DOCSLIB.ORG

Regulation and Genetic Manipulation of Ligands for the Immunoreceptor NKG2D

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Regulation and Genetic Manipulation of Ligands for the Immunoreceptor NKG2D Regulation and Genetic Manipulation of Ligands for the Immunoreceptor NKG2D by Benjamin Gregory Gowen A dissertation submitted in partial satisfaction of the requirements for the degree of Doctor of Philosophy in Molecular and Cell Biology in the Graduate Division of the University of California, Berkeley Committee in charge: Professor David H. Raulet, Chair Professor Gregory M. Barton Professor Michael Rape Professor Karsten Gronert Spring 2015 Abstract Regulation and Genetic Manipulation of Ligands for the Immunoreceptor NKG2D by Benjamin Gregory Gowen Doctor of Philosophy in Molecular and Cell Biology University of California, Berkeley Professor David H. Raulet, Chair NKG2D is an important activating receptor expressed by natural killer (NK) cells and some subsets of T cells. NKG2D recognizes a family of cell surface protein ligands that are typically not expressed by healthy cells, but become upregulated by cellular stress associated with transformation or infection. Engagement of NKG2D by its ligands displayed on a target cell membrane leads to NK cell activation, cytokine secretion, and lysis of the target cell. Despite the importance of NKG2D for controlling tumors, the molecular mechanisms driving NKG2D ligand expression on tumor cells are not well defined. The work described in this dissertation was centered on the identification of novel regulators of ULBP1, one of the human NKG2D ligands. Using a forward genetic screen of a tumor-derived human cell line, we identified several novel factors supporting ULBP1 expression, and used the CRISPR/Cas9 system to further investigate these hits. Our results showed stepwise contributions of independent pathways working at multiple stages of ULBP1 biogenesis, including transcription of the ULBP1 gene, splicing of the ULBP1 mRNA, and additional co-translational or post-translational regulation of the ULBP1 protein. One of the novel regulators of ULBP1 we identified was ATF4, a stress-induced transcription factor. ATF4 drives the constitutive expression of ULBP1 on some cancer cell lines and causes further upregulation of ULBP1 in response to stresses such as amino acid starvation or activation of the unfolded protein response. We found that ATF4 drives ULBP1 transcription by binding directly to the ULBP1 locus. The screen also identified the RNA-binding protein RBM4 as a driver of ULBP1 expression. Analysis of RBM4-deficient cells revealed that RBM4 suppresses a novel alternative splicing event in the ULBP1 transcript. The alternative isoform of ULBP1 mRNA is unlikely to encode a functional protein. As such, RBM4 supports ULBP1 expression by promoting the splicing of the functional mRNA isoform. This dissertation also describes the use of the CRISPR/Cas9 methodology to generate mice lacking two key NKG2D ligands, RAE-1ε and RAE-1δ. These mice are being used by other lab members to test hypotheses concerning regulation of NK cell activation imparted by RAE-1 expression on host cells within tumors. Additionally, these mice will soon be used to generate mice lacking all known NKG2D ligands. 1 The findings presented here highlight diverse mechanisms for the control of NKG2D ligand expression, and offer insight into the stress pathways that alert the immune system to danger. Furthermore, this work demonstrates the power of forward genetic screens and the CRISPR/Cas9 system for both discovery- and hypothesis-driven research. 2 Table of Contents Table of Contents ............................................................................................................................. i List of Figures and Tables............................................................................................................... ii Acknowledgements ........................................................................................................................ iv Chapter 1: Introduction ................................................................................................................1 Introduction to the immune system......................................................................................2 Natural killer cells ................................................................................................................3 NKG2D and its ligands ........................................................................................................4 Cell stress pathways and ATF4............................................................................................8 Chapter 2: Methodology..............................................................................................................12 Chapter 3: Identification of novel regulators of ULBP1 ..........................................................24 A genetic screen to identify regulators of human NKG2D ligand expression ..................25 Stepwise regulation of ULBP1 expression ........................................................................37 HSPA13 .............................................................................................................................37 SPCS1 and SPCS2 .............................................................................................................39 CRNKL1 ............................................................................................................................39 Genes involved in glycosylation ........................................................................................40 Functional assays ...............................................................................................................40 