Expression and Functional Characterization of LRRC4, a Novel Brain-Specific Member of the LRR Superfamily

View metadata, citation and similar papers at core.ac.uk brought to you by CORE

provided by Elsevier - Publisher Connector

FEBS Letters 579 (2005) 3674–3682 FEBS 29683

Expression and functional characterization of LRRC4, a novel brain-speciﬁc member of the LRR superfamily

Qiuhong Zhanga,1, Jieru Wanga,b,1, Songqing Fana, Lili Wanga, Li Caoa, Ke Tanga, Cong Penga, Zheng Lia, Weifang Lia, Kai Gana, Zhongqi Liua, Xiaoling Lia, Shourong Shenc, Guiyuan Lia,* a Cancer Research Institute, Central South University, Changsha 410078, Hunan, PeopleÕs Republic of China b School of Public Health, Central South University, Changsha 410078, Hunan, PeopleÕs Republic of China c The Third Aﬃliated Hospital of Xiang Ya School of Medicine, Central South University, Changsha 410078, Hunan, PeopleÕs Republic of China

Received 28 February 2005; revised 20 April 2005; accepted 9 May 2005

Available online 13 June 2005

Edited by Lukas Huber

sias. Loss of heterozygosity (LOH) of markers on human chro- Abstract LRRC4, a novel member of LRR superfamily thought to be involved in development and tumorigenesis of the mosome 7q are frequently encountered in malignant myeloid nervous tissue, has the potential to suppress tumorigenesis and disorders as well as in head and neck, breast, prostate, ovarian, cell proliferation of U251MG cells. This study aimed at reveal- colon, gastric, pancreatic, and renal cell carcinomas [1,2]. Our ing the correlation between expression of LRRC4 and the main- previous studies demonstrate there is the LOH on chromo- tenance of normal function and tumorigenesis suppression within some 7q31-ter in nasopharyngeal carcinoma [3,4]. Introduc- the central nervous system. We systematically analyzed the tion of an intact copy of human chromosome 7 restored expression and tissue distributions of the gene in tissues. Results senescence of immortalized human fibroblast cell lines harbor- showed that LRRC4 expression was limited to normal adult ing LOH of markers within 7q31-32 and inhibited the tumor- brain, both in human and in mouse, and exhibited a develop- igenic phenotype of a murine squamous cell carcinoma cell line ment-regulated pattern, but was down-regulated in brain tumor [5]. These studies indicated that one or more tumor suppressor tissues and U251MG cell line. Furthermore, dynamic alterations in gene expression associated with cell cycle progression were genes are located at chromosome 7q. investigated by using Tet-on system. Results showed that Employing an EST-mediated screening strategy [6], we have LRRC4 induced a cell cycle delay at the late G1 phase, probably identified a potential tumor suppressor gene encoding a leu- through the alteration of the expression of different cell cycle cine-rich repeat (LRR) protein on 7q31-ter designated as regulating proteins responsible for mediating G1-S progression, LRRC4 (GenBank accession number is AF196976). LRRC4 such as p21Waf1/Cip1 and p27Kip1, Cdk2 and PCNA, p-ERK1/2. specifically expresses in human normal brain tissues and is These findings suggest that LRRC4 may play an important role down-regulated in primary brain tumor biopsies, especially in maintaining normal function and suppressing tumorigenesis in in gliomaÕs [7]; it has the potential of suppressing U251MG the central nervous system. tumorigenesis and cell proliferation [8]. LRR domains are 2005 Federation of European Biochemical Societies. Published known to mediate protein–protein interactions and cell adhe- by Elsevier B.V. All rights reserved. sion. Many of LRR containing proteins contribute to the dif- Keywords: LRRC4; Leucine-rich repeat; Brain specific; ferentiation and development of a variety of tissues as Glioma; Suppression; Cell proliferation receptor-binding ligand, particularly to the nervous tissue [9,10]. On the basis of the structural property, expression pattern, and map location, LRRC4 may be a candidate tumor suppressor gene on 7q31-32. To further verify and demonstrate the functional character- 1. Introduction ization of LRRC4, we systematically analyzed the localization of this protein in the cells and its mRNA distribution in tissues; A growing body of evidences indicates that the long arm of we also investigated the potential molecular mechanism of human chromosome 7 is associated with many types of neopla- LRRC4 on inhibiting glioma tumorigenesis by flow cytometry and Western blot analysis using Tet on system [11,12]. *Corresponding author. Fax: +86 731 480 5383. E-mail address: [email protected] (G. Li).

