DOCSLIB.ORG

The Murine Cytomegalovirus Immunoevasin Gp40/M152 Inhibits

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Murine Cytomegalovirus Immunoevasin Gp40/M152 Inhibits The murine cytomegalovirus immunoevasin gp40/m152 inhibits activation of NK cell receptor NKG2D by intracellular retention and cell surface masking of RAE-1g ligand by Natalia Lis a Thesis submitted in partial fulfilment of the requirements for the degree of Doctor of Philosophy in Cell Biology Approved Dissertation Committee ________________________________ Prof. Dr. Sebastian Springer Jacobs University Bremen Prof. Dr. Susanne Illenberger Jacobs University Bremen Prof. Dr. Wolfram Brune Heinrich-Pette-Institut Hamburg Date of Defense: 04.09.2020 Life Sciences & Chemistry 2 Statutory Declaration Family Name, Given/First Name Natalia Lis Matriculation number 20331750 What kind of thesis are you submitting: PhD thesis Bachelor-, Master- or PhD-Thesis English: Declaration of Authorship I hereby declare that the thesis submitted was created and written solely by myself without any external support. Any sources, direct or indirect, are marked as such. I am aware of the fact that the contents of the thesis in digital form may be revised with regard to usage of unauthorized aid as well as whether the whole or parts of it may be identified as plagiarism. I do agree my work to be entered into a database for it to be compared with existing sources, where it will remain in order to enable further comparisons with future theses. This does not grant any rights of reproduction and usage, however. The Thesis has been written independently and has not been submitted at any other university for the conferral of a PhD degree; neither has the thesis been previously published in full. German: Erklärung der Autorenschaft (Urheberschaft) Ich erkläre hiermit, dass die vorliegende Arbeit ohne fremde Hilfe ausschließlich von mir erstellt und geschrieben worden ist. Jedwede verwendeten Quellen, direkter oder indirekter Art, sind als solche kenntlich gemacht worden. Mir ist die Tatsache bewusst, dass der Inhalt der Thesis in digitaler Form geprüft werden kann im Hinblick darauf, ob es sich ganz oder in Teilen um ein Plagiat handelt. Ich bin damit einverstanden, dass meine Arbeit in einer Datenbank eingegeben werden kann, um mit bereits bestehenden Quellen verglichen zu werden und dort auch verbleibt, um mit zukünftigen Arbeiten verglichen werden zu können. Dies berechtigt jedoch nicht zur Verwendung oder Vervielfältigung. Diese Arbeit wurde in der vorliegenden Form weder einer anderen Prüfungsbehörde vorgelegt noch wurde das Gesamtdokument bisher veröffentlicht. Date, Signature 3 This work was funded by Deutsche Forschungsgemeinschaft (SP583/11-1) and by the Tönjes Vagt Foundation of Bremen (XXXII) to Sebastian Springer. 4 Part of this thesis is submitted to JCS peer-reviewed journal 5 Acknowledgments First of all, I would like to express my gratitude to Prof. Sebastian Springer for giving me an opportunity to join your group and work on this exciting and challenging project. You gave me a perfect amount of supervision, guidance, and space to grow professionally. I would like to thank my thesis committee members, Prof. Susanne Illenberger and Prof. Wolfram Brune, for your dedication, time, and effort while reviewing my research work. I would like to thank Springer group current and former members: Swapnil Ghanwat, Ankur Saikia, Raghavendra Anjappa, Britta Borchert, Cindy Dirscherl, Esam Abualrous, Sebastián Montealegre, and Sujit Verma for a great working environment, and especially Ursula Wellbrock for being the most trusted, patient and helpful colleague ever. Special thanks go to Venkat Raman Ramnarayan and Zeynep Hein for teaching me all the methods and scientific approaches necessary to succeed with my work and become a scientist, and endless discussions of my work. Many thanks go to my students, Bersal Williams and Miriam Herbert, for your great help with the project and the chance to improve my teaching skills. The project would not develop so well without much valuable scientific advice from excellent scientists like Dr. Linda Janssen, Dr. Malgorzata Garstka, Dr. Susanne Fritzsche, Dr. Anne Halenius, Dr. Benedict Chambers, Prof. Martin Messerle, and Prof. Hartmut Hengel. Thank you for all your input. I would like to thank my friends in Bremen for their company and all the fun we had during the past five years. I enjoyed each of our meetings and celebrations together. You made this time very joyful and precious. This time would be extremely difficult without the support and encouragement from my awesome mum Jola and my super-smart sister Paulina. Dziękuję! Finally, I would like to thank Pawel for being a supportive, patient, and wonderful partner throughout this time. 6 Abstract NKG2D is a crucial Natural Killer (NK) cell activating receptor, and the