Failure of the ULBP2 screen..............................................................................................45 Discussion ..........................................................................................................................47 Chapter 4: Regulation of ULBP1 transcription by ATF4 ........................................................48 ATF4 supports ULBP1 expression on multiple tumor-derived cell lines ..........................49 ATF4 drives ULBP1 transcription in response to cell stress .............................................49 Additional treatments that may induce ULBP1 .................................................................63 Discussion ..........................................................................................................................67 Chapter 5: Regulation of ULBP1 mRNA splicing by RBM4 ...................................................69 Results ................................................................................................................................70 Discussion ..........................................................................................................................77 Chapter 6: Generation of Raet1 knockout mice ........................................................................79 Introduction ........................................................................................................................80 Generation of mutant mice, genotyping, and propagation of founders .............................81 Discussion ..........................................................................................................................86 Chapter 7: Conclusion .................................................................................................................87 References .....................................................................................................................................89 i List of Figures and Tables Figure 1-1: NKG2D ligands in humans and mice ...........................................................................5 Figure 2-1: Sequences of CRISPR/Cas9 target sites in HAP1 cells ..............................................15 Table 2-1: sgRNA sequences .........................................................................................................16 Table 2-2: PCR primers used to detect mutations .........................................................................17 Table 2-3: Primers used for qPCR .................................................................................................19 Table 2-4: Raet1 genotyping PCR primers ....................................................................................23 Figure 3-1: Expression of NKG2D ligands on HAP1 cells ...........................................................27 Figure 3-2: Genetic screens for drivers of ULBP1 and ULBP2 expression ..................................28 Table 3-1: List of genes enriched for gene-trap insertions in the ULBP1 screen ..........................30 Table 3-2: List of genes enriched for gene-trap insertions in the ULBP2 screen ..........................31 Figure 3-3: Target gene mutagenesis with the CRISPR/Cas9 system ...........................................33 Figure 3-4: Decreased ULBP1 expression upon loss of identified drivers ....................................35 Figure 3-5: Mutations specifically affect ULBP1 ..........................................................................36 Figure 3-6: Double and triple-mutant cell lines show stepwise decrease in ULBP1 expression ......................................................................................................38 Figure 3-7: Killing of HAP1 cells by activated mouse NK cells is primarily NKG2D-independent ..................................................................................................42 Figure 3-8: ATF4 KO HAP1 cells
Load more

Recommended publications
  • NKG2D Signaling Within the Pancreatic Islets Reduces NOD Diabetes and Increases Protective Central Memory CD81 T-Cell Numbers
    Diabetes Volume 69, August 2020 1749 NKG2D Signaling Within the Pancreatic Islets Reduces NOD Diabetes and Increases Protective Central Memory CD81 T-Cell Numbers Andrew P. Trembath,1 Kelsey L. Krausz,1 Neekun Sharma,1 Ivan C. Gerling,2 Clayton E. Mathews,3 and Mary A. Markiewicz1 Diabetes 2020;69:1749–1762 | https://doi.org/10.2337/db19-0979 NKG2D is implicated in autoimmune diabetes. How- The immune receptor NKG2D, expressed by natural killer ever, the role of this receptor in diabetes pathogenesis (NK) cells and subsets of T cells (1–5), is implicated in type IMMUNOLOGY AND TRANSPLANTATION is unclear owing to conflicting results with studies in- 1 diabetes development. However, its role in disease pro- volving global inhibition of NKG2D signaling. We found gression remains unclear, with conflicting reports describ- that NKG2D and its ligands are present in human pan- ing pathogenic (6,7), nonpathogenic (8), and protective (9) creata, with expression of NKG2D and its ligands in- effects of NKG2D signaling. creased in the islets of patients with type 1 diabetes. NKG2D recognizes multiple NKG2D ligands in both To directly assess the role of NKG2D in the pancreas, we humans and mice. These are endogenous ligands, which generated NOD mice that express an NKG2D ligand in are all distantly related to MHC class I in sequence, and are b-islet cells. Diabetes was reduced in these mice. The generally believed to be functionally redundant (10,11). reduction corresponded with a decrease in the effector 1 NKG2D ligands are considered stress ligands, with their to central memory CD8 T-cell ratio.
