DOCSLIB.ORG

Bartonella Gabonensis Sp. Nov., a New Bartonella Species from Savannah Rodent Lophuromys Sp

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Bartonella Gabonensis Sp. Nov., a New Bartonella Species from Savannah Rodent Lophuromys Sp TAXONOGENOMICS: GENOME OF A NEW ORGANISM Bartonella gabonensis sp. nov., a new bartonella species from savannah rodent Lophuromys sp. in Franceville, Gabon J. B. Mangombi1,3,4,N.N’Dilimabaka1,2, H. Medkour4,5, O. L. Banga1, M. L. Tall4,5, M. Ben Khedher4,5, J. Terras4,5, S. Abdi4,5, M. Bourgarel6,7, E. Leroy8, F. Fenollar3,4 and O. Mediannikov4,5 1) Centre Interdisciplinaire de Recherches Médicales de Franceville (CIRMF), 2) Département de Biologie, Université des Sciences et Techniques de Masuku (USTM), Franceville, Gabon, 3) Aix-Marseille Université, IRD, APHM, Microbes, VITROME, 4) IHU Méditerranée Infection, 5) Aix-Marseille Université, IRD, APHM, Microbes, MEPHI, Marseille, France, 6) ASTRE, Université Montpellier, CIRAD, INRA, 7) UMR MIVEGEC IRDCNRSUM, Institut de Recherche pour le Développement (IRD), Montpellier, France and 8) CIRAD, UMR ASTRE, Harare, Zimbabwe Abstract We describe a new strain named Bartonella gabonensis sp. nov. strain 669T (CSURB1083). The entire genome of this strain is described here. It was isolated from a savannah rodent, a brush-furred rat (Lophuromys sp.), trapped the city of Franceville in Gabon, in Central Africa. B. gabonensis is an aerobic, rod-shaped and Gram-negative bacterium. On the basis of the organism’s features, and following a taxonogenomic approach, we propose the creation of the species Bartonella gabonensis sp. nov. © 2020 The Authors. Published by Elsevier Ltd. Keywords: Bartonella gabonensis sp. nov., Gabon, genome, Lophuromys sp., rodents Original Submission: 20 June 2020; Revised Submission: 7 October 2020; Accepted: 14 October 2020 Article published online: 27 October 2020 The latest epidemiologic studies from around the world have Corresponding author: N. N’Dilimabaka, Centre Interdisciplinaire shown a high prevalence and diversity of Bartonella species in de Recherches Médicales de Franceville (CIRMF), BP : 769, France- ville, Gabon. rodents [4]. Several Bartonella species associated with rodent E-mail: [email protected] hosts have been involved in human pathologies, including endocarditis, myocarditis, fever, neurologic disorders, intraoc- ular disorders, meningitis and splenomegaly [4]. Indeed, many studies have shown that rodents are important hosts of Bar- Introduction tonella spp. bacteria [1,5,6]. More recently, several new species of Bartonella have been isolated in rodents and their ectopar- asites in sub-Saharan Africa, including Bartonella mastomydis Bartonella is the only genus of the family Bartonellaceae within [7], Bartonella massiliensis [8] and Bartonella saheliensis [9]. the Alphaproteobacteria class [1,2]. The members of this family In Gabon, a previous study on rodent-borne infectious are Gram negative, facultative intracellular and fastidious with agents in the city of Franceville (Mangombi et al., unpublished slow growth. The genus Bartonella to date contains 37 known data) identified three Bartonella species from rodent hosts: species and three subspecies (http://www.bacterio.net/ Bartonella elizabethae in Rattus rattus, Bartonella massiliensis in bartonella.html). The majority of associations between Barto- Cricetomys sp. and Candidatus Bartonella gabonensis in nella and their primary hosts are specific. The best-known Lophuromys sp. example is Bartonella henselae, which has been found in do- Here we aim to describe Bartonella gabonensis sp. nov. mestic and wild Felidae worldwide, including Africa [3]. In strains 662, 667 and 669, which we previously called Candi- addition, Bartonella species infect a wide range of hosts, datus Bartonella gabonensis (Mangombi et al., unpublished data). including