DOCSLIB.ORG

Convergent Evolution by Cancer and Viruses in Evading the NKG2D Immune Response

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Convergent Evolution by Cancer and Viruses in Evading the NKG2D Immune Response cancers Review Convergent Evolution by Cancer and Viruses in Evading the NKG2D Immune Response Richard Baugh , Hena Khalique and Leonard W. Seymour * Anticancer Viruses and Cancer Vaccines Research Group, Department of Oncology, University of Oxford, Oxford OX3 7DQ, UK; [email protected] (R.B.); [email protected] (H.K.) * Correspondence: [email protected]; Tel.: +44-01865-617331 Received: 13 November 2020; Accepted: 16 December 2020; Published: 18 December 2020 Simple Summary: Cells undergoing stress, viral infection, and malignant transformation express natural killer group 2 member D (NKG2D) ligands on their surface, rendering them susceptible to immunosurveillance. Given this selective pressure exerted on viruses and cancer cells, many viruses and several cancers have evolved means of evading NKG2D recognition. This review highlights the various ways in which stresses, viruses and cancers induce the expression of NKG2D ligands, before comparing the similarities and differences between viral and cancer mechanisms to subsequently prevent recognition by the NKG2D system. Abstract: The natural killer group 2 member D (NKG2D) receptor and its family of NKG2D ligands (NKG2DLs) are key components in the innate immune system, triggering NK, γδ and CD8+ T cell-mediated immune responses. While surface NKG2DL are rarely found on healthy cells, expression is significantly increased in response to various types of cellular stress, viral infection, and tumour cell transformation. In order to evade immune-mediated cytotoxicity, both pathogenic viruses and cancer cells have evolved various mechanisms of subverting immune defences and preventing NKG2DL expression. Comparisons of the mechanisms employed following virus infection or malignant transformation reveal a pattern of converging evolution at many of the key regulatory steps involved in NKG2DL expression and subsequent immune responses. Exploring ways to target these shared steps in virus- and cancer-mediated immune evasion may provide new mechanistic insights and therapeutic opportunities, for example, using oncolytic virotherapy to re-engage the innate immune system towards cancer cells. Keywords: NKG2D ligands; NKG2D receptor; NK cells; immune evasion; convergent evolution; cancer; viruses; immunotherapy 1. Introduction Cancer cells have long been defined with a set of characteristics, known as the ‘hallmarks of cancer’, with immune evasion rapidly emerging as a key player in cancer progression [1]. Viruses share several of these hallmarks with cancer cells to achieve a successful infection, as immune evasion is also critically important for viruses. 1.1. NKG2D Receptor and NK Cell Activation Natural killer (NK) cells play a critical role in the innate immunosurveillance of both virally infected cells and tumours. They possess an extensive repertoire of both activatory and inhibitory receptors that recognise a range of ligands on target cells [2]. In contrast to T cell activation by clonotypic T cell receptor (TCR) interacting with specific peptides presented in the context of major histocompatibility complex (MHC), NK cells are inhibited by MHC molecules, and are instead activated Cancers 2020, 12, 3827; doi:10.3390/cancers12123827 www.mdpi.com/journal/cancers Cancers 2020, 12, 3827 2 of 27 by the lackCancers ofMHC, 2020, 12, x referred to as ‘missing-self’ [3]. NK cells also interpret other positive2 andof 27 negative signals fromactivated their by environment the lack of MHC, and referred the target to as ‘missing-self’ cell. Some [3]. of theNK cells activatory also interpret receptors other positive responsible for processingand positive negative signals signals includefrom their NKp46, environment NKp44 and andthe target NKp30 cell. [ 2Some]. One of ofthe the activatory most well-documentedreceptors activatoryresponsible receptors for is processing the natural positive killer signals group inclu 2 memberde NKp46, D NKp44 (NKG2D) and NKp30 receptor. [2]. One NKG2D of the most receptor and its ligandswell-documented (NKG2DLs) areactivatory part of receptors the early is the warning natural signalskiller group for 2 the member innate D immune(NKG2D) system;receptor. flagging NKG2D receptor and its ligands (NKG2DLs) are part of the early warning signals for the innate up cells thatimmune may system; represent