DOCSLIB.ORG

Phyre 2 Results for P34558

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

Email [email protected] Description P34558 Sun Jun 30 11:11:21 BST Date 2013 Unique Job 2f66722d48841f4a ID Detailed template information # Template Alignment Coverage 3D Model Confidence % i.d. Template Information PDB header:transferase Chain: A: PDB Molecule:bifunctional coenzyme a synthase; 1 c2f6rA_ 100.0 26 Alignment PDBTitle: crystal structure of bifunctional coenzyme a synthase (coa synthase):2 (18044849) from mus musculus at 1.70 a resolution Fold:P-loop containing nucleoside triphosphate hydrolases 2 d1vhta_ Alignment 100.0 33 Superfamily:P-loop containing nucleoside triphosphate hydrolases Family:Nucleotide and nucleoside kinases PDB header:transferase Chain: B: PDB Molecule:dephospho-coa kinase; 3 c4i1vB_ 100.0 27 Alignment PDBTitle: crystal structure of a dephospho-coa kinase from burkholderia2 vietnamiensis bound to adp Fold:P-loop containing nucleoside triphosphate hydrolases 4 d1jjva_ Alignment 100.0 28 Superfamily:P-loop containing nucleoside triphosphate hydrolases Family:Nucleotide and nucleoside kinases Fold:P-loop containing nucleoside triphosphate hydrolases 5 d1uf9a_ Alignment 99.9 32 Superfamily:P-loop containing nucleoside triphosphate hydrolases Family:Nucleotide and nucleoside kinases PDB header:transferase Chain: H: PDB Molecule:dephospho-coa kinase; 6 c2grjH_ Alignment 99.9 26 PDBTitle: crystal structure of dephospho-coa kinase (ec 2.7.1.24)2 (dephosphocoenzyme a kinase) (tm1387) from thermotoga maritima at3 2.60 a resolution PDB header:transferase Chain: C: PDB Molecule:dephospho-coa kinase; 7 c2if2C_ 99.9 34 Alignment PDBTitle: crystal structure of the putative dephospho-coa kinase from aquifex2 aeolicus, northeast structural genomics target qr72. Fold:P-loop containing nucleoside triphosphate hydrolases 8 d1deka_ Alignment 99.9 14 Superfamily:P-loop containing nucleoside triphosphate hydrolases Family:Nucleotide and nucleoside kinases PDB header:structural genomics, unknown function Chain: A: PDB Molecule:upf0200 protein sso1041; 9 c3h0kA_ 99.9 18 Alignment PDBTitle: crystal structure of an adenylated kinase related protein from2 sulfolobus solfataricus to 3.25a PDB header:transferase 10 c3tr0A_ Alignment 99.8 16 Chain: A: PDB Molecule:guanylate kinase; PDBTitle: structure of guanylate kinase (gmk) from coxiella burnetii Fold:P-loop containing nucleoside triphosphate hydrolases 11 d1q3ta_ Alignment 99.8 16 Superfamily:P-loop containing nucleoside triphosphate hydrolases Family:Nucleotide and nucleoside kinases PDB header:transferase Chain: A: PDB Molecule:cytidylate kinase; 12 c3akcA_ 99.7 16 Alignment PDBTitle: crystal structure of cmp kinase in complex with cdp and adp from2 thermus thermophilus hb8 Fold:P-loop containing nucleoside triphosphate hydrolases 13 d1uj2a_ Alignment 99.7 15 Superfamily:P-loop containing nucleoside triphosphate hydrolases Family:Phosphoribulokinase/pantothenate kinase PDB header:transferase Chain: C: PDB Molecule:shikimate kinase; 14 c3vaaC_ 99.7 18 Alignment PDBTitle: 1.7 angstrom resolution crystal structure of shikimate kinase from2 bacteroides thetaiotaomicron PDB header:transferase Chain: B: PDB Molecule:phosphomevalonate kinase; 15 c3ch4B_ 