TAXONOGENOMICS: GENOME OF A NEW ORGANISM Bartonella gabonensis sp. nov., a new bartonella species from savannah rodent Lophuromys sp. in Franceville, Gabon J. B. Mangombi1,3,4,N.N’Dilimabaka1,2, H. Medkour4,5, O. L. Banga1, M. L. Tall4,5, M. Ben Khedher4,5, J. Terras4,5, S. Abdi4,5, M. Bourgarel6,7, E. Leroy8, F. Fenollar3,4 and O. Mediannikov4,5 1) Centre Interdisciplinaire de Recherches Médicales de Franceville (CIRMF), 2) Département de Biologie, Université des Sciences et Techniques de Masuku (USTM), Franceville, Gabon, 3) Aix-Marseille Université, IRD, APHM, Microbes, VITROME, 4) IHU Méditerranée Infection, 5) Aix-Marseille Université, IRD, APHM, Microbes, MEPHI, Marseille, France, 6) ASTRE, Université Montpellier, CIRAD, INRA, 7) UMR MIVEGEC IRDCNRSUM, Institut de Recherche pour le Développement (IRD), Montpellier, France and 8) CIRAD, UMR ASTRE, Harare, Zimbabwe Abstract We describe a new strain named Bartonella gabonensis sp. nov. strain 669T (CSURB1083). The entire genome of this strain is described here. It was isolated from a savannah rodent, a brush-furred rat (Lophuromys sp.), trapped the city of Franceville in Gabon, in Central Africa. B. gabonensis is an aerobic, rod-shaped and Gram-negative bacterium. On the basis of the organism’s features, and following a taxonogenomic approach, we propose the creation of the species Bartonella gabonensis sp. nov. © 2020 The Authors. Published by Elsevier Ltd. Keywords: Bartonella gabonensis sp. nov., Gabon, genome, Lophuromys sp., rodents Original Submission: 20 June 2020; Revised Submission: 7 October 2020; Accepted: 14 October 2020 Article published online: 27 October 2020 The latest epidemiologic studies from around the world have Corresponding author: N. N’Dilimabaka, Centre Interdisciplinaire shown a high prevalence and diversity of Bartonella species in de Recherches Médicales de Franceville (CIRMF), BP : 769, France- ville, Gabon. rodents [4]. Several Bartonella species associated with rodent E-mail: [email protected] hosts have been involved in human pathologies, including endocarditis, myocarditis, fever, neurologic disorders, intraoc- ular disorders, meningitis and splenomegaly [4]. Indeed, many studies have shown that rodents are important hosts of Bar- Introduction tonella spp. bacteria [1,5,6]. More recently, several new species of Bartonella have been isolated in rodents and their ectopar- asites in sub-Saharan Africa, including Bartonella mastomydis Bartonella is the only genus of the family Bartonellaceae within [7], Bartonella massiliensis [8] and Bartonella saheliensis [9]. the Alphaproteobacteria class [1,2]. The members of this family In Gabon, a previous study on rodent-borne infectious are Gram negative, facultative intracellular and fastidious with agents in the city of Franceville (Mangombi et al., unpublished slow growth. The genus Bartonella to date contains 37 known data) identified three Bartonella species from rodent hosts: species and three subspecies (http://www.bacterio.net/ Bartonella elizabethae in Rattus rattus, Bartonella massiliensis in bartonella.html). The majority of associations between Barto- Cricetomys sp. and Candidatus Bartonella gabonensis in nella and their primary hosts are specific. The best-known Lophuromys sp. example is Bartonella henselae, which has been found in do- Here we aim to describe Bartonella gabonensis sp. nov. mestic and wild Felidae worldwide, including Africa [3]. In strains 662, 667 and 669, which we previously called Candi- addition, Bartonella species infect a wide range of hosts, datus Bartonella gabonensis (Mangombi et al., unpublished data). including domestic animals as cats, dogs and cattle; wild animal This description also include the complete and annotated such as bats, coyotes and foxes; and many rodent species. genome of this new species. Three strains were isolated from New Microbe and New Infect 2020; 38: 100796 © 2020 The Authors. Published by Elsevier Ltd This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/) https://doi.org/10.1016/j.nmni.2020.100796 2 New Microbes and New Infections, Volume 38 Number C, --- 2020 NMNI Lophuromys sp. rodents collected in the town of Franceville, Bartonella colonies were obtained from bacterial culture Gabon. of liver of rodents previously found to be positive for Bartonella spp. by a Bartonella genus–specific qPCR after 5 to 10 days’ incubation at 37°C. Culturing was performed in Samples and bacterial culture a 5% CO2-enriched atmosphere on Columbia agar plates supplemented with 5% sheep’s blood (bioMérieux, Marcy In Gabon, a Central African country, rodents were sampled in l’Etoile, France) [3,8]. six districts and small savannah and forest islands within the city of Franceville in 2014 