domestic animals as cats, dogs and cattle; wild animal This description also include the complete and annotated such as bats, coyotes and foxes; and many rodent species. genome of this new species. Three strains were isolated from New Microbe and New Infect 2020; 38: 100796 © 2020 The Authors. Published by Elsevier Ltd This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/) https://doi.org/10.1016/j.nmni.2020.100796 2 New Microbes and New Infections, Volume 38 Number C, --- 2020 NMNI Lophuromys sp. rodents collected in the town of Franceville, Bartonella colonies were obtained from bacterial culture Gabon. of liver of rodents previously found to be positive for Bartonella spp. by a Bartonella genus–specific qPCR after 5 to 10 days’ incubation at 37°C. Culturing was performed in Samples and bacterial culture a 5% CO2-enriched atmosphere on Columbia agar plates supplemented with 5% sheep’s blood (bioMérieux, Marcy In Gabon, a Central African country, rodents were sampled in l’Etoile, France) [3,8]. six districts and small savannah and forest islands within the city of Franceville in 2014 according to a standardized live-trapping Classification and features protocol as previously described [10]. The districts sampled were Mbaya, Yéné, Sable, Mangoungou, Ombélé and Poto-poto (Potos). Mbaya and Yéné are the two main entry points to the As previously described in similar studies [7,8], the internal city, by road or railway respectively. Sable and Mangoungou are transcribed spacer (ITS), gltA, rpoB, ftsZ and 16S ribosomal more isolated districts. Mbaya is mainly industrial. Potos is the RNA (rRNA) genes were amplified and sequenced to identify central trade district, including large storehouses and the main isolated Bartonella strains. Three B. gabonensis isolates (strains open market. Trapping campaigns were performed under the 662, 667 and 669T) were obtained from three individuals of the auspices of prior agreement from local authorities (city mayor same rodent species, the rusty-bellied brush-furred rat Lophur- and district chief), and all sampling procedures were approved omys sikapusi. We could not obtain all the sequences for the by the Comité Nationale d’Ethique pour la Recherche (0020/ 662T strain. However, after analysis of the sequences obtained, 2013/SG/CNE). Live-trapped rodents were brought back to the 667T and 669T strains showed 100% identity between each laboratory, humanely killed with a halothane solution, necrop- other for the 16S rRNA gene; the other genes—in this case gltA, sied according to a previously established protocol [11] and rpoB, ftsZ and ITS—showed 99% identity. This means that the then weighed, sexed and measured. During necroscopy, various three strains belong to the same species. organs and tissues such as kidney, liver, brain, lungs and spleen − were collected and stored at 80°C. However, only livers were TABLE 1. Classification and general features of Bartonella used for the present study. gabonensis sp. nov. strain 669T Total DNA was extracted from liver of rodent on the Bio- Evidence Robot EZ1 device (Qiagen, Courtaboeuf, France) using a MIGS ID Property Term codea commercial EZ1 DNA/RNA tissue kit (Qiagen) following the Current classification manufacturer’s instructions. Real-time quantitative PCR (qPCR) Domain Bacteria TAS Phylum Proteobacteria TAS was performed to screen all rodent samples for Bartonella sp. Class Alphaproteobacteria TAS Order Rhizobiales TAS using the following primers: Barto ITS3, forward: Family Bartonellaceae TAS GATGCCGGGGAAGGTTTTC, and reverse: ITS3 Genus Bartonella TAS Species Bartonella gabonensis IDA GCCTGGGAGGACTTGAACCT, and probe: Barto ITS3 P Type strain 669T IDA Gram stain Negative IDA 6FAM-GCGCGCGCTTGATAAGCGTG. Conventional PCR Cell shape Rod IDA Motility Nonmotile IDA was performed on all qPCR-positive samples using following Sporulation