Role of Folp1 and Folp2 Genes in the Action of Sulfamethoxazole and Trimethoprim Against Mycobacteria

J. Microbiol. Biotechnol. (2015), 25(9), 1559–1567 http://dx.doi.org/10.4014/jmb.1503.03053 Research Article Review jmb

Role of folP1 and folP2 Genes in the Action of Sulfamethoxazole and Trimethoprim Against Mycobacteria Tianzhou Liu1,2, Bangxing Wang2,3, Jintao Guo2, Yang Zhou2, Mugweru Julius2, Moses Njire2, Yuanyuan Cao2,3, Tian Wu2, Zhiyong Liu2, Changwei Wang2, Yong Xu2, and Tianyu Zhang 2*

1School of Life Sciences, University of Science and Technology of China, Hefei, Anhui 230027, P.R. China 2State Key Laboratory of Respiratory Disease, Guangzhou Institutes of Biomedicine and Health, Chinese Academy of Sciences, Guangzhou, Guangdong 510530, P.R. China 3School of Life Sciences, Anhui University, Hefei, Anhui 230601, P.R. China

Received: March 16, 2015 Revised: April 20, 2015 The combination of trimethoprim (TMP) and sulfamethoxazole (SMX) has been shown to be Accepted: April 21, 2015 active against Mycobacterium tuberculosis (Mtb) in clinical tuberculosis (TB) treatment. However, the mechanism of action of TMP-SMX against Mtb is still unknown. To unravel this, First published online we have studied the effect of TMP and SMX by deleting the folP2 gene in Mycobacterium April 23, 2015 smegmatis (Msm), and overexpressing the Mtb and Msm folP1/2 genes in Msm. Knocking out *Corresponding author of the folP2 gene in Msm reduced the minimum inhibitory concentration of SMX 8-fold Phone: +86-18819181735/ compared with wild type. Overexpression of the folP1 genes from Mtb and Msm increased the +86-2032015270; Fax: +86-2032015270; MICs by 4- and 2-fold in Msm for SMX and TMP, respectively. We show a strong correlation E-mail: [email protected]/ between the expression of folP1 and folP2 genes and TMP-SMX resistance in mycobacteria. [email protected] This suggests that a combination of FolP2 inhibitor and SMX could be used for TB treatment pISSN 1017-7825, eISSN 1738-8872 with a better outcome.

Introduction Sulfamethoxazole (SMX) and trimethoprim (TMP) are such potential candidates for TB treatment, having been Tuberculosis (TB) is a chronic disease caused by used in drug regimens for the treatment of various bacterial Mycobacterium tuberculosis (Mtb). The emergence of multidrug infections of the respiratory, urinary, and gastrointestinal resistance (MDR), defined as resistance to at least the two tracts for more than 40 years [1, 10]. TMP and SMX target main first-line anti-TB drugs, rifampicin and isoniazid; successive steps of the folate biosynthesis pathway. SMX extensively drug resistance (XDR), defined as MDR strains inhibits the dihydropteroate synthase (DHPS) activity, that are also resistant to a fluoroquinolone and at least one which catalyzes the addition of dihydropterindiphosphate second-line injectable agent such as amikacin, kanamycin to p-aminobenzoic acid (PABA), a structural analog of (KAN), or capreomycin; and the more severe totally drug SMX. The product of DHPS, 7,8-dihydropteroate (DHP), resistance (TDR), defined as Mtb strains resistant to all reacts with glutamate to form dihydrofolate (DHF), which first- and second-line anti-TB drugs, is an urgent medical is reduced to tetrahydrofolate (THF) by dihydrofolate and public health concern, as the available anti-TB drugs reductase (DHFR), the target of TMP (Fig. 1). Bacteria, exhibit limited efficacy [20, 26]. Development of new drugs fungi, and plants synthesize folate de novo, but mammals is time-consuming, difficult, and expensive. However, if lack DHPS and therefore cannot produce folate. THF is an already existing clinically established effective drugs could essential co-factor involved in the transfer of a one-carbon be used for treatment of TB, then faster and cheaper drug unit and is implicated in the biosynthesis of purines and development coupled with effective TB management would pyrimidines and in the biosynthesis and catabolism of be attained. some amino acids. The combination of TMP and SMX

September 2015 ⎪ Vol. 25⎪ No. 9 1560 Liu et al.

