(12) Patent Application Publication (10) Pub. No.: US 2013/0156808 A1 Jonjic (43) Pub

US 2013 O156808A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2013/0156808 A1 Jonjic (43) Pub. Date: Jun. 20, 2013

(54) VACCINE COMPRISING Publication Classification BETA-HERPESVIRUS (51) Int. Cl. (71) Applicant: Stipan Jonjic, Viskovo (HR) A6139/00 (2006.01) CI2N 7/04 (2006.01) (72) Inventor: Stipan Jonjic, Viskovo (HR) (52) U.S. Cl. CPC ...... A61K39/00 (2013.01); CI2N 7/045 (2013.01) (21) Appl. No.: 13/684,241 USPC ... 424/199.1; 536/23.1; 424/184.1; 435/236; 435/320.1 (22) Filed: Nov. 22, 2012 (57) ABSTRACT The present invention relates to a beta-herpesvirus, prefer Related U.S. Application Data ably a recombinant beta-herpesvirus, wherein the beta-herp esvirus comprises at least one heterologous nucleic acid, (60) Provisional application No. 61/562,738, filed on Nov. wherein the at least one heterologous nucleic acid comprises 22, 2011. a gene encoding a cellular ligand. Patent Application Publication Jun. 20, 2013 Sheet 1 of 78 US 2013/0156808A1

Patent Application Publication Jun. 20, 2013 Sheet 2 of 78 US 2013/0156808A1

Fig.1B Airis RAE-ty Cy Cy

&x------::::::: 3 & s RAE-3 Patent Application Publication Jun. 20, 2013 Sheet 3 of 78 US 2013/0156808A1

Fig.1C

{} $8; 8.88% 8::::$388.88: e 848. :88:8:y

M &M ity ------& t ka

× : s X X- s: s Patent Application Publication Jun. 20, 2013 Sheet 4 of 78 US 2013/0156808A1

Fig.1D

Days after infection Patent Application Publication Jun. 20, 2013 Sheet 5 of 78 US 2013/0156808A1

Fig.1E

ays after infection Patent Application Publication Jun. 20, 2013 Sheet 6 of 78 US 2013/0156808A1

s s & s S ; : *S 83 s 3:38:::::::::::: ays aft: infector Patent Application Publication Jun. 20, 2013 Sheet 7 of 78 US 2013/0156808A1

Fig.2B

Ex8: 8888 is $388.: 83C88w

28 se 38ys ai: 88;io Patent Application Publication Jun. 20, 2013 Sheet 8 of 78 US 2013/0156808A1

Fig.3A

8-8::::: Patent Application Publication Jun. 20, 2013 Sheet 9 of 78 US 2013/0156808A1

& Patent Application Publication Jun. 20, 2013 Sheet 10 of 78 US 2013/0156808A1

Fig.3C

Patent Application Publication Jun. 20, 2013 Sheet 11 of 78 US 2013/0156808A1

Fig.3D

8:38-3-8:38: Patent Application Publication Jun. 20, 2013 Sheet 12 of 78 US 2013/0156808A1

Fig.3E

*:::::::::::

88.8.3:838. Patent Application Publication Jun. 20, 2013 Sheet 13 of 78 US 2013/0156808A1

Fig.4A

s OCS & 3:38

& 38 3 88 8sie:fe C8* 88 haive MCMV-specific Patent Application Publication Jun. 20, 2013 Sheet 14 of 78 US 2013/0156808A1

Fig. 4B

Steen & 888 8A: 3888&

Days &fie c8ailege $33ys aft& chai:ge 33ays aft& chair:g& Patent Application Publication Jun. 20, 2013 Sheet 15 of 78 US 2013/0156808A1

Fig.4C

S3 ics& s : 8* *: 3G is8S X {* *

8. s Patent Application Publication Jun. 20, 2013 Sheet 16 of 78 US 2013/0156808A1

Fig.5A

888 i 838. 8088

0-6-lb.------1284-DL

...:3S Spiege: Saiway gi:33 Patent Application Publication Jun. 20, 2013 Sheet 17 of 78 US 2013/0156808A1

Fig.5B

t' is 3: #48-88C&ir;3 £AE-i 8:C88w:30 fia: ; 8:08.8wr:S X------1. rererrerrerrerrerrerrerrerrerer, ressessessessessessessessessee FA-18CRAvrix}

88 Patent Application Publication Jun. 20, 2013 Sheet 18 of 78 US 2013/0156808A1

Fig.5C

City RAE-1, MCMVrs Patent Application Publication Jun. 20, 2013 Sheet 19 of 78 US 2013/0156808A1

Fig.6A

IFNRapR

x if -:x gisa Cixi -- 8A-18C&W Patent Application Publication Jun. 20, 2013 Sheet 20 of 78 US 2013/0156808A1

Fig.6B

...tigs Patent Application Publication Jun. 20, 2013 Sheet 21 of 78 US 2013/0156808A1

Fig.7A

$8 288 38::::::::

- 4.rt 8 x & 8:88-8-&

www.www.v.v. So- ::::::::: 883: {38:ex KX:

888 & Patent Application Publication Jun. 20, 2013 Sheet 22 of 78 US 2013/0156808A1

Fig.7B

4. : k

&:88: .338g: :::::: Patent Application Publication Jun. 20, 2013 Sheet 23 of 78 US 2013/0156808A1

Fig.8A

8. Patent Application Publication Jun. 20, 2013 Sheet 24 of 78 US 2013/0156808A1

Fig.8B

ities:tex

::::::: 88:

Hso muir-i RAE-tag Patent Application Publication Jun. 20, 2013 Sheet 25 of 78 US 2013/0156808A1

Fig.9A

s : & 8.

i 8: x Patent Application Publication Jun. 20, 2013 Sheet 26 of 78 US 2013/0156808A1

Fig.9B

s 3. 29 Rays castiffs:tity: 3 sist C8 R&E-gy kickii Patent Application Publication Jun. 20, 2013 Sheet 27 of 78 US 2013/0156808A1

Fig.10

#--~~~~~~~~~~~~~~~~~~~~~~~~~~~

* * } * * * * Patent Application Publication Jun. 20, 2013 Sheet 28 of 78 US 2013/0156808A1

Fig.11

tissisted m |

Patent Application Publication Jun. 20, 2013 Sheet 29 of 78 US 2013/0156808A1

Fig.12A

:38.883 : *x. :::33,888 3.88 88.888.8.88 88.883 & 83.388: 888 & 38.888 &: 8888.

88: 8888 : Patent Application Publication Jun. 20, 2013 Sheet 30 of 78 US 2013/0156808A1

Fig.12B

iisteric fiepolytogenes challegé

w: *rotective capacity sieterrinatio & 3 weeks post 3 days $38st inizatio aiege intratizatios ig. Patent Application Publication Jun. 20, 2013 Sheet 31 of 78 US 2013/0156808A1

Fig.13

-- Wit MCMV H Rae-1, MCMV List ahe MCMV List

O 2 3 4. 5 6 7 34.56789. Days post infection Patent Application Publication Jun. 20, 2013 Sheet 32 of 78 US 2013/0156808A1

Fig.14

8 : 38 & 83 3. 88 8: 3&sc38.388gties: 38s 38&:::$8&888 {X 88w ist is 888-8; 88% is: Patent Application Publication Jun. 20, 2013 Sheet 33 of 78 US 2013/0156808A1

Fig.15 A B 100 3 80 H -- o 60 8 d d C. 40 C s st 20 c 0 Tem c C D O MCMVList O Rae-1y MCMVList 2 t 3 3 H - do do ? d C) s s

C os l d 9. C. s S8 O 8 14 30 60 92 8 14 30 60 92 Days post infection Days post infection Patent Application Publication Jun. 20, 2013 Sheet 34 of 78 US 2013/0156808A1

Fig.16A

See iiver

::::::::38:38. 8:::::::8: M. 8:88-338 : Patent Application Publication Jun. 20, 2013 Sheet 35 of 78 US 2013/0156808A1

PALS - periarteriolar lymphoid sheath central arthery Patent Application Publication Jun. 20, 2013 Sheet 36 of 78 US 2013/0156808A1

Fig.17

ississiysis

& s x. e s & Patent Application Publication Jun. 20, 2013 Sheet 37 of 78 US 2013/0156808A1

Fig.18

&sixx 88:

8 s : WWWYY*ws ...... 8 - 8. itis 8-a $x: 8 2

8& 38:888 :8: 888& 888 & 3888 S: 38s 3888-888 &six$88 accitxxx: & x 888; & 88 is 8 8x8- 88 is Patent Application Publication Jun. 20, 2013 Sheet 38 of 78 US 2013/0156808A1

Patent Application Publication Jun. 20, 2013 Sheet 39 of 78 US 2013/0156808A1

Fig. 20

$3. 38w & M & 8w Sixx:3883: x & & e &- 8:8 4 I $888-8g 888wist & & 3- *38Y &irates grex8 were i.888 &8x8g888: 3:3:38gxi Patent Application Publication Jun. 20, 2013 Sheet 40 of 78 US 2013/0156808A1

Fig. 21

Rae-y 8088w.jst Patent Application Publication Jun. 20, 2013 Sheet 41 of 78 US 2013/0156808A1

Fig. 22

E. six:ss.xxx s: 888-ky 388 list 38 s 88. 88: 3ays & 388xx $3&y: xis: 8:8:388 Patent Application Publication Jun. 20, 2013 Sheet 42 of 78 US 2013/0156808A1

Fig. 23

3. .S. s : ,

WW8 & 8 8 s & 8 : m : *. s & x :::::::::::8: & 8.8 is& 8.x: v.888 V. V. & 8. Ra8-iy 808w ist Ew: soil 38 8s 3 ty 83888 8888 as post infection &ys ::::::::::::::cts C. :8itiexte: { w x Rae-ty city is: Patent Application Publication Jun. 20, 2013 Sheet 43 of 78 US 2013/0156808A1

Fig.24A

- -. - ---. --- "-- - s Patent Application Publication Jun. 20, 2013 Sheet 44 of 78 US 2013/0156808A1

Fig.24B

"a s--.

r ------s CMV-PRAE-lyC-P RAE- pa CMv-PE,HA pA Patent Application Publication Jun. 20, 2013 Sheet 45 of 78 US 2013/0156808A1

s ::::::::::::::f - E PR8 HA

st a

-ex. E. R38s. R ar.

s 8.

Patent Application Publication Jun. 20, 2013 Sheet 46 of 78 US 2013/0156808A1

Fig.24D

. s sessessies 8 Rs.

$53:5. g3 84 RS-H & :

ass:

. R Reaga'a R af::::: : . Ss:::::8:

F & 3 3: PR8–HA teasess 3:ecais 88.3 kg

Patent Application Publication Jun. 20, 2013 Sheet 47 of 78 US 2013/0156808A1

Fig. 24 E 8:88-8-8& 8::::::::::::

Patent Application Publication Jun. 20, 2013 Sheet 48 of 78 US 2013/0156808A1

Fig. 25

g 9. Ma titly 8. •- Rae-igiCNV HA the CW A s 36 g5 g4 iss f 2. 3 3. 8 f says post infection Patent Application Publication Jun. 20, 2013 Sheet 49 of 78 US 2013/0156808A1

Fig.26

8. 3:33 :: :x: A is 8 H D c G. I. F. K. P. E. l ra

... 2-ax

--- 's- ...a W ------CMW-P RAE-1y wgAGAPNSAA was Patent Application Publication Jun. 20, 2013 Sheet 50 of 78 US 2013/0156808A1

Fig.27A

SINFEK c) CV-A to Rae-1 FitCMV HA

days post infection Patent Application Publication Jun. 20, 2013 Sheet 51 of 78 US 2013/0156808A1

Fig. 27B

AS E3 2.3 s 85 1.5 w a. &4 S-38. 8.0 & 2 s s & { . bays post infection bays post infection

m139 33 y s o6. s a.35 a:43 r aa 84 83

4. 3 . 2 f2 t s: s

3 s 33 88. ?ays post itection )ays post infestion Patent Application Publication Jun. 20, 2013 Sheet 52 of 78 US 2013/0156808A1

Fig. 28

RSS WES Sps s s s 3. s s Sr. S5 A E4 i-s tra --eeC s g 38e. X Day 4 p.i. 3 is s { s-- 3 S. 8 s s g4 2 s s s2 M

3 at 81's a sat 57 FRF 88CMy HA Rae-y clay-A

s s * 3. s s s S4 is 4 es s Day 8 p.i. g3s S. 3.s tes w 82Xaa 33 2. ww.s 2 i s s X Patent Application Publication Jun. 20, 2013 Sheet 53 of 78 US 2013/0156808A1

Fig. 29

Day 8 p.i.

4. SNEK 8 M4s $ 8 h 3. . s --O "re 82o 5,6 8c 8 & 2 O s t g is 2 8 8 CS3 is cSysis NCR (pig's cassis ostics 3''' c5?88 Cssisirst's Patent Application Publication Jun. 20, 2013 Sheet 54 of 78 US 2013/0156808A1

Fig. 30A - UBP2

KonO 2 UBP2 Bam cut with Kpni and BamH te cut with Kipni and Bgll, tigate to PCR fragment Kpni MEP UBP2 Kan

II. MEP LBP2 Kar U16 - x - U16 homology homology region region

IV. Patent Application Publication Jun. 20, 2013 Sheet 55 of 78 US 2013/0156808A1

Fig.3OB

88: ------1.-1.-1.-1.-1.-1.- e set o F mino v. --- Hindi -- ---.

- - s -

WWP BP2 Patent Application Publication Jun. 20, 2013 Sheet 56 of 78 US 2013/0156808A1

Fig.30C

cy s n - y P s to C tes l l e L.

He als

72 52 A2 34 26

ka short exposure long exposure Patent Application Publication Jun. 20, 2013 Sheet 57 of 78 US 2013/0156808A1

Fig.30D

s & ...A uninfected Control ... HCMV TB40 infected - HCMV TB40-ULBP2 infected

w 8 III I I I I I f O 3. 38 :8: ;3 F33 -Ges ULBP2 expression Patent Application Publication Jun. 20, 2013 Sheet 58 of 78 US 2013/0156808A1

Fig.30E

: 5.

-- itiece it: -H H 88 gig -- H. Si-E ist:

88: 5: 2,5: Ef sic Patent Application Publication Jun. 20, 2013 Sheet 59 of 78 US 2013/0156808A1

Fig.31

m is 8xB.A. Witor rt sit: TBill OE LE EAC red (x, -, -y-mediated &: ?& Orbirl&tir in ECOf l-Scal

-Sel-expression and red c, -, --mediated r&Cirratifir EOC)

AlbAC vectork Patent Application Publication Jun. 20, 2013 Sheet 60 of 78 US 2013/0156808A1

SEtiwa 8. 4. S3 S8 38 s

38 3verage body Weight $oss

WER

1. 3 3988

0 with CRW & RCWst RAE-Sybichlist Patent Application Publication Jun. 20, 2013 Sheet 61 of 78 US 2013/0156808A1

Fig.32B

* vacciated

or C.Vist

6. * - Rae-fly twist : Patent Application Publication Jun. 20, 2013 Sheet 62 of 78 US 2013/0156808A1

Fig.32C

2 months p.i. 11 months p.i. Patent Application Publication Jun. 20, 2013 Sheet 63 of 78 US 2013/0156808A1

Fig.33A

UNGS

x,88: Ex.:

ifist (). At 52 Vist to RAE-tylic Vist Patent Application Publication Jun. 20, 2013 Sheet 64 of 78 US 2013/0156808A1

Fig.33B

UNGS

2. x.88

. s

uninfected Civist (). An 152Civilist O RAE-tyiCMVList Patent Application Publication Jun. 20, 2013 Sheet 65 of 78 US 2013/0156808A1

Fig.34A

24. NK Owt CW Civist O RAE-y?icivilist Patent Application Publication Jun. 20, 2013 Sheet 66 of 78 US 2013/0156808A1

Fig.34B

3.5 6.5 . S

, 4.

. NKG NKG " wit City M RAE-tyiCMVList Patent Application Publication Jun. 20, 2013 Sheet 67 of 78 US 2013/0156808A1

Fig.35A

Days post-MCMV infection aive ifist M RAE-tyi Civilist Patent Application Publication Jun. 20, 2013 Sheet 68 of 78 US 2013/0156808A1

Fig.35B

Days post-MCMV infection 8 faiye filis M RAE-4yfictivist Patent Application Publication Jun. 20, 2013 Sheet 69 of 78 US 2013/0156808A1

Fig.35C

ix.

x :

Days post-NCMV infection Civist M RAE-tyiCivist Patent Application Publication Jun. 20, 2013 Sheet 70 of 78 US 2013/0156808A1

Fig.36

we wit CW we City. SEK. *the RAE-syfictiv-SiiNFEK.

Days post infection Patent Application Publication Jun. 20, 2013 Sheet 71 of 78 US 2013/0156808A1

Fig.37 SNFEK 45

& CRAW SiFEK. A RAS-ty. MC&W SENFEK 38 39

---

ays post infection Patent Application Publication Jun. 20, 2013 Sheet 72 of 78 US 2013/0156808A1

Fig.38 SNFE 4.

s t t 18w SINFEK. : RAE- 88 SSNFEK. 38 aros 8 f 2. & 8 s 8 4. s 3 A. 2 2 1 8 Patent Application Publication Jun. 20, 2013 Sheet 73 of 78 US 2013/0156808A1

Fig.39 SPEEN WER

S. 8 g 3 S 5 5 3. 4. t C3 2 2 10 CFufmouse 5x10 CFjirouse 10 CFLimouse 5x0 CFjimouse

y C.SNFE W. RAE-ysiciav-SinifeK. Patent Application Publication Jun. 20, 2013 Sheet 74 of 78 US 2013/0156808A1

Fig.40A

2.3.3.