Nonsporulating IDA Temperature range Mesophilic IDA primers: Urbarto1: 5’ CTTCGTTTCTCTTTCTTCA 3’ for Optimum temperature 37°C IDA MIGS-22 Oxygen requirement Aerobic IDA forward; and reverse, Urbarto2: CTTCTCTTCA- Carbon source Unknown IDA Energy source Unknown IDA CAATTTCAAT, as previously described [12,13]. MIGS-6 Habitat Rodents liver IDA From a total of 198 rodents tested by qPCR for Bartonella MIGS-15 Biotic relationship Facultative intracellular IDA Pathogenicity Unknown IDA sp., only five rodents from two districts and an island savannah Biosafety level 3 IDA MIGS-14 Isolation Lophuromys sp. IDA were infected, as follows: in Potos district, one (6.7%) of 15 B. MIGS-4 Geographic location Franceville, Gabon IDA MIGS-5 Sample collection 14 April, 2014 IDA elizabethae were infected; Sable district, one (4%) of 25 with MIGS-4.2 Latitude 1° 37’ 59.9" S IDA MIGS-4.3 Longitude 13° 34’ 59.9" E IDA B. massiliensis; and savannah, three (9.7%) of 34 with what is MIGS-4.4 Altitude 372 m IDA apparently a novel Bartonella genotype (Mangombi et al., un- MIGS, Minimum Information About a Genome Sequence. aEvidence codes are as follows: IDA, inferred from direct assay; TAS, traceable published data). Three strains were isolated from livers of author statement (i.e. a direct report exists in the literature). These evidence codes are from the Gene Ontology project (http://www.geneontology.org/GO.evidence. three brush-furred rats of the genus Lophuromys shtml). If the evidence code is IDA, then the property should have been directly (MT256381.1). Bartonella strains were cultured as previously observed, for the purpose of this specific publication, for a live isolate by one of the authors, or by an expert or reputable institution mentioned in the acknowledge- reported [7,8,14]. ments. © 2020 The Authors. Published by Elsevier Ltd, NMNI, 38, 100796 This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). NMNI Mangombi et al. Taxonogenomics: genome of a
Load more

Recommended publications
  • Bartonella Apis Sp. Nov., a Honey Bee Gut Symbiont of the Class Alphaproteobacteria
    Serveur Academique´ Lausannois SERVAL serval.unil.ch Author Manuscript Faculty of Biology and Medicine Publication This paper has been peer-reviewed but does not include the final publisher proof-corrections or journal pagination. Published in final edited form as: Title: Bartonella apis sp. nov., a honey bee gut symbiont of the class Alphaproteobacteria. Authors: Keˇsnerov´aL, Moritz R, Engel P Journal: International journal of systematic and evolutionary microbiology Year: 2016 Jan Issue: 66 Volume: 1 Pages: 414-21 DOI: 10.1099/ijsem.0.000736 In the absence of a copyright statement, users should assume that standard copyright protection applies, unless the article contains an explicit statement to the contrary. In case of doubt, contact the journal publisher to verify the copyright status of an article. 1 Bartonella apis sp. nov., a honey bee gut symbiont of the 2 class Alphaproteobacteria 3 4 Lucie Kešnerová, Roxane Moritz, Philipp Engel* 5 6 Department of Fundamental Microbiology, University of Lausanne, CH-1015 7 Lausanne, Switzerland 8 9 Running title: Description of a bee gut symbiont 10 11 *Correspondence: 12 Prof. Philipp Engel 13 Department of Fundamental Microbiology 14 University of Lausanne, CH-1015 Lausanne, Switzerland 15 Tel.: +41 (0)21 692 56 12 16 e-mail: [email protected] 17 18 Category: New Taxa – Proteobacteria 19 Keywords: Apis mellifera; insect; Bartonella; gut microbiota; Alpha-1 20 21 Sequence deposition: The 16S rRNA gene sequences and protein-coding gene 22 sequences of the bacterial strains PEB0122T, PEB0149, PEB0150, BBC0104, and 23 BBC0108 from Apis mellifera, and the uncultured Rhizobiales bacterium from 24 Herpagnathos saltator are deposited in GenBank with accession numbers KP987849 25 – KP987886 and KT315729 – KT315734.