99.7 15 Alignment PDBTitle: the crystal structure of human phosphomavelonate kinase at2 1.8 a resolution PDB header:transferase Chain: A: PDB Molecule:shikimate kinase; 16 c1zuiA_ 99.7 20 Alignment PDBTitle: structural basis for shikimate-binding specificity of helicobacter2 pylori shikimate kinase PDB header:transferase Chain: C: PDB Molecule:cytidylate kinase; 17 c2h92C_ 99.7 15 Alignment PDBTitle: crystal structure of staphylococcus aureus cytidine2 monophosphate kinase in complex with cytidine-5'-3 monophosphate PDB header:transferase Chain: B: PDB Molecule:uridine kinase; 18 c3asyB_ 99.7 15 Alignment PDBTitle: ligand-free structure of uridine kinase from thermus thermophilus hb8 Fold:P-loop containing nucleoside triphosphate hydrolases 19 d1ckea_ Alignment 99.7 13 Superfamily:P-loop containing nucleoside triphosphate hydrolases Family:Nucleotide and nucleoside kinases PDB header:transferase Chain: A: PDB Molecule:pantothenate kinase; 20 c2gesA_ 99.7 17 Alignment PDBTitle: pantothenate kinase from mycobacterium tuberculosis (mtpank) in2 complex with a coenzyme a derivative, form-i (rt) Fold:P-loop containing nucleoside triphosphate hydrolases 21 d1zaka1 Alignment not modelled 99.7 14 Superfamily:P-loop containing nucleoside triphosphate hydrolases Family:Nucleotide and nucleoside kinases Fold:P-loop containing nucleoside triphosphate hydrolases 22 d1s96a_ Alignment not modelled 99.7 13 Superfamily:P-loop containing nucleoside triphosphate hydrolases Family:Nucleotide and nucleoside kinases PDB header:transferase Chain: B: PDB Molecule:uridine-cytidine kinase 2; 23 c1ueiB_ not modelled 99.6 15 Alignment PDBTitle: crystal structure of human uridine-cytidine kinase 22 complexed with a feedback-inhibitor, utp PDB header:transferase Chain: A: PDB Molecule:guanylate kinase; 24 c1znyA_ not modelled 99.6 15 Alignment PDBTitle: crystal structure of mycobacterium tuberculosis guanylate kinase in2 complex with gdp PDB header:transferase Chain: B: PDB Molecule:cytidylate kinase; 25 c3r8cB_ not modelled 99.6 13 Alignment PDBTitle: crystal structure of cytidylate kinase (cmk) from mycobacterium2 abscessus Fold:P-loop containing nucleoside triphosphate hydrolases 26 d1znwa1 Alignment not modelled 99.6 16 Superfamily:P-loop containing nucleoside triphosphate hydrolases Family:Nucleotide and nucleoside kinases Fold:P-loop containing nucleoside triphosphate hydrolases 27 d1sq5a_ Alignment not modelled 99.6 18 Superfamily:P-loop containing nucleoside triphosphate hydrolases Family:Phosphoribulokinase/pantothenate kinase PDB header:transferase Chain: B: PDB Molecule:thymidylate kinase; 28 c2pbrB_ not modelled 99.6 9 Alignment PDBTitle: crystal structure of thymidylate kinase (aq_969) from aquifex aeolicus2 vf5 Fold:P-loop containing nucleoside triphosphate hydrolases 29 d1rkba_ Alignment not modelled 99.6 18 Superfamily:P-loop containing nucleoside triphosphate hydrolases Family:Nucleotide and nucleoside kinases PDB header:transferase Chain: A: PDB Molecule:gluconokinase; 30 c3t61A_ not modelled 99.6 15 Alignment PDBTitle: crystal structure of a gluconokinase from sinorhizobium meliloti 1021 PDB header:transferase 31 c3umfA_ Alignment not modelled 99.6 17 Chain: A: PDB Molecule:adenylate kinase; PDBTitle: schistosoma