1 These authors contributed equally to this work. 2. Materials and methods

Abbreviations: LRRC4, leucine rich repeat containing 4; LRR, leucine 2.1. Computer-assisted analysis rich repeat; LOH, loss of heterozygosity; ESTs, expressed sequence Database searches were carried out using BLAST and Swiss-Prot. tags; CDKI, cyclin-dependent kinase inhibitor; CDK, cyclin-depen- Motif searches were performed with PSORT and SMART program. dent kinase; Tet, tetracycline; ORF, open reading frame; Dox, doxy- Comparison of sequence was carried out using ClustalW (www.ebi.a- cycline; GAC1, glioma amplified on chromosome 1 protein; LGI-1, c.uk/clustalw) and BOXSHADE (http://bioweb.pasteur.fr/seqanal/ leucine-rich gene, glioma-inactivated-1; ISLR, immunoglobulin super- interfaces/boxshade). All bioinformatics tools including the open read- family containing LRR; NGL-1, netrin G1 ligand; PCNA, proliferating frame (ORF) identification in the paper could be found at the ing-cell nuclear antigen; ERK1/2, extracellular receptor-activated NCBI (National Center for Biotechnology Information) server kinases 1/2; MAPK, mitogen-activated protein kinase; PBS, phos- (www.ncbi.nlm.nih.gov) and molecular biology server of the Swiss phate-buffered saline; FBS, fetal bovine serum Institute of Bioinformatics (www.expasy.ch).

0014-5793/$30.00 2005 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.febslet.2005.05.058 Q. Zhang et al. / FEBS Letters 579 (2005) 3674–3682 3675