    [Show full text]
  • Delineation of Natural Killer Cell Differentiation from Myeloid Progenitors in Human
    Delineation of Natural Killer Cell Differentiation from Myeloid Progenitors in Human The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation Chen, Qingfeng, Weijian Ye, Wei Jian Tan, Kylie Su Mei Yong, Min Liu, Shu Qi Tan, Eva Loh, et al. “Delineation of Natural Killer Cell Differentiation from Myeloid Progenitors in Human.” Scientific Reports 5 (October 12, 2015): 15118. As Published http://dx.doi.org/10.1038/srep15118 Publisher Nature Publishing Group Version Final published version Citable link http://hdl.handle.net/1721.1/100500 Terms of Use Creative Commons Attribution Detailed Terms http://creativecommons.org/licenses/by/4.0/ www.nature.com/scientificreports OPEN Delineation of Natural Killer Cell Differentiation from Myeloid Progenitors in Human Received: 01 July 2015 1,* 2,3,* 2 1 1 4 Accepted: 16 September 2015 Qingfeng Chen , Weijian Ye , Wei Jian Tan , Kylie Su Mei Yong , Min Liu , Shu Qi Tan , 5 5,6 4,6 2,3 2,7 Published: 12 October 2015 Eva Loh , Kenneth TE Chang , Thiam Chye Tan , Peter R Preiser & Jianzhu Chen Understanding of natural killer (NK) cell development in human is incomplete partly because of limited access to appropriate human tissues. We have developed a cytokine-enhanced humanized mouse model with greatly improved reconstitution and function of human NK cells. Here we report the presence of a cell population in the bone marrow of the cytokine-treated humanized mice that express both NK cell marker CD56 and myeloid markers such as CD36 and CD33. The CD56+CD33+CD36+ cells are also found in human cord blood, fetal and adult bone marrow.
    [Show full text]
  • ULBP2 (NM 025217) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG204506 ULBP2 (NM_025217) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: ULBP2 (NM_025217) Human Tagged ORF Clone Tag: TurboGFP Symbol: ULBP2 Synonyms: ALCAN-alpha; N2DL2; NKG2DL2; RAET1H; RAET1L Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RG204506 representing NM_025217 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCAGCAGCCGCCGCTACCAAGATCCTTCTGTGCCTCCCGCTTCTGCTCCTGCTGTCCGGCTGGTCCC GGGCTGGGCGAGCCGACCCTCACTCTCTTTGCTATGACATCACCGTCATCCCTAAGTTCAGACCTGGACC ACGGTGGTGTGCGGTTCAAGGCCAGGTGGATGAAAAGACTTTTCTTCACTATGACTGTGGCAACAAGACA GTCACACCTGTCAGTCCCCTGGGGAAGAAACTAAATGTCACAACGGCCTGGAAAGCACAGAACCCAGTAC TGAGAGAGGTGGTGGACATACTTACAGAGCAACTGCGTGACATTCAGCTGGAGAATTACACACCCAAGGA ACCCCTCACCCTGCAGGCCAGGATGTCTTGTGAGCAGAAAGCTGAAGGACACAGCAGTGGATCTTGGCAG TTCAGTTTCGATGGGCAGATCTTCCTCCTCTTTGACTCAGAGAAGAGAATGTGGACAACGGTTCATCCTG GAGCCAGAAAGATGAAAGAAAAGTGGGAGAATGACAAGGTTGTGGCCATGTCCTTCCATTACTTCTCAAT GGGAGACTGTATAGGATGGCTTGAGGACTTCTTGATGGGCATGGACAGCACCCTGGAGCCAAGTGCAGGA GCACCACTCGCCATGTCCTCAGGCACAACCCAACTCAGGGCCACAGCCACCACCCTCATCCTTTGCTGCC TCCTCATCATCCTCCCCTGCTTCATCCTCCCTGGCATC ACGCGTACGCGGCCGCTCGAG - GFP Tag - GTTTAA This product is to be used for laboratory only.