A strialected A C-SENFEK A RAE-ty-SENFEK. Patent Application Publication Jun. 20, 2013 Sheet 75 of 78 US 2013/0156808A1

Fig.40B

3. 32

A RAE-tyCar SNFEK. Patent Application Publication Jun. 20, 2013 Sheet 76 of 78 US 2013/0156808A1

s .: k , . W-M-X CW-A. ses is . wana as S. 40 s - '., -- Rae-tyCW-HA Patent Application Publication Jun. 20, 2013 Sheet 77 of 78 US 2013/0156808A1

Fig.41B

1.1 - its

0.95 t 0.9

in C1 0.8 into Rae-tyCV-HA e 0.75 ^ -8-- - triate 0,7 8,65 Patent Application Publication Jun. 20, 2013 Sheet 78 of 78 US 2013/0156808A1

Fig.42

SYSNN

: 8 3 an we x Reinfected s SY RAE-1yMCMV-SY

14 Days post infection US 2013/0156808 A1 Jun. 20, 2013

VACCNE COMPRISING 4:435-436; Peggs, K. S. et al., 2003, Lancet 362:1375-1377). BETA-HERPESVIRUS Innate immunity, in particular NK cells, plays a key role in 0001. The present invention is related to a beta-herpesvi limiting CMV infection at an early stage and in priming of the rus comprising at least one heterologous nucleic acid, the adoptive immune response (Robbins, S. H. et al., 2007. PLoS beta-herpesvirus for use in a method for the treatment and/or Pathog 3:e123; Rolle, A., and Olweus, J., 2009, APMIS 117: prevention of a disease such as HIV infection, influenza virus 413-426). infection, HPV infection, Helicobacter pylori infection, 0005 NK cells play a crucial role in fighting many patho Mycobacterium tuberculosis infection and/or Plasmodium gens. As part of the innate immune system they represent the falciparum infection, the use of the beta-herpesvirus, a first line of a host defense. Their activation is a result of signal nucleic acid coding for the beta-herpesvirus, a vector com balance from their inhibitory and activating receptors. prising the nucleic acid, a host cell comprising the nucleic Healthy and untransformed cells express MHC class I mol acid and a pharmaceutical composition comprising the beta ecules which bind to NK cell inhibitory receptors providing herpesvirus, the nucleic acid and/or the and a pharmaceuti inhibition of their activity. When MHC class I molecules are cally acceptable carrier. lacking from the cell Surface, or cells express ligands for 0002 Human cytomegalovirus, also referred to herein as activating receptors on NK cells, NK cells are activated to kill HCMV or human CMV, is an important human pathogen infected or transformed cell. causing morbidity and mortality in congenitally infected and 0006. One very potent activating receptor, whose engage immunosuppressed individuals. Cytomegaloviruses, also ment can override inhibitory signals, is NKG2D. In addition referred to herein as CMV(s), are highly adapted to their to NK cells, NKG2D is also expressed on Yö T cells and mammalian hosts and are host-species specific in their repli activated CD8" T cells, where it has co-stimulatory function. cation which precludes the study of HCMV in animal models. Ligands for the NKG2D receptor in mice are the members of Research on murine cytomegalovirus, also referred to herein the RAE-1 family of proteins (RAE-1C., B, Y. 8, e) as well as as MCMV. Mouse CMV or murine CMV is the most MULT-1 and H60 proteins. NKG2D plays a major role in advanced model in regard to the principles that govern the fighting MCMV. The best evidence for the importance of immune surveillance of CMVs. After primary infection the NKG2D is given by the fact that MCMV evolved numerous host immune response effectively terminates virus replica mechanisms against NKG2D (Lisnic, V. J. et al., 2010, Curr tion; however, clearance of the viral genome is not achieved Opin Microbiol 13(4):530-9). and CMV is able to establish lifelong latency with periodic 0007 CD8" T cells are the principal effectors required for reactivation and shedding of virus (Pass, R. F. et al. 2001, in resolution of productive infection and establishment of Fields Virology. D. M. Knipe and P. M. Howley, editors. latency (Reddehase, M. J., 2002, Nat Rev Immunol 2:831 Philadelphia: Lippincott Williams and Wilkins. 2675-2706, 844). Although CD8" T cells play a dominant role, CD4 T Stratton K Ret al., in Vaccines for the 21st Century: A Tool for cells and NK cells contribute to the maintenance of latent Decision Making: Report of the Committee to Study Priori CMV infection (Polic, B. et al., 1998, J Exp Med 188: 1047 ties for Vaccine Development, Washington, D.C., USA: Insti 1054). tute of Medicine; 1999). 0008 Antiviral antibodies, although not essential for the 0003. While HCMV infection is readily controlled by the control of primary CMV infection and the establishment of immune competent host, the virus displays its pathogenic latency, play a critical role in limiting the dissemination of potential when host immunity is impaired. HCMV infection recurrent virus (Jonjic, S. et al., 1994, J Exp Med 179: 1713 is the most common viral congenital infection which may 1717). Antibodies can modify the disease associated with result in live-long neurological sequelae, including brain HCMV infection intransplant recipients as well as congenital damage, sensorineural hearing loss and mental retardation CMV infection in humans and experimental animal models (Boppana, S. B. et al., 1997, Pediatrics 99:409–414: Boppana, (Nigro, G. et al., 2005, N EnglJ Med 353:1350-1362; Nigro, S. B. et al., 1992, Pediatr Infect Dis J 11:93-99; Hamprecht, G. et al., 2008, Prenat Diagn28.512-517: Bratcher, D. F. et al., K. et al., 2001, Lancet 357:513-5 18: Whitley, R.J., 2004, Adv 1995, J Infect Dis 172:944-950; Cekinovic, D. et al., 2008, J Exp Med Biol 549:155-160). Solid organ transplant recipi Virol 82:12172-12180; Chatterjee, A. et al., 2001, J Infect Dis ents and hematopoietic stem cell transplant recipients are the 183:1547-1553; Snydman, D. R. et al., 1987, N Engl J Med second group of patients at risk for severe CMV infections 317:1049-1054). (Mwintshi, K., and Brennan, D.C., 2007, Expert Rev Anti 0009 Consequently, a CMV vaccine should ideally aim to Infect Ther 5:295-304; Ljungman, P., 2008, Bone Marrow elicit an effective cellular and humoral immune response and Transplant 42 Suppl 1:S70-S72; Streblow, D. N. et al., 2007, at the same time the CMV vaccine should be safe for the Curr Opin Immunol 19:577-582). In HIV-infected patients vaccinated patient. CMV continues to be the most frequent viral opportunistic 0010. A number of subunit vaccine strategies and live, pathogen although severe infections have become less com attenuated CMV vaccines have been developed (Schleiss, M. mon following the introduction of highly active antiretroviral R., 2008, Curr Top Microbiol Immunol 325:361-382: Zhong, therapy (Steininger, C. et al., 2006, J Clin Virol 37: 1-9). Due J., and Khanna, R., 2007, Expert Rev Anti Infect Ther 5:449 to this immense public health importance, the development of 459; Gonczol, E., and Plotkin, S., 2001, Expert Opin Biol a HCMV vaccine has been ranked as a top priority for the 21st Ther 1:401-412: Griffiths, P., 2009, Rev Med Virol 19:117 century by the US Institute of Medicine (Arvin, A. M. et al., 119; Mohr, C. A. et al., 2010, J Virol 84(15): 7730-42). 2004, Clin Infect Dis 39:233-239). Recently, a phase 2 clinical trial was described that Suggested 0004 Both innate and adaptive immune responses are a protective capacity against maternal infection by use of important for the control of CMV infection (Krmpotic, A. et recombinant monovalent glycoprotein B HCMV vaccine al., 2003 Microbes Infect 5:1263-1277; Koszinowski, U.H. et (Pass, R. F. et al., 2009, N Engl J Med 360:1191-1199). al., 1991, Curr Opin Immunol 3:471-475; Reusser, P. et al., Glycoprotein B is also referred to hereinasgB. While subunit 1991, Blood 78:1373-1380: Einsele, H., 2002, Cytotherapy vaccines induce an immune response to selected viral pro US 2013/0156808 A1 Jun. 20, 2013

teins, the advantage of live vaccines is that they elicit an Embodiment 4 immune response that mimics natural immunity and provides a broader protection. Their use, however, carries the risk of 0021. The beta-herpesvirus according to embodiment 3, CMV disease caused by the vaccine strain or reactivation in wherein the receptor for the cellular ligand is present on the the immunocompromised State, unless residual immunity Surface of at least one immune cell. would efficiently control the vaccine virus. Embodiment 5 0011. One approach to generate such an immunogenic, yet safe live vaccine is by deleting viral genes that subvert the 0022. The beta-herpesvirus according to any one of host immune response (Cicin-Sain, L. et al., 2007, J Virol embodiments 3 to 4, wherein the receptor for the cellular 81:13825-13834; Crumpler, M. M. et al., 2009, Vaccine ligand is an activating receptor. 27:4209-4218) or essential genes resulting in spread-defi cient virus (Mohr, C. A. et al. 2010, supra). Embodiment 6 0012 Nevertheless, until today there is no approved 0023 The beta-herpesvirus according to any one of HCMV vaccine available and such HCMV vaccine has been embodiments 4 to 5, wherein the at least one immune cell is recently ranked as a top priority for the 21st century by the US selected from the group comprising NK cells, Yö T cells and Institute of Medicine (Arvin, A. M. et al., 2004, supra; Strat activated CD8" T cells. ton, K. R. et al., 1999, supra). 0013 Thus a problem underlying the present invention is Embodiment 7 to provide an effective HCMV vaccine and a beta-herpesvirus 0024. The beta-herpesvirus according to any one of contained in Such vaccine, respectively. embodiments 4 to 6, wherein the at least one immune cell is 0014. It is also a problem underlying the present invention selected from the group consisting of NK cells, Yö T cells and to provide a beta-herpesvirus being an effective vaccine activated CD8" T cells. against infection with a pathogen in addition to or other than HCMV, wherein the pathogen is selected from the group Embodiment 8 comprising viruses other than HCMV, bacteria and parasites. 0015. It is a still further problem underlying the present 0025. The beta-herpesvirus according to any one of invention to provide a nucleic acid coding for a beta-herpes embodiments 4 to 7, wherein the receptor for the cellular virus, wherein the beta-herpesvirus is suitable for use as an ligand is present on the surface of NK cells. effective HCMV vaccine. Embodiment 9 0016. These and other problems underlying the instant invention are solved by the subject matter of the independent 0026. The beta-herpesvirus according to any one of claims. Preferred embodiments may be taken from the depen embodiments 4 to 8, wherein the receptor for the cellular dent claims. ligand is present on the surface of NK cells, Yö T cells and 0017. Furthermore, these and other problems underlying activated CD8 T cells. the instant invention are solved by the subject matter of the aspects and embodiments of the invention outlined in the Embodiment 10 following in more detail. 0027. The beta-herpesvirus according to any one of embodiments 1 to 9, wherein the cellular ligand is a protein SUMMARY anchored to or in a membrane of a cell, preferably a cell infected by the beta-herpesvirus, via glycosylphosphatidyli Embodiment 1 nositol (GPI). 0018. A beta-herpesvirus, preferably a recombinant beta herpesvirus, wherein the beta-herpesvirus comprises at least Embodiment 11 one heterologous nucleic acid, wherein the at least one het 0028. The beta-herpesvirus according to any one of erologous nucleic acid comprises a gene encoding a cellular embodiments 1 to 9, wherein the cellular ligand is a trans ligand. membrane protein. Embodiment 2 Embodiment 12 0019. The beta-herpesvirus according to embodiment 1, 0029. The beta-herpesvirus according to any one of wherein the beta-herpesvirus is not a murine cytomegalovirus embodiments 1 to 9, wherein the cellular ligand comprises at comprising at least one heterologous nucleic acid, wherein least one immunoglobulin-like domain. the at least one heterologous nucleic acid comprises a gene encoding a cellular ligand, wherein the cellular ligand is Embodiment 13 RAE1 Y, and wherein the beta-herpesvirus is NOT a murine 0030 The beta-herpesvirus according to any one of cytomegalovirus deficient in at least one gene product embodiments 1 to 9, wherein the at least one immunoglobu encoded by an immune modulatory gene, wherein the lin-like domain is selected from the group comprising an C.1 immune modulatory gene is m152. domain, an C2 domain and an C3 domain. Embodiment 3 Embodiment 14 0020. The beta-herpesvirus according to embodiments 1 0031. The beta-herpesvirus according to embodiment 13, and 2, wherein the cellular ligand is capable of binding a wherein the cellular ligand comprises an C.1 domain and an receptor for the cellular ligand. C2 domain. US 2013/0156808 A1 Jun. 20, 2013

Embodiment 15 Embodiment 28 0032. The beta-herpesvirus according to embodiment 13, 0045. The beta-herpesvirus according to embodiment 22, wherein the cellular ligand comprises an C.1 domain, an O.2 wherein the UL16 binding protein is ULBP6. domain and an C3 domain. Embodiment 29 Embodiment 16 0046. The beta-herpesvirus according to embodiment 21, 0033. The beta-herpesvirus according to any one of wherein the MHC class-1-related protein is selected from the embodiments 1 to 15, wherein the cellular ligand is an group comprising MICA and MICB. NKG2D ligand. Embodiment 30 Embodiment 17 0047. The beta-herpesvirus according to embodiment 29, 0034. The beta-herpesvirus according to embodiment 16, wherein the MHC class-1-related protein is MICA. wherein the NKG2D ligand is a mammalian NKG2D ligand or a homolog thereof. Embodiment 31 Embodiment 18 0048. The beta-herpesvirus according to embodiment 29, 0035. The beta-herpesvirus according to embodiment 17, wherein the MHC class-1-related protein is MICB wherein the NKG2D ligand is selected from the group com prising murine NKG2D ligand and human NKG2D ligand. Embodiment 32 0049. The beta-herpesvirus according to any one of Embodiment 19 embodiments 18 and 20, wherein the murine NKG2D ligand 0036. The beta-herpesvirus according to embodiment 18, is selected from the group comprising RAE-1 protein, H60 wherein the NKG2D ligand is a human NKG2D ligand. protein and murine UL 16 protein-like transcript protein. Embodiment 20 Embodiment 33 0037. The beta-herpesvirus according to embodiment 18, 0050. The beta-herpesvirus according to embodiment 32, wherein the NKG2D ligand is a murine NKG2D ligand. wherein the RAE-1 protein is selected from the group com prising RAE-1C, RAE-1B, RAE-1 Y, RAE-18, and RAE-1-e. Embodiment 21 0038. The beta-herpesvirus according to any one of Embodiment 34 embodiments 18 and 19, wherein the human NKG2D ligand 0051. The beta-herpesvirus according to embodiment 33, is selected from the group comprising UL16 binding proteins wherein the RAE-1 protein is RAE-1 Y. and MHC class-1-related protein. Embodiment 35 Embodiment 22 0.052 The beta-herpesvirus according to embodiment 33, 0039. The beta-herpesvirus according to embodiment 21, wherein the RAE-1 protein is RAE-1C. wherein the UL16 binding protein is selected from the group comprising ULBP2, ULPB1, ULBP3, ULBP4, ULBP5 and Embodiment 36 ULBP6. 0053. The beta-herpesvirus according to embodiment 33, Embodiment 23 wherein the RAE-1 protein is RAE-1B. 0040. The beta-herpesvirus according to embodiment 22, wherein the UL16 binding protein is ULBP2. Embodiment 37 0054 The beta-herpesvirus according to embodiment 33, Embodiment 24 wherein the RAE-1 protein is RAE-16. 0041. The beta-herpesvirus according to embodiment 22, wherein the UL16 binding protein is ULPB1. Embodiment 38 0055. The beta-herpesvirus according to embodiment 33, Embodiment 25 wherein the RAE-1 protein is RAE-1e. 0042. The beta-herpesvirus according to embodiment 22, wherein the UL16 binding protein is ULBP3. Embodiment 39 0056. The beta-herpesvirus according to embodiment 33, Embodiment 26 wherein the murine UL 16 protein-like transcript protein is 0043. The beta-herpesvirus according to embodiment 22, MULT1. wherein the UL16 binding protein is ULBP4. Embodiment 40 Embodiment 27 0057 The beta-herpesvirus according to embodiment 33, 0044) The beta-herpesvirus according to embodiment 22, wherein the H60 protein is selected from the group compris wherein the UL16 binding protein is ULBP5. ing H60a, H60b and H60c. US 2013/0156808 A1 Jun. 20, 2013