2.2. Reverse transcription (RT) PCR for LRRC4 expression by semi-quantitative RT-PCR using avian mye- Total RNA was extracted using Trizol reagent according to the loblastosis virus reverse transcriptase system (Promega) and Northern guide of manufacturer (Gibco-BRL). After being treated with blot. Two positive U251MG Tet-on cell lines expressing LRRC4 cell DNase-I, 1–2 lg of total RNA was reverse transcribed with oligo clones were selected to develop the following experiments. Primer (dT) using cDNA synthesis kit (Promega). The subsequent PCRs were and probe sequences were chosen using Primer 3 (www-genome.wi. performed using Taq polymerase and the buffer (Promega) supplied mit.edu). The LRRC4 cDNA from stably transfected cell lines was with 0.2 mM dNTPs and 0.2 uM primers. Primers corresponding to amplified by using a forward primer (50 ttggcccacaataacctctc 30) and the ESTs, human LRRC4 and its mouse homology sequence were cho- a reverse primer (50 acaggcttgtactttcgcgt 30). As an internal control, sen by using Primer 3 (www-genome.wi.mit.edu). A housekeeping b-actin was analyzed in parallel by using a forward primer (50 tccgtgga- gene, GAPDH was amplified as internal control to normalize the rela- gaagagctacga 30) and a reverse primer (50 gtacttgagctcagaaggag 30). tive levels of the cDNA. The reaction products were analyzed on 1.5% agarose gels. 2.8. Flow cytometry analysis Cells were seeded 2 · 105 cells in 75-ml cell culture Petri flasks. After 2.3. Northern blot analysis 24 h, the cells were treated with 0.5 lM nocodazole for 7 or 24 h and Human MTN blots containing 2 lg of polyA RNA per lane from 16 then trypsinized, washed, and fixed with 70% ice-cold ethanol at different human tissues and 8 different brain tissues were obtained from 4 C for 30 min. After two washes in ice-cold PBS, the cells were incu- BD Clontech. The 1576 bp LRRC4 cDNA was excised from bated with 100 mg/L propidium iodide (PI) (Sigma) plus 100 mg/L I.M.A.G.E consortium clone 51970, gel-purified, and labeled with RNase overnight at 4 C and analyzed by Flow cytometry using a [a-32P] dCTP using the Random prime kit (Promega). Hybridization 488-nm Argon laser and FL2-A detection line. DNA content fre- was carried out at 68 C overnight in Express Hyb (Clontech). Member quency histograms were deconvoluted using MODFIT LT software was washed at increasing stringency up to a final wash of 1· SSC, 0.1% (Verity, Topsham, ME). Values were expressed as mean and error (w/v) SDS at 65 C. The membranes were subsequently re-hybridized deviation of three independent experiments. with b-actin probe. 2.9. Western blot analysis 2.4. In situ hybridization Cells were collected by centrifugation at 12 000 rpm for 10 min, and The probe, LRRC4-cDNA, was labeled with digoxigenin-11-dUTP then the pellets were resuspended in lysis buffer (1% Nonidet P-40, by random priming according to the protocol of the manufacturer 1 mmol/L, 40 mmol/L Tris hydrochloride, pH 8.0, and 150 mmol/L (Boehinger Mannheim, Indianapolis, IN). The ISH detection methods NaCl) at 4 C for 30 min. Protein concentrations were determined have been previously described with minor modifications [13]. Briefly, using BCA protein assay (Pierce) examined with Microplate Reader 5-lm-thick sections were deparaffinized, rehydrated, digested with (Bio-Tek, Elx800) at 570 nm. Cell lysates (80 lg protein per lane) cells 2.0 mg/L proteinase K at 37 C for 15 min, and dehydrated. The slides were lysed in SDS/PAGE sample buffer with complete protease inhib- were incubated with prehybridization solution at 37 C for 2 h and itors (Roche), separated by SDS/PAGE and transferred to PVDF hybridized with LRRC4 probe 37 C overnight before being washed (Amersham Biosciences). Blot were incubated with PCNA(sc-56) (San- with graded saturated solutions of sodium citrate and treated with ta Cruz Biotechnology) which is mouse antibody and p21Waf/Cip(H- anti-digoxigenin horseradish peroxidase Fab fragments (anti-DIG- 164, sc-756), p27Kip1(c-19), p-ERK1/2(CST), ERK1/2(CST) and POD). The color was brought out by the 3-amino-9-ethylcarbazole Cdk2(M2, sc-163) (Santa Cruz Biotechnology) which are rabbit anti- (AEC) and counterstained with hematoxylin. bodies; Followed by a horseradish peroxidase conjugated anti-mouse or anti-rabbit antibody (Santa Cruz Biotechnology), developed by 2.5. Construction of expression vectors for LRRC4 and transient using Supersignal chemiluminescence reagents (Pierce), and exposed transfection to X-ray film. The 1962 bp full length coding region of LRRC4 cDNA was amplified by PCR with a forward primer (50 cgtggatccatgaagctcttgggcag 30) and a reverse primer (50 cgggaattctcatatttgagtttcctg 30) using brain cDNA library as template. The PCR amplification was performed 3. Results for 30 cycles of denaturation (94 C, 30 s), annealing and extension (70 C, 4 min), using the advantage2 PCR kit. The PCR-amplified 3.1. Molecular characterization of LRRC4 product was then subcloned into the pGEM-T Easy vector. The full As shown in Fig. 1A, the structural properties of LRRC4 length-coding region was obtained by EcoRI digestion of pGEM-T suggest it is a potential type Ia membrane protein of the Easy-LRRC4 and subcloned into the EcoRI site of the pEGFP-C1 expression vector. After being transformed into JM109 (E. coli) and LRR superfamily [9,14]. LRRC4 contains two hydrophobic identified by sequencing, the pEGFP-C1-LRRC4 fusion plasmid was segments at its N-terminus and C-terminus for sequences rep- transiently introduced into U251MG cell by liposome transfection. resenting a putative signal peptide with a possible cleavage site Localization of fusion protein was observed under the fluorescence between amino acid 41–42 and a transmembrane region, microscope (Olympus). respectively. Following the signal peptide, the LRR region consists of nine and a half times tandem arrays of LRRs 2.6. Generation of U251MG Tet-on cell lines accompanied by typical amino-flanking (AF) and carboxy- U251MG cells were purchased from American Center for Type Cul- ture Collection (ATCC). U251MG Tet-on Cells, which are stably flanking (CF) clusters [9]; the cysteine-rich clusters flanking transfected with pTetOn (Clontech) and a G418-resistance plasmid, the LRRs are highly conserved in many LRR proteins which were maintained in RMPI 1640 (Invitrogen) supplemented with 10% function as adhesion proteins and receptors (Fig. 1B and C) FBS (Clontech)/100 units/ml penicillin/20 units/ml streptomycin/ [9,14]. Among these LRRC4 shares the highest homology 800 mg/L G418 (Sigma). Then clones were screened by the luciferase activity measured before and after doxycycline induction using scintil- (up to 55% identity and 71% similarity) with NGL-1 (Netrin- lation counting (Germany). G1 ligand) [15]. Adjacent to the carboxy-flanking region, one C2-type Ig-like domain is identified. Similar to the other do- 2.7. Generation of U251MG Tet-on cell lines expressing LRRC4 mains, alignment of LRRC4 with the members of Ig superfam- The doxycycline-inducible LRRC4 expression plasmid pTRE-2hyg- ily revealed the Ig-like domain in LRRC4 showed highest LRRC4 was constructed by inserting the LRRC4 coding sequence into homologue with NGL-1 (up to 56% identity and 72% similar- NotI site of vector pTRE-2hyg (Clontech). To generate stable cell lines, ity) [15]. Furthermore, it is homologous to that domain in neu- U251MG Tet-On cells were transfected with pTRE-2hyg-LRRC4. Each culture was divided into the plates 2 days later, grown for an ron-glia cell adhesion molecule (NCAM) [16], with 42% additional 24 h, and then subjected to selection with 300 mg/L hygro- identity and 48% similarity. LRRC4 also shares up to 39% mycin (Calbiochem)/G418 (Sigma). Resulting colonies were screened identities and 54% similarities with three Ig-like domains of 3676 Q. Zhang et al. / FEBS Letters 579 (2005) 3674–3682