murine cytomegalovirus (MCMV) employs multiple immunoevasins in order to avoid NKG2D-mediated activation. One of the MCMV immunoevasins, gp40 (m152), downregulates the cell surface NKG2D ligand, RAE-1g, thus limiting NK cell activation. My study establishes the molecular mechanism by which gp40 retains RAE-1g in the secretory pathway. Using flow cytometry and pulse chase analysis, I demonstrate that gp40 retains RAE-1g in the early secretory pathway, and that this effect depends on the binding of gp40 to a host protein, TMED10, a member of the p24 protein family. I also show that the TMED10-based retention mechanism can be saturated, and that gp40 has a backup mechanism as it masks RAE-1g on the cell surface, blocking the interaction with the NKG2D receptor and thus NK cell activation. 7 List of abbreviations ADAM - A disintegrin and metalloprotease ADCC - Antibody-dependent cellular cytotoxicity AUF1 - AU-rich element RNA-binding protein 1 BiP - Binding immunoglobulin protein cGAMP - Cyclic guanosine monophosphate–adenosine monophosphate cGAS - Cyclic GMP-AMP synthase, cGAMP synthase CK2 - Casein kinase 2 CLP - Common lymphoid progenitors COP - Coat protein complex DAF - Decay-accelerating factor DAMP - Damage-associated molecular pattern DAP - Disulphide adaptor molecule EGFR - Epidermal growth factor receptor ERGIC - ER-Golgi intermediate compartment FasL - Fas ligand GM-CSF - Granulocyte–macrophage colony-stimulating factor GOLD - Golgi dynamic (domain) gp40LM - gp40 linker mutant gp40WT - gp40 wild type GPCR - G-protein-coupled receptors GPI - Glycosylphosphatidylinositol (anchor) H60 - Histocompatibility antigen 60 HCMV - Human cytomegalovirus HDAC3 - Histone deacetylase 3 hpi - Hours post infection IE - Immediate early genes IL - Interleukin ILC - Innate lymphoid cells IMP3 - Insulin-like growth factor 2 mRNA-binding protein 3 INF - Interferon IRF3 - Interferon regulatory factor 3 ITAM - Immunoreceptor tyrosine-based activation motif KIR - Killer-cell immunoglobulin-like receptors Klrk1 - Killer Cell Lectin Like Receptor K1 (gene) LAMP-1 - Lysosomal-Associated Membrane Protein-1 LPS - Lipopolisacharide MCMV - Mouse cytomegalovirus metastamiR, miR - Metastasis-associated miRNA MICA/B - MHC class I polypeptide–related sequences A/B 8 MMP - Matrix metalloproteinase MULT-1 - Murine UL16-binding protein-like transcript-1 NCAM - Neural cell adhesion molecule ? NF-kB - Nuclear Factor kappa-light-chain-enhancer of activated B cells NK cell - Natural killer (cell) NKC - NK gene complex NKG2D-L - Long NKG2DR isoform NKG2D-S - Short NKG2DR isoform NKG2DL - NKG2D ligands NKG2DR - NKG2D receptor ORF - Open reading frames PAMP - Pathogen-associated molecular pattern PI3K - Phosphatidylinositol 3-kinase PLC - Peptide loading complex RAE-1 - Retinoic acid early-inducible protein 1 RBP - RNA binding protein SLT - Secondary lymphoid tissues SNP - Single nucleotide polymorphism SPR - Surface plasmon resonance STING - Stimulator of interferon genes STR - Short tandem repeat SV - Sedimentation velocity ultracentrifugation TBK1 - TANK Binding Kinase 1 TCR - T cell receptor TLR - Toll like receptor TNF - Tumor necrosis factor TRAIL - TNF-related apoptosis-inducing ligand UL - Unique long (region of the HCMV genome) ULBP - UL16-binding protein US - Unique short (region of the HCMV genome) VAC - Viral assembly compartment vICA - Viral Inhibitor of Caspase-8 Activation YINM - Tyrosine-based motif 9 List of figures Figure 1-1. Cytomegalovirus genome organization ........................................... 19 Figure 1-2. RAE-1g amino acid sequence. ........................................................... 36 Figure 1-3. Overview of human and mouse immunoevasins that target NKG2D ligands. ................................................................................................................... 40 Figure 1-4. Amino acid sequence of gp40. .......................................................... 46 Figure 1-5. Amino acid sequence alignment of RAE-1 isoforms. ..................... 51 Figure 1-6. Crystal structures of NKG2D ligands, NKG2D receptor, HCMV and MCMV immunoevasins, and mouse MHC class I H-2Kb. .................................... 53 Figure 1-7. Enrichment of p24 proteins at the cell surface and in the whole cell lysate during HCMV infection (176). ..................................................................... 61 Figure 3-1. Mouse and human NKG2D ligands. .................................................. 89 Figure 3-2 . gp40 retains murine MHC class I proteins in the early secretory pathway. .................................................................................................................. 92 Figure 3-3. Intracellular retention of class I depends on the binding of the gp40 linker to TMED10. ..................................................................................................