Fig. 1. SMX and TMP target the folate pathway in mycobacteria. SMX: sulfamethoxazole; TMP: trimethoprim; PABA, p-aminobenzoic acid; DHP: 7,8-dihydropteroate; DHFS: dihydrofolate synthase; DHF: dihydrofolate; THF: tetrahydrofolate; DHFR: dihydrofolate reductase. prevents the emergence of drug resistance and has been that SMX inhibited 80% growth in 117 Mtb clinical isolates demonstrated to be synergistic in many bacteria [3, 10]. at an MIC90 of 9.5 mg/l, regardless of their susceptibility to Vilcheze and Jacobs suggested that the folate biosynthesis the first-line agents. When used in combination with pathway could be a good Mtb target for drug development rifampicin or isoniazid, SMX and TMP have been shown to [19]. be bactericidal and prevent the emergence of drug Forgacs et al. [7] reported that drug-susceptible and resistance in Mtb [11, 19]. Recently, 100 Mtb isolates, drug-resistant Mtb strains were susceptible to TMP/SMX including 48 MDR-TB and 13 XDR-TB, were tested. All the with a bacteriostatic activity of 2/38 µg/ml. Subsequently, isolates had MICs 38 mg/l of SMX, whereas it was less an analysis of 12 drug-susceptible Mtb clinical isolates active inside the macrophages. This implied SMX could be from Australia revealed a susceptibility concentration of a treatment option in selected MDR and XDR TB cases in below 38 µg/ml to SMX [13]. A clinical case study of a patient the initial phase [6]. The analysis of complete genome data infected with an XDR Mtb strain reported susceptibility to revealed the presence of two genes in mycobacteria, folP1 TMP-SMX at 1/19 µg/ml [4]. Huang et al. [9] demonstrated and folP2, which encode proteins that have homology to

J. Microbiol. Biotechnol. folP1/2 Gene and Sulfamethoxazole-Trimethoprim in Mycobacteria Treatment 1561

Fig. 2. Comparison of binding mode of SMX in YpDHPS and Mtb FolP1. (A) Crystal structure of the YpDHPS with SMX (green) complex (PDB: 3TZF). (B) Predicted binding mode of SMX (yellow) with Mtb FolP1. PtP in the active site is shown in sticks (grey). Key residues of the binding site are shown as lines and the hydrogen bonds are labeled as red dash lines.

respectively, to maintain vector constructs. HYG and KAN DHPS in other bacteria [5, 21]. The overall structure of (Invitrogen) were added at 150 µg/ml and 40 µg/ml, respectively, FolP1 and FolP2 showed a “TIM barrel” fold (n =8, S=8) for Msm when required. SMX and TMP were purchased from with eight α-helices surrounding a central barrel composed Sigma and dissolved in DMSO. of eight parallel β-strands (Fig. 2). The structure and key residues essential for substrate binding of FolP1 and FolP2 Vector Construction of pblMsfp2LRH are highly conserved, with the two proteins sharing only To delete the folP2 gene in Msm, the plasmid pBluescript II about 30% amino acid identity [2, 8, 12]. In mycobacteria, SK(+) was used to construct the vector pblMsfp2LRH. The the folP1 gene is located within the folate operon, whereas upstream 884 bp DNA fragment (ArmL) and the downstream folP2 is organized with genes belonging to fatty acid 982 bp DNA fragment (ArmR) of folP2 were amplified using primers Msfolp2L and Msfolp2R (Table 2), respectively. The two metabolism [5]. It has been shown that the product fragments were cloned into KpnI-EcoRI sites of pBluescript II encoded by the respective folP1 gene exhibited DHPS SK(+) by 3-fragment ligation to form vector pblMSfp2LR, which activity in mycobacteria [12], and folP1 was found to be was verified by restriction digestion and sequencing. The dif-HYG- essential for growth [15]. However, the function of folP2 dif from plasmid pTYdHm [22] was inserted into pblMSfp2LR at has not yet been established. the HindIII site to construct pblMsfp2LRH (Fig. 3). This study thus sets out to explore the role of folP1/ folP2 genes in TMP-SMX resistance in mycobacteria by Construction of the Msm Gene Knockout Mutants gene knockout, overexpression, and drug susceptibility The fragment containing the ArmL–dif-Hyg-dif–ArmR was experiments. excised from vector pblMSfp2LRH at the KpnI and EcoRI sites and transformed into induced Msm-TS53 (Msm containing pJV53Ts) competent cells as previously described [18, 22]. The folP2 gene Materials and Methods was replaced by the Hyg gene through allelic replacement. To remove the Hyg gene, the mutants were cultured into fresh 7H9 Bacterial Strains and Media broth without HYG for 3 days. To remove vector pJV53Ts, the E. coli DH5α was grown at 37°C in Luria Bertani (LB) broth and mutants were cultured into fresh 7H9 broth at 42°C for 3 days, agar. Mycobacterium smegmatis (Msm) mc2155, its mutants, and serially diluted 10-fold and plated onto 7H11 plates containing Mtb H37Rv were grown in Middlebrook 7H9 broth (Difco) 10% sucrose, and incubated at 42°C for 72 h. The loss of the vector supplemented with 10% oleic acid albumin dextrose catalase pJV53Ts in the mutants was subsequently confirmed by plating (OADC) and 0.05% Tween 80, or on solid Middlebrook 7H11 100 colonies in 7H11 plates containing 10% sucrose and KAN or in medium (Difco) supplemented with 10% OADC or containing 10% 7H11 plates containing 10% sucrose at 42°C. sucrose if necessary (Table 1). Hygromycin (HYG; Roche) and Successful folP2 gene deletion was confirmed by PCR using ampicillin (AMP; Sigma) were added at 200 µg/ml and 100 µg/ml,