    [Show full text]
  • View Tickborne Diseases Sample Report
    1360 Bayport Ave, Ste B. San Carlos, CA 94070 1(866) 364-0963 | [email protected] | www. vibrant-wellness.com PATIENT PROVIDER NAME: DEMO REPORT GENDER: Male PRACTICE NAME: Vibrant IT4 Practice DATE OF BIRTH: 04/14/1998 AGE: 22 PROVIDER NAME: Demo Client, DDD (999994) ADDRESS: TEST STREET, TEST CITY, KY- 42437. ACCESSION ID: 2009220006 PHLEBOTOMIST: 607 SPECIMEN COLLECTION TIME: 09-21-2020 11:14 SPECIMEN RECEIVED TIME: 09-22-2020 05:14 FINAL REPORT TIME: 09-25-2020 15:56 FASTING: FASTING Your Vibrant Wellness TickBorne 2.0 panel results are enclosed. These results are intended to aid in the diagnosis of tickborne diseases by your healthcare provider. The Vibrant Tickborne Diseases panel tests for IgG and IgM antibodies for Borreliosis/Lyme disease as well as co-infection(s) and opportunistic infections with other tick-borne illnesses along with detection of DNA of the species causing these infections. The Vibrant Immunochip test is a semiquantitative assay that detects IgG and IgM antibodies in human serum. The PCR Test is a real-time PCR Assay designed for qualitative detection of infectious group- specific DNA in clinical samples. Interpretation of Report: The test results of antibody levels to the individual antigens are calculated by comparing the average intensity of the individual antibody to that of a reference population and cut-off chosen for each protein. Reference ranges have been established using a well characterized set of more than 300 serum samples and antibodies to specific bacteria tested. The results are displayed as In Control, Moderate, or High Risk.for each antigen tested.
    [Show full text]
  • Genetic Diversity of Bartonella Species in Small Mammals in the Qaidam
    www.nature.com/scientificreports OPEN Genetic diversity of Bartonella species in small mammals in the Qaidam Basin, western China Huaxiang Rao1, Shoujiang Li3, Liang Lu4, Rong Wang3, Xiuping Song4, Kai Sun5, Yan Shi3, Dongmei Li4* & Juan Yu2* Investigation of the prevalence and diversity of Bartonella infections in small mammals in the Qaidam Basin, western China, could provide a scientifc basis for the control and prevention of Bartonella infections in humans. Accordingly, in this study, small mammals were captured using snap traps in Wulan County and Ge’ermu City, Qaidam Basin, China. Spleen and brain tissues were collected and cultured to isolate Bartonella strains. The suspected positive colonies were detected with polymerase chain reaction amplifcation and sequencing of gltA, ftsZ, RNA polymerase beta subunit (rpoB) and ribC genes. Among 101 small mammals, 39 were positive for Bartonella, with the infection rate of 38.61%. The infection rate in diferent tissues (spleens and brains) (χ2 = 0.112, P = 0.738) and gender (χ2 = 1.927, P = 0.165) of small mammals did not have statistical diference, but that in diferent habitats had statistical diference (χ2 = 10.361, P = 0.016). Through genetic evolution analysis, 40 Bartonella strains were identifed (two diferent Bartonella species were detected in one small mammal), including B. grahamii (30), B. jaculi (3), B. krasnovii (3) and Candidatus B. gerbillinarum (4), which showed rodent-specifc characteristics. B. grahamii was the dominant epidemic strain (accounted for 75.0%). Furthermore, phylogenetic analysis showed that B. grahamii in the Qaidam Basin, might be close to the strains isolated from Japan and China.
    [Show full text]
  • Detection and Partial Molecular Characterization of Rickettsia and Bartonella from Southern African Bat Species
    Detection and partial molecular characterization of Rickettsia and Bartonella from southern African bat species by Tjale Mabotse Augustine (29685690) Submitted in partial fulfillment of the requirements for the degree MAGISTER SCIENTIAE (MICROBIOLOGY) in the Department of Microbiology and Plant Pathology Faculty of Natural and Agricultural Sciences University of Pretoria Pretoria, South Africa Supervisor: Dr Wanda Markotter Co-supervisors: Prof Louis H. Nel Dr Jacqueline Weyer May, 2012 I declare that the thesis, which I hereby submit for the degree MSc (Microbiology) at the University of Pretoria, South Africa, is my own work and has not been submitted by me for a degree at another university ________________________________ Tjale Mabotse Augustine i Acknowledgements I would like send my sincere gratitude to the following people: Dr Wanda Markotter (University of Pretoria), Dr Jacqueline Weyer (National Institute for Communicable Diseases-National Health Laboratory Service) and Prof Louis H Nel (University of Pretoria) for their supervision and guidance during the project. Dr Jacqueline Weyer (Centre for Zoonotic and Emerging diseases (Previously Special Pathogens Unit), National Institute for Communicable Diseases (National Heath Laboratory Service), for providing the positive control DNA for Rickettsia and Dr Jenny Rossouw (Special Bacterial Pathogens Reference Unit, National Institute for Communicable Diseases-National Health Laboratory Service), for providing the positive control DNA for Bartonella. Dr Teresa Kearney (Ditsong Museum of Natural Science), Gauteng and Northern Region Bat Interest Group, Kwa-Zulu Natal Bat Interest Group, Prof Ara Monadjem (University of Swaziland), Werner Marias (University of Johannesburg), Dr Francois du Rand (University of Johannesburg) and Prof David Jacobs (University of Cape Town) for collection of blood samples.