mansoni adenylate kinase Fold:P-loop containing nucleoside triphosphate hydrolases 32 d2cdna1 Alignment not modelled 99.6 15 Superfamily:P-loop containing nucleoside triphosphate hydrolases Family:Nucleotide and nucleoside kinases PDB header:transferase 33 c2bwjC_ Alignment not modelled 99.6 11 Chain: C: PDB Molecule:adenylate kinase 5; PDBTitle: structure of adenylate kinase 5 Fold:P-loop containing nucleoside triphosphate hydrolases 34 d4tmka_ Alignment not modelled 99.6 17 Superfamily:P-loop containing nucleoside triphosphate hydrolases Family:Nucleotide and nucleoside kinases Fold:P-loop containing nucleoside triphosphate hydrolases 35 d1viaa_ Alignment not modelled 99.6 17 Superfamily:P-loop containing nucleoside triphosphate hydrolases Family:Shikimate kinase (AroK) PDB header:transferase Chain: D: PDB Molecule:shikimate kinase; 36 c2pt5D_ not modelled 99.6 20 Alignment PDBTitle: crystal structure of shikimate kinase (aq_2177) from aquifex aeolicus2 vf5 PDB header:transferase Chain: B: PDB Molecule:pantothenate kinase; 37 c3tqcB_ not modelled 99.6 17 Alignment PDBTitle: structure of the pantothenate kinase (coaa) from coxiella burnetii Fold:P-loop containing nucleoside triphosphate hydrolases 38 d1ukza_ Alignment not modelled 99.6 16 Superfamily:P-loop containing nucleoside triphosphate hydrolases Family:Nucleotide and nucleoside kinases PDB header:transferase Chain: B: PDB Molecule:adenylate kinase; 39 c1zakB_ not modelled 99.6 14 Alignment PDBTitle: adenylate kinase from maize in complex with the inhibitor2 p1,p5-bis(adenosine-5'-)pentaphosphate (ap5a) PDB header:transferase 40 c2ar7A_ Alignment not modelled 99.6 13 Chain: A: PDB Molecule:adenylate kinase 4; PDBTitle: crystal structure of human adenylate kinase 4, ak4 PDB header:transferase (phosphotransferase) Chain: B: PDB Molecule:adenylate kinase isoenzyme-3; 41 c2ak3B_ Alignment not modelled 99.6 17 PDBTitle: the three-dimensional structure of the complex between2 mitochondrial matrix adenylate kinase and its substrate3 amp at 1.85 angstroms resolution PDB header:transferase Chain: A: PDB Molecule:adenylate kinase; 42 c2xb4A_ not modelled 99.6 19 Alignment PDBTitle: crystal structures of zinc containing adenylate kinase from2 desulfovibrio gigas Fold:P-loop containing nucleoside triphosphate hydrolases 43 d1p3ja1 Alignment not modelled 99.6 15 Superfamily:P-loop containing nucleoside triphosphate hydrolases Family:Nucleotide and nucleoside kinases Fold:P-loop containing nucleoside triphosphate hydrolases 44 d1ak2a1 Alignment not modelled 99.6 15 Superfamily:P-loop containing nucleoside triphosphate hydrolases Family:Nucleotide and nucleoside kinases Fold:P-loop containing nucleoside triphosphate hydrolases 45 d1zina1 Alignment not modelled 99.6 15 Superfamily:P-loop containing nucleoside triphosphate hydrolases Family:Nucleotide and nucleoside kinases PDB header:transferase Chain: A: PDB Molecule:fructokinase; 46 c3c8uA_ Alignment not modelled 99.6 14 PDBTitle: crystal structure of putative fructose transport system kinase2 (yp_612366.1) from silicibacter sp. tm1040 at 1.95 a resolution PDB header:transferase Chain: A: PDB Molecule:thymidylate kinase;
Recommended publications
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB

    Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB

    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
  • Interaction of Shikimic Acid with Shikimate Kinase

    Interaction of Shikimic Acid with Shikimate Kinase

    BBRC Biochemical and Biophysical Research Communications 325 (2004) 10–17 www.elsevier.com/locate/ybbrc Interaction of shikimic acid with shikimate kinase Jose´ Henrique Pereiraa, Jaim Simo˜es de Oliveirab, Fernanda Canduria,c, Marcio Vinicius Bertacine Diasa,Ma´rio Se´rgio Palmac,d, Luiz Augusto Bassob, Walter Filgueira de Azevedo Jr.a,d,*, Dio´genes Santiago Santose,* a Department of Physics, UNESP, Sa˜o Jose´ do Rio Preto, SP 15054-000, Brazil b Rede Brasileira de Pesquisa em Tuberculose Grupo de Microbiologia Molecular e Funcional, Departamento de Biologia Molecular e Biotecnologia, UFRGS, Porto Alegre, RS 91501-970, Brazil c Center for Applied Toxinology, Institute Butantan, Sa˜o Paulo, SP 05503-900, Brazil d Laboratory of Structural Biology and Zoochemistry, CEIS/Department of Biology, Institute of Biosciences, UNESP, Rio Claro, SP 13506-900, Brazil e Centro de Pesquisa e Desenvolvimento em Biologia Molecular e Funcional, Pontifı´cia Universidade Cato´lica do Rio Grande do Sul, Porto Alegre, RS 90619-900, Brazil Received 24 September 2004 Available online 19 October 2004 Abstract The crystal structure of shikimate kinase from Mycobacterium tuberculosis (MtSK) complexed with MgADP and shikimic acid (shikimate) has been determined at 2.3 A˚ resolution, clearly revealing the amino acid residues involved in shikimate binding. In MtSK, the Glu61 strictly conserved in SK forms a hydrogen bond and salt-bridge with Arg58 and assists in positioning the guan- idinium group of Arg58 for shikimate binding. The carboxyl group of shikimate interacts with Arg58, Gly81, and Arg136, and hydroxyl groups with Asp34 and Gly80. The crystal structure of MtSK–MgADP–shikimate will provide crucial information for elucidation of the mechanism of SK-catalyzed reaction and for the development of a new generation of drugs against tuberculosis.
  • Enzymatic Manufacture of Deoxythymidine-5'-Triphosphate with Permeable Intact Cells of E. Coli Coexpressing Thymidylate Kinase

    Enzymatic Manufacture of Deoxythymidine-5'-Triphosphate with Permeable Intact Cells of E. Coli Coexpressing Thymidylate Kinase

    J. Microbiol. Biotechnol. (2015), 25(12), 2034–2042 http://dx.doi.org/10.4014/jmb.1506.06020 Research Article Review jmb Enzymatic Manufacture of Deoxythymidine-5’-Triphosphate with Permeable Intact Cells of E. coli Coexpressing Thymidylate Kinase and Acetate Kinase Jiao Zhang, Yahui Qian, Qingbao Ding*, and Ling Ou* State Key Laboratory of Bioreactor Engineering, East China University of Science and Technology, Shanghai 200237, P.R. China Received: June 8, 2015 Revised: July 26, 2015 A one-pot process of enzymatic synthesis of deoxythymidine-5’-triphosphate (5’-dTTP) Accepted: September 11, 2015 employing whole cells of recombinant Escherichia coli coexpressing thymidylate kinase (TMKase) and acetate kinase (ACKase) was developed. Genes tmk and ack from E. coli were First published online cloned and inserted into pET28a(+), and then transduced into E. coli BL21 (DE3) to form September 15, 2015 recombinant strain pTA in which TMKase and ACKase were simultaneously overexpressed. It *Corresponding authors was found that the relative residual specific activities of TMKase and ACKase, in pTA Q.D. pretreated with 20 mM ethylene diamine tetraacetic acid (EDTA) at 25oC for 30 min, were 94% Phone: +86-21-64250676; Fax: +86-21-64250676; and 96%, respectively. The yield of 5’-dTTP reached above 94% from 5 mM deoxythymidine E-mail: [email protected] 5’-monophosphate (5’-dTMP) and 15 mM acetyl phosphate catalyzed with intact cells of pTA L.O. Phone: +86-21-64253257; pretreated with EDTA. The process was so effective that only 0.125 mM adenosine-5’- Fax: +86-21-64253257; triphosphate was sufficient to deliver the phosphate group from acetyl phosphate to dTMP E-mail: [email protected] and dTDP.
  • Genome of Phaeocystis Globosa Virus Pgv-16T Highlights the Common Ancestry of the Largest Known DNA Viruses Infecting Eukaryotes