September 2015 ⎪ Vol. 25⎪ No. 9 1562 Liu et al.

Table 1. Bacterial strains and plasmids in this study. Source or Strains/plasmids Relevant characteristic(s) reference E. coli DH5α General-purpose cloning strain; F- [ϕ80d lacZ∆M15] ∆D (lacZYA-argF) U169 deoR recA1 [24] endA1 hsdR17 glnV44 thi-1 gyrA96 relA M. smegmatis mc2155 (Msm) Highly transformable derivative of ATCCa 607 [16] Msm-TS53 Msm containing pJV53Ts [22] Msm::p60fp1 Msm containing p60fp1 This study Msm::p60fp2 Msm containing p60fp2 This study Msm::p60Msfp1 Msm containing p60Msfp1 This study Msm::p60Msfp2 Msm containing p60Msfp2 This study Msm∆ folP2 Msm deleted folP2 gene This study Msm∆ folP2-H Msm deleted folP2 gene without Hyg This study Msm∆ folP2-5H Msm deleted folP2 gene without Hyg and pJV53Ts This study M. tuberculosis H37Rv (Mtb) Widely used virulent laboratory Mtb strain, ATCCa 27294 [17] p60lux pNBV1 carrying the luxAB gene under the hsp60 promoter [14] p60luxN p60lux was truncated with 18 bp at the 3’ of hsp60 promoter to remove the six amino This study acids for fusion expression and was introduced the ATG of NdeI as the initiation codon pTYdHm pUC19 containing dif-ΩHYG-dif d,e at KpnI-HindIII sites [22] pJV53Ts gp60/61, sacB, KANr,c [22] pBluescript II SK(+) AMPr, ori, general-purpose cloning vectorb Stratagene p60fp1 p60lux containing Mtb folP1 gene at BamHI–HindIII sites This study p60fp2 p60lux containing Mtb folP2 gene at BamHI–HindIII sites This study p60Msfp1 p60luxN containing Msm folP1 gene at NdeI–HindIII sites This study p60Msfp2 p60luxN containing Msm folP2 gene at NdeI–HindIII sites This study pblMsfp2LR pBluescript II SK(+) containing ArmL-ArmRf,h at KpnI-EcoRI sites This study pblMsfp2LRH pblMsfp2LR containing dif-ΩHYG-dif d,e at HindIII site This study aATCC: The American Type Culture Collection; bAMPr: ampicillin resistance gene; cKANr: kanamycin resistance gene; dHYG: hygromycin resistance gene; edif: the action site of the XerCD recombinase; fArmL: The upstream 884 bp DNA fragment of Msm folP2 gene; hArmR: the downstream 982 bp DNA fragment of Msm folP2 gene.