    [Show full text]
  • Analysis of the Indacaterol-Regulated Transcriptome in Human Airway
    Supplemental material to this article can be found at: http://jpet.aspetjournals.org/content/suppl/2018/04/13/jpet.118.249292.DC1 1521-0103/366/1/220–236$35.00 https://doi.org/10.1124/jpet.118.249292 THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS J Pharmacol Exp Ther 366:220–236, July 2018 Copyright ª 2018 by The American Society for Pharmacology and Experimental Therapeutics Analysis of the Indacaterol-Regulated Transcriptome in Human Airway Epithelial Cells Implicates Gene Expression Changes in the s Adverse and Therapeutic Effects of b2-Adrenoceptor Agonists Dong Yan, Omar Hamed, Taruna Joshi,1 Mahmoud M. Mostafa, Kyla C. Jamieson, Radhika Joshi, Robert Newton, and Mark A. Giembycz Departments of Physiology and Pharmacology (D.Y., O.H., T.J., K.C.J., R.J., M.A.G.) and Cell Biology and Anatomy (M.M.M., R.N.), Snyder Institute for Chronic Diseases, Cumming School of Medicine, University of Calgary, Calgary, Alberta, Canada Received March 22, 2018; accepted April 11, 2018 Downloaded from ABSTRACT The contribution of gene expression changes to the adverse and activity, and positive regulation of neutrophil chemotaxis. The therapeutic effects of b2-adrenoceptor agonists in asthma was general enriched GO term extracellular space was also associ- investigated using human airway epithelial cells as a therapeu- ated with indacaterol-induced genes, and many of those, in- tically relevant target. Operational model-fitting established that cluding CRISPLD2, DMBT1, GAS1, and SOCS3, have putative jpet.aspetjournals.org the long-acting b2-adrenoceptor agonists (LABA) indacaterol, anti-inflammatory, antibacterial, and/or antiviral activity. Numer- salmeterol, formoterol, and picumeterol were full agonists on ous indacaterol-regulated genes were also induced or repressed BEAS-2B cells transfected with a cAMP-response element in BEAS-2B cells and human primary bronchial epithelial cells by reporter but differed in efficacy (indacaterol $ formoterol .