Embodiment 41 Embodiment 53 0058. The beta-herpesvirus according to embodiment 40, 0070 The beta-herpesvirus according to any one of wherein the H60 protein is H60a. embodiments 1 to 52, wherein the beta-herpesvirus is a cytomegalovirus. Embodiment 42 0059. The beta-herpesvirus according to embodiment 40, Embodiment 54 wherein the H60 protein is H60b. 0071. The beta-herpesvirus according to embodiment 53, wherein the beta-herpesvirus is a cytomegalovirus is selected Embodiment 43 from the group comprising human cytomegalovirus, rhesus 0060. The beta-herpesvirus according to embodiment 40, cytomegalovirus and mouse cytomegalovirus. wherein the H60 protein is H60c. Embodiment 55 Embodiment 44 0072 The beta-herpesvirus according to embodiment 54, 0061 The beta-herpesvirus according to any one of wherein the beta-herpesvirus is human cytomegalovirus. embodiments 3 to 43, wherein the binding of the cellular ligand and the receptor for the cellular ligand is capable of Embodiment 56 activating NK cells. 0073. The beta-herpesvirus according to embodiment 55, wherein the human cytomegalovirus is a human cytomega Embodiment 45 lovirus derived from a Bacterial Artificial Chromosome. 0062. The beta-herpesvirus according to any one of embodiments 1 to 44, wherein the beta-herpesvirus is suitable Embodiment 57 for inducing an immune response against a beta-herpesvirus. 0074 The beta-herpesvirus according to embodiment 56, wherein the Bacterial Artificial Chromosome is selected from Embodiment 46 the group comprising AD 169-BAC, modified AD 169-BAC, 0063. The beta-herpesvirus according to embodiment 45, TB40E-BAC, VHLE, Toledo-BAC, Toledo-BAC, TR-BAC, wherein the immune response comprises neutralizing anti FIX-BAC and transgenic Merlin-BAC. bodies against beta-herpesvirus and/or CD4 T-cells directed against epitopes of beta-herpesvirus and/or CD8" T-cells Embodiment 58 directed against epitopes of beta-herpesvirus. 0075. The beta-herpesvirus according to any one of embodiments 1 to 57, wherein the beta-herpesvirus is defi Embodiment 47 cient in at least one gene product encoded by an immune 0064. The beta-herpesvirus according to any one of modulatory gene. embodiments 1 to 46, wherein the beta-herpesvirus has a tropism like a wild type beta-herpesvirus. Embodiment 59 0076. The beta-herpesvirus according to embodiment 58, Embodiment 48 wherein the beta-herpesvirus comprises a deletion of the cod 0065. The beta-herpesvirus according to any one of ing sequence of the at least one immune modulatory gene. embodiments 1 to 47, wherein the beta-herpesvirus is capable of infecting professional antigen presenting cells. Embodiment 60 0077. The beta-herpesvirus according to any one of Embodiment 49 embodiments 58 to 59; wherein the at least one gene product 0066. The beta-herpesvirus according to any one of encoded by an immune modulatory gene is a gene product embodiments 1 to 48, wherein the beta-herpesvirus is capable regulating NK cell response. of infecting dendritic cells and macrophages. Embodiment 61 Embodiment 50 0078. The beta-herpesvirus according to embodiment 60: 0067. The beta-herpesvirus according to any one of wherein the gene product regulating NK cell response is embodiments 1 to 49, wherein the beta-herpesvirus is capable capable of binding the cellular ligand. of infecting professional antigen presenting cells only. Embodiment 62 Embodiment 51 007.9 The beta-herpesvirus according to embodiment 61, 0068. The beta-herpesvirus according to any one of wherein the binding of the gene product regulating NK cell embodiments 1 to 50, wherein the beta-herpesvirus is capable response and the cellular ligand results in reduction of expres of infecting fibroblasts. sion of the cellular ligand. Embodiment 52 Embodiment 63 0069. The beta-herpesvirus according to any one of 0080. The beta-herpesvirus according to embodiment 62, embodiments 1 to 51, wherein the beta-herpesvirus is a wherein the expression of the cellular ligand is an expression human beta-herpesvirus. on the surface of a cell infected with the beta-herpesvirus. US 2013/0156808 A1 Jun. 20, 2013

Embodiment 64 Embodiment 76 0081. The beta-herpesvirus according to any one of 0093. The beta-herpesvirus according to any one of embodiments 58 to 63, wherein the at least one immune embodiments 58 to 64 and 67, wherein the at least one modulatory gene is selected from the group comprising immune modulatory gene is m152 and wherein the cellular UL16, UL142, m152, m155, m145 and m138. ligand is selected from the group comprising RAE-1C, RAE 1B, RAE-1), RAE-18, and RAE-1-e. Embodiment 65 0082. The beta-herpesvirus according to embodiment 64, Embodiment 77 wherein the immune modulatory gene is UL16. 0094. The beta-herpesvirus according to any one of embodiments 58 to 64 and 68, wherein the at least one Embodiment 66 immune modulatory gene is m155 and wherein the cellular 0083. The beta-herpesvirus according to embodiment 64, ligand is selected from the group comprising H60a, H6Ob and wherein the immune modulatory gene is UL142. H6Oc. Embodiment 67 Embodiment 78 0084. The beta-herpesvirus according to embodiment 64, 0.095 The beta-herpesvirus according to any one of wherein the immune modulatory gene is m152. embodiments 58 to 64 and 69, wherein the at least one immune modulatory gene is m145 and wherein the cellular Embodiment 68 ligand is MULT-1. 0085. The beta-herpesvirus according to embodiment 64, Embodiment 79 wherein the immune modulatory gene is m155. 0096. The beta-herpesvirus according to any one of Embodiment 69 embodiments 58 to 64 and 70, wherein the at least one I0086. The beta-herpesvirus according to embodiment 64, immune modulatory gene is m138 and wherein the cellular wherein the immune modulatory gene is m145. ligand is MULT-1. Embodiment 80 Embodiment 70 0097. The beta-herpesvirus according to any one of 0087. The beta-herpesvirus according to embodiment 64, embodiments 58 to 64 and 70, wherein the at least one wherein the immune modulatory gene is m138. immune modulatory gene is m138 and wherein the cellular Embodiment 71 ligand is selected from the group comprising H60a, H6Ob and H6Oc. 0088. The beta-herpesvirus according to any one of embodiments 58 to 65, wherein the at least one immune Embodiment 81 modulatory gene is UL 16 and wherein the cellular ligand is 0098. The beta-herpesvirus according to any one of ULBP2. embodiments 58 to 64 and 70, wherein the at least one immune modulatory gene is m138 and wherein the cellular Embodiment 72 ligand is selected from the group comprising RAE-1C, RAE 0089. The beta-herpesvirus according to any one of 1B, RAE-1), RAE-18, and RAE-1-e. embodiments 58 to 65, wherein the at least one immune modulatory gene is UL 16 and wherein the cellular ligand is Embodiment 82 MICB. 0099. The beta-herpesvirus according to any one of embodiments 58 to 81, wherein the beta-herpesvirus is defi Embodiment 73 cient in one or more additional gene product(s) each encoded 0090 The beta-herpesvirus according to any one of by an additional immune modulatory gene. embodiments 58 to 65, wherein the at least one immune modulatory gene is UL 16 and wherein the cellular ligand is Embodiment 83 ULBP1. 0100. The beta-herpesvirus according to any one of embodiments 58 to 82, preferably embodiment 82, wherein Embodiment 74 the beta-herpesvirus comprises a deletion of the coding 0091. The beta-herpesvirus according to any one of sequence of the additional immune modulatory gene. embodiments 58 to 65, wherein the at least one immune modulatory gene is UL 16 and wherein the cellular ligand is Embodiment 84 ULBP6. 0101 The beta-herpesvirus according to any one of embodiments 81 to 82; wherein the at least one additional Embodiment 75 gene product encoded by the additional immune modulatory 0092. The beta-herpesvirus according to any one of gene is a gene product regulating NK cell response encoded embodiments 58 to 64 and 65, wherein the at least one by an immune modulatory gene selected from the group immune modulatory gene is UL142 and wherein the cellular comprising UL16, UL18, UL40, UL142, m152, m155, m145 ligand is MICA. and m138. US 2013/0156808 A1 Jun. 20, 2013

Embodiment 85 UL91, UL92, UL93, UL94, UL95, UL96, UL98, UL99, 0102 The beta-herpesvirus according to any one of UL100, UL 102, UL104, UL105, UL115 and UL122. embodiments 81 to 83 wherein the at least one additional gene product encoded by the additional immune modulatory gene Embodiment 95 is a gene product regulating MHC class I presentation. 0112 The beta-herpesvirus according to any one of embodiments 1 to 93, wherein the beta-herpesvirus is defi Embodiment 86 cient in at least one glycoprotein. 0103) The beta-herpesvirus according to embodiment 85, wherein the gene product regulating MHC class I presenta Embodiment 96 tion is a gene product encoded by an immune modulatory 0113. The beta-herpesvirus according to embodiment 95, gene selected from the group comprising US6, US3, US2 and wherein the glycoprotein is selected from the group compris US 11. ing gB.

Embodiment 87 Embodiment 97 0104. The beta-herpesvirus according to any one of 0114. The beta-herpesvirus according to any one of embodiments 1 to 86, wherein the beta-herpesvirus com embodiments 1 to 96, wherein the beta-herpesvirus encodes prises the deletion of at least one miRNA. at least one additional heterologous nucleic acid. Embodiment 88 Embodiment 98 0105. The beta-herpesvirus according to embodiment 87, 0115 The beta-herpesvirus according to embodiment 97. wherein the miRNA is capable of binding a transcript of the wherein the at least one additional heterologous nucleic acid cellular ligand. is a functional nucleic acid, preferably the functional nucleic acid is selected from the group comprising antisense mol Embodiment 89 ecules, ribozymes and RNA interference mediating nucleic 0106 The beta-herpesvirus according to any one of acids. embodiments 87 to 88, preferably embodiment 88, wherein the miRNA is capable of repressing the translation of the gene Embodiment 99 coding for the cellular ligand. 0116. The beta-herpesvirus according to embodiment 97. wherein the at least one additional heterologous nucleic acid Embodiment 90 is a heterologous nucleic acid coding for a peptide, oligopep tide, polypeptide or protein. 0107 The beta-herpesvirus according to any one of embodiments 87 to 89, preferably embodiment 89, wherein Embodiment 100 the miRNA is miRNA-UL112. 0117 The beta-herpesvirus according to embodiment 99, Embodiment 91 wherein the peptide, oligopeptide, polypeptide or protein 0108. The beta-herpesvirus according to any one of constitutes or comprises at least one antigen. embodiments 1 to 90, wherein the beta-herpesvirus is defi cient in at least one gene product encoded by a gene regulat Embodiment 101 ing viral replication. 0118. The beta-herpesvirus according to embodiment 100, wherein the antigen is an antigen selected from the group Embodiment 92 comprising tumor antigens, tumor associated antigens, viral antigens, bacterial antigens and parasite antigens. 0109 The beta-herpesvirus according to any one of embodiments 1 to 91, wherein the gene regulating viral rep Embodiment 102 lication is selected from the group comprising IE1, pp 71 and pp 65. 0119 The beta-herpesvirus according to embodiment 101, wherein the viral antigen is an antigen derived from a Embodiment 93 virus, wherein the virus is selected from the group comprising 0110. The beta-herpesvirus according to any one of HIV, Influenza, HPV and RSV. embodiments 1 to 92, wherein the beta-herpesvirus is defi Embodiment 103 cient in at least one gene product encoded by an essential gene. 0.120. The beta-herpesvirus according to embodiment 102, wherein the viral antigen from Influenza is selected from Embodiment 94 the group comprising haemaglutinin.

0111. The beta-herpesvirus according to embodiment 93, Embodiment 104 wherein the essential gene is selected from the group com prising UL32, UL34, UL37.1, UL44, UL46, UL48, UL48, I0121 The beta-herpesvirus according to embodiment UL49, UL50, UL51, UL52, UL53, UL54, UL55, UL56, 103, wherein the haemaglutinin is selected from the group UL57, UL60, UL70, UL71, UL73, UL75, UL76, UL77, comprising haemaglutinin full-length form and haemagluti UL79, UL80, UL84, UL85, UL86, UL87, UL89.1, UL90, nin headless form. US 2013/0156808 A1 Jun. 20, 2013

Embodiment 105 prising Plasmodium falciparum, Plasmodium vivax, Plasmo 0122) The beta-herpesvirus according to embodiment dium ovale, Plasmodium malariae and Plasmodium 102, wherein the viral antigen from RSV is selected from the knowlesi. group comprising glycoprotein F and glycoprotein G. Embodiment 116 Embodiment 106 I0133. The beta-herpesvirus according to embodiment 0123. The beta-herpesvirus according to embodiment 115, wherein Plasmodium is Plasmodium falciparum. 102, wherein the viral antigen from HIV is selected from the group comprising HIV-1 gag. Embodiment 117 I0134. The beta-herpesvirus according to embodiment Embodiment 107 116, wherein the parasite antigen from Plasmodium falci 0.124. The beta-herpesvirus according to embodiment parum is selected from the group circumsporozoite protein. 102, wherein the viral antigen from HPV is selected from the group comprising E629-38, E629-37, E631-38, E652-61, Embodiment 118 E6 and E7. 0.135 The beta-herpesvirus according to any one of embodiments 1 to 117 for or suitable for use in a method for Embodiment 108 the treatment of a subject and/or for use in a method for the 0.125. The beta-herpesvirus according to embodiment vaccination of a subject. 101, wherein the bacterial antigen is an antigen derived from a bacterium, wherein the bacterium is selected from the group Embodiment 119 comprising mycobacterium, Helicobacter pylori and List 0.136 The beta-herpesvirus according to embodiment el. 118, wherein the Subject is a mammal, preferably a human being. Embodiment 109 0126 The beta-herpesvirus according to embodiment Embodiment 120 108, wherein the bacterial antigen from Helicobacterpylori is selected from the group comprising urease, VacA, CagA, heat 0.137 The beta-herpesvirus according to any one of shock protein, neutrophil-activating protein outer membrane embodiments 118 to 119, wherein the subject is suffering lipoprotein and bab A2. from a disease or is at risk of Suffering from a disease. Embodiment 110 Embodiment 121 0127. The beta-herpesvirus according to embodiment 0.138. The beta-herpesvirus according to any one of 108, wherein mycobacterium is selected from the group com embodiments 118 to 120, wherein the vaccination is a vacci prising Mycobacterium tuberculosis. nation against a disease. Embodiment 111 Embodiment 122 0128. The beta-herpesvirus according to embodiment 0.139. The beta-herpesvirus according to any one of 110, wherein the bacterial antigen from Mycobacterium embodiments 120 to 121, wherein the disease is a disease or tuberculosis is selected from the group comprising Antigen condition which is associated with beta-herpesvirus infec 85 A, Antigen 85B and Antigen 85B-TB10.4. tion, preferably human cytomegalovirus infection. Embodiment 112 Embodiment 123 0129. The beta-herpesvirus according to embodiment 0140. The beta-herpesvirus according to any one of 108, wherein Listeria is selected from the group comprising embodiments 120 to 122, wherein the disease or condition is Listeria monocytogenes. selected from the group comprising congenital inclusion dis CaSC. Embodiment 113 0130. The beta-herpesvirus according to embodiment Embodiment 124 108, wherein the bacterial antigen from Listeria is selected 0.141. The beta-herpesvirus according to any one of from the group comprising listeriolysin O (LLO). embodiments 118 to 123, wherein the subject is a pregnant female or female of reproductive age, preferably a pregnant Embodiment 114 human or a human of reproductive age. 0131 The beta-herpesvirus according to embodiment 101, wherein the parasite antigen is an antigen derived from a Embodiment 125 parasite, wherein the parasite is selected from the group com 0142. The beta-herpesvirus according to any one of prising Plasmodium. embodiments 118 to 124, wherein the treatment is or is suit able for or capable of preventing the transfer of a beta-herp Embodiment 115 esvirus, preferably human cytomegalovirus, from the female 0132) The beta-herpesvirus according to embodiment to a fetus and/or to an embryo carried by the female or to be 114, wherein Plasmodium is selected from the group com carried in the future by the female. US 2013/0156808 A1 Jun. 20, 2013

Embodiment 126 wherein the beta-herpesvirus preferably is a beta-herpesvirus 0143. The beta-herpesvirus according to any one of according to any one of embodiments 1 to 133. embodiments 118 to 125, wherein the treatment is for or is Suitable for the generation of or capable of generating an Embodiment 135 immune response in the female body, whereby preferably 0152 Abeta-herpesvirus for use in a method for the treat Such immune response confers protection to a fetus and/or to ment and/or prevention of influenza virus infection, an embryo carried or to be carried in the future by the female wherein the beta-herpesvirus expresses a cellular ligand and against beta-herpesvirus and/or a disease or condition asso an antigen, ciated with beta-herpesvirus infection, wherein the cellular ligand is selected from the group com prising ULBP2, ULPB1, ULBP3, ULBP4, ULBP5, ULBP6, Embodiment 127 MICA, MICB, RAE-1C, RAE-1 B, RAE-1y, RAE-18, RAE 0144. The beta-herpesvirus according to embodiment 1-e, MULT-1, H60a, H6Ob and H60c, 126, wherein the beta-herpesvirus is a cytomegalovirus, pref wherein the antigen is selected from the group comprising erably human cytomegalovirus. haemaglutinin full-length form and haemaglutinin headless form, and Embodiment 128 wherein the beta-herpesvirus preferably is a beta-herpesvirus 0145 The beta-herpesvirus according to any one of according to any one of embodiments 1 to 133. embodiments 1 to 127, wherein the beta-herpesvirus is suit able of inducing an immune response against a beta-herpes Embodiment 136 virus. 0153. A beta-herpesvirus for use in a method for the treat ment and/or prevention of HPV infection, Embodiment 129 wherein the beta-herpesvirus expresses a cellular ligand and 0146 The beta-herpesvirus according to embodiment an antigen, 128, wherein the immune response comprises neutralizing wherein the cellular ligand is selected from the group com antibodies against beta-herpesvirus and/or CD4 T-cells prising ULBP2, ULPB1, ULBP3, ULBP4, ULBP5, ULBP6, directed against epitopes of beta-herpesvirus and/or CD8" MICA, MICB, RAE-1C, RAE-1 B, RAE-1y, RAE-18, RAE T-cells directed against epitopes of beta-herpesvirus. 1-e, MULT-1, H60a, H6Ob and H60c, wherein the antigen is selected from the group comprising E6 Embodiment 130 29-38, E629-37, E631-38, E6 52-61, E6 and E7, and 0147 The beta-herpesvirus according to any one of wherein the beta-herpesvirus preferably is a beta-herpesvirus embodiments 120 to 121, wherein the disease is a disease according to any one of embodiments 1 to 133. selected from the group comprising bacterial disease, viral disease, parasite disease and tumors. Embodiment 137 0154 Abeta-herpesvirus for use in a method for the treat Embodiment 131 ment and/or prevention of RSV infection, 0148. The beta-herpesvirus according to embodiment wherein the beta-herpesvirus expresses a cellular ligand and 130, wherein the viral disease is selected from the group an antigen, comprising AIDS, Influenza and RSV infection wherein the cellular ligand is selected from the group com prising ULBP2, ULPB1, ULBP3, ULBP4, ULBP5, ULBP6, Embodiment 132 MICA, MICB, RAE-1C, RAE-1 B, RAE-1y, RAE-18, RAE 014.9 The beta-herpesvirus according to embodiment 1-e, MULT-1, H60a, H6Ob and H60c, 130, wherein the bacterial disease is selected from the group wherein the antigen is selected from the group comprising comprising Tuberculosis and listeriosis. glycoprotein F and glycoprotein G, and wherein the beta-herpesvirus preferably is a beta-herpesvirus Embodiment 133 according to any one of embodiments 1 to 133. 0150. The beta-herpesvirus according to embodiment 130, wherein the parasite disease is selected from the group Embodiment 138 comprising Malaria. 0.155. A beta-herpesvirus for use in a method for the treat ment and/or prevention of Helicobacter pylori infection, Embodiment 134 wherein the beta-herpesvirus expresses a cellular ligand and 0151. A beta-herpesvirus for use in a method for the treat an antigen, ment and/or prevention of HIV infection, wherein the cellular ligand is selected from the group com wherein the beta-herpesvirus expresses a cellular ligand and prising ULBP2, ULPB1, ULBP3, ULBP4, ULBP5, ULBP6, an antigen, MICA, MICB, RAE-1C, RAE-1 B, RAE-1y, RAE-18, RAE wherein the cellular ligand is selected from the group com 1-e, MULT-1, H60a, H6Ob and H60c, prising ULBP2, ULPB1, ULBP3, ULBP4, ULBP5, ULBP6, wherein the antigen is selected from the group comprising MICA, MICB, RAE-1C, RAE-1 B, RAE-1y, RAE-18, RAE urease, VacA, CagA, heat shock protein, neutrophil-activat 1-e, MULT-1, H60a, H6Ob and H60c, ing protein outer membrane lipoprotein and babA2, and wherein the antigen is selected from the group comprising wherein the beta-herpesvirus preferably is a beta-herpesvirus HIV-1 gag, and according to any one of embodiments 1 to 133. US 2013/0156808 A1 Jun. 20, 2013

Embodiment 139 Embodiment 145 0156 Abeta-herpesvirus for use in a method for the treat 0162 Use of a beta-herpesvirus according to any one of ment and/or prevention of Mycobacterium tuberculosis infec embodiment 1 to 141, for the manufacture of a vaccine. tion, wherein the beta-herpesvirus expresses a cellular ligand and Embodiment 146 an antigen, 0163 Use of a beta-herpesvirus according to embodiment wherein the cellular ligand is selected from the group com 145, wherein the vaccine is for the treatment and/or preven prising ULBP2, ULPB1, ULBP3, ULBP4, ULBP5, ULBP6, tion of a disease. MICA, MICB, RAE-1C, RAE-1 B, RAE-1y, RAE-18, RAE 1-e, MULT-1, H60a, H6Ob and H60c, Embodiment 147 wherein the antigen is selected from the group comprising 0164. Use of a beta-herpesvirus according to embodiment Antigen 85 A, Antigen 85B and Antigen 85B-TB10.4, and 146, wherein the disease is beta-herpesvirus infection. wherein the beta-herpesvirus preferably is a beta-herpesvirus according to any one of embodiments 1 to 133. Embodiment 148 Embodiment 140 0.165. Use of a beta-herpesvirus according to any one of embodiments 146 and 147, wherein the disease is a disease as 0157 Abeta-herpesvirus for use in a method for the treat defined in any one of embodiments 130 to 133. ment and/or prevention of Listeria infection, preferably List eria monocytogenes infection, Embodiment 149 wherein the beta-herpesvirus expresses a cellular ligand and 0166 Use of a beta-herpesvirus according to embodiment an antigen, 145, wherein the vaccine is for the treatment and/or preven wherein the cellular ligand is selected from the group com tion of a disease or condition associated with beta-herpesvi prising ULBP2, ULPB1, ULBP3, ULBP4, ULBP5, ULBP6, rus infection, preferably human cytomegalovirus infection. MICA, MICB, RAE-1C, RAE-1 B, RAE-1y, RAE-18, RAE 1-e, MULT-1, H60a, H6Ob and H60c, Embodiment 150 wherein the antigen is selected from the group comprising 0.167 Use of a beta-herpesvirus according to embodiment listeriolysin O(LLO), and wherein the beta-herpesvirus pref 149, wherein the vaccine is or is suitable for the administra erably is a beta-herpesvirus according to any one of embodi tion to a subject, whereby the subject is selected form the ments 1 to 133. group comprising a pregnant female, a female of reproductive age, a donor of a transplant, a recipient of a transplant and a Embodiment 141 subject being infected with HIV or being at risk of being 0158. A beta-herpesvirus for use in a method for the treat infected with HIV. ment and/or prevention of Plasmodium falciparum infection, wherein the beta-herpesvirus expresses a cellular ligand and Embodiment 151 an antigen, 0168 Use of a beta-herpesvirus according to embodiment wherein the cellular ligand is selected from the group com 150, wherein the donor is a potential donor and/or the recipi prising ULBP2, ULPB1, ULBP3, ULBP4, ULBP5, ULBP6, ent is a potential recipient. MICA, MICB, RAE-1C, RAE-1 B, RAE-1y, RAE-18, RAE 1-e, MULT-1, H60a, H6Ob and H60c, Embodiment 152 wherein the antigen is selected from the group comprising 0169. A nucleic acid coding for a beta-herpesvirus as circumsporozoite protein, and defined in any of the preceding embodiments. wherein the beta-herpesvirus preferably is a beta-herpesvirus according to any one of embodiments 1 to 133. Embodiment 153 0170 A vector, preferably an expression vector, compris Embodiment 142 ing the nucleic acid according to embodiment 152. 0159. Use of a beta-herpesvirus as defined in any one of embodiments 1 to 141 for the manufacture of a medicament. Embodiment 154 0171 A host cell comprising a nucleic acid according to Embodiment 143 embodiment 152 or a vector according to embodiment 153. 0160 Use of a beta-herpesvirus according to embodiment 142, wherein the medicament is for the treatment and/or Embodiment 155 prevention of beta-herpesvirus infection. 0172 A pharmaceutical composition comprising a beta herpesvirus according to any one of the preceding embodi Embodiment 144 ments, a nucleic acid of embodiment 152 and/or a vector of 0161 Use of a beta-herpesvirus according to any one of embodiment 153, and a pharmaceutically acceptable carrier. embodiment 142 to 143, wherein the medicament is for the treatment and/or prevention of a disease or condition associ BRIEF DESCRIPTION OF THE DRAWINGS ated with beta-herpesvirus infection, preferably human 0173 FIG. 1A is a schematic illustration of the cloning cytomegalovirus infection. process and genome organization of RAE-1 yMCMV; FIG. US 2013/0156808 A1 Jun. 20, 2013

1B is a series of histograms showing the result of FACS 0182 FIG. 10 depicts diagrams indicating the viral load in analysis of the surface expression of RAE-1 in MCMV organs of MCMV infected neonatal BALB/c mice. infected cells: FIG. 1C is a diagram indicating virus load in 0183 FIG. 11 is a series of dot plots showing the results of different organs of infected mice with and without blocking FACS analysis of the percentage of CD11b clCs and CD8C. anti-NKG2D monoclonal antibody treatment: FIG. 1D is a cDCs in infected mice. diagram indicating virus load in Salivary glands at different 0.184 FIG. 12A is a schematic illustration of the cloning time points: FIG.1E is a is a diagram indicating copies of viral process and genome organization of RAE-1 yMCMV and genome in different organs of infected mice at different time RAE-1 YMCMVList; FIG.12B is an illustrative scheme of the points. experimental protocol for experiments applying Listeria 0.174 FIG. 2A is a diagram indicating virus load in differ monocytogenes challenge. ent organs of infected neonatal mice at different time points; 0185 FIG. 13 is a diagram indicating virus titer in vitro as FIG. 2B is a diagram indicating copies of MCMV genome in a function over time. different organs of infected neonatal mice at different time 0186 FIG. 14 are diagrams indicating virus titer in sali points. vary glands of infected mice. 0175 FIG. 3A is a diagram indicating the percentage of 0187 FIGS. 15A to 15B are diagrams indicating percent tetramer-specific CD8" T cells of mice infected with MCMV age of IFN-y" CD8" T cells of peptide-stimulated splenocytes at different time points; FIG. 3B is a bar diagram indicating from infected mice. the percentage of IE1/m 123-specific CD8" T cells of mice 0188 FIG. 16A depicts diagrams indicating CFU of list infected with MCMV expressing various cell surface mol eria monocytogenes after challenge of virus infected mice; ecules: FIG. 3C is a histogram showing the result of FACS FIG. 16B is a series of micrographs illustrating the effect of analysis of surface expression of NKG2D on IE1/m 123-spe vaccination by Rae-1y MCMVList in limiting depletion of T cific CD8" T cells in spleen of mice infected with MCMV: cells from PALS in spleen. FIG. 3D is a series of dot plots showing the result of FACS 0189 FIG. 17 depicts diagrams indicating the percentage analysis of tetramer-positive and/or IFN-Y positive spleno of IFNY' CD8" T cells of splenocytes from vaccinated mice cytes of mice infected with MCMV; FIG.3E is a series of dot after challenge with Listeria monocytogenes. plots showing the result of FACS analysis of splenocytes of 0.190 FIG. 18 depicts diagrams indicating CFU of listeria infected mice stimulated in the presence of the O.CD107a monocytogenes of vaccinated mice challenged with Listeria antibody and co-stained for IFN-Y and TNF-C. production. monocytogenes after depletion for CD8" T cells. (0191 FIG. 19 is a series of micrographs indicating liver (0176 FIG. 4A is a diagram indicating the virus titer in pathology after Listeria monocytogenes challenge in vacci spleen of BALB/cmice infected with MCMV after transfer of nated mice. memory CD8" T from latently infected uMT/uMT B cell 0.192 FIG. 20 depicts diagrams indicating the percentage deficient mice; FIG. 4B are diagrams indicating the percent of IFNY' NK cells and percentage of total NK cells of sple age of IE1/m123 MHC class I tetramer per CD8" T cells in nocytes of vaccinated mice after challenge with Listeria various organs of mice challenged with of salivary gland monocytogenes. derived MCMV; FIG. 4C is a survival curve indicating sur 0193 FIG. 21 depicts diagrams indicating the frequency vival of different vaccinated mice as a function of time. of CD8o." DCs (CD11c CD8+) and CD11 b+ DCs 0177 FIG.5A is a diagram indicating viral load of various (CD11c CD8C) of infected mice. organs in latently infected B cell-deficient mice depleted of 0194 FIG. 22 depicts diagrams indicating the frequency CD4, CD8", and NK1.1" cells: FIG. 5B is a series of histo of pDC and the concentration of serum IFNC. of infected grams showing the result of FACS analysis of surface RAE-1) mice. expression of SVEC4-10 cells infected with recurrent plaque 0.195 FIG. 23 depicts diagrams indicating the total num purified RAE-1YMCMV viruses: FIG.5C is a diagram indi ber of CD8" T cells, effector memory CD8" T cells and virus cating the virus titer in spleen of mice infected with MCMV specific CD8" T cells infected mice. treated with or without blocking anti-NKG2D antibody. 0.196 FIG. 24. A to E are schematic illustrations of the 0.178 FIG. 6A is a survivorship curve indicating survival genome organization and cloning process of Rae-lyMCMV of IFNa/bR ko mice infected with MCMV as a function of or WTMCMV expressing HA and HA-headless expressed. time; FIG. 6B is a diagram indicating the viral load of organs 0.197 FIG.25 is a diagram indicating virus titer in vitro as ofy-irradiated infected mice optionally depleted for NK cells. a function over time. 0179 FIG. 7A depicts diagrams indicating antiviral anti 0198 FIG. 26 is a schematic illustration of the genome body titers in serum of infected females and neonates and an organization and cloning process of G.APINSATAM express illustrative scheme of the experimental protocol; FIG. 7B is a ing MCMV. diagram indicating viral load in various organs of infected 0199 FIGS. 27A and B depict diagrams indicating the neonates and an illustrative scheme of the experimental pro percentage of IFNY CD8" T cells as a result of peptide tocol. stimulation of splenocytes from infected mice. 0180 FIG. 8A is a diagram indicating virus titer of 0200 FIG. 28 is a diagram indicating viral load of various MCMV in vitro as a function over time; FIG. 8B is a series of organs of infected mice. histograms showing the result of FACS analysis of the surface 0201 FIG. 29 is a diagram indicating the percentage of expression of NKG2D ligands on infected cells. IFNY" CD8" T cells of splenocytes of infected mice. 0181 FIG. 9A depicts diagrams indicating the virus load 0202 FIGS. 30 A and B are schematic illustrations of the in organs of infected mice treated with or without with block genome organization and cloning process of ULBP2 express ing anti-NKG2D antibody; FIG.9B is a diagram indicating ing HCMV; FIG.30C is a series of Western blots showing the the percentage of IFNCD8" T cells of peptide-stimulated expression of ULBP2 in infected cells: FIG. 30D is a histo splenocytes from mice infected with MCMV. gram showing the Surface expression of ULBP2 on human US 2013/0156808 A1 Jun. 20, 2013

foreskin fibroblast infected with HCMV TB40 or HCMV preferably recognized by an activating receptor on immune TB40 expressing ULBP2: FIG.30 E is a diagram showing the cells, is inserted into the genome of the beta-herpesvirus, results of NK cell cytotoxicity using uninfected human fore results in eliciting an immune response against the beta skin fibroblast or cells infected with either HCMV TB40 or herpesvirus sufficient to protect against infection with wild HCMV TB40 expressing ULBP2. type beta-herpesvirus, although said beta-herpesvirus is 0203 FIG. 31 is a schematic illustration of the cloning severely attenuated compared to a respective wild type beta process of an HCMV vaccine expressing ULBP2 and influ herpesvirus. Accordingly, said beta-herpesvirus was found to enza HA. provide a safe and protective beta-herpesvirus vaccine, Suit 0204 FIG. 32A are diagrams indicating the percentage of able for vaccination against beta-herpesvirus infection. More survival and body weight loss (upper panel), and CFU of specifically, the present inventor has surprisingly found that listeria monocytogenes (lower panel) of virus infected Balb/c the infection of a subject by a CMV, preferably a recombinant mice after challenge with L. monocytogenes; FIG. 32B is a CMV, wherein a cellular ligand, preferably recognized by an survivorship curve indicating survival of virus infected activating receptor on immune cells, is inserted into the Balb/c mice after challenge with L. monocytogenes; FIG.32C genome of the CMV, results in eliciting an immune response is a diagram showing the percentage of LLO-specific CD8+ T against the CMV sufficient to protect against infection with cell-mediated cytotoxicity. wild type CMV, although said CMV is severely attenuated 0205 FIG.33A is a diagram indicating viral load of lungs compared to a respective wild type CMV. Accordingly, said in Balb/c mice infected with MCMV; FIG.33 B is a diagram CMV was found to provide a safe and protective CMV vac showing the percentage of LLO-specific CD8" T cells in cine, suitable for vaccination against CMV infection. lungs of Balb/c mice infected with MCMV. 0216. The present inventor surprisingly found that a CMV 0206 FIG.34A is a diagram indicating viral load of spleen encoding a ligand for NKG2D provides a safe and protective in Balb/c mice infected with MCMV and treated with CMV vaccine, suitable for vaccination against CMV infec NKG2D blocking antibody; FIG.34 B is a diagram indicating tion. the absolute number of LLO-specific CD8" T cells in Balb/c 0217. Furthermore, the present inventor has found that a mice infected with MCMV and treated with NKG2D block beta-herpesvirus according to the present invention, wherein ing antibody. a nucleic acid coding for a cellular ligand and a nucleic acid 0207 FIG. 35A is a diagram showing the percentage of coding for an antigen and epitope, respectively, of a pathogen, BrdU total CD8 T cells in BALB/c mice infected with preferably an immunodominant antigen, is inserted into the MCMV and injected with BrdU: FIG. 35B is a diagram genome of the beta-herpesvirus, may serve as a vaccine or be showing the percentage LLO-specific CD8" T cells in Balb/c used as a vaccine or vaccination vector for vaccination against mice infected with MCMV and injected with BrdU: FIG.35C infection with the pathogen. The pathogen is preferably a is a diagram showing the percentage of BrdU LLO-specific virus, a bacterium or a parasite. CD8" T cells in Balb/c mice infected with MCMV and injected with BrdU. 0218. In connection therewith a person skilled in the art 0208 FIG. 36 is a diagram indicating virus titer of WT will immediately acknowledge that immune cells, such as MCMV, MCMV-SIINFEKL and RAE-1MCMV-SIIN natural killer cells, also referred to herein as NK cells, CD8" FEKL in vitro as a function over time. T cells and dendritic cells, also referred to hereinas DCs, have 0209 FIG.37 is a series of diagrams showing the percent basically the same function in different mammalian species, age of IFNY" CD8" T cells in C57BL/6 mice infected fp. with Such as mouse and man, as may be taken from immunology MCMV. textbooks such as "Janeway's Immunobiology", 8"addition, 0210 FIG.38 is a series of diagrams showing the percent by Kenneth Murphy. age of IFNY" CD8" T cells in C57BL/6 mice infected i.v. with 0219. Furthermore, it has to be acknowledged by a person MCMV. skilled in the art that any characteristic feature, embodiment 0211 FIG. 39 is a series of diagrams indicating CFU of of and any statement made herein in relation to beta-herpes listeria monocytogenes of vaccinated mice challenged with viruses such as MCMV equally applies to HCMV. Further Listeria monocytogenes. more, it will be acknowledged by a person skilled in the art 0212 FIG. 40A is a series of diagrams showing the per that the beta-herpesvirus according to the present invention centage of SIINFEKL- and M45-tetramer-specific CD8" T will, in a preferred embodiment, exhibit the following char cells in MCMV infected C57BL/6 mice; FIG. 40 B is a acteristics as observed for HCMV and MCMV, respectively: diagram indicating the viral load in lungs of MCMV infected multiple infections occur with MCMV in mouse and HCMV C57BL/6 mice. in human, respectively, (Boppana, S. B. et al., 2001, NEngl J 0213 FIG. 41A is a survivorship curve indicating survival Med 344:1366-1371; Cicin-Sain, L. et al., 2005, J Virol of C57BL/6 mice infected with MCMV and challenged with 79:9492-9502); a response of neutralizing antibodies against PR8 virus as a function of time: FIG. 41 B is a weight loss CMV is caused by infection with MCMV in mouse and curve indicating the weight loss of C57BL/6 mice infected HCMV in human, respectively (Farrell, H. E. and Shellam, G. with MCMV and challenged with PR8 virus as a function of R. 1990, J Gen Virol 71 (Pt3):655-664: Farrell, H. E. and time. Shellam, G.R. 1991, JGenVirol 72 (Pt 1):149-156; Gerna, G. A. et al., 2008, J Gen Virol 89:853-865); memory inflation, 0214 FIG. 42 is a diagram showing the percentage of which represents a very characteristic CD8+ T cell response, IFNY" CD8" T cells in MCMV infected BALB/c mice. is caused by infection with MCMV in mouse and HCMV in DETAILED DESCRIPTION human, respectively, and has almost identical kinetics in both human and mouse (Karrer, U. et al., 2003, J Immunol 170: 0215. The present inventor has surprisingly found that the 2022-2029; Karrer, U. et al., 2004, J Virol 78:2255-2264; infection of a subject by a beta-herpesvirus, preferably a Klenerman, P. and Dunbar, P. R. 2008, Immunity. 29:520 recombinant beta-herpesvirus, wherein a cellular ligand, 522; Komatsu, H. et al., 2003, ClinExp Immunol 134:9-12; US 2013/0156808 A1 Jun. 20, 2013

Holtappels R. et al., 2002, JVirol 76:151-164: Holtappels R. a heterologous nucleic acid which according to its sequence et al., 2001, JVirol 75:6584-6600; Snyder, C. M. et al., 2008, preferably is not comprised in or part of the genome of the Immunity: 29(4):650-9). wild type beta-herpesvirus and more preferably is a func 0220. It canthus be immediately taken from the above that tional nucleic acid. Preferably, the functional nucleic acid is infection of a host with its corresponding CMV species such selected from the group comprising antisense molecules, as infection of human with HCMV and infection of mouse ribozymes and RNA interference mediating nucleic acids. with MCMV, as well as immune responses to said infections Alternatively, at least one additional heterologous nucleic in human and mouse, respectively, are comparable. More acid is a nucleic acid coding for a peptide, oligopeptide, particularly, numerous publications of the prior art acknowl polypeptide or protein, wherein in a more preferred embodi edge the usefulness and appropriateness of the mouse model ment the peptide, oligopeptide, polypeptide or protein con for studying CMV infection and immune response to said stitutes or comprises at least one antigen and epitope, respec infection. For example, evidence for the above is found, tively. Preferably said antigen is an antigen selected from the among others, in the publications of Reddehase et al. (Red group comprising tumor antigens, tumor associated antigens, dehase, M. J. et al., 1985, J Virol 55(2):264-73; Reddehase, viral antigens, bacterial antigens and parasite antigens. M.J., 2002, Nat Rev Immunol2:831-844), Pollock and Virgin 0224. The term “antigen” as used herein preferably means (Pollock, J. L. and Virgin, H. W. 4, J Virol. 1995, 69(3): a foreign molecule or part of a foreign molecule. Such as a 1762-8), Koffron et al. (Koffron, A. J. et al., 1998, J Virol protein derived from a bacterium, or a peptide derived from 72(1): 95-103), Brune et al. (Brune, W. et al., 2001, Curr said protein. Said foreign molecule when introduced into a Protoc Immunol. Chapter 19:Unit 19.7.) and Babi? et al. body Such as a human or mammalian body, is recognized by (Babic, M. et al., 2011, Trends Mol. Med. 17(11):677-85). the receptor of an immune cell, such as the receptor of an NK 0221) Furthermore there is increasing evidence that in cell, and preferably triggers an immune response against said connection with infection of a host with a corresponding antigen, Such as the production of an antibody directed CMV species, such as infection of human with HCMV and against said antigen or triggers an effector function of an infection of mouse with MCMV, basically the same organs immune cell. and tissues are infected, disease preferably occurs in immu 0225. The term “epitope as used herein preferably means nocompromised Subjects and the overall immune response the distinct molecular feature of an antigen, preferably a caused by said infections is similar. Additionally, the value of feature on the Surface of an antigen, that is recognized by the CD8" T cells in CMV infection, particularly in HCMV infec immune system, preferably by antibodies, B cells and/or T tion has been shown. Evidence therefore may for example be cells. taken from Riddelletal. (Riddell, S. R. et al., 1997, Rev Med 0226. The term “homolog”or “homologue' as used herein Virol 7(3):181-192: Riddell, S. R. et al., 1993, Curr Opin in connection with herpesvirus proteins preferably means that Immunol 5(4):484-91; Riddell, S. R. et al., 1992, Science a CMV gene of one CMV species, such as MCMV, can 257(5067):238-41), Riddell and Greenberg (Riddell, S. R. replace a homolog of said MCMV gene in another CMV and Greenberg, P. D., 1995, Annu Rev Immunol 13:545-86), species, such as HCMV. (Schnee, M. et al., 2006, J Virol Brestrich et al. (Brestrich, G. et al., 2009, J Immunother, 80: 11658-11666). In other words homolog proteins prefer 32(9):932-40), Lilleri et al. (Lilleri, D. et al., 2009, J Infect ably exhibit at least one common protein function. Accord Dis, 199(6):829-36), Kapp et al. (Kapp, M. et al., 2007, Cyto ingly, it will be acknowledged by a person skilled in the art therapy, 9(8):699-711) Wilkinson et al., (Wilkinson, G. W. et that, for example, the homolog of UL50 of HCMV is M50 of al., 2008, J. Clin Virol 41(3):206-12), Braud et al. (Braud, V. MCMV and vice versa. A person skilled in the art will M. et al., 2002, Curr Top Microbiol Immunol 269:117-29) acknowledge that two proteins which exhibit at least one and Jackson et al. (Jackson, S. E. et al., 2011, Virus Res, common protein function do not necessarily share the same 157(2):151-60). amino acid sequence. For example, the gene product of m152 0222. In an embodiment of the beta-herpesvirus according of MCMV and the gene product of US3 of HCMV are also to the present invention, wherein the beta-herpesvirus com understood to be homologs as both retain MHCI molecules in prises at least one heterologous nucleic acid and wherein the the ER. at least one heterologous nucleic acid comprises a gene 0227 Homologs or homologue proteins that display some encoding a cellular ligand, the at least one heterologous degree of sequence homology in MCMV and HCMV are nucleic acid is a nucleic acid which according to its nucleotide listed in Rawlinson et al. (Rawlinson, W. D. et al., 1996, J sequence preferably is not comprised in or part of the genome Virol 70(12):8833-49). Further examples are the viral immu of the wild type beta-herpesvirus. In connection therewith it nevasins targeting the ligands for NK cell recpetors in human will be understood that a beta-herpesvirus according to the and murine cells. In connection therewith it will be acknowl present invention in an embodiment comprises the heterolo edged that not all NKG2D ligands are homologs by sequence gous nucleic acid comprising the gene encoding the cellular but by function. It will be acknowledged by a person skilled in ligand as well as a heterologous nucleic acid comprising one the art that preferred human NKG2D ligands are MHC class or more than one gene encoding one or more cellular ligand 1-related protein A (MICA), MICB and UL 16-binding pro (s). In connection therewith, the nucleic acid coding for the teins (ULPB1-6). In connection therewith it is important to cellular ligand is also referred to herein as heterologous note that ULBP1 and ULBP2 also bind to mouse NKG2D nucleic acid. (Sutherland, C. L. et al., 2006, Blood 108 (4): 1313-1319). 0223) In an alternative embodiment the beta-herpesvirus 0228. Alternatively and/or additionally, the term according to the present invention comprises more than one “homolog”or “homologue' as used herein in connection with heterologous nucleic acids. Accordingly, a beta-herpesvirus herpesvirus proteins, preferably means a peptide, polypeptide of the present invention comprises in an embodiment the at or protein, wherein the gene encoding said peptide, polypep least one additional heterologous nucleic acid. In an embodi tide or protein is the gene of one herpesvirus species, such as ment said at least one additional heterologous nucleic acid is HCMV, indicated to be a homolog of the gene of another US 2013/0156808 A1 Jun. 20, 2013 species, such as another herpesvirus species according to of nuclear receptors, to which one or more specific types of Fossum et al. (Fossum, E. et al. 2009, PLoS Pathog5(9):) or signaling molecules, such as a cellular ligand as disclosed Davison et al. (Davison, A. J. et al., 2010, Vet Microbiol. herein, may bind. 143(1):52-69 and Davison, A.J. et al., 2004, Compendium of 0233. A molecule which binds to a receptor is preferably Human Herpesvirus gene names, Reno). called a ligand, and is, in an embodiment of the beta-herpes 0229. Alternatively and/or additionally, the term virus according to the present invention, a peptide, a polypep “homolog”or “homologue' as used herein in connection with tide, a protein or a small molecule. Such as a neurotransmitter, cellular proteins, such as a cellular ligand as encoded by the a hormone, a pharmaceutical drug, or a toxin. Each kind of beta-herpesvirus according to the present invention, prefer receptor can bind only certain types or forms of ligands. Each ably means that a protein and its homolog, i.e. its homolog cell typically has many receptors of many different types. protein exhibit a common biological function. Preferably, 0234. In an embodiment of the beta-herpesvirus of the two proteins are homologs of each other if said two proteins present invention a ligand, including a cellular ligand, is also show an amino acid (aa) sequence identity and/or an identity understood to be a Substance that forms a complex with a of the nucleotide sequence of the genes encoding the proteins. biomolecule to serve a biological purpose. In a narrower More preferably said sequence identity is of at least 50%, sense of said embodiment, a ligand is a signal triggering more preferably at least 75%, and most preferably at least molecule shich binds to a site on a target molecule which is 80%, 90% or 95%. Nevertheless it is important to note that as preferably a receptor for said ligand. homolog proteins evolve, their 3D structure often remains 0235. The binding of a ligand with a target molecule, such more conserved than their sequence. Consequently, similari as a receptor molecule preferably occurs by intermolecular ties in protein structure can be more reliable than sequence forces, such as ionic bonds, hydrogen bonds and Van der similarities for grouping together distant homologs, which Waals forces. The docking, i.e. the association, of ligand to often retain some aspect of Such common biological function. target molecule, is usually reversible, i.e. dissociation of the 0230. The term “receptor” as used herein preferably ligand from the receptor may occur under specific reaction means a molecule expressed on the Surface of a cell, whereby conditions. In an embodiment of the present invention irre said molecule is capable of binding a cellular ligand. A recep versible covalent binding between a ligand and its target tor-ligand binding as used herein is preferably capable of molecule. Such as the respective receptor, occurs. initializing or inhibiting biochemical pathways and/or signal 0236. The binding of a ligand to a receptor usually alters cascades when the properligand is binding to the receptor. It the conformation of the receptor particularly in case the will be understood by a person skilled in the art that the receptor is a peptide, polypeptide or protein. The conforma cellular ligand(s) encoded by the beta-herpesvirus of the tion of a receptor determines the function of a receptor. present invention is preferably one which is, as such and when Ligand as referred to herein preferably comprise Substrates, naturally occurring, expressed by a cell from a subject, Such inhibitors, activators, and neurotransmitters. as a neighboring cell of the receptor expressing cell or a cell 0237 Immune cells such as NK cells, express a variety of of the wider environment within an organism. In an embodi receptors that serve either to activate or to Suppress the immu ment of the beta-herpesvirus according to the present inven nologic activity of said immune cells, including the cytolytic tion the gene encoding Such cellular ligand is inserted into the activity thereof. genome of the beta-herpesvirus, the beta-herpesvirus is 0238 Natural killer cells, also referred to herein as NK capable of expressing said cellular ligand, preferably upon cells, are a type of cytotoxic lymphocyte that constitutes a infection of a cell, irrespective of whether expression of said major component of the innate immune system. NK cells play ligand is naturally occurring in said infected cell, i.e. without a major role in the rejection of tumors, bacteria, parasites and infection of the cell by said beta-herpesvirus. In a further cells infected by viruses. One particular immunological activ embodiment the cellular ligand is a cellular ligand which, ity mediated by NK cells is the release of small cytoplasmic when naturally occurring, is expressed upon infection of the granules of proteins called perforin and granzyme that cause cell by the beta-herpesvirus according to the present inven the target cell to die by apoptosis, i.e. programmed cell death tion expressing said ligand. In a still further embodiment the and IFNY and TNFC. release. cellular ligand is a cellular ligand which, when naturally 0239 NK cells are defined as large granular lymphocytes, occurring, is expressed in the absence of infection of the cell also referred to hereinas LGL, and constitute the third type of by the beta-herepSevirus according to the present invention cells differentiated from the common lymphoid progenitor expressing said ligand. In connection therewith it is thus to be generating Band T lymphocytes. NK cells preferably do not understood that a beta-herpesvirus of the present invention express T-cell antigen receptors, also referred to herein as comprising a gene encoding a cellular ligand may mediate TCR, or PanT marker CD3 or surface immunoglobulins (Ig) expression of a cellular ligand which when naturally occur B cell receptors. More preferably, NK cells preferably and ring, is not expressed in the infected cell or is not expressed herein express surface markers such as CD16 (FcyRIII) and upon infection of the cell infected by the betaherpesvirus CD56 in humans and NK1.1 or NK1.2 in C57BL/6 mice. Up according to the present invention. to 80% of human NK cells also express CD8. 0231. The binding of a cellular liganda with its respective 0240 Given their strong cytolytic activity and the poten receptor preferably mediates a signal to the cell bearing said tial for auto-reactivity, the activity of NK cells is tightly receptor to initialize or inhibit a biochemical pathway and/or regulated. NK cells must receive an activating signal which signal cascade. This may, for example, result in the cells can come in a variety of forms comprising cytokines, Fc activation or de-activation, cell division or cell death, or in receptor, activating and inhibitory receptors. certain molecules entering and/or exiting the cell. 0241. As knownto a person skilled in the art NK cells were 0232 Receptors as used herein preferably are protein mol found to not require activation in order to kill cells that are ecules, embedded in either the plasma membrane of a cell in missing “self markers of major histocompatibility complex, case of cell Surface receptors or the cytoplasm of a cell in case also referred to herein as MHC class I. US 2013/0156808 A1 Jun. 20, 2013

0242. In order for NK cells to defend the body against molecules. This inhibition is crucial to the role played by NK viruses and other pathogens, NK cells require mechanisms cells. MHC class I molecules mediate a main mechanism by that enable the determination of whether a cell is infected or which cells display viral or tumor antigens to cytotoxic not. The exact mechanism has not yet been finally elucidated, T-cells. A common evolutionary adaption to this is seen in but recognition of an “altered self state is thought to be both intracellular microbes and tumours is a chronic down involved. To control their cytotoxic activity, NK cells possess regulation of these MHC I molecules, rendering the cell two types of Surface receptors: activating receptors and impervious to T-cell mediated immunity. It is believed that inhibitory receptors. Most of these receptors are not unique to NK cells, in turn, evolved as an evolutionary response to this NK cells and can be present in some T cell subsets as well. adaption, as the loss of the MHC would deprive these cells of 0243 The relative balance of signals from these receptors the inhibitory effect of MHC and would render these cells regulates NK cell activity (Lanier, L. L. et al., 2001, Nature Vulnerable to NK cell mediated apoptosis. Immunol 2:23-27; Moretta, A. et al., 2001, Annu Rev Immu 0248 More specifically, inhibitory NK cell receptors nol 19:197-223; Ravetch, J.V. and Lanier, L.L. 2000, Science comprise an ITIM motif in the intracellular domain of said 290:84-89 and Lopez-Botet, M. et al., 2000, Hum Immunol NK cell receptors. Ligation of inhibitory receptors via their 61:7-17). ligand, such as MHC-I, leads to phosphorylation of motifs 0244 NK cell receptors, also referred to herein as NKR, and initiates the signaling cascade involving tyrosine phos can be subdivided into activating or inhibitory receptors. phatase such as SHP-1 and SHP-2 and results in dephospho Although the extracellular domains of the various NKRs are rilation of activating signaling motif and NK cell inhibiton. extremely diverse, their intracellular domains are mostly con (Lanier, L. L. 2003, Curr Opin Immunol 15(3):308-14). The served so that inhibitory or activating receptors share com inhibitory NK cell receptors include killer immunoglobulin mon inhibitory or activating signaling pathways. Inhibitory like receptors (KIR) and immunoglobulin-like receptors receptors contain a tyrosine-based inhibitory motif (ITIM) in (LIR) in humans and the Ly49 family of receptors in the their intracellular domain. Receptor ligation triggers tyrosine mouse, as well as CD94-NKG2A receptor in humans and phosphorylation by a Src family kinase. This recruits SHIP-1 mice (Vilches, C. and Parham, P. 2002, Annu Rev Immunol to the membrane, which then degrades phosphatidylinositol 20:217-51; Moretta, L. A. 2004, Embo J 23(2):255-259). 3,4,5-trisphosphate to phosphatidylinositol-3,4-bisphos Ligands for the inhibitory KIR receptor family, such as LIR phate; SHP-1 or SHP-2 can also be recruited to the membrane and Ly49 receptors are classical MHC-I molecules, while at this time. CD94-NKG2A receptor binds to non-classical MHC-I mol 0245 Activating NK cell receptors, such as NKG2D, lack ecule, HLA-E in humans and Qa-1 in mice (Raulet, D. H. ITIMs, but posses a positively charged arginine residue in 2003, Nat Rev Immunol 3(10):781-90). Recognition of their transmembrane domain which allows them to interact MHC-I molecules is also required during the development of with adaptor proteins such as DAP10, DAP12, FceRI-y or NK cells and for reaching their functional competence (re CD3-5 (Lanier, L. L. 2008, Nat Immunol 9(5):495-502.). viewed in: Elliott, J. M. and Yokoyama, W. M. 2011, Trends These adaptors bear tyrosine-based activation motifs Immunol 32(8):364-72; Vivier, E. et al., 2011, Science 7: (ITAMs), which are phosphorylated upon receptor engage 331(6013):44-49). ment, also by a Src family kinase. Syk, ZAP-70, and PIK or 0249 Furthermore, the family of natural cytotoxicity Grb2 are then recruited to the membrane, where they mediate receptors, also referred to herein as NCR receptors, which actin cytoskeleton reorganization, cell polarization, release of comprises NKp30, NKp44, NKp80 and NKp46, is almost cytolytic granules, and the transcription of many cytokine and exclusively expressed by NK cells. All four receptors have chemokine genes. The engagement of NKG2D leads to NK been extensively studied in human NK cells, whereas NKp46 cell cytotoxicity and cytokine secretion or to a co-stimulation has been characterized in mice as well. In contrast to NKp30, of CD8+ T cells. NKp80 and NKp46, only NKp44 is not expressed on all NK 0246. In connection therewith a person skilled in the art cells, but is only found on activated NK cells. NCRs ligands will acknowledge that the maturation of NK cells is charac are diverse and include viral haemagglutinins (NKp46 and terized by a high frequency of NK cells expressing the most NKp44), heparan sulphate proteoglycans (NKp30 and mature phenotype CD27"CD11b'8". For example a high NKp46) and the nuclear factor HLA-B-associated transcript frequency of NK cells expressing the most mature phenotype 3 (BAT3) (NKp30) 47 and the activation-induced C-type CD27°CD11b'3' is observed in WT-MCMV infected lectin (AICL) (NKp80). However, no endogenous cellular mice. Additionally and alternatively, NK-cell expression of NCR ligands have been identified as yet. (Raulet, D. H. and IFN-Y and CD69, but also several other markers, can be used Guerra, N. 2009, Nat Rev Immunol. 9(8):568-80) to assess the activation of NK cells. In connection therewith a (0250 Preferably, NK cells as used herein are different person skilled in the art knows assays for assassing wheter from Natural Killer T cells. NK cell is activated or not. For example, NK cells can be (0251. Furthermore, NK cell receptor types, both with analysed by flow cytometry after Surface staining with anti inhibitory as well as activating function, can be differentiated CD69 (H1.2F3) and for the detection of IFN-y expression by by structure. NK cells, incubation in medium supplemented with 10% of 0252 Based on their chemical structure NK cell receptors FCS (Gibco), IL-2 and Brefeldin A (eBioscience) is needed. are classified into two families: 0247 Natural killer cells express inhibitory receptors spe 0253 a) receptors containing Ig-like ectodomains and cific for polymorphic MHC molecules, which enables them to 0254 b) receptors containing C-type lectin-like mediate “missing self-recognition', which provides the domains (Raulet, D. H. 2003, supra). capacity to attack cells of the body that extinguish expression The latter group include Ly49, NKG2 and NKRp1 receptors. of MHC class I molecules. These inhibitory receptors recog 0255. The following is a compilation of the most impor nize MHC class I alleles, which is regarded as an explanation tant NK cell receptor types. CD94 also referred to as NKG2. why NK cells kill cells possessing low levels of MHC class I which are C-type lectin family receptors, comprising US 2013/0156808 A1 Jun. 20, 2013

NKG2D, are conserved in both rodents and primates and vation. Neither isoform can be detected in resting CD8" T identifies non-classical (also non-polymorphic) MHC I mol cells but after T-cell receptor (TCR) stimulation the expres ecules like HLA-E. Expression of HLA-E at the cell surface sion of both isoforms is upregulated. Because CD8" T cells do is dependent on the presence of a nonamer peptide epitope not express DAP12, the two NKG2D isoforms that are derived from the signal sequence of classical MHC class I expressed by activated T cells can interact only with DAP10, molecules, which is generated by the sequential action of whereas activated NK cells can transmit signals through signal peptide peptidase and the proteasome. DAP10 and DAP12. In humans there is only one isoform 0256 Ly49 represents C-type lectin family receptors which corresponds to the long form in mouse and it only which are of multigenic presence in mice, while humans have interacts with DAP10 (Bauer, S. et al., 1999, Science, 285: only one pseudogenic Ly49. Ly49 is the receptor for classical 727-9; Wu, J. et al., 1999, Science, 285:730-2: Rosen, D.B. et (polymorphic) MHC I molecules. It will be immediately al., 2004, J Immunol, 173:2470-8). NKG2D is expressed by understood by a person skilled in the art that multigenic as all NK cells, most NKT cells, a subset of yöT cells, all human used herein preferably refers to a receptor which is encoded CD8" T cells, activated mouse CD8" T cells and a subset of by multiple genes. For example, C-type lectin family recep CD4 T cells (Diefenbach, A. et al., 2002, supra; Jamieson, A. tors are encoded by multiple genes in the NK gene complex M. et al., 2002, Immunity, 17:19-29; Bauer, S. et al., 1999, (NKC) on mouse chromosome 6. supra; Diefenbach, A. et al., 2000, Nat Immunol. 1: 119-26; 0257 More particularly, Ly49 receptors are type II trans Girardi, M. et al., 2001, Science, 294:605-9: Ehrlich, L.I. et membrane proteins encoded by polymorphic and polygenic al., 2005, J. Immunol, 174: 1922–31). On NK cells NKG2D gene complex on chromosome 6 (reviewed in Ravetch, J. V. serves as a primary activating receptor meaning that the and Lanier, L.L., 2000, Science, 290(5489):84-9.). The num engagement of NKG2D can override inhibitory signals (Cer ber of Ly49 genes varies among different mouse strains. wenka, A. et al., 2001, Proc Natl AcadSci USA,98: 11521-6). Although many inhibitory receptors are shared among differ NKG2D receptor on CD8" T cells acts as a co-stimulatory ent haplotypes (e.g. Ly49A, Ly49C, Ly49G2, and Ly49I), receptor which augments TCR-induced responses (Groh, V. their contribution in inhibitory signalling is different with et al., 2001, Nat Immunol. 2:255-60; Maasho, K. et al., 2005, regards to MHC-I haplotype-restricted education imposed J Immunol, 174:4480-4; Markiewicz, M. A. et al., 2005, J during NK cell development. The number of activating genes Immunol, 175:2825-33). varies a great deal among strains, from one (Ly491) in 0262 Human NKG2D was originally identified in 1991 as BALB/c to seven (Ly49d, u, p3, p 1, w, m, h) in NOD mice an orphan receptor that is expressed on NK cells (Houchins, (Carlyle, J. R. et al., 2008, Semin Immunol 20(6):321-30). J. et al., 1991, J. Exp. Med. 173(4): 1017-20). The mouse 0258 KIR, also referred to herein as Killer-cell immuno (Vance, R. et al., 1997, Eur. J Immunol. 27(12):3236-41; Ho, globulin-like receptors, belong to a multigene family of more E. et al., 1998, Proc Natl AcadSci USA95(11):6320-5), rat recently-evolved Ig-like extracellular domain receptors. KIR (Berg, S. F. et al., 1998, Int. Immunol. 10(4):379-85), and are present in non-human primates and are the main receptors porcine (Yim, D. et al., 2001, Immunogenetics 53(3):243-9). for both classical MHCI (HLA-A. HLA-B, HLA-C) and also Homologs of NKG2D have also been identified. Interspecies non-classical HLA-G in primates. Some KIRs are specific for amino acid (aa) sequence identities range from 52-78% for certain HLA subtypes. the entire protein, whereby mouse and rat are the most closely 0259 ILT or LIR, also referred to herein as leukocyte related sequences, and from 72-90% within the lectin domain inhibitory receptors, are recently-discovered members of the of NKG2D. Its function was first described in 1999 by two Ig receptor family. separate groups investigating MICA/MICB ligands (Bauer, 0260 NKG2D is an activating receptor for the NKG2 S. et al., 1999, Supra) or signal transduction through the receptor family expressed on NK cells, NKT cells, Yö T cells DAP10 adapter protein (Wu, J. et al., 1999, supra). More and CD8 T cells. NKG2D recognizes cell surface molecules recently, several additional ligands have also been reported structurally related to MHC class I proteins induced by infec (Cerwenka, A. et al., 2000, Immunity 12(6):721-7, Diefen tion or any other type of cellular stress. The involvement of bach, A., et al. 2000, supra; Cosman, D. et al., 2001, Immu NKG2D leads to NK cell cytotoxicity and cytokine secretion nity. 14(2):123-33). or to a co-stimulation of CD8" T cells. 0263 NKG2D ligands are distantly related homologs of 0261 NKG2D is a type-2 trans-membrane glycoprotein the MHC I proteins and are characterized by a striking struc expressed as a disulfide linked homodimer on the cell surface tural diversity, different expression patterns and regulation (Diefenbach, A. et al., 2002, Nat Immunol. 3:1142-9; Jamie mechanisms. son, A. M. et al., 2002, Immunity, 17:19-29). It is encoded by 0264. Preferred human NKG2D ligands are MHC class the KLRK1 (killer cell lecitin-like receptor subfamily mem 1-related protein A, also referred to herein as MICA, MHC ber 1) gene located on a mouse chromosome 6 and in the class-1-related protein B, also referred to herein as MICB, Syntenic position on human chromosome 12 (Houchins, J. P. and UL 16-binding proteins 1 to 6, also referred to herein as et al., 1991, J Exp Med, 173:1017-20). NKG2D has no sig ULPB1 to 6. MICA (ENSG00000204520 according to the naling motif and therefore associates with signal-transducing ENSEMBL database) and MICB (ENSG00000231372 proteins through charged residues in the trans-membrane according to the ENSEMBL database)), encoded by the genes region. In mice, alternative RNA splicing results in two within human MHC (Bauer, S. et al., 1999, Supra; Groh, V. et NKG2D isoforms, the long (NKG2D-L) and short (NKG2D al., 1996, Proc Natl AcadSci USA 93:12445-50) are the only S) isoform which differ in 13 amino acids (Diefenbach, A. et NKG2D ligands containing three immunoglobulin-like al., 2002, supra; Gilfillan, S. et al., 2002, Nat Immunol, domains (C.1, C2 and C3), but unlike MHC molecules, they do 3:1150-5). The NKG2D-L isoform pairs with the DAP10 neither associate with 32 microglobulin nor do they bind signaling molecule, while NKG2D-S associates either with antigenic peptides. All other NKG2D ligands are related to DAP10 or DAP12. Resting mouse NK cells express very little MHC I molecules but contain only C.1 and C2 domains. In an NKG2D-S, but the expression is induced after NK cell acti embodiment of the beta-herpesvirus according to the present US 2013/0156808 A1 Jun. 20, 2013

invention wherein the cellular ligand comprises at least one ULBP5 and ULBP6. In a further embodiment the cellular immunoglobulin-like domain, the cellular ligand comprises ligand is a MIC protein preferably selected from the group an C.1 domain and an O2 domain. In a further embodiment of comprising MICA and MICB the beta-herpesvirus according to the present invention the 0267 A trans-membrane protein as used herein preferably cellular ligand comprises an C1 domain, an C2 domain and an means a protein which is extending through the membrane of C3 domain, wherein the cellular ligand is preferably selected a cell. More preferably, a trans-membrane protein as used from the group comprising MICA and MICB. herein is an integral membrane protein which extends from 0265 Although named by their ability to bind HCMV one side of a membrane of a cell to the other side of the protein UL16, only the first two identified ULBP proteins membrane. Furthermore, a trans-membrane protein as used ULBP1 (ENSG00000111981 according to the ENSEMBL herein preferably is a polytopic protein that spans an entire database)), ULBP2 (ENSG 00000131015 according to the biological membrane. ENSEMBL database)) and the subsequently described 0268. In an embodiment of the beta-herpesvirus according ULBP5 bind this viral protein (Cosman, D. et al., 2001, to the present invention the cellular ligand is a protein Immunity, 14:123-33: Radosavljevic, M. et al., 2002 Genom anchored to or in the membrane via glycosylphosphatidyli ics, 79:114-23; Bacon L. et al., 2004, J Immunol, 173:1078 nositol, also referred to hereinas GPI. In an embodiment the 84). Like MIC proteins, ULBP5 and ULBP6 are trans-mem cellular ligand anchored to or in the membrane via GPI is brane proteins, while proteins ULBP1, ULBP2 and ULBP3 preferably selected from the group comprising ULBP1, (ENSG 00000131019 according to the ENSEMBL database)) ULBP2 and ULBP3. are anchored to the membrane via glycosylphosphatidyli 0269. A “glycosylphosphatidylinosity1 which is also nositol (GPI) (Eleme, K. et al., 2004, J Exp Med, 199:1005 referred to herein as “GPI-anchor, is preferably a glycolipid 10). The ULBP family is also known as the retinoic acid early which preferably is attached to a terminus, preferable the transcript 1 (RAET-1) family since they show sequence C-terminus, of a protein during posttranslational modifica homology to the mouse retinoic acid early 1 (RAE-1) proteins tion. The GPI-anchor is preferably composed of a phosphati (Nomura, M. et al., 1994, Differentiation, 57:39-50; Cer dylinositol group linked through a carbohydrate-containing wenka, A. et al., 2000, Immunity, 12:721-7; Diefenbach, A. et linker, i.e. glucosamine and mannose glycosidically bound to al., 2001, Nature, 413:165-71). Accordingly, in human and in the inositol residue, and via an ethanolamine phosphate case of the beta-herpesvirus according to the present inven (EtNP) bridge to the terminal amino acid of a protein. Pref tion for us in the vaccination of a human ligands for NKG2D erabyl, the terminal amino acid is the C-termunal amino acid. are preferably selected from the group comprising MHC The two fatty acids within the hydrophobic phosphatidyl class-1-related proteins and UL 16-binding proteins. MHC inositol group anchor the protein to or in the membrane of a class-1-related proteins are preferably selected from the cell. group comprising MICA and MICB. UL 16-binding proteins 0270. A protein anchored to or in the membrane via gly are preferably selected from the group comprising ULPB1, cosylphosphatidylinositol also referred to herein as a GPI ULPB2, ULPB3, ULPB4, ULPB5 and ULPB6. With regard linked protein, is preferably a protein which contains a signal to mouse NKG2D ligands there is a first family of ligands peptide directing the protein into the endoplasmic reticulum which is referred to as the RAE-1 family. Said RAE-1 family (ER). The terminus of the protein, such as the C-terminus, is comprises RAE-1C, RAE-1B, RAE-1, RAE 1-8 and RAE preferably composed of hydrophobic amino acids that stay 1e, which are highly related to each other (>85% amino acid inserted in the membrane of the ER. Such hydrophobic end is homology) and differentially expressed in various mouse then cleaved off by an enzyme and replaced by the GPI strains. A second family of mouse NKG2D ligands is the H60 anchor. As the protein processes through the secretory path family that comprises three members of the H60 family, way of the ER, it preferably is transferred via vesicles to the namely H60a, H60b and H60c, of which H60a is a minor Golgi apparatus and finally to the extracellular space where it histocompatibility antigen (Malarkannan, S. et al., 1998, JI remains attached to the exterior leaflet of the cell membrane. Immunol, 161:3501-9: Takada, A. et al., 2008, JImmunol, In a preferred embodiment the GPI anchor is the sole means 180: 1678-85; Whang, M. I. et al., 2009, J. Immunol, 182: of attachment of such proteins to the membrane. It will be 4557-64). Finally, murine UL16 protein-like transcript 1, also understood by a person skilled in the art that cleavage of the referred to herein as MULT-1, is the sole member of the third GPI-anchor by phospholipases will result in controlled family of mouse NKG2D ligands (Carayannopoulos, L.N. et release of the protein from the membrane. al., 2002, J Immunol, 169:4079-83; Diefenbach, A. et al., 0271. It is the merit of the present inventor to have found 2003, Eur J. Immunol, 33:381-91). Accordingly, in mice that the insertion of at least one gene encoding a cellular ligands for NKG2D are preferably selected from the group ligand, such as NKG2D, into the genome of a beta-herpesvi comprising proteins of the RAE-1 family, proteins of the H60 rus, results in expression of said cellular ligand which over family and murine UL 16 protein-like transcripts. Proteins of rides inhibitory signals delivered by self-MHC class I pro the RAE-1 family are preferably selected from the group teins and thus triggers activation of an immune cell, more comprising RAE-1C, RAE-1B, RAE-1 Y, RAE 1-8 and RAE particularly NK cells. le. Proteins of the H60 family are preferably selected from 0272. The importance of signaling pathways in beta-her the group comprising H60a, H6Ob and H60c. Murine UL16 pesvirus control induced by receptor-ligand interaction, Such protein-like transcripts are preferably selected from the group as NKG2D signaling pathway, is best illustrated by the comprising MULT-1. sophisticated mechanism that HCMV and MCMV have 0266. In an embodiment of the beta-herpesvirus according developed to avoid NKG2D-mediated immune control. to the present invention the cellular ligand is a trans-mem 0273. It is acknowledged by a person skilled in the art that brane protein. In a preferred embodiment wherein the cellular more than half of the CMV genes encode gene products ligand is a trans-membrane protein the cellular ligand is pref interfering with different immune mechanisms at all stages of erably selected from the group comprising MIC proteins, the immune system of an organsim infected with CMV. Such US 2013/0156808 A1 Jun. 20, 2013