primers a, b, c, and d (Table 2) as previously described [22] and marker were used as the parental plasmids for the construction of Southern blot analysis using the Ms0615–0616 gene-deleted p60fp1, p60fp2, p60Msfp1, and p60Msfp2. The plasmid p60luxN mutant and wild-type Msm as controls. Genomic DNAs from the was constructed by modifying the hsp60 promoter in p60lux to folP2 and Ms0615–0616 gene knockout mutant and wild-type Msm remove the sequence expressing the six amino acids that were were purified, and digested with PstI and SpeI restriction usually used to express fused proteins. An NdeI restriction enzymes. Similarly, some genomic DNAs were digested with KpnI sequence was introduced with the ATG sequence of NdeI as the as positive controls. DNA probes were labeled and band detection initiation codon by primers P60-f and P60-r (Table 2). was carried out with anti-DIG alkaline phosphatase antibodies The folP1 and folP2 genes were amplified using primers Fp1 and and a CDP-star substrate solution in the DIG High Prime DNA Fp2 (Table 2) from Mtb H37Rv, digested with BamHI and HindIII, Labeling and Detection Starter Kit II (Roche). The folP2 and and then cloned into p60lux digested with the same enzymes to positive probes were generated with primers Msfp2 and Ms0615 construct vectors p60fp1 and p60fp2, respectively, which were (Table 2), respectively. verified by restriction digestion and sequencing. Similarly, the folP1 and folP2 genes were amplified using primer couple Msfp1 Vectors for Overexpressing folP1 and folP2 and Transformation and Msfp2 (Table 2) from Msm, digested with NdeI and HindIII, in Msm and then cloned into p60luxN cut with the same enzymes to The E. coli/mycobacterial shuttle vector p60lux [14] and p60luxN construct vectors p60Msfp1 and p60Msfp2, which were verified (Table 1) carrying the strong promoter hsp60 and HYG resistance by restriction digestion and sequencing. All constructs were

J. Microbiol. Biotechnol. folP1/2 Gene and Sulfamethoxazole-Trimethoprim in Mycobacteria Treatment 1563

Table 2. DNA primers used in this study. Primer Nucleotide sequence (5’-3’) with restriction enzyme sites underlined P60-f CGCTCTAGAGGTGACCACAACGACGCGC P60-r TTGGATCCCATATGGAAGTGATTCCTCCGGATC Fp2-f ATGGATCCAGTGCGTTCAACACCGCCGGCCT Fp2-r GCCAAGCTTTCATGCGAGTCCTCTCACCG Msfp1-f GGGAATTCCATATGAACCCACCGAGCCTGA Msfp1-r GCCAAGCTTTCAGCCAATCTGTCCTCCAGAAGTC Msfp2-f GGGAATTCCATATGTTCTCGACGTTCTGCGGTCGTC Msfp2-r GCCAAGCTTTCATGCCAGTCCCCTCACTGTTCGT Msfp2L-f AGGGCGAATTGGGTACCGTGATCGTCGGAAACGGGCT Msfp2L-r AAGCTTGGACGACCGCAGAACGTCGAGAACAC Msfp2R-f TGCGGTCGTCCAAGCTTAGGGGACTGGCATGACAGCG Msfp2R-r CCGGGCTGCAGGAATTCAGCGGACGCACCTAGCGCG a GAGGAAGTCACGGCGGGTAA b GAGCAGCGGTTTGATGGTCT c CCAAGGACAAGGCGTTCTACAT d CACAGCGGACCTCTATTCACA Hyg-f GTGACACAAGAATCCCTGTTACTT Hyg-r TCAGGCGCCGGGGGC Ms0615-f GACTGGTCGGTGAGATCCTGGCGCG Ms0615-r CGGTCTCGCCGATGTGCTG

Drug Susceptibility Testing The measurement of MICs was adapted from previous works [24, 25]. The MIC values for wild-type and recombinant Msm colonies were determined by culturing on 7H11 agar plates containing 2-fold serial dilutions of SMX (0 to 8 µg/ml) or TMP (0 to 20 µg/ml) for 72 h. The MIC values for each strain were defined as the lowest concentration of SMX or TMP needed to inhibit 99% of bacterial growth.