    [Show full text]
  • Natural Killer Cell Lymphoma Shares Strikingly Similar Molecular Features
    Leukemia (2011) 25, 348–358 & 2011 Macmillan Publishers Limited All rights reserved 0887-6924/11 www.nature.com/leu ORIGINAL ARTICLE Natural killer cell lymphoma shares strikingly similar molecular features with a group of non-hepatosplenic cd T-cell lymphoma and is highly sensitive to a novel aurora kinase A inhibitor in vitro J Iqbal1, DD Weisenburger1, A Chowdhury2, MY Tsai2, G Srivastava3, TC Greiner1, C Kucuk1, K Deffenbacher1, J Vose4, L Smith5, WY Au3, S Nakamura6, M Seto6, J Delabie7, F Berger8, F Loong3, Y-H Ko9, I Sng10, X Liu11, TP Loughran11, J Armitage4 and WC Chan1, for the International Peripheral T-cell Lymphoma Project 1Department of Pathology and Microbiology, University of Nebraska Medical Center, Omaha, NE, USA; 2Eppley Institute for Research in Cancer and Allied Diseases, University of Nebraska Medical Center, Omaha, NE, USA; 3Departments of Pathology and Medicine, University of Hong Kong, Queen Mary Hospital, Hong Kong, China; 4Division of Hematology and Oncology, Department of Internal Medicine, University of Nebraska Medical Center, Omaha, NE, USA; 5College of Public Health, University of Nebraska Medical Center, Omaha, NE, USA; 6Departments of Pathology and Cancer Genetics, Aichi Cancer Center Research Institute, Nagoya University, Nagoya, Japan; 7Department of Pathology, University of Oslo, Norwegian Radium Hospital, Oslo, Norway; 8Department of Pathology, Centre Hospitalier Lyon-Sud, Lyon, France; 9Department of Pathology, Samsung Medical Center, Sungkyunkwan University, Seoul, Korea; 10Department of Pathology, Singapore General Hospital, Singapore and 11Penn State Hershey Cancer Institute, Pennsylvania State University College of Medicine, Hershey, PA, USA Natural killer (NK) cell lymphomas/leukemias are rare neo- Introduction plasms with an aggressive clinical behavior.
    [Show full text]
  • Heiyoun Jung Doctoral Thesis
    UC Berkeley UC Berkeley Electronic Theses and Dissertations Title Expression of Ligands for the NKG2D Activating Receptor are Linked to Proliferative Signals Permalink https://escholarship.org/uc/item/0bf4c1f4 Author Jung, Heiyoun Publication Date 2011 Peer reviewed|Thesis/dissertation eScholarship.org Powered by the California Digital Library University of California Expression of Ligands for the NKG2D Activating Receptor are Linked to Proliferative Signals by Heiyoun Jung A dissertation submitted in partial satisfaction of the requirements for the degree of Doctor of Philosophy in Molecular and Cell Biology in the Graduate Division of the University of California, Berkeley Committee in charge: Professor David H. Raulet, Chair Professor Mark S. Schlissel Professor Stuart Linn Professor Gertrude Buehring ABSTRACT Expression of Ligands for the NKG2D Activating Receptor is Linked to Proliferative Signals By Heiyoun Jung Doctor of Philosophy in Molecular and Cell Biology University of California, Berkeley Professor David H. Raulet, Chair NKG2D is a stimulatory receptor expressed by natural killer cells and subsets of T cells. The receptor recognizes a set of self-encoded cell surface proteins that are usually not displayed on the surface of healthy cells but are often induced in transformed and infected cells. NKG2D engagement activates or enhances the cell killing function and cytokine production programs of NK cells and certain T cells. Emerging evidence suggests that different ligands are to some extent regulated by distinct signals associated with disease states, thus enabling the immune system to respond to a broad range of disease-associated stimuli via a single activating receptor. The research presented in this thesis demonstrated that at least one of the murine NKG2D ligands, RAE-1 ε (gene: Raet1e), is transcriptionally activated by signals associated with cell proliferation.