gene products which interfere with different immune mecha AAGUGACGGUGAGAUCCAGGCU (MirBase) (Stern-Gi nisms are referred to herein as so-called immunoevasins. The nossar et al., 2008, supra; Stern-Ginossar et al., 2007, Supra) gene enconding an immunevasin is also referred to herein as 0276. In an embodiment of the beta-herpesvirus of the immunevasive gene or immune modulatory gene. present invention, wherein binding of a gene product regulat 0274) Infection of the respective host organism with either ing NK cell response is capable of binding the cellular, the of HCMV and MCMV up-regulates the transcription of binding of the gene product regulating NK cell response and NKG2D ligands in said host organisms, which can result in the cellular ligand results in reduction of expression of the NKG2D-mediated lysis by NK cells of cells infected by cellular ligand. In connection therewith it will be acknowl HCMV and MCMV, respectively. Both viruses have devel edged that a person skilled in the art will know tests for oped different evasive mechanisms using immunevasins to assessing wheter the expression of the cellular ligand is prevent and/or at least counteract the expression of NKG2D reduced. Such test is, for example, described in Cosman et al. ligands on the cell Surface. Such immunevasins which down (Dunn, C. et al., 2003, J Exp Med, 197(11): 1427–39). More regulate the expression of NKG2D ligands on the cell surface particularly, FACS analysis of surface expression of cellular of infected cells are also referred to herein as gene products ligands and assays for determining NK cell cytotoxicity can regulating NK cell response. be performed. (0275 Moreparticularly, HCMV protein UL16 which is an 0277 MCMV also encodes immunoevasins that prevent immune modulatory gene encoding a gene product regulating the accessibility of mouse NKG2D ligands to the cell surface NK cell response, binds NKG2D ligands MICB, ULBP1, (Lenac, T. et al., 2008, Med Microbiol Immunol, 197: 159 ULBP2 and ULBP6 in the endoplasmatic reticulum (ER) and 66). The product of the m152 gene, initially described as a redirects these ligands to the lysosomes for sequestration negative regulator of MHC-I molecules (Ziegler, H. et al., (Cosman, D. et al., 2001, supra; Welte, S.A. et al., 2003, Eur 1997. Immunity, 6:57-66), retains the RAE-1 family of pro J Immunol, 33:194-203: Dunn, C. et al., 2003, J Exp Med, teins in the ERGIC/cis-Golgi compartment (Krmpotic, A. et 197: 1427–39; Wu, J. et al., 2003, J Immunol, 170:4196-200; al., 2002, Nat Immunol, 3:529-35; Lodoen, M. et al., 2003, J Vales-Gomez, M. et al., 2003, BMC Immunol. 4:4: Rolle, A. Exp Med, 197:1245-53; Arapovic, J. et al., 2009, J. Virol, et al., 2003, J Immunol, 171:902-8). The ability of UL16 to 83:8198-207). Not all RAE-1 isoforms, however, are equally bind its ligands depends critically on the presence of a susceptible to MCMV regulation. RAE-18 is more resistant glutamine (MICB) or closely related glutamate (ULBP1 and to MCMV than other RAE-1 isoforms which is, at least in ULBP2) at position 169. An arginine residue at this position part, due to the absence of the PLWY motiv in the RAE-18 however, as found for example in MICA or ULBP3, would cytoplasmatic domain (Arapovic, J. et al., 2009, Supra). The cause steric clashes with UL16 residues. The inability of product of the m155 gene causes the degradation of the H60 UL16 to bind MICA and ULBP3 can therefore be attributed protein, although the underlying molecular mechanism is not to single substitutions at key NKG2D ligand locations yet entirely understood. The product of the m145 gene binds (Muller, S. et al., 2010, PLoS Pathog, 6(1): e1000723). UL16 MULT-1 after it leaves the ER and makes MULT-1 more doesn’t bind ULBP3-5. The structure of UL16 revealed that susceptible for m138-mediated degradation (Krmpotic, A. et this viral protein mimics a central binding motif of otherwise al., 2005 J Exp Med, 201:211-20). Finally, the product of structurally unrelated NKG2D and thus enabling the virus to m138, also known as fer-1, assists in diminishing the expres evade several diverse NKG2D ligands (Muller, S. et al., 2010, sion of MULT-1, H60 and RAE-1e by interfering with their supra). The gene product of another HCMV immunomodu recycling on the cell Surface and redirecting them to lysos latory gene, namely the gene product of UL142, retains newly omes for degradation (Lenac, T., 2006, J Exp Med, 203:1843 synthesized full-length MICA in the cis-Golgi compartment 50; Wilkinson, G. W. et al., 2008, J. Clin Virol, 41(3):206 (Ashiru, O. et al., 2009, JVirol, 83:12345-54; Chalupny, N.J. 12.)). et al., 2006, Biochemical and biophysical research commu 0278. As has been outlined above receptors, such as nications, 346(1):175-81). Interestingly, the MICA*008 NKG2D, may serve as primary activating receptors, particu allele, which lacks the cytoplasmatic domain, is resistant to larly on NK cells. In a preferred embodiment of the beta the action of UL142. Since MICA*008 is frequently found in herpesvirus of the present invention thus at least one gene humans, this suggests that HCMV exerts during co-evolution encoding a cellular ligand, preferably a gene encoding at least selective pressure to the host which drives diversity and poly one ligand for NKG2D, is introduced into the genome of the morphism of NKG2D ligands. In addition to targeting already beta-herpesvirus. Expression of said cellular ligand is prefer synthesized proteins, HCMV employs miRNAs to prevent ably mediated and occurring, respectively, upon infection of the translation of ligands for NKG2D. HCMV encodes a cell with said beta-herpesvirus whereby the cell is prefer miRNA-UL112 that competes with endogenous miRNA for ably permissive for infection with the beta-herpesvirus. binding to the 3'-UTR (untranslated region) of the MICA 0279. In a further preferred embodiment of the beta-herp transcript thus repressing the translation of this NKG2D esvirus of the present invention at least one immune modula ligand (Stern-Ginossar, N. et al., 2007, Science, 317:376-81: tory gene is deleted from the genome of the beta-herpesvirus. Stern-Ginossar, N. et al., 2008, Nat Immun, 9:1065-73; It is also within the present invention that more than one Wilkinson et al., 2008, J. Clin Virol, 41(3):206-12). In an immune modulatory gene is deleted from the genome of the embodiment of the beta-herpesvirus of the present invention beta-herpesvirus. In CMV simultaneous deletion of several the beta-herpesvirus herpesvirus comprises the deletion of at immune modulatory genes as well as other genes encoding least one miRNA. In a further embodiment the miRNA is gene products with unknown function or functions other than capable of binding a transcript of the cellular ligand. In a immunevasion has been described (Cicin-Sain et al., 2007, further embodiment the miRNA is capable of repressing the supra). In a further embodiment of the beta-herpesvirus of the translation of the gene coding for the cellular ligand. In a still present invention the additional deletion of at least one non further embodiment the miRNA is miRNA-UL112, also essential gene coding for a gene product with a function other referred to herein as hemv-miR-UL112 (MIMAT0001577 than immunevasion or immunemodulation is also considered. US 2013/0156808 A1 Jun. 20, 2013