Growth Analysis of Msm Strains All Msm strains were grown at 37°C with aeration in 7H9 medium (7H9 medium supplemented with 10% OADC, 0.05% Tween 80, and 0.2% glycerol) in the presence or absence of SMX and TMP, and wild-type Msm was used as a control. Samples were taken and measured at OD at 3 h intervals. All assays were Fig. 3. The vector constructed in this study for deleting the 600 folP2 gene in Msm. performed three times. pUC ori: replication region in E. coli; f1(+) ori: origin of replication plasmids for making single-stranded DNA; bla: ampicillin resistance Results gene; Hyg: hygromycin resistance gene; dif: the recombinases XerCD action site; ArmL: The upstream 884 bp DNA fragment of Msm folP2 Construction of Recombinant Strains gene; ArmR: the downstream 982 bp DNA fragment of Msm folP2 gene. To determine the role of folP1 and folP2 genes in the action of SMX and TMP against mycobacteria, we overexpressed the two genes and deleted gene folP2 in transformed into Msm competent cells using standard electroporation Msm. We constructed the vector pblMsfp2LRH for deleting at 4°C. The HYG-resistant colonies were isolated and tested individually by PCR using primers Hyg-f and Hyg-r (Table 2). the folP2 gene in Msm. The fragment carrying the upstream

September 2015 ⎪ Vol. 25⎪ No. 9 1564 Liu et al.

Fig. 4. Diagrammatic illustration of introduction of an unmarked folP2 in-frame deletion in Msm.

Fig. 5. Identification of Msm folP2 gene deletion mutants. PCR products in A and C using primers a+b, B using primers c+d, and D using primers c+b. Lane M, DNA marker; lane 1, PCR products with water as a control; lane 2, PCR products from plasmid pblMsfp2LRH, 1,453 bp and/or 353 bp band (A and C), no product (B and D); lane 3, PCR products from Msm-TS53 (Msm containing pJV53Ts); 1,136 bp (A and C), no product (B), 2,301 bp band (D); lanes 4 and 5, PCR products from Msm∆folP2, 1,453 bp (A and C), 1,350 bp (B), and 1,519 bp (D). A 353 bp fragment was obtained with primers “a” and “b” and a 1,519 bp fragment was obtained with primers “c” and “b” in Msm∆folP2, showing that the some cells had already lost the dif-ΩHYG-dif cassette during incubation without selection (lanes 4 and 5 in A , C, and D).

and downstream of the Msm folP2 from vector pblMsfp2LRH was transformed into competent Msm-TS53 cells. The subsequent Msm transformants were subjected to allelic exchange to disrupt the folP2 gene on their own chromosomes (Fig. 4). The folP2 gene in the recombinant strains was confirmed replaced by the HYG resistance gene by PCR analysis (Fig. 5) and further confirmation by Fig. 6. Southern blot analysis of Msm∆folP2-5H. The folP2 gene as a probe in A and an 804 bp fragment in the Southern blot analysis (Fig. 6). We further found that some MSMEI_0615 gene as a probe in B. Lane 1, Msm; lane 2, Msm∆folP2- recombinant strains had even lost the HYG resistance 5H; lane 3, Ms0615–0616 gene knockout mutant. genes (Fig. 5). To overexpress the folP1 and folP2 genes in

J. Microbiol. Biotechnol. folP1/2 Gene and Sulfamethoxazole-Trimethoprim in Mycobacteria Treatment 1565

Table 3. MIC values for drugs against recombinant mycobacteria. Msm, we constructed the vectors p60fp1, p60fp2, p60Msfp1, MIC (µg/ml) and p60Msfp2 and successfully transformed them into Strain Msm. SMX TMP

Msm 0.5 2.5 Drug Susceptibility Testing Msm∆folP2-5H 0.06 2.5 SMX and TMP susceptibilities of the recombinant and Msm::p60fp1 2.0 10.0 wild-type Msm strains were tested. As shown in Table 3, Msm::p60fp2 0.5 5.0 the MICs of SMX and TMP in wild-type Msm were 0.5 µg/ml and 2.5 µg/ml, respectively. The MICs of SMX and TMP Msm::p60Msfp1 1.0 5.0 for Msm::p60fp1 and Msm::p60Msfp1 increased by 4- and Msm::p60Msfp2 0.5 2.5 2-fold, respectively, compared with wild-type Msm. MIC: minimum inhibitory concentration; SMX: sulfamethoxazole; TMP: Interestingly, we obtained a MIC of 0.08 µg/ml for SMX in trimethoprim; Msm: Mycobacterium smegmatis mc2155; Msm∆folP2-5H: Msm Msm∆folP2, which was an 8-fold reduction compared with deleted folP2 gene without Hyg and pJV53Ts; Msm::p60fp1: Msm containing wild-type Msm, whereas there were no changes in the p60fp1; Msm::p60fp2: Msm containing p60fp2; Msm::p60Msfp1: Msm containing p60Msfp1; and Msm::p60Msfp2: Msm containing p60Msfp2. MICs of TMP. No observable differences were noted in the