    Genome of Phaeocystis Globosa Virus Pgv-16T Highlights the Common Ancestry of the Largest Known DNA Viruses Infecting Eukaryotes

    Genome of Phaeocystis globosa virus PgV-16T highlights the common ancestry of the largest known DNA viruses infecting eukaryotes Sebastien Santinia, Sandra Jeudya, Julia Bartolia, Olivier Poirota, Magali Lescota, Chantal Abergela, Valérie Barbeb, K. Eric Wommackc, Anna A. M. Noordeloosd, Corina P. D. Brussaardd,e,1, and Jean-Michel Claveriea,f,1 aStructural and Genomic Information Laboratory, Unité Mixte de Recherche 7256, Centre National de la Recherche Scientifique, Aix-Marseille Université, 13288 Marseille Cedex 9, France; bCommissariat à l’Energie Atomique–Institut de Génomique, 91057 Evry Cedex, France; cDepartment of Plant and Soil Sciences, University of Delaware, Newark, DE 19711; dDepartment of Biological Oceanography, Royal Netherlands Institute for Sea Research, NL-1790 AB Den Burg (Texel), The Netherlands; eAquatic Microbiology, Institute for Biodiversity and Ecosystem Dynamics, University of Amsterdam, Amsterdam, The Netherlands; and fService de Santé Publique et d’Information Médicale, Hôpital de la Timone, Assistance Publique–Hôpitaux de Marseille, FR-13385 Marseille, France Edited by James L. Van Etten, University of Nebraska, Lincoln, NE, and approved May 1, 2013 (received for review February 22, 2013) Large dsDNA viruses are involved in the population control of many viruses: 730 kb and 1.28 Mb for CroV and Megavirus chilensis, globally distributed species of eukaryotic phytoplankton and have respectively. Other studies, targeting virus-specific genes [e.g., a prominent role in bloom termination. The genus Phaeocystis (Hap- DNA polymerase B (8) or capsid proteins (9)] have suggested tophyta, Prymnesiophyceae) includes several high-biomass-forming a close phylogenetic relationship between Mimivirus and several phytoplankton species, such as Phaeocystis globosa, the blooms of giant dsDNA viruses infecting various unicellular algae such as which occur mostly in the coastal zone of the North Atlantic and the Pyramimonas orientalis (Chlorophyta, Prasinophyceae), Phaeocys- North Sea.
  • Proteome Cold-Shock Response in the Extremely Acidophilic Archaeon, Cuniculiplasma Divulgatum

    Proteome Cold-Shock Response in the Extremely Acidophilic Archaeon, Cuniculiplasma Divulgatum

    microorganisms Article Proteome Cold-Shock Response in the Extremely Acidophilic Archaeon, Cuniculiplasma divulgatum Rafael Bargiela 1 , Karin Lanthaler 1,2, Colin M. Potter 1,2 , Manuel Ferrer 3 , Alexander F. Yakunin 1,2, Bela Paizs 1,2, Peter N. Golyshin 1,2 and Olga V. Golyshina 1,2,* 1 School of Natural Sciences, Bangor University, Deiniol Rd, Bangor LL57 2UW, UK; [email protected] (R.B.); [email protected] (K.L.); [email protected] (C.M.P.); [email protected] (A.F.Y.); [email protected] (B.P.); [email protected] (P.N.G.) 2 Centre for Environmental Biotechnology, Bangor University, Deiniol Rd, Bangor LL57 2UW, UK 3 Systems Biotechnology Group, Department of Applied Biocatalysis, CSIC—Institute of Catalysis, Marie Curie 2, 28049 Madrid, Spain; [email protected] * Correspondence: [email protected]; Tel.: +44-1248-388607; Fax: +44-1248-382569 Received: 27 April 2020; Accepted: 15 May 2020; Published: 19 May 2020 Abstract: The archaeon Cuniculiplasma divulgatum is ubiquitous in acidic environments with low-to-moderate temperatures. However, molecular mechanisms underlying its ability to thrive at lower temperatures remain unexplored. Using mass spectrometry (MS)-based proteomics, we analysed the effect of short-term (3 h) exposure to cold. The C. divulgatum genome encodes 2016 protein-coding genes, from which 819 proteins were identified in the cells grown under optimal conditions. In line with the peptidolytic lifestyle of C. divulgatum, its intracellular proteome revealed the abundance of proteases, ABC transporters and cytochrome C oxidase. From 747 quantifiable polypeptides, the levels of 582 proteins showed no change after the cold shock, whereas 104 proteins were upregulated suggesting that they might be contributing to cold adaptation.
  • Table S1. List of Oligonucleotide Primers Used

