and has been implicated in controlling regulatory processes such as the cell cycle. Viruses interact with the nucleolus and its antigens; viral proteins co-localise with factors such as nucleolin, B23 and fibrillarin, and can cause their redistribution during infection. Viruses can use these components as part of their replication process, and also use the nucleolus as a site of replication itself. Many of these properties are not restricted to any particular type of virus or replication mechanism, and examples of these processes can be found in DNA, RNA and retroviruses. Evidence suggests that viruses may target the nucleolus and its components to favour viral transcription, translation and perhaps alter the cell cycle in order to promote virus replication. Autoimmunity to nucleolin and fibrillarin have been associated with a number of diseases, and by targeting the nucleolus and displacing nucleolar antigens, virus infection might play a role in the initiation of these conditions. Introduction The eukaryotic nucleus contains a number of domains or subcompartments, which include nucleoli, nuclear Cajal bodies, nuclear speckles, transcription and replica- tion foci, and chromosome territories [34].
  • Table S1. List of Oligonucleotide Primers Used

    Table S1. List of Oligonucleotide Primers Used

    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG