DOCSLIB.ORG

Genome-Wide Analysis of Vaccinia Virus Protein–Protein Interactions

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Genome-Wide Analysis of Vaccinia Virus Protein–Protein Interactions Genome-wide analysis of vaccinia virus protein–protein interactions Stephen McCraith*, Ted Holtzman†, Bernard Moss‡, and Stanley Fields*§¶ *Departments of Genetics and Medicine, Box 357360, †Locke Computer Center, and §Howard Hughes Medical Institute, University of Washington, Seattle, WA 98195; and ‡Laboratory of Viral Diseases, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892-0445 Contributed by Bernard Moss, February 23, 2000 To detect interactions between proteins of vaccinia virus, we Materials and Methods carried out a comprehensive two-hybrid analysis to assay every Construction of pOBD2-20. A new DNA-binding domain vector was pairwise combination. We constructed an array of yeast transfor- generated containing Gal4 residues 1 to 147 and a small portion mants that contained each of the 266 predicted viral ORFs as Gal4 of the activation domain plasmid pOAD (11) that encodes Gal4 activation domain hybrid proteins. The array was individually mated to transformants containing each ORF as a Gal4–DNA- residues 866 to 881 along with a shared multicloning site (Fig. 1A). PCR was used to amplify the Gal4 DNA-binding domain binding domain hybrid, and diploids expressing the two-hybrid Ј reporter gene were identified. Of the Ϸ70,000 combinations, we from the plasmid pCPL2 (12) by using primer P1 5 - Ј found 37 protein–protein interactions, including 28 that were (GTTCTCGTTCCCTTTCTTCCTTGT)-3 located in the previously unknown. In some cases, e.g., late transcription factors, ADH1 promoter region and primer P2 5Ј-CGATCTCTTTTT- both proteins were known to have related roles although there TTGGGTTTGGTGGGGTATCTTCATCATCGAATAGAT- was no prior evidence of physical associations. For some other AGTT(CGATACAGTCAACTGTCTTTGACC)-3Ј corre- interactions, neither protein had a known role. In the majority of sponding to residues 866–881 of the Gal4 activation domain. The cases, however, one of the interacting proteins was known to be primer sequences shown in parentheses are complementary to involved in DNA replication, transcription, virion structure, or host those present in pCPL2, and the underlined bases are an added evasion, thereby providing a clue to the role of the other unchar- sequence. The additional sequence is complementary to se- acterized protein in a specific process. quences in pOAD. In a separate PCR, a portion of the multi- cloning site and ADH1 terminator sequence was amplified from oxviruses are large, complex, double-stranded DNA viruses pOAD by using primer P3 5Ј-AACTATCTATTCGATGA- Pthat replicate in the cytoplasm of infected cells (1). Vaccinia TGAAGATACCCCACCAAACCCAAAAAAAGAGAT- virus, the best-characterized member of this large family, was CGAATTCCAGCTGACCACCATGGCAA-3Ј and primer P4 extensively used as the smallpox vaccine, has gained popularity 5Ј-AAATTTCTGGCAAGGTAGACAAGC-3Ј. These two re- as a mammalian expression vector, and is being tested as a gions were joined in a subsequent PCR amplification using recombinant vaccine against cancer and infectious diseases (2). primers P1 and P4 and a mixture of the two initial PCR products Vaccinia virus has a genome of approximately 190 kbp and can as a template. This second product was digested with HindIII and potentially express more than 200 proteins, allowing an excep- ligated into HindIII-cut and calf intestinal phosphatase-treated tional degree of independence from the host (3). Virus-encoded proteins involved in transcription include a multicomponent pCPL2. The resultant vector, pOBD2-20, was confirmed by DNA-dependent RNA polymerase, an assortment of transcrip- sequence analysis. The inserted portion contains a region com- tion factors, and enzymes that cap, methylate, and polyadeny- mon to both pOAD and pOBD2-20 (Fig. 1B), and thus a set of Ј Ј lylate mRNA (4). Of the eight virus-encoded proteins that have PCR products with appropriate 5 and 3 sequences can be been implicated in DNA replication, four are directly involved in cloned by homologous recombination into both vectors. DNA polymerization, and others (such as a type I DNA topo- isomerase, a single-stranded DNA-binding protein, a DNA Selection of Vaccinia Virus ORFs. The MAP program from the ligase, and a DNA–RNA helicase) have other roles (5). Addi- Wisconsin Package version 10.0 [Genetics Computer Group tional viral proteins are needed to maintain adequate levels of (GCG), Madison, WI] was used to identify potential coding deoxyribonucleotides for DNA replication, including a thymi- sequences in all six reading frames of 65 or more residues in the dine kinase, a thymidylate kinase, a deoxyribonucleotide reduc- genome of the WR strain of vaccinia virus. Sequence files tase, and a deoxyuridine triphosphatase. At least 30 proteins representing the coding regions for each of these ORFs were form the core and membrane components of virus particles (6, created. For each of these sequences, a list was constructed 7). Other viral proteins interact with host components to facil- containing 15 potential forward primers consisting of the 5Ј 18, itate virus dissemination, prevent apoptosis, and attenuate im- 19,..., or32 nucleotides of coding region starting with the mune responses (8, 9). The study of vaccinia virus thus provides predicted ATG, and 15 potential reverse primers containing the important information that will help us to understand the nature of more pathogenic members of the family, such as the agents of reverse complement of the last 18, 19, ..., or32 nucleotides smallpox, monkeypox, and molluscum contagiosum (10), as well ending with the predicted stop codons. Using the GCG PRIME as insights into many areas of molecular and cellular biology and program, we selected the most promising primer pairs on the immunology. basis of limited folding parameters and with optimal annealing Although 10 years have passed since the genome of vaccinia temperatures of Ϸ55°C. Twenty ORFs whose primer sets did not virus was sequenced (3), the roles of about half of the genes meet these criteria were further analyzed by using OLIGO 4.0 MICROBIOLOGY remain entirely unknown. A similar situation exists for other large DNA viruses, including members of the herpesvirus family. ¶To whom reprint requests should be addressed at: Howard Hughes Medical Institute, To increase our understanding of the poxvirus life cycle and to Departments of Genetics and Medicine, University of Washington, Box 357360, Seattle, evaluate an approach that would be generally applicable to other WA 98195. E-mail: fi[email protected]. large viruses, we initiated a genome-wide yeast two-hybrid The publication costs of this article were defrayed in part by page charge payment. This analysis to identify vaccinia virus protein–protein interactions. article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Each of the Ϸ70,000 potential pairwise combinations of proteins §1734 solely to indicate this fact. was assayed, identifying putative interactions among both char- Article published online before print: Proc. Natl. Acad. Sci. USA, 10.1073͞pnas.080078197. acterized viral proteins and those of unknown function. Article and publication date are at www.pnas.org͞cgi͞doi͞10.1073͞pnas.080078197 PNAS ͉ April 25, 2000 ͉ vol. 97 ͉ no. 9 ͉ 4879–4884 Downloaded by guest on September 30, 2021 The products were analyzed by electrophoresis on a 0.8% agarose gel and ethidium bromide staining. The size of each ORF was estimated by comparison with DNA standards. Two ORFs that failed to amplify were successfully amplified on another attempt. Generation of the Activation Domain Array. The reamplified PCR products were cotransformed with linearized pOAD into PJ69- 4A, and with linearized pOBD2-20 into PJ69-4␣, as described (11, 14). Transformants were grown overnight in yeast extract͞ peptone͞dextrose (YEPD) medium (15) and stored in 15% glycerol at Ϫ70°C. Transformants were recovered by regrowth in YEPD for 6 h, followed by selection on 35-mm synthetic plates (15) lacking either leucine (pOAD transformants) or tryptophan (pOBD2-20 transformants). Each activation domain transformation was represented by four individual clonal isolates in the array. Additionally, four isolates of transformants carrying activation domain hybrids of either the yeast Mec3 or Rad17 proteins, or human lamin, as well as four transformants of the vector pOAD, were used as control positions in the array. Colonies were transferred to 2 ml of YEPD for overnight growth in 96-deep-well dishes (USA͞ Scientific, Ocala, FL). Cultures in PJ69-4A were then transferred to a 384-well dish and stamped onto three Omnitrays (Nalgene Nunc) containing synthetic medium lacking leucine. The trans- fers were done with a Biomek 2000 Laboratory Automation Workstation (Beckman Coulter) equipped with a high density replicating tool. Thus, the vaccinia virus array consisted of 1,076 colonies on three Omnitrays. One ORF, K7R (a protein of unknown function), appeared to be toxic, as yeast containing this gene were not able to grow on selective medium. Two-Hybrid Screens. For each ORF, two pOBD2-20 transformants in PJ69-4␣ were selected on synthetic plates lacking tryptophan and grown for 48 h in 2.5 ml of YEPD medium. The two cultures were pooled and mated on YEPD plates to the PJ69-4A acti- Fig. 1. Scheme for construction of pOBD2-20. (A) A small portion of the Gal4 vation domain array by using a 384-pin high density replicating activation domain was PCR amplified and transferred to the Gal4–DNA- tool. After 3 days of growth at 30°C, diploids containing both an binding domain vector pOBD1 (11) to create the new vector pOBD2-20. (B) activation domain and a DNA-binding domain plasmid were Common sequence flanking the multicloning site of pOAD1 and pOBD2-20. A selected by transfer to synthetic medium lacking leucine and portion of this shared sequence was added to each vaccinia ORF by PCR tryptophan and incubated 3 days more. Two-hybrid selection was amplification to allow recombinational cloning of these ORFs into pOBD2-20. performed by replicating the diploid array onto medium lacking leucine, tryptophan, and histidine and supplemented with 3 mM 3-amino-1,2,4-triazole.
Load more

Recommended publications
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
    [Show full text]
  • Enzymatic Manufacture of Deoxythymidine-5'-Triphosphate with Permeable Intact Cells of E. Coli Coexpressing Thymidylate Kinase
    J. Microbiol. Biotechnol. (2015), 25(12), 2034–2042 http://dx.doi.org/10.4014/jmb.1506.06020 Research Article Review jmb Enzymatic Manufacture of Deoxythymidine-5’-Triphosphate with Permeable Intact Cells of E. coli Coexpressing Thymidylate Kinase and Acetate Kinase Jiao Zhang, Yahui Qian, Qingbao Ding*, and Ling Ou* State Key Laboratory of Bioreactor Engineering, East China University of Science and Technology, Shanghai 200237, P.R. China Received: June 8, 2015 Revised: July 26, 2015 A one-pot process of enzymatic synthesis of deoxythymidine-5’-triphosphate (5’-dTTP) Accepted: September 11, 2015 employing whole cells of recombinant Escherichia coli coexpressing thymidylate kinase (TMKase) and acetate kinase (ACKase) was developed. Genes tmk and ack from E. coli were First published online cloned and inserted into pET28a(+), and then transduced into E. coli BL21 (DE3) to form September 15, 2015 recombinant strain pTA in which TMKase and ACKase were simultaneously overexpressed. It *Corresponding authors was found that the relative residual specific activities of TMKase and ACKase, in pTA Q.D. pretreated with 20 mM ethylene diamine tetraacetic acid (EDTA) at 25oC for 30 min, were 94% Phone: +86-21-64250676; Fax: +86-21-64250676; and 96%, respectively. The yield of 5’-dTTP reached above 94% from 5 mM deoxythymidine E-mail: [email protected] 5’-monophosphate (5’-dTMP) and 15 mM acetyl phosphate catalyzed with intact cells of pTA L.O. Phone: +86-21-64253257; pretreated with EDTA. The process was so effective that only 0.125 mM adenosine-5’- Fax: +86-21-64253257; triphosphate was sufficient to deliver the phosphate group from acetyl phosphate to dTMP E-mail: [email protected] and dTDP.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Overexpression of DNA Polymerase @Jsensitizes Mammalian Cells to 2',3'
    ICANCERRESEARCH57.I10-I 16,JanuaryI. I997J Overexpression of DNA Polymerase @JSensitizesMammalian Cells to 2',3'-Deoxycytidine and 3'-Azido-3' .deoxythymidine' Khalil Bouayadi, Jean-Sébastien Hoffmann, Pascal Fons, Michele Tiraby, Jean-Paul Reynes, and Christophe Cazaux2 Laboratoire de Microbiologic et de Génétique,UniversitéPaul Sabatier, 118 route de Narbonne, 31062 Toulouse cédex(K. B., P. F., C. C.]; Institut de Pharmacologic et Biologic Structurale. Centre National de Ia Recherche ScienujIque, UPR 9062, 205 route de Narbonne, 31077 Toulouse cédexfl. S. H.!; and Laboratoire CAYLA, ZI. Montaudran, 5 rue J. Rodier, 3/400 Toulouse (M. T., J. P. R.J ABSTRACT nator AZT-MP was also observed (10, 11). In vivo, AZT-MP is incorporated into cellular DNA (12), and it has been suggested that Mammalian DNA polymerase @3is a DNA repair enzyme expressed polymerase 13may play a role in this process (1 1). @ constitutively at a low level. In vitro, purified DNA polymerase (Pol) incorporates the nucleotide analogues 2'-3' deoxycytidine (ddC)-triphos AZT and ddC are antiviral agents currently used in the treatment phate and 3'-azido-3'-deoxythymidine (AZT)-triphosphate Into DNA, of AIDS. These chemotherapeutic drugs target HIV reverse tran causing chain termination. We have tested the possibility ofenhancing the scriptase which incorporates them into HIV DNA, terminating cytotoxicity of these chain terminators against mammalian cells by in DNA polymerization (13). In this study, we hypothesized that creasing the level of Pol (I. Chinese hamster ovary AA8 and murine overexpression of Pol f3, a cellular target of ddC and AZT, might melanoma B16 cell lines were stably transfected with rat pol fi cDNA render these analogues effective also against tumor cells.
    [Show full text]
  • The Metabolic Building Blocks of a Minimal Cell Supplementary
    The metabolic building blocks of a minimal cell Mariana Reyes-Prieto, Rosario Gil, Mercè Llabrés, Pere Palmer and Andrés Moya Supplementary material. Table S1. List of enzymes and reactions modified from Gabaldon et. al. (2007). n.i.: non identified. E.C. Name Reaction Gil et. al. 2004 Glass et. al. 2006 number 2.7.1.69 phosphotransferase system glc + pep → g6p + pyr PTS MG041, 069, 429 5.3.1.9 glucose-6-phosphate isomerase g6p ↔ f6p PGI MG111 2.7.1.11 6-phosphofructokinase f6p + atp → fbp + adp PFK MG215 4.1.2.13 fructose-1,6-bisphosphate aldolase fbp ↔ gdp + dhp FBA MG023 5.3.1.1 triose-phosphate isomerase gdp ↔ dhp TPI MG431 glyceraldehyde-3-phosphate gdp + nad + p ↔ bpg + 1.2.1.12 GAP MG301 dehydrogenase nadh 2.7.2.3 phosphoglycerate kinase bpg + adp ↔ 3pg + atp PGK MG300 5.4.2.1 phosphoglycerate mutase 3pg ↔ 2pg GPM MG430 4.2.1.11 enolase 2pg ↔ pep ENO MG407 2.7.1.40 pyruvate kinase pep + adp → pyr + atp PYK MG216 1.1.1.27 lactate dehydrogenase pyr + nadh ↔ lac + nad LDH MG460 1.1.1.94 sn-glycerol-3-phosphate dehydrogenase dhp + nadh → g3p + nad GPS n.i. 2.3.1.15 sn-glycerol-3-phosphate acyltransferase g3p + pal → mag PLSb n.i. 2.3.1.51 1-acyl-sn-glycerol-3-phosphate mag + pal → dag PLSc MG212 acyltransferase 2.7.7.41 phosphatidate cytidyltransferase dag + ctp → cdp-dag + pp CDS MG437 cdp-dag + ser → pser + 2.7.8.8 phosphatidylserine synthase PSS n.i. cmp 4.1.1.65 phosphatidylserine decarboxylase pser → peta PSD n.i.