    Table S1. List of Oligonucleotide Primers Used

    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
  • Genome-Scale Fitness Profile of Caulobacter Crescentus Grown in Natural Freshwater

    Genome-Scale Fitness Profile of Caulobacter Crescentus Grown in Natural Freshwater

    Supplemental Material Genome-scale fitness profile of Caulobacter crescentus grown in natural freshwater Kristy L. Hentchel, Leila M. Reyes Ruiz, Aretha Fiebig, Patrick D. Curtis, Maureen L. Coleman, Sean Crosson Tn5 and Tn-Himar: comparing gene essentiality and the effects of gene disruption on fitness across studies A previous analysis of a highly saturated Caulobacter Tn5 transposon library revealed a set of genes that are required for growth in complex PYE medium [1]; approximately 14% of genes in the genome were deemed essential. The total genome insertion coverage was lower in the Himar library described here than in the Tn5 dataset of Christen et al (2011), as Tn-Himar inserts specifically into TA dinucleotide sites (with 67% GC content, TA sites are relatively limited in the Caulobacter genome). Genes for which we failed to detect Tn-Himar insertions (Table S13) were largely consistent with essential genes reported by Christen et al [1], with exceptions likely due to differential coverage of Tn5 versus Tn-Himar mutagenesis and differences in metrics used to define essentiality. A comparison of the essential genes defined by Christen et al and by our Tn5-seq and Tn-Himar fitness studies is presented in Table S4. We have uncovered evidence for gene disruptions that both enhanced or reduced strain fitness in lake water and M2X relative to PYE. Such results are consistent for a number of genes across both the Tn5 and Tn-Himar datasets. Disruption of genes encoding three metabolic enzymes, a class C β-lactamase family protein (CCNA_00255), transaldolase (CCNA_03729), and methylcrotonyl-CoA carboxylase (CCNA_02250), enhanced Caulobacter fitness in Lake Michigan water relative to PYE using both Tn5 and Tn-Himar approaches (Table S7).
  • Pantothenate Kinase-Associated Neurodegeneration

    Pantothenate Kinase-Associated Neurodegeneration

    Pantothenate kinase-associated neurodegeneration Description Pantothenate kinase-associated neurodegeneration (formerly called Hallervorden-Spatz syndrome) is a disorder of the nervous system. This condition is characterized by progressive difficulty with movement, typically beginning in childhood. Movement abnormalities include involuntary muscle spasms, rigidity, and trouble with walking that worsens over time. Many people with this condition also develop problems with speech ( dysarthria), and some develop vision loss. Additionally, affected individuals may experience a loss of intellectual function (dementia) and psychiatric symptoms such as behavioral problems, personality changes, and depression. Pantothenate kinase-associated neurodegeneration is characterized by an abnormal buildup of iron in certain areas of the brain. A particular change called the eye-of-the- tiger sign, which indicates an accumulation of iron, is typically seen on magnetic resonance imaging (MRI) scans of the brain in people with this disorder. Researchers have described classic and atypical forms of pantothenate kinase- associated neurodegeneration. The classic form usually appears in early childhood, causing severe problems with movement that worsen rapidly. Features of the atypical form appear later in childhood or adolescence and progress more slowly. Signs and symptoms vary, but the atypical form is more likely than the classic form to involve speech defects and psychiatric problems. A condition called HARP (hypoprebetalipoproteinemia, acanthocytosis, retinitis pigmentosa, and pallidal degeneration) syndrome, which was historically described as a separate syndrome, is now considered part of pantothenate kinase-associated neurodegeneration. Frequency The precise incidence of this condition is unknown. It is estimated to affect 1 to 3 per million people worldwide. Causes Mutations in the PANK2 gene cause pantothenate kinase-associated neurodegeneration.
  • Identification of Active Molecules Against Mycobacterial Shikimate