Load more

Recommended publications
  • Pathogen Receptor Discovery with a Microfluidic Human Membrane Protein Array
    Pathogen receptor discovery with a microfluidic human membrane protein array Yair Glicka,1,Ya’ara Ben-Aria,1, Nir Draymanb, Michal Pellacha, Gregory Neveuc,d, Jim Boonyaratanakornkitc,d, Dorit Avrahamia, Shirit Einavc,d, Ariella Oppenheimb, and Doron Gerbera,2 aMina and Everard Goodman Faculty of Life Sciences, Bar Ilan University, 5290002, Israel; bFaculty of Medicine, Hebrew University, Jerusalem, 9112001, Israel; cDepartment of Medicine, Division of Infectious Diseases and Geographic Medicine, Stanford University School of Medicine, Stanford, CA 94305; and dDepartment of Microbiology and Immunology, Stanford University School of Medicine, Stanford, CA 94305 Edited by Stephen R. Quake, Stanford University, Stanford, CA, and approved March 1, 2016 (received for review September 20, 2015) The discovery of how a pathogen invades a cell requires one to and translate into proteins in situ (10, 11). This approach has determine which host cell receptors are exploited. This determina- enabled the study of the Pseudomonas aeruginosa outer mem- tion is a challenging problem because the receptor is invariably a brane protein for immunity (12). membrane protein, which represents an Achilles heel in proteomics. Combining integrated microfluidics with microarrays and We have developed a universal platform for high-throughput ex- in vitro transcription and translation (TNT) systems may over- – pression and interaction studies of membrane proteins by creating a come all of the above mentioned difficulties (Fig. 1A) (13 16). microfluidic-based comprehensive human membrane protein array The integrated microfluidic device allows smart liquid manage- (MPA). The MPA is, to our knowledge, the first of its kind and offers ment in very low volumes, partitioning, and process integration a powerful alternative to conventional proteomics by enabling the (i.e., protein expression, immobilization, and interaction exper- simultaneous study of 2,100 membrane proteins.
    [Show full text]
  • NK Cell Memory to Cytomegalovirus: Implications for Vaccine Development
    Review NK Cell Memory to Cytomegalovirus: Implications for Vaccine Development Calum Forrest 1 , Ariane Gomes 1 , Matthew Reeves 1,* and Victoria Male 2,* 1 Institute of Immunity & Transplantation, UCL, Royal Free Campus, London NW3 2PF, UK; [email protected] (C.F.); [email protected] (A.G.) 2 Department of Metabolism, Digestion and Reproduction, Imperial College London, Chelsea and Westminster Campus, London SW10 9NH, UK * Correspondence: [email protected] (M.R.); [email protected] (V.M.) Received: 24 June 2020; Accepted: 15 July 2020; Published: 20 July 2020 Abstract: Natural killer (NK) cells are innate lymphoid cells that recognize and eliminate virally-infected and cancerous cells. Members of the innate immune system are not usually considered to mediate immune memory, but over the past decade evidence has emerged that NK cells can do this in several contexts. Of these, the best understood and most widely accepted is the response to cytomegaloviruses, with strong evidence for memory to murine cytomegalovirus (MCMV) and several lines of evidence suggesting that the same is likely to be true of human cytomegalovirus (HCMV). The importance of NK cells in the context of HCMV infection is underscored by the armory of NK immune evasion genes encoded by HCMV aimed at subverting the NK cell immune response. As such, ongoing studies that have utilized HCMV to investigate NK cell diversity and function have proven instructive. Here, we discuss our current understanding of NK cell memory to viral infection with a focus on the response to cytomegaloviruses. We will then discuss the implications that this will have for the development of a vaccine against HCMV with particular emphasis on how a strategy that can harness the innate immune system and NK cells could be crucial for the development of a vaccine against this high-priority pathogen.