    [Show full text]
  • Direct Induction of Gj-Specific Transcripts Following Reactivation of the Cdc28 Kinase in the Absence of De Novo Protein Synthesis
    Downloaded from genesdev.cshlp.org on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press Direct induction of Gj-specific transcripts following reactivation of the Cdc28 kinase in the absence of de novo protein synthesis Nicholas J. Marini and Steven I. Reed* The Scripps Research Institute, Department of Molecular Biology, La Jolla, California 92037 USA In Saccharomyces cerevisiae, the genes encoding the HO endonuclease, G,-specific cyclins CLNl and CLN2, as well as most proteins involved in DNA synthesis, are periodically transcribed with maximal levels reached in late G,. For HO and the DNA replication genes, cell cycle stage-specific expression has been shown to be dependent on the Cdc28 kinase and passage through START. Here, we show that cells released from cdc28*^ arrest in the presence of cycloheximide show wild-type levels of induction for HO, CLNl, and CDC9 (DNA ligase). Induction is gradual with a significant lag not seen in untreated cells where transcript levels fluctuate coordinately with the cell cycle. This lag may be due, at least in part, to association of the Cdc28 peptide with Gj cyclins to form an active kinase complex because overexpression of CLN2 prior to release in cycloheximide increases the rate of induction for CDC9 and HO. Consistent with this, release from pheromone arrest (where CLNl and CLN2 are not expressed) in cycloheximide shows no induction at all, Transcriptonal activation of CDC9 is likely to be mediated through a conserved promoter element also present in genes for other DNA synthesis enzymes similarly cell cycle regulated. The element contains an intact Mlul restriction enzyme recognition site (consensus ~5'-A/TPuACGCGTNA/T-3'), Insertion of a 20-bp fragment from the CDC9 promoter (containing a Mlul element) upstream of LacZ confers both periodic expression and transcriptional induction in cycloheximide following release from cdc28"' arrest.
    [Show full text]
  • A Review of Isozymes in Cancer1
    Cancer Research VOLUME31 NOVEMBER 1971 NUMBER11 [CANCER RESEARCH 31, 1523-1542, November 1971] A Review of Isozymes in Cancer1 Wayne E. Criss Department of Obstetrics and Gynecology, University of Florida College of Medicine, Gainesville, Florida 32601 TABLE OF CONTENTS postulated role for that particular isozymic system in cellular metabolism. Summary 1523 Introduction 1523 Normal enzyme differentiation 1523 INTRODUCTION Tumor enzyme differentiation 1524 Isozymes 1524 Normal Enzyme Differentiation DNA polymerase 1524 Enzyme differentiation is the process whereby, during the Hexokinase 1525 Fructose 1,6-diphosphatase 1525 development of an organ in an animal, the organ acquires the quantitative and qualitative adult enzyme patterns (122). Key Aldolase 1526 pathway enzymes in several metabolic processes have been Pyruvate kinase 1527 found to undergo enzymatic differentiation. The enzymes Láclatedehydrogenase 1527 Isocitrate dehydrogenase 1527 involved in nitrogen metabolism, and also in urea cycle Malate dehydrogenase 1528 metabolism (180), are tyrosine aminotransferase (123, 151, Glycerol phosphate dehydrogenase 1529 330, 410), tryptophan pyrrolase (261), serine dehydratase Glutaminase 1529 (123, 410), histidine ammonia lyase (11), and aspartate Aspartate aminotransferase 1530 aminotransferase (337, 388). The enzymes involved in nucleic Adenylate kinase 1531 acid metabolism are DNA polymerase (156, 277) and RNase (52). In glycolysis the enzymes are hexokinase-glucokinase Carbamyl phosphate synthetase 1531 Lactose synthetase 1533 (98, 389), galactokinase 30, aldolase (267, 315), pyruvate Discussion 1533 kinase (73, 386), and lactate dehydrogenase (67, 69). In References 1533 mitochondrial oxidation they are NADH oxidase, succinic oxidase, a-glycero-P oxidase, ATPase, cytochrome oxidase, and flavin content (84, 296). In glycogen metabolism the SUMMARY enzymes involved are UDPG pyrophosphorylase and UDPG glucosyltransferase (19).
    [Show full text]
  • Identification and Purification of a Factor That Binds to the Mlu I Cell Cycle Box of Yeast DNA Replication Genes
    Proc. Nati. Acad. Sci. USA Vol. 88, pp. 7155-7159, August 1991 Biochemistry Identification and purification of a factor that binds to the Mlu I cell cycle box of yeast DNA replication genes (Saccharomyces cerevisiae/G, phase/S phase/periodic transcription/DNA polymerase a) RATI VERMA, ARDEM PATAPOUTIAN, COLIN B. GORDON*, AND JUDITH L. CAMPBELL Braun Laboratories, California Institute of Technology, Pasadena, CA 91125 Communicated by John D. Roberts, May 15, 1991 ABSTRACT In Saccharomyces cerevisiae, the genes encod- that are a mixture of the sequences adjacent to both sites in ing at least 10 enzymes involved in DNA replication are the natural promoter confers periodicity (18). The Mlu I site periodically expressed in the late GI and S phases of the cell is necessary for the periodic expression of the CDC21 and cycle. All of these genes have one copy or more of the sequence CDC9 promoters as well (16, 17), suggesting coordinate ACGCGT, which conforms to the recognition site for the Mlu regulation of the entire set of periodic replication genes I restriction endonuclease. For the CDC21, CDC9, and POLl through Mlu I sites. We have designated the UAS that is genes, the Mlu I site has been shown to be absolutely required involved the Mlu I cell cycle box (MCB). for periodic transcription. Using nuclear extracts fractionated The MCB is a potential target for a trans-acting factor that by conventional and oligonucleotide affinity chromatography, responds either directly or indirectly to Start. Identification we have purified a 17-kDa protein that recognizes the Ml4 I of such a factor in an organism such as yeast should facilitate motif.