Fig. 7. Growth assays for wild-type and recombinant Msm strains in response to SMX and TMP. Growth of wild-type Msm (A), Msm∆folP2 (B), Msm::p60fp1 (C), Msm::p60fp2 (D), Msm::p60Msfp1 (E), and Msm::p60Msfp2 (F) in 7H9 medium with SMX and TMP. The solid lines with open symbols show the growth curves of strains in different concentrations of SMX; the broken lines with solid symbols show the growth curves of strains in different concentrations of TMP. The concentration is in units of µg/ml.

September 2015 ⎪ Vol. 25⎪ No. 9 1566 Liu et al.

MICs of SMX for Msm::p60fp2 and Msm::p60Msfp2 of gene folP1 in Mtb and Msm could probably be responsible compared with wild type. In addition, the MICs of TMP for for the difference in SMX and TMP susceptibilities. Msm::p60fp2 increased 2-fold compared with wild-type We used an improved method to construct an unmarked Msm, whereas there were no changes for Msm::p60Msfp2. Msm recombinant using the modified dif-ΩHYG-dif cassette, as it was easy to remove the resistance gene by the XerCD Growth Analysis of the Recombinant Msm Strains system in mycobacteria. Thus, we obtained unmarked in- We determined the growth curves of wild-type and frame deletion gene knockout strains without polar effect, mutant strains in the presence or absence of SMX and TMP. which is consistent with a recent study by Yang et al. [22]. There were no substantial change on wild-type and mutant We observed an 8-fold reduction in MICs of Msm with the strains in the general growth conditions. However, when deleted folP2 gene compared with wild type, hence different concentrations of SMX and TMP were added to confirming that the gene is perhaps associated with the challenge their growth, all strains grew more slowly than action of SMX against mycobacteria. their respective controls, as similarly observed in the MIC We found that overexpression of Mtb folP2 in Msm determination (Fig. 7). increased the MICs by 2-fold, whereas no changes were observed for Msm folP2 overexpressed in Msm compared Discussion with wild type for both SMX and TMP, respectively. This imperative bacterial inhibition could perhaps explain the Since 2009, several studies [6, 7, 9, 11, 13, 19] have role of gene folP2 in SMX susceptibility in Msm and Mtb. reported that TMP and SMX could be used in the treatment Surprisingly, we report the same MICs for Msm deleted of TB. Although not listed in the World Health Organization folP2 gene and the wild type in TMP. Previous work by guidelines for TB treatment, TMP and SMX could be Gengenbacher et al. [8] reported that folP2 does not encode potential candidates for evaluation against Mtb. TMP-SMX a DHPS and therefore cannot act as bypass for gene folP1 in has been in use for prophylactic treatment of patients with Mtb. However, our results revealed that the folP2 gene has HIV in combination with other drugs, and TB co-infection a role in SMX efficacy against mycobacteria, although the with HIV has been a big challenge in the control and mechanism remains unknown (Fig. 1). Computational management of TB. Excessive use of antimicrobial drugs, protein-ligand docking analysis (Fig. 2) revealed the drug including TMP/SMX, has been known to be widespread in binding site of SMX in Mtb to perfectly fit the PABA developing countries, causing spread of serious antibiotic binding pocket, with the negatively charged oxygen atoms resistance strains that hamper the effective treatment of of the sulfonyl group matching the PABA carboxyl group infectious diseases. The establishment of the mechanism of and their common phenyl groups engaging the same action of SMX and TMP against Mtb, which could contribute hydrophobic pocket in the substructure as similarly to better treatment therapy, is highly needed. Therefore, a observed in Yersinia pestis DHPS (YpDHPS) [23]. clear understanding of the resistance mechanisms of these In summary, our study provides an alternative explanation two drugs in mycobacteria is urgently needed. of the effects of SMX and TMP and their respective mode of In this study, we attempted to explore the role of the action against Msm, which could be adopted in a TB folP1 and folP2 genes in the mechanism of TMP and SMX treatment scheme. Moreover, we suggest the use of folP1 against mycobacteria. Since the folP1 gene is essential in and folP2 as drug targets. A combination of FolP2 inhibitor mycobacteria, we just deleted the folP2 gene and and SMX (the FolP1 inhibitor) used for TB could have a overexpressed both genes in Msm and examined whether better treatment outcome. overexpression of the two genes using a strong promoter in Msm would lead to increased resistance to SMX and TMP. Acknowledgments We found that overexpression of Mtb folP1 and Msm folP1 in Msm increased MICs 4- and 2-fold compared with wild This work was supported by the Chinese Academy of type. A similar pattern was observed in the MICs of TMP Sciences “One Hundred Talents Program” (Category A, to against folP1 mutants, which indicated that the folP1 gene is T.Z.), and the Key Program of the Chinese Academy of evidently associated with the action mechanism of TMP Sciences (KJZD-EW-L02). We thank Professor Jiaoyu Deng and SMX in mycobacteria. This probably explains why at Wuhan Institute of Virology, Chinese Academy of SMX is more effective against Msm than Mtb and the Sciences for providing us with the Mycobacterium smegmatis observed TMP resistance in Mtb. The intrinsic differences mc2155, and Professor Riccardo Manganelli from University