    [Show full text]
  • Bartonella Spp. Infection Rate and B. Grahamii in Ticks
    LETTERS 8. Reif KE, Macaluso KR. Ecology which is common in Europe, may nlm.nih.gov/Blast.cgi) comparison to of Rickettsia felis: a review. J Med also transmit zoonotic Bartonella spp. published sequences. Entomol. 2009;46:723–36. http://dx.doi. org/10.1603/033.046.0402 Evidence of possible tick transmission On the basis of the amplicon- 9. Reif KE, Stout RW, Henry GC, Foil LD, of bartonellae to humans under natural specifi c melting temperature and DNA Macaluso KR. Prevalence and infection conditions was provided by Eskow et bands representing the specifi c size load dynamics of Rickettsia felis in al. (3) and Angelakis et al. (4), who of 249-bp after gel electrophoresis, actively feeding cat fl eas. PLoS ONE. 2008;3:e2805. http://dx.doi.org/10.1371/ identifi ed Bartonella spp. in tissue results of qPCR showed 100 (4.76%) journal.pone.0002805 samples of patients who were recently infected I. ricinus ticks (Table). 10. Mitchell CJ. The role of Aedes albopictus bitten by ticks. We determined the Positive results did not vary by as an arbovirus vector. Parassitologia. prevalence of Bartonella spp. in developmental tick stages; 4.84% 1995;37:109–13. questing I. ricinus ticks in the city (18/372) adult ticks (5.08% [9/177] Address for correspondence: Didier Raoult, of Hanover, Germany, which is female and 4.62% [9/195] male), URMITE, UMR CNRS 7278, IRD 198, nicknamed The Green Metropolis and 4.71% (80/1,698) nymphs, and 6.67% INSERM 1095, Faculté de Médecine, 27 Bd was selected the German Capital of (2/30) larvae were infected (Table).
    [Show full text]
  • Tick-Borne Pathogens in Removed Ticks Veneto, Northeastern Italy
    Tick-borne pathogens in removed ticks Veneto, northeastern Italy: A cross-sectional investigation Anna Beltrame, Maureen Laroche, Monica Degani, Francesca Perandin, Zeno Bisoffi, Didier Raoult, Philippe Parola To cite this version: Anna Beltrame, Maureen Laroche, Monica Degani, Francesca Perandin, Zeno Bisoffi, et al.. Tick- borne pathogens in removed ticks Veneto, northeastern Italy: A cross-sectional investigation. Travel Medicine and Infectious Disease, Elsevier, 2018, 26, pp.58-61. 10.1016/j.tmaid.2018.08.008. hal- 01970220 HAL Id: hal-01970220 https://hal.archives-ouvertes.fr/hal-01970220 Submitted on 10 Apr 2019 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Travel Medicine and Infectious Disease 26 (2018) 58–61 Contents lists available at ScienceDirect Travel Medicine and Infectious Disease journal homepage: www.elsevier.com/locate/tmaid Tick-borne pathogens in removed ticks Veneto, northeastern Italy: A cross- sectional investigation T ∗ Anna Beltramea, , Maureen Larocheb, Monica Degania, Francesca Perandina, Zeno Bisoffia, Didier Raoultc, Philippe Parolab a Centre for Tropical Diseases, IRCCS Sacro Cuore Don Calabria Hospital, Via Sempreboni 5, 37024, Negrar, Italy b Aix Marseille Univ, AP-HM, SSA, VITROME, IHU-Méditerranée Infection, 19-21 Bd Jean Moulin, 13005, Marseille, France c Aix Marseille Univ, AP-HM, MEPHI, IHU-Méditerranée Infection, 19-21 Bd Jean Moulin, 13005, Marseille, France ARTICLE INFO ABSTRACT Keywords: Background: In Italy, the incidence of tick-borne diseases in humans is underestimated, as they are not ob- Tick-borne diseases ligatorily notifiable.