    [Show full text]
  • Monitoring of Successive Phosphorylations of Thymidine
    Monitoring of successive phosphorylations of thymidine using free and immobilized human nucleoside/nucleotide kinases by Flow Injection Analysis with High-Resolution Mass Spectrometry Justine Ferey, David da Silva, Cyril Colas, Reine Nehmé, Pierre Lafite, Vincent Roy, Philippe Morin, Richard Daniellou, Luigi Agrofoglio, Benoît Maunit To cite this version: Justine Ferey, David da Silva, Cyril Colas, Reine Nehmé, Pierre Lafite, et al.. Monitoring of successive phosphorylations of thymidine using free and immobilized human nucleoside/nucleotide kinases by Flow Injection Analysis with High-Resolution Mass Spectrometry. Analytica Chimica Acta, Elsevier Masson, 2019, 1049, pp.115-122. 10.1016/j.aca.2018.10.032. hal-02090335 HAL Id: hal-02090335 https://hal.archives-ouvertes.fr/hal-02090335 Submitted on 29 Nov 2019 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Monitoring of successive phosphorylations of thymidine using free and immobilized human nucleoside/nucleotide kinases by Flow Injection Analysis with High-Resolution Mass Spectrometry Justine Ferey1, David Da Silva*1, Cyril Colas1,2, Reine Nehmé*1, Pierre Lafite1, Vincent Roy1, Philippe Morin1, Richard Daniellou1, Luigi Agrofoglio1, Benoît Maunit1. 1 Univ. Orléans, CNRS, ICOA, UMR 7311, F-45067 Orléans, France.
    [Show full text]
  • Supplementary Table 1
    Up-regulated accession # Development M93275 ADFP, adipose differentiation related protein D43694 MATH-1, homolog of atonal 1 M64068 Bmi-1, zinc finger protein AW124785 Midnolin, midbrain nucleolar protein AI843178 Cla3, Cerebellar ataxia 3 D10712 Nedd1, Neural precursor cell expressed, developmentally down-regulated gene 1 AB011678 Doublecortin, for neurogenesis M57683 mPDGF-alpha-R, PDGF alpha receptor U41626 DSS1, deleted in split hand/split foot 1 homolog (Dss1), for limb development AB010833 PTCH2, patched 2, Mouse homolog of yeast CDC46 NP_034226 Ebf3, early B-cell factor 3 AI846695 Qk, Quaking U63386 Edr1 Early development regulator 1 (homolog of polyhomeotic 1), Mph1 AI043016 Rnf2, Ring finger protein 2 X69942 Enhancer-trap-locus 1, for transcription regulation AF100694 Ruvbl1, Ruv-B like protein 1, DNA helicase AW123618 Fzd2, Frizzled homolog 2 U88566 Sfrp1, secreted frizzled related protein 1 AA681520 Geminin-pending, for embryogenesis and morphogenesis U88567 Sfrp2, secreted frizzled related protein 2 AB025922 Gli1, GLI-Kruppel family member 1 AF089721 Smo, Smoothened X99104 Gli2, GLI-Kruppel family member 2 AF009414 SOX11, SRY-box containing gene 11 U61362 Grg1, groucho-related gene 1, Tle1, transducin-like enhancer of split 1 U85614 SRG3, Smarcc1, SWI/SNF related, matrix associated, action dependent regulator of chromatin, subfamily, member 1 M97506 Hen1, helix-loop-helix protein AI837838 Tmeff1, Transmembrane protein with EGF-like and two follistatin-like domains 1 U79748 Madh4, MAD homolog 4, for transcription regulation
    [Show full text]
  • Periodic Expression of Nuclear and Mitochondrial DNA Replication Genes During the Trypanosomatid Cell Cycle