    [Show full text]
  • Case of the Anti HIV-1 Antibody, B12
    Spectrum of Somatic Hypermutations and Implication on Antibody Function: Case of the anti HIV-1 antibody, b12 Mesfin Mulugeta Gewe A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy University of Washington 2015 Reading Committee: Roland Strong, Chair Nancy Maizels Jessica A. Hamerman Program Authorized to Offer Degree: Molecular and Cellular Biology i ii ©Copyright 2015 Mesfin Mulugeta Gewe iii University of Washington Abstract Spectrum of Somatic Hypermutations and Implication on Antibody Function: Case of the anti HIV-1 antibody, b12 Mesfin Mulugeta Gewe Chair of the Supervisory Committee: Roland Strong, Full Member Fred Hutchinson Cancer Research Center Sequence diversity, ability to evade immune detection and establishment of human immunodeficiency virus type 1 (HIV-1) latent reservoirs present a formidable challenge to the development of an HIV-1 vaccine. Structure based vaccine design stenciled on infection elicited broadly neutralizing antibodies (bNAbs) is a promising approach, in some measure to circumvent existing challenges. Understanding the antibody maturation process and importance of the high frequency mutations observed in anti-HIV-1 broadly neutralizing antibodies are imperative to the success of structure based vaccine immunogen design. Here we report a biochemical and structural characterization for the affinity maturation of infection elicited neutralizing antibodies IgG1 b12 (b12). We investigated the importance of affinity maturation and mutations accumulated therein in overall antibody function and their potential implications to vaccine development. Using a panel of point iv reversions, we examined relevance of individual amino acid mutations acquired during the affinity maturation process to deduce the role of somatic hypermutation in antibody function.
    [Show full text]
  • The T Cell Repertoire Specific for the IE-1 Protein of Human Cytomegalovirus: Diversity, Function and Evasion
    Dissertation zur Erlangung des Doktorgrades der Fakultät für Chemie und Pharmazie der Ludwig-Maximilians-Universität München The T cell repertoire specific for the IE-1 protein of human cytomegalovirus: diversity, function and evasion von Stefanie Maria Ameres aus Deggendorf, Deutschland 2012 Erklärung Diese Dissertation wurde im Sinne von §7 der Promotionsordnung vom 28. November 2011 von Herrn Prof. Dr. Wolfgang Hammerschmidt betreut und von Herrn Prof. Dr. Horst Domdey vor der Fakultät für Chemie und Pharmazie vertreten. Eidesstattliche Versicherung Diese Dissertation wurde eigenständig und ohne unerlaubte Hilfe erarbeitet. München, den 03.07.2012 Stefanie Ameres Dissertation eingereicht am 03.07.2012 1. Gutachter: Prof. Dr. Horst Domdey 2. Gutachter: Prof. Dr. Wolfgang Hammerschmidt Mündliche Prüfung am 28.01.2013 Teile dieser Arbeit werden/wurden wie folgt veröffentlicht: Ameres, S., J. Mautner, F. Schlott, M. Neuenhahn, D.H. Busch, B. Plachter, and A. Moosmann. Antigen Presentation to an Immunodominant Population of HLA-C-Restricted T Cells Resists Cytomegalovirus Immunoevasion. 2nd revision PLOS Pathogens Hesse, J., S. Ameres, K. Besold, S. Krauter, A. Moosmann, and B. Plachter. Suppression of CD8+ T-cell recognition in the immediate-early phase of human cytomegalovirus infection. Epub oct 2012. J. Gen. Virol. Teile dieser Arbeit wurden im Rahmen der Dissertation wie folgt präsentiert: May 3rd–4th, 2012 DFG SFB-TR36 Symposium "Adoptive T Cell Therapy" Berlin, Germany Talk: "CD8+ T cells overcome HCMV immunoevasion dependent on their HLA restriction" Dec. 5th–7th, 2011 DFG SFB-TR36 Retreat "Principles and Applications of Wildbad Kreuth, Adoptive T Cell therapy" Germany Talk: "CD8+ T cells defeat HCMV immunoevasins dependent on MHC restriction" May 14th–17th, 2011 13th International CMV/Betaherpesvirus Workshop Nürnberg, Germany Poster 1: "Preferential T cell control of HCMV infection through HLA-C" Poster 2: "HCMV IE-1 is recognized by a diverse repertoire of CD4+ Tcells" Oct.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Structural Basis of Mouse Cytomegalovirus M152/Gp40 Interaction with Rae1γ Reveals a Paradigm for MHC/MHC Interaction in Immune