flagging danger up cells to that the may host repres organism.ent danger NKG2D to the host receptor organism. is NKG2D an activatory receptor receptor + + expressedison an theactivatory surface receptor of NK expressed cells, CD8 on theT cells, surface natural of NK killercells, CD8 T (NKT)+ T cells, cells, naturalγδ T killer cells Tand (NKT) some CD4 T cell subsetscells, [γδ4– T6 ].cells NKG2D and some is anCD4 invariant+ T cell subsets homodimeric [4–6]. NKG2D receptor, is an invariant with each homodimeric monomer receptor, consisting of a type-II transmembranewith each monomer domain consisting and aof C-type a type-II lectin-like transmembrane extracellular domain domain,and a C-type and islectin-like associated with extracellular domain, and is associated with DNAX activating protein 10 (DAP10) or DAP12 in mice, DNAX activating protein 10 (DAP10) or DAP12 in mice, and DAP10 only in humans [4] (Figure1a). and DAP10 only in humans [4] (Figure 1a). Figure 1.FigureNKG2D 1. NKG2D receptor receptor and ligands.and ligands (a. )(a The) The natural natural killer group group 2 member 2 member D (NKG2D) D (NKG2D) receptor receptor is expressedis byexpressed natural by killernatural (NK) killer cells,(NK) cells,γδ T γδ cells, T cells, CD8 CD8++ T cells, cells, and and some some CD4 CD4+ T cells.+ T The cells. NKG2D The NKG2D receptor isreceptor associated is associated with with DNAX DNAX activating activating protein protein (DAP) (DAP) 10 10in humans, in humans, but DAP10 but DAP10 and DAP12 and in DAP12 in mice. (b) NKG2D ligands (NKG2DLs) include MHC-class-I-polypeptide-related sequence (MIC) A mice. (b) NKG2D ligands (NKG2DLs) include MHC-class-I-polypeptide-related sequence (MIC) A and and MICB, and UL16 binding protein (ULBP) 1-6 in humans, and retinoic acid early inducible (RAE- MICB, and1) α UL16-ε, H60a-c, binding and proteinmurine UL16 (ULBP) binding 1-6 inprotein-like humans, transcript and retinoic (MULT) acid 1 in early mice. inducible All NKG2DLs (RAE-1) α-", H60a-c, andfeature murine MHC-class-I-like UL16 binding α1 and protein-likeα2 domains, whilst transcript MICA and (MULT) MICB 1also in have mice. an Allα3-like NKG2DLs domain feature MHC-class-I-likebut do notα bind1 and to βα2-microglobulin.2 domains, whilst Some NKG2DLs MICA and are MICBtransmembrane also have proteins an α 3-like(TM), while domain others but do not bind to βare2-microglobulin. linked to the membrane Some NKG2DLs via glycophosphatidy are transmembranelinositol (GPI) proteins anchors.(TM), Diagram while created others with are linked BioRender.com. to the membrane via glycophosphatidylinositol (GPI) anchors. Diagram created with BioRender.com. NKG2D binding to NKG2DLs can directly activate NK cells that have already been stimulated NKG2Dwith interleukin binding to (IL) NKG2DLs -2 or IL-15 can [7,8], directly wherea activates additional NK costimulatory cells that have signals already are required been stimulatedto with interleukinactivate T (IL)cells -2and or freshly IL-15 isolated [7,8], whereasNK cells [9,10]. additional Binding costimulatoryof NKG2D to its signals ligands arerecruits required to activate Tphosphatidylinositol cells and freshly 3-kinase isolated (PI3K) NK and cellsgrowth [9 fa,10ctor]. receptor-bound Binding of protein NKG2D 2 (GRB2), to its triggering ligands recruits phosphatidylinositola subsequent phosphorylation 3-kinase (PI3K) cascade. and growth If the factorbalance receptor-boundof the overall signalling protein favours 2 (GRB2), NK cell triggering a subsequent phosphorylation cascade. If the balance of the overall signalling favours NK cell activation, it can stimulate effector functions including cytokine release and perforin/granzyme-mediated cytotoxicity [11]. 1.2. NKG2D Ligands Although the NKG2D receptor is germline-encoded, it can recognise a diverse range of MHC-class-I-related ligands. In humans, these NKG2DLs include MHC-class-I-polypeptide-related Cancers 2020, 12, 3827 3 of 27 sequence A (MIC) A and MICB, and UL16 binding protein (ULBP) 1-6, also known as retinoic acid early inducible transcript 1 (RAET1) proteins [6,12–17]. In contrast, murine NKG2DLs include retinoic acid early inducible (RAE-1) α-", H60a-c, and murine UL16 binding protein-like transcript (MULT) 1 [18,19]. All NKG2DLs share homology with MHC class I molecules, featuring α1 and α2 domains, while MICA and MICB also have an α3 domain. However, unlike MHC class I molecules, they cannot bind and present antigenic peptides and are not associated with β2-microglobulin. Despite their