    [Show full text]
  • Co-Infection of Bacteria and Protozoan Parasites in Ixodes Ricinus Nymphs Collected in the Alsace Region, France
    Ticks and Tick-borne Diseases 10 (2019) 101241 Contents lists available at ScienceDirect Ticks and Tick-borne Diseases journal homepage: www.elsevier.com/locate/ttbdis Short communication Co-infection of bacteria and protozoan parasites in Ixodes ricinus nymphs T collected in the Alsace region, France Amira Nebbaka,b, Handi Dahmanaa, Lionel Almerasa,c, Didier Raoultd, Nathalie Boulangere,f, ⁎ Benoit Jaulhace,f, Oleg Mediannikovd, Philippe Parolaa,d, a Aix Marseille Univ, IRD, AP-HM, SSA, VITROME, Marseille, France b Centre de Recherche Scientifique et Technique en Analyses Physico-Chimiques (CRAPC). Zone Industrielle, BP 384 Bou-Ismail, Tipaza Algeria c Unité de Parasitologie et Entomologie, Département des Maladies Infectieuses, Institut de Recherche Biomédicale des Armées, Marseille, France d IHU-Méditerranée Infection, Marseille, France e Centre National de Reference Borrelia, Centre Hospitalier Universitaire, Strasbourg, France f EA7290Virulence bactérienne précoce: groupe borréliose de Lyme, Facultés de pharmacie et de médecine, Université de Strasbourg, France ARTICLE INFO ABSTRACT Keywords: Fifty nymphal Ixodes ricinus ticks collected in Alsace, France, identified by morphological criteria and using Ixodes ricinus MALDI-TOF MS, were tested by PCR to detect tick-associated bacteria and protozoan parasites. Seventy percent Co-infection (35/50) of ticks contained at least one microorganism; 26% (9/35) contained two or more species. Several Bacterial pathogens human pathogens were identified including Borrelia burgdorferi s.s. (4%), Borrelia afzelii (2%), Borrelia garinii Protozoan parasites (2%), Borrelia valaisiana (4%), Borrelia miyamotoi (2%), Rickettsia helvetica (6%) and “Babesia venatorum” (2%). MALDI-TOF MS Bartonella spp. (10%) and a Wolbachia spp. (8%) were also detected. The most common co-infections involved Anaplasmataceae with Borrelia spp.
    [Show full text]
  • Bartonella Henselae
    Maggi et al. Parasites & Vectors 2013, 6:101 http://www.parasitesandvectors.com/content/6/1/101 RESEARCH Open Access Bartonella henselae bacteremia in a mother and son potentially associated with tick exposure Ricardo G Maggi1,3*, Marna Ericson2, Patricia E Mascarelli1, Julie M Bradley1 and Edward B Breitschwerdt1 Abstract Background: Bartonella henselae is a zoonotic, alpha Proteobacterium, historically associated with cat scratch disease (CSD), but more recently associated with persistent bacteremia, fever of unknown origin, arthritic and neurological disorders, and bacillary angiomatosis, and peliosis hepatis in immunocompromised patients. A family from the Netherlands contacted our laboratory requesting to be included in a research study (NCSU-IRB#1960), designed to characterize Bartonella spp. bacteremia in people with extensive arthropod or animal exposure. All four family members had been exposed to tick bites in Zeeland, southwestern Netherlands. The mother and son were exhibiting symptoms including fatigue, headaches, memory loss, disorientation, peripheral neuropathic pain, striae (son only), and loss of coordination, whereas the father and daughter were healthy. Methods: Each family member was tested for serological evidence of Bartonella exposure using B. vinsonii subsp. berkhoffii genotypes I-III, B. henselae and B. koehlerae indirect fluorescent antibody assays and for bacteremia using the BAPGM enrichment blood culture platform. Results: The mother was seroreactive to multiple Bartonella spp. antigens and bacteremia was confirmed by PCR amplification of B. henselae DNA from blood, and from a BAPGM blood agar plate subculture isolate. The son was not seroreactive to any Bartonella sp. antigen, but B. henselae DNA was amplified from several blood and serum samples, from BAPGM enrichment blood culture, and from a cutaneous striae biopsy.