    Journal of Cell Science 107, 3515-3520 (1994) 3515 Printed in Great Britain © The Company of Biologists Limited 1994 Periodic expression of nuclear and mitochondrial DNA replication genes during the trypanosomatid cell cycle Sally G. Pasion, Grant W. Brown, Lisa M. Brown and Dan S. Ray* Molecular Biology Institute and Department of Biology, University of California, Los Angeles, California 90024, USA *Author for correspondence SUMMARY In trypanosomatids, DNA replication in the nucleus and in drial topoisomerase, was disrupted by the insertion of a the single mitochondrion (or kinetoplast) initiates nearly NEO drug-resistance cassette was found to express both a simultaneously, suggesting that the DNA synthesis (S) truncated TOP2 mRNA and a truncated topoisomerase phases of the nucleus and the mitochondrion are coordi- polypeptide. The truncated mRNA was also expressed peri- nately regulated. To investigate the basis for the temporal odically coordinate with the expression of the endogenous link between nuclear and mitochondrial DNA synthesis TOP2 mRNA indicating that cis elements necessary for phases the expression of the genes encoding DNA ligase I, periodic expression are contained within cloned sequences. the 51 and 28 kDa subunits of replication protein A, dihy- The expression of both TOP2 and nuclear DNA replication drofolate reductase and the mitochondrial type II topoiso- genes at the G1/S boundary suggests that regulated merase were analyzed during the cell cycle progression of expression of these genes may play a role in coordinating synchronous cultures of Crithidia fasciculata. These DNA nuclear and mitochondrial S phases in trypanosomatids. replication genes were all expressed periodically, with peak mRNA levels occurring just prior to or at the peak of DNA synthesis in the synchronized cultures.
    [Show full text]
  • A Method and Kit for Determination of Thymidine
    (19) & (11) EP 1 856 275 B1 (12) EUROPEAN PATENT SPECIFICATION (45) Date of publication and mention (51) Int Cl.: of the grant of the patent: C12Q 1/48 (2006.01) 12.08.2009 Bulletin 2009/33 (86) International application number: (21) Application number: 06716936.7 PCT/SE2006/000246 (22) Date of filing: 24.02.2006 (87) International publication number: WO 2006/091158 (31.08.2006 Gazette 2006/35) (54) A METHOD AND KIT FOR DETERMINATION OF THYMIDINE KINASE ACTIVITY AND USE THEREOF VERFAHREN UND KIT ZUR BESTIMMUNG VON THYMIDINKINASE-AKTIVITÄT UND VERWENDUNG DAVON MÉTHODE ET TROUSSE PERMETTANT DE DÉTERMINER L’ACTIVITÉ DE LA THYMIDINE KINASE, ET LEUR MODE D’UTILISATION (84) Designated Contracting States: (56) References cited: AT BE BG CH CY CZ DE DK EE ES FI FR GB GR EP-A2- 0 094 923 WO-A1-90/06320 HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI WO-A1-20/04100760 WO-A2-20/04011627 SK TR Designated Extension States: • ARMSTRONG B ET AL: "SELECTIVE INHIBITION AL BA HR MK YU OF THYMIDINE KINASE ISOENZYMES BY (E)- 5-(2-BROMOVINYL)-2-DEOXYURIDINE" (30) Priority: 25.02.2005 SE 0500432 BIOCHEMICAL SOCIETY TRANSACTIONS, COLCHESTER, ESSEX, GB, vol. 18, no. 2, 1990, (43) Date of publication of application: page 270, XP001070196 ISSN: 0300-5127 21.11.2007 Bulletin 2007/47 • OHRVIK ANDERS ET AL: "Sensitive nonradiometric method for determining (73) Proprietor: Rönnerbol International AB thymidine kinase I activity" CLINICAL 752 39 Uppsala (SE) CHEMISTRY, vol. 50, no. 9, September 2004 (2004-09), pages 1597-1606, XP002470247 ISSN: (72) Inventor: GRONOWITZ, Simon 0009-9147 S-752 39 Uppsala (SE) • WICKREMASINGHE R.G.
    [Show full text]