    Identification of Active Molecules Against Mycobacterial Shikimate

    Identification of active molecules against Mycobacterial Shikimate Kinase from Chemical library and their affinity with different domains Sapna Pandey1, Ekta Dhamija1, Sanjay Kumar1, Pragya Yadav1, Tadigopula Narender1, Arnava Dasgupta1, Ravishankar Ramachandran1, and KISHORE SRIVASTAVA1 1Central Drug Research Institute November 9, 2020 Abstract Tuberculosis (TB), regardless of being the oldest disease is still a menace that humans have not been able to control. With the advancement in the drug discovery programme, target-based drug discovery appears to be one of the promising techniques for the development of future therapeutics. It involves identifying an essential gene involved in the pathogenesis of the disease and then targeting the protein against a defined chemical library. Shikimate kinase is one such validated target in mycobacterium. It is vital for the growth of bacteria and is absent in mammals, making it an ideal drug target. Here 6427 compounds were screened through structure based virtual screening where compound S-014-1049 was found active against H37Rv and proven non-cytotoxic in in vitro studies. It specifically binds to the core domain of MTSK. Introduction The development of drug resistance is a severe threat to public health. Presently, use of antibiotics targets bacterial structure and essential functions. Due to the well-identified anti-mycobacterial resistance, there has been an increased interest in the discovery of novel drugs to target other essential processes of bacterial survival. Currently, target-based drug screening is promising and efficient way for development of therapeutic agents. In recent years, extensive efforts have been made for the discovery of inhibitors of enzymes involved in the biosynthesis of aromatic amino acids.
  • The Role of the Salvage Pathway in Nucleotide Sugar Biosynthesis

    The Role of the Salvage Pathway in Nucleotide Sugar Biosynthesis

    THE ROLE OF THE SALVAGE PATHWAY IN NUCLEOTIDE SUGAR BIOSYNTHESIS: IDENTIFICATION OF SUGAR KINASES AND NDP-SUGAR PYROPHOSPHORYLASES by TING YANG (Under the Direction of Maor Bar-Peled) ABSTRACT The synthesis of polysaccharides, glycoproteins, glycolipids, glycosylated secondary metabolites and hormones requires a large number of glycosyltransferases and a constant supply of nucleotide sugars. In plants, photosynthesis and the NDP-sugar inter-conversion pathway are the major entry points to form NDP-sugars. In addition to these pathways is the salvage pathway, a less understood metabolism that provides the flux of NDP-sugars. This latter pathway involves the hydrolysis of glycans to free sugars, sugar transport, sugar phosphorylation and nucleotidylation. The balance between glycan synthesis and recycling as well as its regulation at various plant developmental stages remains elusive as many of the molecular components are unknown. To understand how the salvage pathway contributes to the sugar flux and cell wall biosynthesis, my research focused on the functional identification of salvage pathway sugar kinases and NDP-sugar pyrophosphorylases. This research led to the first identification and enzymatic characterization of galacturonic acid kinase (GalA kinase), galactokinase (GalK), a broad UDP-sugar pyrophosphorylase (sloppy), two promiscuous UDP-GlcNAc pyrophosphorylases (GlcNAc-1-P uridylyltransferases), as well as UDP-sugar pyrophosphorylase paralogs from Trypanosoma cruzi and Leishmania major. To evaluate the salvage pathway in plant biology, we further investigated a sugar kinase mutant: galacturonic acid kinase mutant (galak) and determined if and how galak KO mutant affects the synthesis of glycans in Arabidopsis. Feeding galacturonic acid to the seedlings exhibited a 40-fold accumulation of free GalA in galak mutant, while the wild type (WT) plant readily metabolizes the fed-sugar.
  • Leeds Thesis Template