    [Show full text]
  • Detecting Phylogenetic Signals from Deep Roots of the Tree of Life
    UNIVERSITY OF CALIFORNIA,MERCED Detecting Phylogenetic Signals From Deep Roots of the Tree of Life A dissertation submitted in partial fulfillment of the requirements for the degree Doctor of Philosophy in Quantitative and Systems Biology by Katherine Colleen Harris Amrine Committee in charge: Professor Carolin Frank, Chair Professor David Ardell Professor Meng-Lin Tsao Professor Suzanne Sindi August 2013 Copyright Katherine C. Amrine All Rights Reserved UNIVERSITY OF CALIFORNIA,MERCED Graduate Division The Dissertation of Katherine Colleen Harris Amrine is approved, and it is acceptable in quality and form for publication on microfilm and electronically: Faculty Advisor: David H. Ardell Committee Members: Chair: Carolin Frank Meng-Lin Tsao Suzanne Sindi Date iii Contents List of Figures ................................................................. vi List of Tables .................................................................. ix Acknowledgements ............................................................. x Vita ........................................................................... xi Abstract ...................................................................... xii 1 Shifting focus in evolutionary biology – identifying a new signal for phylogenetic tree reconstruction and taxonomic classification 1 1.1 The evolution of bacterial classification and phylogeny . .1 1.2 The historical marker – 16S . .2 1.3 Complications in bacterial classification and phylogeny . .2 1.3.1 Horizontal gene transfer . .2 1.3.2 Does a true tree exist? . .3 1.4 Methods for phylogenetic tree reconstruction . .3 1.4.1 DNA . .3 1.4.2 RNA . .4 1.4.3 Proteins . .4 1.4.4 Data compilation . .5 1.5 Bias in tree-building . .5 1.6 Biological bias in biological data . .6 1.7 The tRNA interaction network . .6 1.8 Information theory . .8 1.9 Machine Learning for bacterial classification . .9 2 tRNA signatures reveal polyphyletic origins of streamlined SAR11 genomes among the Alphaproteobacteria 12 2.1 Abstract .
    [Show full text]
  • Characterizing the Molecular Biology of a Bacteriophage-Like Particle from Bartonella Bacilliformis
    University of Montana ScholarWorks at University of Montana Graduate Student Theses, Dissertations, & Professional Papers Graduate School 1999 Characterizing the molecular biology of a bacteriophage-like particle from Bartonella bacilliformis Kent D. Barbian The University of Montana Follow this and additional works at: https://scholarworks.umt.edu/etd Let us know how access to this document benefits ou.y Recommended Citation Barbian, Kent D., "Characterizing the molecular biology of a bacteriophage-like particle from Bartonella bacilliformis" (1999). Graduate Student Theses, Dissertations, & Professional Papers. 6634. https://scholarworks.umt.edu/etd/6634 This Thesis is brought to you for free and open access by the Graduate School at ScholarWorks at University of Montana. It has been accepted for inclusion in Graduate Student Theses, Dissertations, & Professional Papers by an authorized administrator of ScholarWorks at University of Montana. For more information, please contact [email protected]. i I S Maureen and Mike MANSFIELD LIBRARY The University of IVIONTANA Permission is granted by the author to reproduce this material in its entirety, provided that this material is used for scholarly purposes and is properly cited in published works and reports. ** Please check ’’Yes'* or ”No” and provide signature ** Yes, I grant permission X" No, I do not grant permission _____ Author's Signature Date Any copying for conunercial purposes or financial gain may be undertaken only with the author's explicit consent. Characterizing the Molecular Biology of a Bacteriophage-Like Particle FromBartonella bacilliformis by Kent D. Barbian B.A,, The University of Montana, 1997 Presented in partial fulfillment of the requirements for the degree of Master of Science in Microbiology The University of Montana 1999 Approved by: Committee Chair Dean, Graduate School Date UMI Number: EP37435 All rights reserved INFORMATION TO ALL USERS The quality of this reproduction is dependent upon the quality of the copy submitted.