overall similarities, NKG2DLs vary from each other in sequence; binding affinity to NKG2D; and membrane anchorage, either transmembrane proteins or glycophosphatidylinositol (GPI)-linked [20] (Figure1b). NKG2DLs also display a high degree of polymorphism in humans, with 104 and 37 distinct alleles currently assigned for MICA and MICB genes, respectively [21]. These polymorphisms can vary certain properties of the NKG2DLs, such as binding affinity to NKG2D receptor [22,23] or protein length [24,25]. The expression of NKG2DLs on normal, healthy cells is low or absent. However,expression dramatically increases during events of cellular stress, virus infection or malignant transformation.
Load more

Recommended publications
  • NK Cell Memory to Cytomegalovirus: Implications for Vaccine Development
    Review NK Cell Memory to Cytomegalovirus: Implications for Vaccine Development Calum Forrest 1 , Ariane Gomes 1 , Matthew Reeves 1,* and Victoria Male 2,* 1 Institute of Immunity & Transplantation, UCL, Royal Free Campus, London NW3 2PF, UK; [email protected] (C.F.); [email protected] (A.G.) 2 Department of Metabolism, Digestion and Reproduction, Imperial College London, Chelsea and Westminster Campus, London SW10 9NH, UK * Correspondence: [email protected] (M.R.); [email protected] (V.M.) Received: 24 June 2020; Accepted: 15 July 2020; Published: 20 July 2020 Abstract: Natural killer (NK) cells are innate lymphoid cells that recognize and eliminate virally-infected and cancerous cells. Members of the innate immune system are not usually considered to mediate immune memory, but over the past decade evidence has emerged that NK cells can do this in several contexts. Of these, the best understood and most widely accepted is the response to cytomegaloviruses, with strong evidence for memory to murine cytomegalovirus (MCMV) and several lines of evidence suggesting that the same is likely to be true of human cytomegalovirus (HCMV). The importance of NK cells in the context of HCMV infection is underscored by the armory of NK immune evasion genes encoded by HCMV aimed at subverting the NK cell immune response. As such, ongoing studies that have utilized HCMV to investigate NK cell diversity and function have proven instructive. Here, we discuss our current understanding of NK cell memory to viral infection with a focus on the response to cytomegaloviruses. We will then discuss the implications that this will have for the development of a vaccine against HCMV with particular emphasis on how a strategy that can harness the innate immune system and NK cells could be crucial for the development of a vaccine against this high-priority pathogen.
    [Show full text]
  • Case of the Anti HIV-1 Antibody, B12
    Spectrum of Somatic Hypermutations and Implication on Antibody Function: Case of the anti HIV-1 antibody, b12 Mesfin Mulugeta Gewe A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy University of Washington 2015 Reading Committee: Roland Strong, Chair Nancy Maizels Jessica A. Hamerman Program Authorized to Offer Degree: Molecular and Cellular Biology i ii ©Copyright 2015 Mesfin Mulugeta Gewe iii University of Washington Abstract Spectrum of Somatic Hypermutations and Implication on Antibody Function: Case of the anti HIV-1 antibody, b12 Mesfin Mulugeta Gewe Chair of the Supervisory Committee: Roland Strong, Full Member Fred Hutchinson Cancer Research Center Sequence diversity, ability to evade immune detection and establishment of human immunodeficiency virus type 1 (HIV-1) latent reservoirs present a formidable challenge to the development of an HIV-1 vaccine. Structure based vaccine design stenciled on infection elicited broadly neutralizing antibodies (bNAbs) is a promising approach, in some measure to circumvent existing challenges. Understanding the antibody maturation process and importance of the high frequency mutations observed in anti-HIV-1 broadly neutralizing antibodies are imperative to the success of structure based vaccine immunogen design. Here we report a biochemical and structural characterization for the affinity maturation of infection elicited neutralizing antibodies IgG1 b12 (b12). We investigated the importance of affinity maturation and mutations accumulated therein in overall antibody function and their potential implications to vaccine development. Using a panel of point iv reversions, we examined relevance of individual amino acid mutations acquired during the affinity maturation process to deduce the role of somatic hypermutation in antibody function.