The term non-essential gene as used herein preferably means by an immune modulatory gene preferably selected from the a gene which encodes a gene product, wherein a beta-herp group comprising m152, m155, m145 and m138. esvirus deficient in said gene product is not attenuated in 0283. In an embodiment of the beta-herpesvirus according vitro. An essential gene as used herein preferably means a to the present invention wherein the gene product is regulat gene which encodes a gene product, wherein a beta-herpes ing MHC class I presentation the immune modulatory gene virus deficient in said gene product is not capable of replicat preferably selected from the group comprising US6, US3, ing in vitro. Additionally and alternatively, The an essential US2, UL18, US 11, UL83 and UL40. gene as used herein in connection with herpesvirus proteins, 0284. It will be acknowledged that a person skilled in the preferably means a gene, indicated to be an essential gene art is aware of further examples of an immune modulatory according to Liu et al. (Liu et al., PNAS 2003). In an embodi gene of each and any of the above mentioned groups of ment of the present invention an essential gene of HCMV is immune modulatory genes as well as of other groups of preferably selected from the group comprising UL32, UL34. immunevasive genes regulating the immune response of the UL37.1, UL44, UL46, UL48, UL48, UL49, UL50, UL51, infected host to the advantage of viral replication, viral spread UL52, UL53, UL54, UL55, UL56, UL57, UL60, UL70, and/or viral infection. The deletion of each and any of these UL71, UL73, UL75, UL76, UL77, UL79, UL80, UL84, immune modulatory genes from the beta-herpesvirus accord UL85, UL86, UL87, UL89.1, UL90, UL91, UL92, UL93, ing to the present invention is encompassed by the present UL94, UL95, UL96, UL98, UL99, UL100, UL102, UL104, invention and is preferably advantageous for the vaccine and/ UL105, UL115 and UL122. or vector properties as well as for the immune response medi 0280. As far as the deletion of at least one immune modu ated by said vaccine and/or vector of the present invention. latory gene is contemplated herein said at least one immune Furthermore, it will be immediately understood that deletion modulatory gene is preferably selected from the group com of one or more than one immune modulatory gene which prising genes encoding gene products affecting antigen pre encodes one or more than one immunevasin(s) regulating the sentation, cytokine response, the complement system and immune response of the infected host to the advantage of the humoral immunity. More preferably, the deleted at least one virus preferably results in attenuation of the beta-herpesvirus immune modulatory gene is preferably selected from the of the present invention. group comprising a gene encoding a gene product that down 0285. In a most preferred embodiment of the beta-herpes regulates MHC I to avoid CTL response; a gene enconding a virus according to the present invention at least one immune gene product that evades the NK cell response, Such as a gene modulatory gene is deleted which encodes an immunevasin enconding gene product which prevents the accessibility of which regulates NK cell response and even more preferably is mouse NKG2D ligand to the cell Surface; a gene enconding a capable of binding the cellular ligand comprised in the beta gene product that interferes with MHC II presentation; a gene herpesvirus of the present invention. It is also preferred that if enconding a gene product that down-regulates adhesion mol more than one such cellular ligand is comprised in the beta ecules; a gene enconding a gene product that interacts with herpesvirus of the present invention for at least one, prefer IL-1, a gene enconding a gene product that activates TGF-B. ably each and any of such cellular ligand at least one immune 0281. In an embodiment of the beta-herpesvirus of the modulatory gene is deleted which encodes an immunevasin present invention where more than one immune modulatory which regulates NK cell response and which is capable of gene is deleted from the genome of the beta-herpesvirus, only binding said cellular ligand comprised in the beta-herpesvirus immune modulatory genes from one particular group of of the present invention. In connection therewith it has to be immune modulatory genes are deleted, e.g. only immune noted that dependent on the particular beta-herpesvirus and modulatory genes are deleted the gene product of which the particular cellular ligand which is comprised in the beta results in preventing the accessibility of an NKG2D ligand to herpesvirus of the present invention such deletion of an the cell surface, more preferably of one particular NKG2D immunevasin which regulates NK cell response and which is ligand. In a further embodiment immune modulatory genes capable of binding said cellular ligand comprised in the beta from two, three, four, five or more of the above mentioned herpesvirus is advantageous. It is important to understand that immune modulatory genes are deleted. In a still further in some embodiments of the beta-herpesvirus of the present embodiment each and any immune modulatory gene are invention Such deletion is nevertheless not necessary as over deleted in combination with each and any other immune expression of the cellular ligand may override the inhibitory modulatory gene. capacity of the respective immunevasin which regulates NK 0282. In an embodiment of the beta-herpesvirus according cell response and which is capable of binding said cellular to the present invention a gene product encoded by an ligand comprised in the beta-herpesvirus. Nevertheless, it immune modulatory gene is preferably a gene product regu will be immediately understood that, although not necessary, lating NK cell response and more preferably is encoded by an in some embodiments it is preferred to delete the inhibitory immune modulatory gene preferably selected from the group gene which inhibits a or the particular interaction of the comprising UL16, UL18, UL40, UL 141 (Prod'homme Vet particular receptor ligand, e.g. NK cell receptor ligand, al., J Gen Virol. 2010; Tomasec Petal., Nat Immunol. 2005), expressed by the beta-herpesvirus according to the present UL142, m152, m155, m145 and m138. In an embodiment invention. wherein the beta-herpesvirus is an HCMV a gene product 0286. In an embodiment of the beta-herpesvirus of the encoded by an immune modulatory gene is a gene product present invention, wherein the beta-herpesvirus of the present regulating NK cell response and more preferably is encoded invention encodes at least one additional heterologous by an immune modulatory gene preferably selected from the nucleic acid and wherein the at least one additional heterolo group comprising UL16, UL18, UL40, UL142. In an embodi gous nucleic acid is a functional nucleic acid, the functional ment wherein the beta-herpesvirus is an MCMV a gene prod nucleic acid is preferably selected from the group comprising uct encoded by an immune modulatory gene is a gene product antisense molecules, ribozymes and RNA interference medi regulating NK cell response and more preferably is encoded ating nucleic acids. It is a further embodiment that the at least US 2013/0156808 A1 Jun. 20, 2013 one additional heterologous nucleic acid is a heterologous binding said cellular ligand comprised in the beta-herpesvirus nucleic acid coding for a peptide, oligopeptide, polypeptide is deleted but an immunevasive gene is deleted which is or is or protein wherein preferably the peptide, oligopeptide, not regulating NK cell response and which is not capable of polypeptide or protein constitutes or comprises at least one binding said cellular ligand comprised in the beta-herpesvi antigen. In a further preferred embodiment an immune modu US latory gene Such as US11 is used as insertion site for the at 0289. Furthermore, in an embodiment of the beta-herpes least one additional heterologous nucleic acid. In an embodi virus according to the present invention wherein the beta ment the immune modulatory gene. Such as US 11 is deleted herpesvirus of the present invention comprises a deletion of by insertion of the at least one additional heterologous nucleic the coding sequence of the additional immune modulatory acid, which preferably codes for a peptide, oligopeptide, gene the coding sequence of more than one immune modu polypeptide or protein wherein preferably the peptide, oli latory gene is preferably deleted. Accordingly, the beta-her gopeptide, polypeptide or protein constitutes or comprises at pesvirus is deficient in one or more additional gene product(s) least one antigen. In a further preferred embodiment an each encoded by an additional immune modulatory gene. immune modulatory gene is deleted by insertion of a gene 0290. In an embodiment of the beta-herpesvirus of the into the beta-herpesvirus genome comprising the at least one present invention the beta-herpesvirus comprises the deletion additional heterologous nucleic acid at the position of the of at least one miRNA, wherein said miRNA is preferably an immune modulatory gene. For example US 11 encodes an miRNA which is capable of binding a transcript of the cellular immunoevasin and its deletion will (i) lead to attenuation of ligand encoded by the beta-herpesvirus of the present inven the vaccine strain and (ii) will improve antigen presentation in tion. Nevertheless, it is within the present invention that fur the HLA class I pathway. Nevertheless it will be immediately ther miRNAs are deleted from the genome of the beta-herp understood that other ORFs encoding HCMV immunoeva esvirus of the present invention which is advantageous for the sins can be used as insertion sites. Such sites of insertion are beta-herpesvirus of the present invention. Thus in an embodi preferably selected form the group comprising immune ment of the beta-herpesvirus according to the present inven modulatory genes, wherein the immune modulatory gene tion wherein the beta-herpesvirus comprises the deletion of at preferably is selected from the group comprising UL14. least one miRNA, the miRNA is preferably selected from the UL18, UL141, UL142, US2 and US6. In a further preferred group comprising miRNAS having immune modulatord func embodiment the at least one additional heterologous nucleic tions (Dölken Let al., J. Virol. 2007). acid is inserted into the beta-herpesvirus genome into a 0291. In order to provide guidance to a person skilled in sequence coding for an immunodominant CMV T cell the art on how a beta-herpesvirus of the present invention is epitope, for example IE1 or pp 65. In a further preferred designed, and in particular a beta-herpesvirus of the present embodiment the sequence coding for an immunodominant invention wherein an immunemodulatory gene is deleted CMV T cell epitope is replaced with a sequence of an epitope from the genome of the beta-herpesvirus, and how Such of an antigen as disclosed herein. immune modulatory gene may be selected, the present inven 0287. In connection therewith it is important to understand tor conceived a vaccine according to the present invention by that certain beta-herpesvirus Strains may not comprise all inserting the NKG2D ligand RAE-1Y into the MCMV immune modulatory genes. For example, the BAC cloned genome in place of the m152 gene, that otherwise negatively genome of HCMV strain TB40E (Sinzger et al., 2008, Supra) regulates this NKG2D ligand. Accordingly, said virus repre already lacks US2 and US6. In connection therewith it will sents an embodiment, wherein an immune modulatory gene also be understood by a person skilled in the art that the has been deleted the gene product of which results in prevent authentic and/or endogenous promotor of the immune modu ing the accessibility of an NKG2D ligand to the cell surface. latory gene is preferably used for expression of the at least one 0292 Whitout wishing to be bound by any theory the additional heterologous nucleic acid. For example, the present inventor currently assumes that: the deletion of an authentic US 11 promoter is preferably used for driving the immunomodulatory gene, which downregulates the cellular expression of the influenza HA. A person skilled in the art will ligand, (a) prevents downregulation of both endogenous cel know other promoters, such as the cellular PGK promoter, lular ligand and cellular ligand encoded by the beta-herpes promoter of the cellular phosphoglycerate kinase (PGK) virus of the present invention, in this particular example housekeeping gene, the viral MCMV MIEP or the HCMV RAE-1Y and RAE-1y encoded by the MCMV; (b) may over MIEP which are equally useful. It is important to note that in ride the consistent expression of the cellular ligand, in this case one of the viral MCMV MIEP or the HCMV MIEP is particular example RAE-1, on infected cells the effect of all used, a person skilled in the art will know that depending on other CMV immunoevasins encoded by immune modulatory the particular beta-herpesvirus strain used, the insertion pref genes, for NK cells, and (c) may also augment CD8" T cell erably occurs in opposite direction to the already present copy response through co-stimulatory function of NKG2D on of these elements, for example in the TB40E-ULBP2 these cells. genome. 0293. Furthermore, since m152 additionally arrests the 0288. In certain embodiments of the beta-herpesvirus maturation of MHC class I molecules (Ziegler, H. et al., 1997, according to the present invention the beta-herpesvirus of the Immunity 6:57-66), the deletion of this gene may improve the present invention is deficient in one or more additional gene presentation of viral proteins and enhance the T cell immune product(s) each encoded by an additional immune modula response. Herein the present inventor demonstrates that tory gene other than the immune modulatory gene which RAE-1-expressing MCMV, also referred to herein as RAE encodes an immunevasin which preferably regulates NK cell 1YMCMV, is dramatically attenuated in vivo not only in the response and which is capable of binding said cellular ligand immunocompetent host but even in immunologically imma comprised in the beta-herpesvirus. In a further embodiment ture neonata mice and in immunodeficient mice. However, no immune modulatory gene which encodes an immunevasin despite tight immune control, RAE-1)MCMV infection elic which regulates NK cell response and which is capable of ited a potent, long-lasting cellular and antibody immune US 2013/0156808 A1 Jun. 20, 2013 20 response able to protect animals against challenge infection. Vivo as attenuation is generally understood to be contermi Moreover, maternal RAE-1MCMV infection resulted in the nous with safety (Cicin-Sain, L. et al., Supra). Accordingly, in production and placental transfer of antiviral antibodies that an embodiment of the beta-herpesvirus according to the protected their offspring from MCMV infection following present invention the beta-herpesvirus of the present inven neonatal infection. tion is attenuated in vivo. 0294. In an embodiment of the beta-herpesvirus according 0296 Attenuation as used herein preferably means that a to the present invention, wherein the beta-herpesvirus is suit virus Such as a live attenuated virus, Such as the beta-herpes able for inducing an immune response, the immune response virus of the present invention, is replicating to lower titers is preferably an immune response against a beta-herpesvirus. compared to the respective wild type virus. Attenuation as Inafurther preferred embodiment the immune response pref used herein more preferably means that a virus has a virulence erably comprises neutralizing antibodies against beta-herp which is reduced compared to the respective wild type virus. esvirus and/or CD4 T-cells directed against epitopes of beta Attenuation alters a virus So that it becomes more harmless herpesvirus and/or CD8 T-cells directed against epitopes of and/or less virulent. These vaccines contrast to those pro beta-herpesvirus. In connection therewith it is important to duced by “killing the virus (inactivated vaccine). Still more understand that the present invention considers that in con preferably, attenuation as used herein means that the titer of a nection with an immune response against a beta-herpesvirus, virus is less compared to the titer of the respective wild type preferably comprising neutralizing antibodies directed virus grown under the same conditions. So as to determine against a beta-herpesvirus and/or CD4 T-cells directed whether the beta-herpesvirus according to the invention and against epitopes of beta-herpesvirus and/or CD8" T-cells particularly the HCMV according to the present invention is directed against epitopes of beta-herpesvirus, the beta-herp attenuated compared to the respective wild type virus, pref esvirus is not necessarily from the same beta-herpesvirus erably, the assay for assessing virus growth kinetics as strain and/or beta-herpesvirus species as the beta-herpesvirus described in Example 1 is used. It is known to a person skilled Suitable anc actually for inducing and elicting, respectively, in the art that in connection with a titer of a virus the term an immune response. A person skilled in the art will acknowl “plaque-forming units” also referred to herein as PFU, is edge that different strains of one species of beta-herpesvirus used. such as different HCMV strains is preferably used as the 0297. The titer of a virus in terms of "plaque-forming beta-herpesvirus according to the present invention is capable units’ is preferably a measure for the amount of infectious of and/or Suitable for inducing an immune response, wherein virus particles present in a sample, Such as a sample from a the immune response is directed against a beta-herpesvirus of subject or an in vitro sample. To determine virus titer a stan another strain, such as another HCMV strain. A person skilled dard plaque assay as for example described in Krmpotic, A. et in the art will also acknowledge that the infection with beta al. (Krmpotic, A. et al. 2005, supra) and/or described in herpesviruses is generally thought to be species-specific. In Example 1 is used. A person skilled in the art will furthermore other words, HCMV is only capable of infecting humans, know how to determine the amount of a pathogen, Such as the MCMV is only capable of infection mice. Nevertheless, it is titer of a virus, in a Subject or in an in vitro sample. The also possible that a beta-herpesvirus species may infect more amount of bacteria, Such as Listeria monocytogenes, in a related species, such as MCMV is capable of infecting other sample or Subject is preferably measured as "colony forming rodents than mouse, or rhesus CMV is capable of infecting units’, also referred to herein as CFU. To determine CFU a humans. It is also within the present invention that Such person skilled in the art will know appropriate assays. As an species-barrier will be overcome, e.g. by genetic manipula example an assay to determine CFU in mouse organs is pref tion with regard to entry of the virus, receptors, glycoproteins erably an assay as described in Example 1 herein. expressed at the Surface and/or prevention of apoptosis. Hav 0298. In connection with attenuation it will be furthermore ing said this it is an embodiment of the present invention that understood that a person skilled in the art will regard the immune response against a beta-herpesvirus, preferably the attenuation of a virus as a measure for the safety of the virus neutralizing antibodies and/or CD4 T-cells and/or CD8" if used as a vaccine or vaccine vector. Accordingly, it is T-cells, is directed against the beta-herpesvirus capable of advantageous with regard to safety if a virus is attenuated. and/or Suitable for inducing an immune response, wherein the Such attenuation is preferably achieved in many ways known beta-herpesvirus Suitable for inducing an immune response is to a person skilled in the art. For example the deletion of one of the same strain and species, of the same species but differ or more immune modulatory genes preferably results in ent strain and/or from a different species and different strain attenuation of a virus in Vivo, as the immune response is as the beta-herpesvirus the immune response is directed stronger if the immune modulatory gene encoding a gene against. In a more preferred embodiment the beta-herpesvirus product down-modulating and/or down-regulating the Suitable for inducing an immune response induces an immune immune response is deleted (Cicin-sain, L. et al., Supra). It response preferably comprising neutralizing antibodies will be also understood that the strongest possible deletion is against the beta-herpesvirus and/or CD4 T-cells directed the absence of virus replication and/or virus progeny. Such against epitopes of the beta-herpesvirus and/or CD8" T-cells most strongest attenuation will be achieved if an essential directed against epitopes of the beta-herpesvirus, wherein the gene is deleted from the virus (Mohr, C. A. et al., 2010, supra). beta-herpesvirus preferably is suitable for inducing an 0299. Accordingly, it will be understood that the strongest immune response is HCMV. conceivable degree of attenuation is the formal impossibility 0295 The present specificaton also provides evidence that of a virus to finish its replication cycle and/or incits inability expression of a cellular ligand Such as an NKG2D ligand on of generating viral progeny and/or incapable of generating beta-herpesvirus infected cells dramatically attenuates the infectious viral progeny. Such virus incapable offinishing its virus growth in vivo but in the same time does not lead to replication cycle and/or generating viral progeny and/or inca attenuation in vitro. It is immediately understood that a per pable of generating infectious viral progeny, is known in the son skilled in the art will prefer a virus which is attenuated in art as spread-deficient and/or replication deficient virus as US 2013/0156808 A1 Jun. 20, 2013 described for example in (Mohr, C. A. et al., 2010, supra; CD8" T cells, the present inventor has not observed any Snyder, C. M. et al., 2009, J. Immunol, 182:128.29). In an mutation of the inserted gene encoding the cellular ligand. embodiment of the beta-herpesvirus of the present invention More importantly, all the viruses recovered from latency the beta-herpesvirus is deficient in at least one gene product showed no differences in comparison with parental virus encoded by an essential gene and/or by a glycoprotein, mutant used for primary infection. wherein the deficiency of said essential gene and/or glyco 0304. It is the merit of the present inventor having recog protein results in a virus which is incapable of replicating its nized that the beta-herpesvirus of the present invention which viral genome, spreading its progeny from one cell to another comprises at least one heterologous nucleic acid, wherein the and/or producing infectious viral progeny. Such deficiency is at least one heterologous nucleic acid comprises a gene achieved in an embodiment of the present invention by dele encoding a cellular ligand, is a Suitable vaccine vector. This tion or partial deletion of the coding sequence of the respec prompted the present inventor to insert immunodominant tive gene, or by inhibition of the transcription, translation or antigens of different pathogens into the beta-herpes virus in function thereof. Respective genes are known to the person order to test its vector capacity in terms of eliciting an skilled in the art. By way of example, a virus having a deletion immune response in the recipient organism against said of a gene encoding a glycoprotein essential for infection is immunodomiunant antigens. disclosed in Snyder et al., (Snyder, C. M. et al., 2009, Supra) 0305 The present inventor unexpectedly found that when and a virus having a deletion of a gene encoding a protein the beta-herpesvirus according to the present invention being essential for virus spread is disclosed in Mohr et al. encodes an additional heterologous nucleic acid, wherein the (Mohr, C. A. et al., 2010, supra). Such virus is preferably additional heterologous nucleic acid codes for a peptide, oli produced using a cell line which is capable of complementing gopeptide, polypeptide and/or protein which constitutes or the gene product of the deleted essential gene and/or glyco comprises at least one antigen and epitope, respectively, that protein. The generation and use of such cell lines is known to said beta-herpesvirus was dramatically attenuated in Vivo: the person skilled in the art. 0306 In connection therewith it is known to the person 0300 However, in spite of reduced antigenic load due to skilled in the art that NK cells have a major role in innate attenuation of the beta-herpesvirus of the present invention immune response to several viruses. Receptors, such as such as CMV expressing Rae-1y, a beta-herpesvirus of the NKG2D, are among the most potent activating receptors present invention is capable of inducing a strong immunity expressed on all NK cells and all CD8" T cells in humans, or and protect immunocompetent Subjects as well as immuno activated CD8" T cells in mice. Insertion of a gene encoding deficient subjects against infection with wild type beta-herp a cellular ligand, for example NKG2D ligand RAE-1, in esvirus. place of its viral downregulator, i.e. an immune modulatory 0301. It is important to note that the present inventor pro gene Such as, for example m152, results in dramatic virus vides conclusive evidence in the Examples shown herein that attenuation. Attenuation as such is not unexpected, since even subjects immunized with the beta-herpesvirus of the present the mutant viruses lacking viral inhibitors of the cellular invention are able to resist challenge infection better than ligand(s) are attenuated (Krmpotic, A. et al., 2002, Supra; subjects immunized with the respective wild type beta-herp Krmpotic, A. et al., 1999, J Exp Med, 190(9): 1285-96: esvirus. In connection therewith it is important to understand Arapovic, J. et al., 2009, supra; Hasan, M. et al., 2005, JVirol, that it is known for decades that infection with wild type 79:2920-30; Lenac, T. et al., 2006, supra; Lodoen, M. et al., beta-herpesvirus, especially with MCMV wild type, which is 2003, J Exp Med, 197(10): 1245-53; Lodoen, M. B. et al., not useful as a vaccine for reasons of safety, confers protec 2004, J Exp Med 200(8): 1075-81), but in case of the beta tion against infection with wild type virus, preferably of the herpesvirus of the present invention expressing the cellular same strain. ligand, said beta-herpesvirus of the present invention, in an 0302 Most importantly, the present inventor found that in embodiment, is attenuated to Such an extent that it even fails naturally more resistant C57BL/6 mice immunized with the to reach salivary gland. A person skilled in the art will imme beta-herpesvirus of the present invention, more particularly diately acknowledge that salivary glands are otherwise a RAE-1MCMV, the CD8" T cell response is stronger com privileged site for virus persistency and horizontal spread. pared to individuals infected with the respective wild type The results obtained in mice expressing Ly49H receptor, virus. Newborn subjects derived from females immunized otherwise resistant to MCMV because of recognition of viral with the beta-herpesvirus of the present invention are pro m157 protein, also demonstrate dramatic attenuation, con tected against perinatal infection to the same extent as the firming that this can not be only the consequence of an NK offspring derived from females immunized with wild type cell response. More particularly, in these mice NK cells are virus. This latter finding confirmed that the beta-herpesvirus strongly activated through Ly49H/m 157 interaction. More of the present invention induces neutralizing antibody over, the beta-herpesvirus of the present invention expressing response despite strong attenuation and therefore lower anti a cellular ligand is attenuated in otherwise severely immuno genic load. More particularly, protection of newborn indi compromized Subjects, for example mice lacking IFNAR, viduals against challenge infection iss mediated through mice immunodepleted by Sublethal gamma irradiation, and transplacentally transferred IgG. mice lacking perforin. These latter findings are extremely 0303 Another important characteristic of the beta-herpes important bearing in mind that the hallmark of beta-herpes virus of the present invention is its ability to provide long viruses is an opportunistic infection in immunocompromised lasting immunity. Although the load of latent viral genome is individuals. significantly lower in subjects immunized with the beta-her 0307 The present inventor furthermore found that when pesvirus of the present invention this virus is able to reactivate the beta-herpesvirus according to the present invention upon immunosuppression of latently infected Subjects. Nota encodes an additional heterologous nucleic acid, wherein the bly, even though the beta-herpesvirus according to the present at additional heterologous nucleic acid preferably codes for a invention is under strong selective pressure by NK cells and peptide, oligopeptide, polypeptide and/or protein which more