    [Show full text]
  • Bartonella: Feline Diseases and Emerging Zoonosis
    BARTONELLA: FELINE DISEASES AND EMERGING ZOONOSIS WILLIAM D. HARDY, JR., V.M.D. Director National Veterinary Laboratory, Inc. P.O Box 239 Franklin Lakes, New Jersey 07417 201-891-2992 www.natvetlab.com or .net Gingivitis Proliferative Gingivitis Conjunctivitis/Blepharitis Uveitis & Conjunctivitis URI Oral Ulcers Stomatitis Lymphadenopathy TABLE OF CONTENTS Page SUMMARY……………………………………………………………………………………... i INTRODUCTION……………………………………………………………………………… 1 MICROBIOLOGY……………………………………………………………………………... 1 METHODS OF DETECTION OF BARTONELLA INFECTION.………………………….. 1 Isolation from Blood…………………………………………………………………….. 2 Serologic Tests…………………………………………………………………………… 2 SEROLOGY……………………………………………………………………………………… 3 CATS: PREVALENCE OF BARTONELLA INFECTIONS…………………………………… 4 Geographic Risk factors for Infection……………………………………………………. 5 Risk Factors for Infection………………………………………………………………… 5 FELINE BARTONELLA DISEASES………………………………………………………….… 6 Bartonella Pathogenesis………………………………………………………………… 7 Therapy of Feline Bartonella Diseases…………………………………………………… 14 Clinical Therapy Results…………………………………………………………………. 15 DOGS: PREVALENCE OF BARTONELLA INFECTIONS…………………………………. 17 CANINE BARTONELLA DISEASES…………………………………………………………... 17 HUMAN BARTONELLA DISEASES…………………………………………………………… 18 Zoonotic Case Study……………………………………………………………………... 21 FELINE BLOOD DONORS……………………………………………………………………. 21 REFERENCES………………………………………………………………………………….. 22 This work was initiated while Dr. Hardy was: Professor of Medicine, Albert Einstein College of Medicine of Yeshiva University, Bronx, New York and Director,
    [Show full text]
  • Viewed to Possess Different Related Sequences Or Outliers and N-Gram-Based Dot Languages
    Osmanbeyoglu and Ganapathiraju BMC Bioinformatics 2011, 12:12 http://www.biomedcentral.com/1471-2105/12/12 RESEARCHARTICLE Open Access N-gram analysis of 970 microbial organisms reveals presence of biological language models Hatice Ulku Osmanbeyoglu, Madhavi K Ganapathiraju* Abstract Background: It has been suggested previously that genome and proteome sequences show characteristics typical of natural-language texts such as “signature-style” word usage indicative of authors or topics, and that the algorithms originally developed for natural language processing may therefore be applied to genome sequences to draw biologically relevant conclusions. Following this approach of ‘biological language modeling’, statistical n-gram analysis has been applied for comparative analysis of whole proteome sequences of 44 organisms. It has been shown that a few particular amino acid n-grams are found in abundance in one organism but occurring very rarely in other organisms, thereby serving as genome signatures. At that time proteomes of only 44 organisms were available, thereby limiting the generalization of this hypothesis. Today nearly 1,000 genome sequences and corresponding translated sequences are available, making it feasible to test the existence of biological language models over the evolutionary tree. Results: We studied whole proteome sequences of 970 microbial organisms using n-gram frequencies and cross- perplexity employing the Biological Language Modeling Toolkit and Patternix Revelio toolkit. Genus-specific signatures were observed even in a simple unigram distribution. By taking statistical n-gram model of one organism as reference and computing cross-perplexity of all other microbial proteomes with it, cross-perplexity was found to be predictive of branch distance of the phylogenetic tree.
    [Show full text]