    [Show full text]
  • The T Cell Repertoire Specific for the IE-1 Protein of Human Cytomegalovirus: Diversity, Function and Evasion
    Dissertation zur Erlangung des Doktorgrades der Fakultät für Chemie und Pharmazie der Ludwig-Maximilians-Universität München The T cell repertoire specific for the IE-1 protein of human cytomegalovirus: diversity, function and evasion von Stefanie Maria Ameres aus Deggendorf, Deutschland 2012 Erklärung Diese Dissertation wurde im Sinne von §7 der Promotionsordnung vom 28. November 2011 von Herrn Prof. Dr. Wolfgang Hammerschmidt betreut und von Herrn Prof. Dr. Horst Domdey vor der Fakultät für Chemie und Pharmazie vertreten. Eidesstattliche Versicherung Diese Dissertation wurde eigenständig und ohne unerlaubte Hilfe erarbeitet. München, den 03.07.2012 Stefanie Ameres Dissertation eingereicht am 03.07.2012 1. Gutachter: Prof. Dr. Horst Domdey 2. Gutachter: Prof. Dr. Wolfgang Hammerschmidt Mündliche Prüfung am 28.01.2013 Teile dieser Arbeit werden/wurden wie folgt veröffentlicht: Ameres, S., J. Mautner, F. Schlott, M. Neuenhahn, D.H. Busch, B. Plachter, and A. Moosmann. Antigen Presentation to an Immunodominant Population of HLA-C-Restricted T Cells Resists Cytomegalovirus Immunoevasion. 2nd revision PLOS Pathogens Hesse, J., S. Ameres, K. Besold, S. Krauter, A. Moosmann, and B. Plachter. Suppression of CD8+ T-cell recognition in the immediate-early phase of human cytomegalovirus infection. Epub oct 2012. J. Gen. Virol. Teile dieser Arbeit wurden im Rahmen der Dissertation wie folgt präsentiert: May 3rd–4th, 2012 DFG SFB-TR36 Symposium "Adoptive T Cell Therapy" Berlin, Germany Talk: "CD8+ T cells overcome HCMV immunoevasion dependent on their HLA restriction" Dec. 5th–7th, 2011 DFG SFB-TR36 Retreat "Principles and Applications of Wildbad Kreuth, Adoptive T Cell therapy" Germany Talk: "CD8+ T cells defeat HCMV immunoevasins dependent on MHC restriction" May 14th–17th, 2011 13th International CMV/Betaherpesvirus Workshop Nürnberg, Germany Poster 1: "Preferential T cell control of HCMV infection through HLA-C" Poster 2: "HCMV IE-1 is recognized by a diverse repertoire of CD4+ Tcells" Oct.