    [Show full text]
  • NKG2D and Related Immunoreceptors
    NKG2D and related immunoreceptors Roland K. Strong1* and Benjamin J. McFarland2 1Division of Basic Sciences, Fred Hutchinson Cancer Research Center, 1100 Fairview Ave. North, Seattle, WA 98109 2Department of Chemistry and Biochemistry, Seattle Pacific University, 3307 Third Avenue West, Seattle WA 98119 *email address: [email protected] Abstract NK cells are crucial components of the innate immune system, capable of directly eliminating infected or tumorigenic cells and regulating down-stream adaptive immune responses. Unlike T cells, where the key recognition event driving activation is mediated by the unique T cell receptor (TCR) expressed on a given cell, NK cells express multiple activating and inhibitory cell-surface receptors (NKRs), often with overlapping ligand specificities. NKRs display two ectodomain structural homologies, either immunoglobulin- or C-type lectin-like (CTLD). The CTLD immunoreceptor NKG2D is found on NK cells but is also widely expressed on T cells and other immune system cells, providing stimulatory or co- stimulatory signals. NKG2D drives target cell killing following engagement of diverse, conditionally expressed MHC class I-like protein ligands whose expression can signal cellular distress due to infection or transformation. The symmetric, homodimeric receptor interacts with its asymmetric, monomeric ligands in similar 2:1 complexes, with an equivalent surface on each NKG2D monomer binding extensively and intimately to distinct, structurally divergent surfaces on the ligands. Thus, NKG2D ligand-binding site recognition is highly degenerate, further demonstrated by NKG2D’s ability to simultaneously accommodate multiple non-conservative allelic or isoform substitutions in the ligands. In TCRs, ‘induced-fit’ recognition explains cross-reactivity, but structural, computational, thermodynamic and kinetic analyses of multiple NKG2D–ligand pairs show that rather than classical ‘induced-fit’ binding, NKG2D degeneracy is achieved using distinct interaction mechanisms at each rigid interface: recognition degeneracy by ‘rigid adaptation’.
    [Show full text]
  • Human NKG2D-Ligands: Cell Biology Strategies to Ensure Immune Recognition
    REVIEW ARTICLE published: 25 September 2012 doi: 10.3389/fimmu.2012.00299 Human NKG2D-ligands: cell biology strategies to ensure immune recognition Lola Fernández-Messina, HughT. Reyburn and Mar Valés-Gómez* Departamento de Inmunología y Oncología, Centro Nacional de Biotecnología, Consejo Superior de Investigaciones Científicas, Madrid, Spain Edited by: Immune recognition mediated by the activating receptor NKG2D plays an important role Eric Vivier, Centre d’Immunologie de for the elimination of stressed cells, including tumors and virus-infected cells. On the other Marseille-Luminy, France hand, the ligands for NKG2D can also be shed into the sera of cancer patients where they Reviewed by: weaken the immune response by downmodulating the receptor on effector cells, mainly Sophie Caillat-Zucman, Institut National de la Santé et de la NK andT cells. Although both families of NKG2D-ligands, major histocompatibility complex Recherche Médicale, France class I-related chain (MIC) A/B and UL16 binding proteins (ULBPs), are related to MHC Daniela Pende, Istituto Di Ricovero molecules and their expression is increased after stress, many differences are observed e Cura a Carattere Scientifico Azienda Ospedaliera Universitaria San in terms of their biochemical properties and cell trafficking. In this paper, we summarize Martino – Istituto Scientifico Tumori, the variety of NKG2D-ligands and propose that selection pressure has driven evolution of Italy diversity in their trafficking and shedding, but not receptor binding affinity. However, it is *Correspondence: also possible to identify functional properties common to individual ULBP molecules and Mar Valés-Gómez, Departamento de MICA/B alleles, but not generally conserved within the MIC or ULBP families.These charac- Inmunología y Oncología, Centro Nacional de Biotecnología, Consejo teristics likely represent examples of convergent evolution for efficient immune recognition, Superior de Investigaciones but are also attractive targets for pathogen immune evasion strategies.