    Leeds Thesis Template

    Determining the Link Between Genome Integrity and Seed Quality Robbie Michael Gillett Submitted in accordance with the requirements for the degree of Doctor of Philosophy The University of Leeds Faculty of Biological Sciences School of Biology January, 2017 - ii - The candidate confirms that the work submitted is his own and that appropriate credit has been given where reference has been made to the work of others. This copy has been supplied on the understanding that it is copyright material and that no quotation from the thesis may be published without proper acknowledgement. The right of Robbie M. Gillett to be identified as Author of this work has been asserted by him in accordance with the Copyright, Designs and Patents Act 1988. © 2016 The University of Leeds and Robbie Michael Gillett - iii - Acknowledgements I would like to thank my supervisor Dr Christopher West and co-supervisor Dr. Wanda Waterworth for all of their support, expertise and incredible patience and for always being available to help. I would like to thank Aaron Barrett, James Cooper, Valérie Tennant, and all my other friends at university for their help throughout my PhD. Thanks to Vince Agboh and Grace Hoysteed for their combined disjointedness and to Ashley Hines, Daniel Johnston and Darryl Ransom for being a source of entertainment for many years. I would like to thank my international Sona friends, Lindsay Hoffman and Jan Maarten ten Katen. Finally unreserved thanks to my loving parents who supported me throughout the tough times and to my Grandma and Granddad, Jean and Dennis McCarthy, who were always very vocal with their love, support and pride.
  • Biological Phosphorylation of an Unnatural Base Pair (UBP) Using a Drosophila Melanogaster Deoxynucleoside Kinase (Dmdnk) Mutant

    Biological Phosphorylation of an Unnatural Base Pair (UBP) Using a Drosophila Melanogaster Deoxynucleoside Kinase (Dmdnk) Mutant

    RESEARCH ARTICLE Biological phosphorylation of an Unnatural Base Pair (UBP) using a Drosophila melanogaster deoxynucleoside kinase (DmdNK) mutant Fei Chen1,2,3☯*, Yuan Zhang4☯, Ashley B. Daugherty5, Zunyi Yang3, Ryan Shaw3, Mengxing Dong1,2, Stefan Lutz5, Steven A. Benner3* a1111111111 1 CAS Key Laboratory of Genome Sciences & Information, Beijing Institute of Genomics, Chinese Academy of Sciences, Beijing, China, 2 University of Chinese Academy of Sciences, Beijing, China, 3 Foundation for a1111111111 Applied Molecular Evolution (FfAME), Alachua, Florida, United States of America, 4 College of Chemistry, a1111111111 Beijing Normal University, Beijing, China, 5 Department of Chemistry, Emory University School of Medicine, a1111111111 Atlanta, Georgia, United States of America a1111111111 ☯ These authors contributed equally to this work. * [email protected] (FC); [email protected] (SAB) OPEN ACCESS Abstract Citation: Chen F, Zhang Y, Daugherty AB, Yang Z, Shaw R, Dong M, et al. (2017) Biological One research goal for unnatural base pair (UBP) is to replicate, transcribe and translate phosphorylation of an Unnatural Base Pair (UBP) them in vivo. Accordingly, the corresponding unnatural nucleoside triphosphates must be using a Drosophila melanogaster deoxynucleoside available at sufficient concentrations within the cell. To achieve this goal, the unnatural kinase (DmdNK) mutant. PLoS ONE 12(3): nucleoside analogues must be phosphorylated to the corresponding nucleoside triphos- e0174163. https://doi.org/10.1371/journal. pone.0174163 phates by a cascade of three kinases. The first step is the monophosphorylation of unnatural deoxynucleoside catalyzed by deoxynucleoside kinases (dNK), which is generally consid- Editor: Giovanni Maga, Istituto di Genetica Molecolare, ITALY ered the rate limiting step because of the high specificity of dNKs.