    [Show full text]
  • Structural Basis of Mouse Cytomegalovirus M152/Gp40 Interaction with Rae1γ Reveals a Paradigm for MHC/MHC Interaction in Immune
    Structural basis of mouse cytomegalovirus m152/gp40 PNAS PLUS interaction with RAE1γ reveals a paradigm for MHC/MHC interaction in immune evasion Rui Wanga, Kannan Natarajana, Maria Jamela R. Revillezaa, Lisa F. Boyda, Li Zhia,1, Huaying Zhaob, Howard Robinsonc, and David H. Marguliesa,2 aMolecular Biology Section, Laboratory of Immunology, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892; bDynamics of Macromolecular Assembly Section, Laboratory of Cellular Imaging and Macromolecular Biophysics, National Institute of Biomolecular Imaging and Bioengineering, National Institutes of Health, Bethesda, MD 20892; and cNational Synchrotron Light Source, Brookhaven National Laboratories, Upton, NY 11973 Edited by K. Christopher Garcia, Stanford University, Stanford, CA, and approved October 24, 2012 (received for review August 17, 2012) Natural killer (NK) cells are activated by engagement of the NKG2D NKG2D ligands, we examined the binding of the MCMV m152 receptor with ligands on target cells stressed by infection or glycoprotein to its RAE1 ligands. Our previous studies investigated tumorigenesis. Several human and rodent cytomegalovirus (CMV) the quantitative interaction of m152 with different RAE1 isoforms immunoevasins down-regulate surface expression of NKG2D (21). Here we report the X-ray structure of the complex of m152 ligands. The mouse CMV MHC class I (MHC-I)–like m152/gp40 glyco- with RAE1γ, the confirmation of the intermolecular contacts protein down-regulates retinoic acid early inducible-1 (RAE1) observed in the crystal structure by site-directed mutagenesis and NKG2D ligands as well as host MHC-I. Here we describe the crystal in vitro binding assays, a comparison of the binding of m152 to structure of an m152/RAE1γ complex and confirm the intermolec- RAE1 and of NKG2D to RAE1, and the functional effects of ular contacts by mutagenesis.
    [Show full text]
  • ULBP2 (NM 025217) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG204506 ULBP2 (NM_025217) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: ULBP2 (NM_025217) Human Tagged ORF Clone Tag: TurboGFP Symbol: ULBP2 Synonyms: ALCAN-alpha; N2DL2; NKG2DL2; RAET1H; RAET1L Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RG204506 representing NM_025217 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCAGCAGCCGCCGCTACCAAGATCCTTCTGTGCCTCCCGCTTCTGCTCCTGCTGTCCGGCTGGTCCC GGGCTGGGCGAGCCGACCCTCACTCTCTTTGCTATGACATCACCGTCATCCCTAAGTTCAGACCTGGACC ACGGTGGTGTGCGGTTCAAGGCCAGGTGGATGAAAAGACTTTTCTTCACTATGACTGTGGCAACAAGACA GTCACACCTGTCAGTCCCCTGGGGAAGAAACTAAATGTCACAACGGCCTGGAAAGCACAGAACCCAGTAC TGAGAGAGGTGGTGGACATACTTACAGAGCAACTGCGTGACATTCAGCTGGAGAATTACACACCCAAGGA ACCCCTCACCCTGCAGGCCAGGATGTCTTGTGAGCAGAAAGCTGAAGGACACAGCAGTGGATCTTGGCAG TTCAGTTTCGATGGGCAGATCTTCCTCCTCTTTGACTCAGAGAAGAGAATGTGGACAACGGTTCATCCTG GAGCCAGAAAGATGAAAGAAAAGTGGGAGAATGACAAGGTTGTGGCCATGTCCTTCCATTACTTCTCAAT GGGAGACTGTATAGGATGGCTTGAGGACTTCTTGATGGGCATGGACAGCACCCTGGAGCCAAGTGCAGGA GCACCACTCGCCATGTCCTCAGGCACAACCCAACTCAGGGCCACAGCCACCACCCTCATCCTTTGCTGCC TCCTCATCATCCTCCCCTGCTTCATCCTCCCTGGCATC ACGCGTACGCGGCCGCTCGAG - GFP Tag - GTTTAA This product is to be used for laboratory only.