    [Show full text]
  • Research Article Raet1e Polymorphisms Are Associated With
    Hindawi Mediators of Inflammation Volume 2018, Article ID 1847696, 10 pages https://doi.org/10.1155/2018/1847696 Research Article Raet1e Polymorphisms Are Associated with Increased Risk of Developing Premature Coronary Artery Disease and with Some Cardiometabolic Parameters: The GEA Mexican Study Rosalinda Posadas-Sánchez ,1 Bladimir Roque-Ramírez,2 José Manuel Rodríguez-Pérez ,3 Nonanzit Pérez-Hernández ,3 José Manuel Fragoso ,3 Teresa Villarreal-Molina ,4 Ramón Coral-Vázquez,5 Maria Elizabeth Tejero-Barrera,2 Carlos Posadas-Romero ,1 and Gilberto Vargas-Alarcón 3 1Departamento de Endocrinología, Instituto Nacional de Cardiología Ignacio Chávez, Ciudad de México, Mexico 2Laboratorio de Nutrigenética y Nutrigenómica, Instituto Nacional de Medicina Genómica (INMEGEN), Ciudad de México, Mexico 3Departamento de Biología Molecular, Instituto Nacional de Cardiología Ignacio Chávez, Ciudad de México, Mexico 4Laboratorio de Genómica Cardiovascular, Instituto Nacional de Medicina Genómica (INMEGEN), Ciudad de México, Mexico 5Sección de Estudios de Posgrado e Investigación, Escuela Superior de Medicina, Instituto Politécnico Nacional, Ciudad de México, Mexico Correspondence should be addressed to Gilberto Vargas-Alarcón; [email protected] Received 4 July 2018; Revised 28 October 2018; Accepted 12 November 2018; Published 18 December 2018 Academic Editor: Vera L. Petricevich Copyright © 2018 Rosalinda Posadas-Sánchez et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. In an animal model, new evidence has been reported supporting the role of raet1e as an atherosclerosis-associated gene. Our objective was to establish if raet1e polymorphisms are associated with the risk of developing premature coronary artery disease (CAD) or with the presence of cardiometabolic parameters.
    [Show full text]
  • Comparative Analysis of Human NK Cell Activation Induced by NKG2D and Natural Cytotoxicity Receptors
    Eur. J. Immunol. 2004. 34: 961–971 NK cell activation by NKG2D and NCR 961 Comparative analysis of human NK cell activation induced by NKG2D and natural cytotoxicity receptors Pascale Andre ´ 1,RobertaCastriconi2,MarionEsp´eli3, Nicolas Anfossi3,Tiffany Juarez4,SophieHue5, Holli Conway1,Fran¸cois Romagne ´ 1, Alessandra Dondero2, Marina Nanni6, Sophie Caillat-Zucman5, David H. Raulet4,CristinaBottino6,Eric Vivier3, Alessandro Moretta2,7 and Pascale Paul3 1 Innate-Pharma SA, Marseille, France 2 Molecular Immunology laboratories, Dipartimento di Medicina Sperimentale, Sezione di Istologia, University of Genova, Genova, Italy 3 Centre d’Immunologie de Marseille-Luminy, CNRS-INSERM-UniversitedelaM´ ´ editerranee, ´ Marseille, France 4 Department of Molecular and Cell Biology and Cancer Research Laboratory, University of California, Berkeley, USA 5 Laboratoire d’Immunologie and Equipe Avenir INSERM, IFR94, Hopital ˆ Necker, Paris, France 6 Istituto Giannina Gaslini, Genova, Genova, Italy 7 Centro di Eccellenza per le Ricerche Biomediche, University of Genova, Genova, Italy NKG2D and natural cytotoxicity receptors (NCR) are essential recognition structures that mediate NK cell activation. NKG2D and NCR signaling is achieved through membrane asso- ciation with signaling adaptors. The adaptors that associate with NCR — such as CD3 ´ , FcR + and KARAP/DAP12 — bear intracytoplasmic immunoreceptor tyrosine-based activa- tion motifs that activate Syk protein tyrosine kinases. Human NKG2D associates with the DAP10 transmembrane adaptor, which bears a YxxM motif and activates the phosphatidyl- inositol 3-kinase pathway. In the mouse, a short NKG2D-S isoform, generated by Nkg2d alternative splicing, can associate with either DAP10 or KARAP/DAP12. Here, we report that neither short human NKG2D alternative transcripts nor NKG2D association with KARAP/ DAP12 was detected in activated human NK cells.