J. Microbiol. Biotechnol. folP1/2 Gene and Sulfamethoxazole-Trimethoprim in Mycobacteria Treatment 1567

of Padua, Italy, for providing us the plasmid pJV53 as a Cloning and expression of Mycobacterium tuberculosis and gift. We are grateful to Jian Tang at Guangzhou Institutes Mycobacterium leprae dihydropteroate synthase in Escherichia of Biomedicine and Health, Chinese Academy of Sciences, coli. J. Bacteriol. 181: 6814-6821. China, for the invaluable help in drawing Fig. 1. 13. Ong W, Sievers A, Leslie DE. 2010. Mycobacterium tuberculosis and sulfamethoxazole susceptibility. Antimicrob. Agents Chemother. 54: 2748. References 14. Roberts EA, Clark A, Friedman RL. 2005. Bacterial luciferase is naturally destabilized in Mycobacterium tuberculosis and 1. Alsaad N, Wilffert B, van Altena R, de Lange WCM, van can be used to monitor changes in gene expression. FEMS der Werf TS, Kosterink JGW, Alffenaar JWC. 2014. Potential Microbiol. Lett. 243: 243-249. antimicrobial agents for the treatment of multidrug-resistant 15. Sassetti CM, Boyd DH, Rubin EJ. 2003. Genes required for tuberculosis. Eur. Respir. J. 43: 884-897. mycobacterial growth defined by high density mutagenesis. 2. Baca AM, Sirawaraporn R, Turley S, Sirawaraporn W, Hol Mol. Microbiol. 48: 77-84. WG. 2000. Crystal structure of Mycobacterium tuberculosis 16. Snapper SB, Melton RE, Mustafa S, Kieser T, Jacobs WR. 7,8-dihydropteroate synthase in complex with pterin 1990. Isolation and characterization of efficient plasmid monophosphate: new insight into the enzymatic mechanism transformation mutants of Mycobacterium smegmatis. Mol. and sulfa-drug action. J. Mol. Biol. 302: 1193-1212. Microbiol. 4: 1911-1919. 3. Bushby SRM. 1973. Trimethoprim-sulfamethoxazole: in vitro 17. Tan YJ, Hu ZQ, Zhang TY, Cai XS, Kuang HB, Liu YW , et microbiological aspects. J. Infect. Dis. 128: S442-S462. al. 2014. Role of pncA and rpsA gene sequencing in detection 4. Cohen-Bacrie S, Ben Kahla I, Botelho-Nevers E, Million M, of pyrazinamide resistance in Mycobacterium tuberculosis Parola P, Brouqui P, Drancourt M. 2011. Imported extensively isolates from Southern China. J. Clin. Microbiol. 52: 291-297. drug-resistant Mycobacterium tuberculosis Beijing genotype, 18. van Kessel JC, Hatfull GF. 2008. Mycobacterial Marseilles, France, 2011. Euro Surveill. 16: 7-8. recombineering. Methods Mol. Biol. 435: 203-215. 5. Cole ST, Brosch R, Parkhill J, Garnier T, Churcher C, Harris 19. Vilcheze C, Jacobs WR Jr. 2012. The combination of D, et al. 1998. Deciphering the biology of Mycobacterium sulfamethoxazole, trimethoprim, and isoniazid or rifampin is tuberculosis from the complete genome sequence. Nature 393: bactericidal and prevents the emergence of drug resistance 537-544. in Mycobacterium tuberculosis. Antimicrob. Agents Chemother. 