    [Show full text]
  • Analysis of the Indacaterol-Regulated Transcriptome in Human Airway
    Supplemental material to this article can be found at: http://jpet.aspetjournals.org/content/suppl/2018/04/13/jpet.118.249292.DC1 1521-0103/366/1/220–236$35.00 https://doi.org/10.1124/jpet.118.249292 THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS J Pharmacol Exp Ther 366:220–236, July 2018 Copyright ª 2018 by The American Society for Pharmacology and Experimental Therapeutics Analysis of the Indacaterol-Regulated Transcriptome in Human Airway Epithelial Cells Implicates Gene Expression Changes in the s Adverse and Therapeutic Effects of b2-Adrenoceptor Agonists Dong Yan, Omar Hamed, Taruna Joshi,1 Mahmoud M. Mostafa, Kyla C. Jamieson, Radhika Joshi, Robert Newton, and Mark A. Giembycz Departments of Physiology and Pharmacology (D.Y., O.H., T.J., K.C.J., R.J., M.A.G.) and Cell Biology and Anatomy (M.M.M., R.N.), Snyder Institute for Chronic Diseases, Cumming School of Medicine, University of Calgary, Calgary, Alberta, Canada Received March 22, 2018; accepted April 11, 2018 Downloaded from ABSTRACT The contribution of gene expression changes to the adverse and activity, and positive regulation of neutrophil chemotaxis. The therapeutic effects of b2-adrenoceptor agonists in asthma was general enriched GO term extracellular space was also associ- investigated using human airway epithelial cells as a therapeu- ated with indacaterol-induced genes, and many of those, in- tically relevant target. Operational model-fitting established that cluding CRISPLD2, DMBT1, GAS1, and SOCS3, have putative jpet.aspetjournals.org the long-acting b2-adrenoceptor agonists (LABA) indacaterol, anti-inflammatory, antibacterial, and/or antiviral activity. Numer- salmeterol, formoterol, and picumeterol were full agonists on ous indacaterol-regulated genes were also induced or repressed BEAS-2B cells transfected with a cAMP-response element in BEAS-2B cells and human primary bronchial epithelial cells by reporter but differed in efficacy (indacaterol $ formoterol .
    [Show full text]
  • The Murine Cytomegalovirus Immunoevasin Gp40 Binds MHC
    © 2016. Published by The Company of Biologists Ltd | Journal of Cell Science (2016) 129, 219-227 doi:10.1242/jcs.175620 RESEARCH ARTICLE The murine cytomegalovirus immunoevasin gp40 binds MHC class I molecules to retain them in the early secretory pathway Linda Janßen1, Venkat Raman Ramnarayan1, Mohamed Aboelmagd1, Maro Iliopoulou1, Zeynep Hein1, Irina Majoul2, Susanne Fritzsche1, Anne Halenius3 and Sebastian Springer1,* ABSTRACT ERGIC or cis-Golgi, and we demonstrate that a sequence in the In the presence of the murine cytomegalovirus (mCMV) gp40 (m152) linker between the folded lumenal domain of gp40 and the protein, murine major histocompatibility complex (MHC) class I transmembrane sequence is required for this retention. molecules do not reach the cell surface but are retained in an early compartment of the secretory pathway. We find that gp40 does not RESULTS impair the folding or high-affinity peptide binding of the class I Gp40 retains MHC class I in the early secretory pathway molecules but binds to them, leading to their retention in the To assess the effect of gp40 on murine class I molecules, we m152 endoplasmic reticulum (ER), the ER-Golgi intermediate compartment expressed in K41 cells (murine fibroblasts) by lentiviral (ERGIC) and the cis-Golgi, most likely by retrieval from the cis-Golgi to transduction. The surface levels of the endogenous class I allotypes b b b b the ER. We identify a sequence in gp40 that is required for both its own H-2D (D ) and H-2K (K ) were reduced to background levels in retention in the early secretory pathway and for that of class I most cells, as observed by flow cytometry with the allotype-specific β b molecules.
    [Show full text]
  • Epstein-Barr Virus May Contribute to Central Nervous System Involvement in HIV-Positive Individuals
    bioRxiv preprint doi: https://doi.org/10.1101/341354; this version posted June 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Epstein-Barr Virus May Contribute to Central Nervous System Involvement in HIV-positive 2 Individuals 3 Lupia T1#*, Milia MG2, Atzori C3, Audagnotto S1, Imperiale D3, Mighetto L4, Pirriatore V1, Gregori G2, 4 Lipani F1, Ghisetti V2, Bonora S1, Di Perri G1, Calcagno A1. 5 1 Unit of Infectious Diseases, Department of Medical Sciences, University of Torino, Torino, Italy 6 2 Laboratory of Virology and Molecular Biology, Ospedale Amedeo di Savoia, ASL “Città di Torino”, 7 Torino, Italy 8 3 Unit of Neurology, Ospedale Maria Vittoria, ASL “Città di Torino”, Torino, Italy 9 4 Laboratory of Immunology, Ospedale Maria Vittoria, ASL “Città di Torino”, Torino, Italy. 10 11 Running Head: EBV and HIV in the CSF 12 13 14 #Address correspondence to Tommaso Lupia, [email protected] 15 *Present address: Tommaso Lupia, Unit of Infectious Diseases, Department of Medical Sciences, 16 University of Torino, Amedeo di Savoia Hospital, C.so Svizzera 164, 10149 Torino, Italy 17 18 19 20 Type of article: Original article 21 22 Key words: EBV; HIV; central nervous system; blood brain barrier; trafficking; biomarkers; S-100 23 beta. 24 25 Word count: Total 2097 (Abstract 250) 26 27 Figures: 3 28 29 Tables: 2 30 31 32 Conflicts of Interest and Source of Funding: AC has received honoraria from Abbvie, BMS, Gilead, 33 Janssen-Cilag, MSD, Viiv and he is currently receiving research grants from BMS, Gilead and Viiv.