according to a standardized live-trapping Classification and features protocol as previously described [10]. The districts sampled were Mbaya, Yéné, Sable, Mangoungou, Ombélé and Poto-poto (Potos). Mbaya and Yéné are the two main entry points to the As previously described in similar studies [7,8], the internal city, by road or railway respectively. Sable and Mangoungou are transcribed spacer (ITS), gltA, rpoB, ftsZ and 16S ribosomal more isolated districts. Mbaya is mainly industrial. Potos is the RNA (rRNA) genes were amplified and sequenced to identify central trade district, including large storehouses and the main isolated Bartonella strains. Three B. gabonensis isolates (strains open market. Trapping campaigns were performed under the 662, 667 and 669T) were obtained from three individuals of the auspices of prior agreement from local authorities (city mayor same rodent species, the rusty-bellied brush-furred rat Lophur- and district chief), and all sampling procedures were approved omys sikapusi. We could not obtain all the sequences for the by the Comité Nationale d’Ethique pour la Recherche (0020/ 662T strain. However, after analysis of the sequences obtained, 2013/SG/CNE). Live-trapped rodents were brought back to the 667T and 669T strains showed 100% identity between each laboratory, humanely killed with a halothane solution, necrop- other for the 16S rRNA gene; the other genes—in this case gltA, sied according to a previously established protocol [11] and rpoB, ftsZ and ITS—showed 99% identity. This means that the then weighed, sexed and measured. During necroscopy, various three strains belong to the same species. organs and tissues such as kidney, liver, brain, lungs and spleen − were collected and stored at 80°C. However, only livers were TABLE 1. Classification and general features of Bartonella used for the present study. gabonensis sp. nov. strain 669T Total DNA was extracted from liver of rodent on the Bio- Evidence Robot EZ1 device (Qiagen, Courtaboeuf, France) using a MIGS ID Property Term codea commercial EZ1 DNA/RNA tissue kit (Qiagen) following the Current classification manufacturer’s instructions. Real-time quantitative PCR (qPCR) Domain Bacteria TAS Phylum Proteobacteria TAS was performed to screen all rodent samples for Bartonella sp. Class Alphaproteobacteria TAS Order Rhizobiales TAS using the following primers: Barto ITS3, forward: Family Bartonellaceae TAS GATGCCGGGGAAGGTTTTC, and reverse: ITS3 Genus Bartonella TAS Species Bartonella gabonensis IDA GCCTGGGAGGACTTGAACCT, and probe: Barto ITS3 P Type strain 669T IDA Gram stain Negative IDA 6FAM-GCGCGCGCTTGATAAGCGTG. Conventional PCR Cell shape Rod IDA Motility Nonmotile IDA was performed on all qPCR-positive samples using following Sporulation Nonsporulating IDA Temperature range Mesophilic IDA primers: Urbarto1: 5’ CTTCGTTTCTCTTTCTTCA 3’ for Optimum temperature 37°C IDA MIGS-22 Oxygen requirement Aerobic IDA forward; and reverse, Urbarto2: CTTCTCTTCA- Carbon source Unknown IDA Energy source Unknown IDA CAATTTCAAT, as previously described [12,13]. MIGS-6 Habitat Rodents liver IDA From a total of 198 rodents tested by qPCR for Bartonella MIGS-15 Biotic relationship Facultative intracellular IDA Pathogenicity Unknown IDA sp., only five rodents from two districts and an island savannah Biosafety level 3 IDA MIGS-14 Isolation Lophuromys sp. IDA were infected, as follows: in Potos district, one (6.7%) of 15 B. MIGS-4 Geographic location Franceville, Gabon IDA MIGS-5 Sample collection 14 April, 2014 IDA elizabethae were infected; Sable district, one (4%) of 25 with MIGS-4.2 Latitude 1° 37’ 59.9" S IDA MIGS-4.3 Longitude 13° 34’ 59.9" E IDA B. massiliensis; and savannah, three (9.7%) of 34 with what is MIGS-4.4 Altitude 372 m IDA apparently a novel Bartonella genotype (Mangombi et al., un- MIGS, Minimum Information About a Genome Sequence. aEvidence codes are as follows: IDA, inferred from direct assay; TAS, traceable published data). Three strains were isolated from livers of author statement (i.e. a direct report exists in the literature). These evidence codes are from the Gene Ontology project (http://www.geneontology.org/GO.evidence. three brush-furred rats of the genus Lophuromys shtml). If the evidence code is IDA, then the property should have been directly (MT256381.1). Bartonella strains were cultured as previously observed, for the purpose of this specific publication, for a live isolate by one of the authors, or by an expert or reputable institution mentioned in the acknowledge- reported [7,8,14]. ments. © 2020 The Authors. Published by Elsevier Ltd, NMNI, 38, 100796 This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). NMNI Mangombi et al. Taxonogenomics: genome of a