    Structural basis of mouse cytomegalovirus m152/gp40 PNAS PLUS interaction with RAE1γ reveals a paradigm for MHC/MHC interaction in immune evasion Rui Wanga, Kannan Natarajana, Maria Jamela R. Revillezaa, Lisa F. Boyda, Li Zhia,1, Huaying Zhaob, Howard Robinsonc, and David H. Marguliesa,2 aMolecular Biology Section, Laboratory of Immunology, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892; bDynamics of Macromolecular Assembly Section, Laboratory of Cellular Imaging and Macromolecular Biophysics, National Institute of Biomolecular Imaging and Bioengineering, National Institutes of Health, Bethesda, MD 20892; and cNational Synchrotron Light Source, Brookhaven National Laboratories, Upton, NY 11973 Edited by K. Christopher Garcia, Stanford University, Stanford, CA, and approved October 24, 2012 (received for review August 17, 2012) Natural killer (NK) cells are activated by engagement of the NKG2D NKG2D ligands, we examined the binding of the MCMV m152 receptor with ligands on target cells stressed by infection or glycoprotein to its RAE1 ligands. Our previous studies investigated tumorigenesis. Several human and rodent cytomegalovirus (CMV) the quantitative interaction of m152 with different RAE1 isoforms immunoevasins down-regulate surface expression of NKG2D (21). Here we report the X-ray structure of the complex of m152 ligands. The mouse CMV MHC class I (MHC-I)–like m152/gp40 glyco- with RAE1γ, the confirmation of the intermolecular contacts protein down-regulates retinoic acid early inducible-1 (RAE1) observed in the crystal structure by site-directed mutagenesis and NKG2D ligands as well as host MHC-I. Here we describe the crystal in vitro binding assays, a comparison of the binding of m152 to structure of an m152/RAE1γ complex and confirm the intermolec- RAE1 and of NKG2D to RAE1, and the functional effects of ular contacts by mutagenesis.
    [Show full text]
  • Supporting Information
    Supporting Information Edgar et al. 10.1073/pnas.1601895113 SI Methods (Actimetrics), and recordings were analyzed using LumiCycle Mice. Sample size was determined using the resource equation: Data Analysis software (Actimetrics). E (degrees of freedom in ANOVA) = (total number of exper- – Cell Cycle Analysis of Confluent Cell Monolayers. NIH 3T3, primary imental animals) (number of experimental groups), with −/− sample size adhering to the condition 10 < E < 20. For com- WT, and Bmal1 fibroblasts were sequentially transduced − − parison of MuHV-4 and HSV-1 infection in WT vs. Bmal1 / with lentiviral fluorescent ubiquitin-based cell cycle indicators mice at ZT7 (Fig. 2), the investigator did not know the genotype (FUCCI) mCherry::Cdt1 and amCyan::Geminin reporters (32). of the animals when conducting infections, bioluminescence Dual reporter-positive cells were selected by FACS (Influx Cell imaging, and quantification. For bioluminescence imaging, Sorter; BD Biosciences) and seeded onto 35-mm dishes for mice were injected intraperitoneally with endotoxin-free lucif- subsequent analysis. To confirm that expression of mCherry:: Cdt1 and amCyan::Geminin correspond to G1 (2n DNA con- erin (Promega E6552) using 2 mg total per mouse. Following < ≤ anesthesia with isofluorane, they were scanned with an IVIS tent) and S/G2 (2 n 4 DNA content) cell cycle phases, Lumina (Caliper Life Sciences), 15 min after luciferin admin- respectively, cells were stained with DNA dye DRAQ5 (abcam) and analyzed by flow cytometry (LSR-Fortessa; BD Biosci- istration. Signal intensity was quantified using Living Image ences). To examine dynamics of replicative activity under ex- software (Caliper Life Sciences), obtaining maximum radiance perimental confluent conditions, synchronized FUCCI reporter for designated regions of interest (photons per second per − − − monolayers were observed by time-lapse live cell imaging over square centimeter per Steradian: photons·s 1·cm 2·sr 1), relative 3 d (Nikon Eclipse Ti-E inverted epifluorescent microscope).