    [Show full text]
  • Role of NKG2D in Obesity-Induced Adipose Tissue Inflammation and Insulin Resistance Jun-Jae Chung Washington University School of Medicine in St
    Washington University School of Medicine Digital Commons@Becker Open Access Publications 2014 Role of NKG2D in obesity-induced adipose tissue inflammation and insulin resistance Jun-Jae Chung Washington University School of Medicine in St. Louis Mary A. Markiewicz Washington University School of Medicine in St. Louis Bojan Polic University of Rijeka School of Medicine Andrey S. Shaw Washington University School of Medicine in St. Louis Follow this and additional works at: https://digitalcommons.wustl.edu/open_access_pubs Recommended Citation Chung, Jun-Jae; Markiewicz, Mary A.; Polic, Bojan; and Shaw, Andrey S., ,"Role of NKG2D in obesity-induced adipose tissue inflammation and insulin resistance." PLoS One.9,10. e110108. (2014). https://digitalcommons.wustl.edu/open_access_pubs/3408 This Open Access Publication is brought to you for free and open access by Digital Commons@Becker. It has been accepted for inclusion in Open Access Publications by an authorized administrator of Digital Commons@Becker. For more information, please contact [email protected]. Role of NKG2D in Obesity-Induced Adipose Tissue Inflammation and Insulin Resistance Jun-Jae Chung1, Mary A. Markiewicz1¤, Bojan Polic´2, Andrey S. Shaw1,3* 1 Department of Pathology and Immunology, Washington University School of Medicine, St. Louis, Missouri, United States of America, 2 Department of Histology and Embryology, University of Rijeka School of Medicine, Rijeka, Croatia, 3 Howard Hughes Medical Institute, Washington University School of Medicine, St. Louis, Missouri, United States of America Abstract The early events that initiate inflammation in the adipose tissue during obesity are not well defined. It is unclear whether the recruitment of CD8 T cells to the adipose tissue during onset of obesity occurs through antigen-dependent or - independent processes.
    [Show full text]
  • NKG2D Ligands in Tumor Immunity
    Oncogene (2008) 27, 5944–5958 & 2008 Macmillan Publishers Limited All rights reserved 0950-9232/08 $32.00 www.nature.com/onc REVIEW NKG2D ligands in tumor immunity N Nausch and A Cerwenka Division of Innate Immunity, German Cancer Research Center, Im Neuenheimer Feld 280, Heidelberg, Germany The activating receptor NKG2D (natural-killer group 2, activated NK cells sharing markers with dendritic cells member D) and its ligands play an important role in the (DCs), which are referred to as natural killer DCs NK, cd þ and CD8 þ T-cell-mediated immune response to or interferon (IFN)-producing killer DCs (Pillarisetty tumors. Ligands for NKG2D are rarely detectable on the et al., 2004; Chan et al., 2006; Taieb et al., 2006; surface of healthy cells and tissues, but are frequently Vosshenrich et al., 2007). In addition, NKG2D is expressed by tumor cell lines and in tumor tissues. It is present on the cell surface of all human CD8 þ T cells. evident that the expression levels of these ligands on target In contrast, in mice, expression of NKG2D is restricted cells have to be tightly regulated to allow immune cell to activated CD8 þ T cells (Ehrlich et al., 2005). In activation against tumors, but at the same time avoid tumor mouse models, NKG2D þ CD8 þ T cells prefer- destruction of healthy tissues. Importantly, it was recently entially accumulate in the tumor tissue (Gilfillan et al., discovered that another safeguard mechanism controlling 2002; Choi et al., 2007), suggesting that the activation via the receptor NKG2D exists. It was shown NKG2D þ CD8 þ T-cell population comprises T cells that NKG2D signaling is coupled to the IL-15 receptor involved in tumor cell recognition.
    [Show full text]