6. Davies Forsman L, Schön T, Simonsson US, Bruchfeld J, 56: 5142-5148. Larsson M, Juréen P, et al. 2014. Intra- and extracellular 20. Wang L, Zhang H, Ruan Y, Chin DP, Xia Y, Cheng S , et al. activities of trimethoprim-sulfamethoxazole against susceptible 2014. Tuberculosis prevalence in China, 1990-2010; a longitudinal and multidrug-resistant Mycobacterium tuberculosis. Antimicrob. analysis of national survey data. Lancet 383: 2057-2064. Agents Chemother. 58: 7557-7559. 21. Williams DL, Spring L, Harris E, Roche P, Gillis TP. 2000. 7. Forgacs P, Wengenack NL, Hall L, Zimmerman SK, Dihydropteroate synthase of Mycobacterium leprae and dapsone Silverman ML, Roberts GD. 2009. Tuberculosis and resistance. Antimicrob. Agents Chemother. 44: 1530-1537. trimethoprim-sulfamethoxazole. Antimicrob. Agents Chemother. 22. Yang F, Tan YJ, Liu J, Liu TZ, Wang BX, Cao YY , et al. 2014. 53: 4789-4793. Efficient construction of unmarked recombinant mycobacteria 8. Gengenbacher M, Xu T, Niyomrattanakit P, Spraggon G, using an improved system. J. Microbiol. Methods 103: 29-36. Dick T. 2008. Biochemical and structural characterization of 23.Yun MK, Wu YN, Li ZM, Zhao Y, Waddell MB, Ferreira the putative dihydropteroate synthase ortholog Rv1207 of AM, et al. 2012. Catalysis and sulfa drug resistance in Mycobacterium tuberculosis. FEMS Microbiol. Lett. 287: 128-135. dihydropteroate synthase. Science 335: 1110-1114. 9. Huang TS, Kunin CM, Yan BS, Chen YS, Lee SS, Syu W Jr. 24. Zhang TY, Bishai WR, Grosset JH, Nuermberger EL. 2010. 2012. Susceptibility of Mycobacterium tuberculosis to Rapid assessment of antibacterial activity against sulfamethoxazole, trimethoprim and their combination over a Mycobacterium ulcerans by using recombinant luminescent 12 year period in Taiwan. J. Antimicrob. Chemother. 67: 633-637. strains. Antimicrob. Agents Chemother. 54: 2806-2813. 10. Huovinen P, Sundstrom L, Swedberg G, and Skold O. 1995. 25. Zhang TY, Li SY, Nuermberger EL. 2012. Autoluminescent Trimethoprim and sulfonamide resistance. Antimicrob. Agents Mycobacterium tuberculosis for rapid, real-time, non-invasive Chemother. 39: 279-289. assessment of drug and vaccine efficacy. PLoS ONE 7: 11. Macingwana L, Baker B, Ngwane AH, Harper C, Cotton e29774. MF, Hesseling A, et al. 2012. Sulfamethoxazole enhances the 26. Zhao YL, Xu SF, Wang LX, Chin DP, Wang SF, Jiang GL , et antimycobacterial activity of rifampicin. J. Antimicrob. Chemother. al. 2012. National survey of drug-resistant tuberculosis in 67: 2908-2911. China. N. Engl. J. Med. 366: 2161-2170. 12. Nopponpunth V, Sirawaraporn W, Greene PJ, Santi DV. 1999.

September 2015 ⎪ Vol. 25⎪ No. 9