    [Show full text]
  • Regulation and Genetic Manipulation of Ligands for the Immunoreceptor NKG2D
    Regulation and Genetic Manipulation of Ligands for the Immunoreceptor NKG2D by Benjamin Gregory Gowen A dissertation submitted in partial satisfaction of the requirements for the degree of Doctor of Philosophy in Molecular and Cell Biology in the Graduate Division of the University of California, Berkeley Committee in charge: Professor David H. Raulet, Chair Professor Gregory M. Barton Professor Michael Rape Professor Karsten Gronert Spring 2015 Abstract Regulation and Genetic Manipulation of Ligands for the Immunoreceptor NKG2D by Benjamin Gregory Gowen Doctor of Philosophy in Molecular and Cell Biology University of California, Berkeley Professor David H. Raulet, Chair NKG2D is an important activating receptor expressed by natural killer (NK) cells and some subsets of T cells. NKG2D recognizes a family of cell surface protein ligands that are typically not expressed by healthy cells, but become upregulated by cellular stress associated with transformation or infection. Engagement of NKG2D by its ligands displayed on a target cell membrane leads to NK cell activation, cytokine secretion, and lysis of the target cell. Despite the importance of NKG2D for controlling tumors, the molecular mechanisms driving NKG2D ligand expression on tumor cells are not well defined. The work described in this dissertation was centered on the identification of novel regulators of ULBP1, one of the human NKG2D ligands. Using a forward genetic screen of a tumor-derived human cell line, we identified several novel factors supporting ULBP1 expression, and used the CRISPR/Cas9 system to further investigate these hits. Our results showed stepwise contributions of independent pathways working at multiple stages of ULBP1 biogenesis, including transcription of the ULBP1 gene, splicing of the ULBP1 mRNA, and additional co-translational or post-translational regulation of the ULBP1 protein.
    [Show full text]
  • Human NKG2D-Ligands: Cell Biology Strategies to Ensure Immune Recognition
    REVIEW ARTICLE published: 25 September 2012 doi: 10.3389/fimmu.2012.00299 Human NKG2D-ligands: cell biology strategies to ensure immune recognition Lola Fernández-Messina, HughT. Reyburn and Mar Valés-Gómez* Departamento de Inmunología y Oncología, Centro Nacional de Biotecnología, Consejo Superior de Investigaciones Científicas, Madrid, Spain Edited by: Immune recognition mediated by the activating receptor NKG2D plays an important role Eric Vivier, Centre d’Immunologie de for the elimination of stressed cells, including tumors and virus-infected cells. On the other Marseille-Luminy, France hand, the ligands for NKG2D can also be shed into the sera of cancer patients where they Reviewed by: weaken the immune response by downmodulating the receptor on effector cells, mainly Sophie Caillat-Zucman, Institut National de la Santé et de la NK andT cells. Although both families of NKG2D-ligands, major histocompatibility complex Recherche Médicale, France class I-related chain (MIC) A/B and UL16 binding proteins (ULBPs), are related to MHC Daniela Pende, Istituto Di Ricovero molecules and their expression is increased after stress, many differences are observed e Cura a Carattere Scientifico Azienda Ospedaliera Universitaria San in terms of their biochemical properties and cell trafficking. In this paper, we summarize Martino – Istituto Scientifico Tumori, the variety of NKG2D-ligands and propose that selection pressure has driven evolution of Italy diversity in their trafficking and shedding, but not receptor binding affinity. However, it is *Correspondence: also possible to identify functional properties common to individual ULBP molecules and Mar Valés-Gómez, Departamento de MICA/B alleles, but not generally conserved within the MIC or ULBP families.These charac- Inmunología y Oncología, Centro Nacional de Biotecnología, Consejo teristics likely represent examples of convergent evolution for efficient immune recognition, Superior de Investigaciones but are also attractive targets for pathogen immune evasion strategies.