    [Show full text]
  • S41467-020-18249-3.Pdf
    ARTICLE https://doi.org/10.1038/s41467-020-18249-3 OPEN Pharmacologically reversible zonation-dependent endothelial cell transcriptomic changes with neurodegenerative disease associations in the aged brain Lei Zhao1,2,17, Zhongqi Li 1,2,17, Joaquim S. L. Vong2,3,17, Xinyi Chen1,2, Hei-Ming Lai1,2,4,5,6, Leo Y. C. Yan1,2, Junzhe Huang1,2, Samuel K. H. Sy1,2,7, Xiaoyu Tian 8, Yu Huang 8, Ho Yin Edwin Chan5,9, Hon-Cheong So6,8, ✉ ✉ Wai-Lung Ng 10, Yamei Tang11, Wei-Jye Lin12,13, Vincent C. T. Mok1,5,6,14,15 &HoKo 1,2,4,5,6,8,14,16 1234567890():,; The molecular signatures of cells in the brain have been revealed in unprecedented detail, yet the ageing-associated genome-wide expression changes that may contribute to neurovas- cular dysfunction in neurodegenerative diseases remain elusive. Here, we report zonation- dependent transcriptomic changes in aged mouse brain endothelial cells (ECs), which pro- minently implicate altered immune/cytokine signaling in ECs of all vascular segments, and functional changes impacting the blood–brain barrier (BBB) and glucose/energy metabolism especially in capillary ECs (capECs). An overrepresentation of Alzheimer disease (AD) GWAS genes is evident among the human orthologs of the differentially expressed genes of aged capECs, while comparative analysis revealed a subset of concordantly downregulated, functionally important genes in human AD brains. Treatment with exenatide, a glucagon-like peptide-1 receptor agonist, strongly reverses aged mouse brain EC transcriptomic changes and BBB leakage, with associated attenuation of microglial priming. We thus revealed tran- scriptomic alterations underlying brain EC ageing that are complex yet pharmacologically reversible.
    [Show full text]
  • ULBP2 (NM 025217) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG204506 ULBP2 (NM_025217) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: ULBP2 (NM_025217) Human Tagged ORF Clone Tag: TurboGFP Symbol: ULBP2 Synonyms: ALCAN-alpha; N2DL2; NKG2DL2; RAET1H; RAET1L Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RG204506 representing NM_025217 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCAGCAGCCGCCGCTACCAAGATCCTTCTGTGCCTCCCGCTTCTGCTCCTGCTGTCCGGCTGGTCCC GGGCTGGGCGAGCCGACCCTCACTCTCTTTGCTATGACATCACCGTCATCCCTAAGTTCAGACCTGGACC ACGGTGGTGTGCGGTTCAAGGCCAGGTGGATGAAAAGACTTTTCTTCACTATGACTGTGGCAACAAGACA GTCACACCTGTCAGTCCCCTGGGGAAGAAACTAAATGTCACAACGGCCTGGAAAGCACAGAACCCAGTAC TGAGAGAGGTGGTGGACATACTTACAGAGCAACTGCGTGACATTCAGCTGGAGAATTACACACCCAAGGA ACCCCTCACCCTGCAGGCCAGGATGTCTTGTGAGCAGAAAGCTGAAGGACACAGCAGTGGATCTTGGCAG TTCAGTTTCGATGGGCAGATCTTCCTCCTCTTTGACTCAGAGAAGAGAATGTGGACAACGGTTCATCCTG GAGCCAGAAAGATGAAAGAAAAGTGGGAGAATGACAAGGTTGTGGCCATGTCCTTCCATTACTTCTCAAT GGGAGACTGTATAGGATGGCTTGAGGACTTCTTGATGGGCATGGACAGCACCCTGGAGCCAAGTGCAGGA GCACCACTCGCCATGTCCTCAGGCACAACCCAACTCAGGGCCACAGCCACCACCCTCATCCTTTGCTGCC TCCTCATCATCCTCCCCTGCTTCATCCTCCCTGGCATC ACGCGTACGCGGCCGCTCGAG - GFP Tag - GTTTAA This product is to be used for laboratory only.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Aneuploidy: Using Genetic Instability to Preserve a Haploid Genome?
    Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Science (Cancer Biology) Aneuploidy: Using genetic instability to preserve a haploid genome? Submitted by: Ramona Ramdath In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Science Examination Committee Signature/Date Major Advisor: David Allison, M.D., Ph.D. Academic James Trempe, Ph.D. Advisory Committee: David Giovanucci, Ph.D. Randall Ruch, Ph.D. Ronald Mellgren, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: April 10, 2009 Aneuploidy: Using genetic instability to preserve a haploid genome? Ramona Ramdath University of Toledo, Health Science Campus 2009 Dedication I dedicate this dissertation to my grandfather who died of lung cancer two years ago, but who always instilled in us the value and importance of education. And to my mom and sister, both of whom have been pillars of support and stimulating conversations. To my sister, Rehanna, especially- I hope this inspires you to achieve all that you want to in life, academically and otherwise. ii Acknowledgements As we go through these academic journeys, there are so many along the way that make an impact not only on our work, but on our lives as well, and I would like to say a heartfelt thank you to all of those people: My Committee members- Dr. James Trempe, Dr. David Giovanucchi, Dr. Ronald Mellgren and Dr. Randall Ruch for their guidance, suggestions, support and confidence in me. My major advisor- Dr. David Allison, for his constructive criticism and positive reinforcement.
    [Show full text]
  • Analysis of the Indacaterol-Regulated Transcriptome in Human Airway
    Supplemental material to this article can be found at: http://jpet.aspetjournals.org/content/suppl/2018/04/13/jpet.118.249292.DC1 1521-0103/366/1/220–236$35.00 https://doi.org/10.1124/jpet.118.249292 THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS J Pharmacol Exp Ther 366:220–236, July 2018 Copyright ª 2018 by The American Society for Pharmacology and Experimental Therapeutics Analysis of the Indacaterol-Regulated Transcriptome in Human Airway Epithelial Cells Implicates Gene Expression Changes in the s Adverse and Therapeutic Effects of b2-Adrenoceptor Agonists Dong Yan, Omar Hamed, Taruna Joshi,1 Mahmoud M. Mostafa, Kyla C. Jamieson, Radhika Joshi, Robert Newton, and Mark A. Giembycz Departments of Physiology and Pharmacology (D.Y., O.H., T.J., K.C.J., R.J., M.A.G.) and Cell Biology and Anatomy (M.M.M., R.N.), Snyder Institute for Chronic Diseases, Cumming School of Medicine, University of Calgary, Calgary, Alberta, Canada Received March 22, 2018; accepted April 11, 2018 Downloaded from ABSTRACT The contribution of gene expression changes to the adverse and activity, and positive regulation of neutrophil chemotaxis. The therapeutic effects of b2-adrenoceptor agonists in asthma was general enriched GO term extracellular space was also associ- investigated using human airway epithelial cells as a therapeu- ated with indacaterol-induced genes, and many of those, in- tically relevant target. Operational model-fitting established that cluding CRISPLD2, DMBT1, GAS1, and SOCS3, have putative jpet.aspetjournals.org the long-acting b2-adrenoceptor agonists (LABA) indacaterol, anti-inflammatory, antibacterial, and/or antiviral activity. Numer- salmeterol, formoterol, and picumeterol were full agonists on ous indacaterol-regulated genes were also induced or repressed BEAS-2B cells transfected with a cAMP-response element in BEAS-2B cells and human primary bronchial epithelial cells by reporter but differed in efficacy (indacaterol $ formoterol .
    [Show full text]