    [Show full text]
  • NKG2D Ligands in Tumor Immunity
    Oncogene (2008) 27, 5944–5958 & 2008 Macmillan Publishers Limited All rights reserved 0950-9232/08 $32.00 www.nature.com/onc REVIEW NKG2D ligands in tumor immunity N Nausch and A Cerwenka Division of Innate Immunity, German Cancer Research Center, Im Neuenheimer Feld 280, Heidelberg, Germany The activating receptor NKG2D (natural-killer group 2, activated NK cells sharing markers with dendritic cells member D) and its ligands play an important role in the (DCs), which are referred to as natural killer DCs NK, cd þ and CD8 þ T-cell-mediated immune response to or interferon (IFN)-producing killer DCs (Pillarisetty tumors. Ligands for NKG2D are rarely detectable on the et al., 2004; Chan et al., 2006; Taieb et al., 2006; surface of healthy cells and tissues, but are frequently Vosshenrich et al., 2007). In addition, NKG2D is expressed by tumor cell lines and in tumor tissues. It is present on the cell surface of all human CD8 þ T cells. evident that the expression levels of these ligands on target In contrast, in mice, expression of NKG2D is restricted cells have to be tightly regulated to allow immune cell to activated CD8 þ T cells (Ehrlich et al., 2005). In activation against tumors, but at the same time avoid tumor mouse models, NKG2D þ CD8 þ T cells prefer- destruction of healthy tissues. Importantly, it was recently entially accumulate in the tumor tissue (Gilfillan et al., discovered that another safeguard mechanism controlling 2002; Choi et al., 2007), suggesting that the activation via the receptor NKG2D exists. It was shown NKG2D þ CD8 þ T-cell population comprises T cells that NKG2D signaling is coupled to the IL-15 receptor involved in tumor cell recognition.
    [Show full text]
  • Immunoevasin Is Targeted by a Poxvirus MHC Class I-Like Cutting
    Cutting Edge: FcR-Like 5 on Innate B Cells Is Targeted by a Poxvirus MHC Class I-Like Immunoevasin †,‡,x ‡ { Jessica A. Campbell,* Randall S. Davis, Lauren M. Lilly,‖ Daved H. Fremont, Anthony R. French,*,1 and Leonidas N. Carayannopoulos ,1,2 Under selective pressure from host immunity, viruses evasins) must specifically bind one or more host-encoded have retained genes encoding immunoevasins, molecules molecules. In this regard, immunoevasins can be viewed as interfering with host viral recognition and clearance. probes with which the complex network of host-encoded Due to their binding specificities, immunoevasins can proteins can be searched to identify those that are important be exploited as affinity labels to identify host-encoded to defense against the respective class of viruses. molecules of previously unsuspected importance in We previously described an orthopoxvirus MHC class I-like defense against the relevant class of virus. We previously protein (OMCP) encoded by monkeypoxvirus and cowpox- described an orthopoxvirus MHC class I-like protein virus (CPXV) (1). OMCP is secreted from infected cells (OMCP) that binds with high affinity to the activating and binds with high affinity to human and mouse NKG2D, receptor NKG2D on NK and T cell subsets, implicating an activating receptor expressed by NK and T cell subsets. NKG2D in antiorthopoxvirus immunity. In this study, As a soluble NKG2D antagonist, OMCP potently inhibits NKG2D-dependent killing of target cells. These findings we report that OMCP also binds in an NKG2D- strongly implicated NKG2D in host defense against zoonotic independent manner to B cells and monocytes/macro- orthopoxviruses, and this conclusion was recently verified by phages.
    [Show full text]