Fig. 1. Molecular characterization of LRRC4. (A) The top is deduced amino acid sequence of LRRC4. The boxed sequences corresponding to the putative N-terminal signal peptide and C-terminal transmembrane region. The nine and a half conserved LRRs are indicated by Roman numerals and alternating shadow, all the residues of the LRR backbone in black squares. The ﬂanking sequence is in bold type. An IgC2 like domain is in black box. The bottom is the consensus sequence comparisons between LRR motif of LRRC4 and a typical LRR. (B, C) Comparisons of amino- and carboxy-terminal LRR-ﬂanking regions from LRRC4 with several members of LRR superfamily. Consensus residues are shadowed in black, conserved residues are shaded in grey.

Robo 2, a transmembrane receptor that plays an important served under ﬂuorescent microscope. As shown in Fig. 2, the role in axon guidance [17,18]. cell membrane localization of LRRC4 was visualized 24 h after transfection, indicating that the human LRRC4 encodes a 3.2. Membrane localization of LRRC4 membrane-bound LRR protein. To provide further support on the subcellular localization of LRRC4, we transiently transfected U251MG cells with 3.3. The distribution of LRRC4 in the tissues pEGFP-C1-LRRC4, a construct containing LRRC4 CDS re- To systematically examine the distributions of LRRC4 gion in the COOH terminus of GFP. Transfected cells were ob- mRNA in human and mouse normal tissues, we performed Q. Zhang et al. / FEBS Letters 579 (2005) 3674–3682 3677

Fig. 2. Subcellular localization of LRRC4 in U251MG cells. The left picture indicates U251MG cells transfected with pEGFP-C1; the right picture indicates U251MG cells transfected with pEGFP-C1-LRRC4.

Northern blot hybridization and RT-PCR analysis. As shown in Fig. 3, LRRC4 mRNA displayed a brain-specific expression pattern both in human and mouse. Three dot nine kb tran- script for LRRC4 was detected in human brain, while not in the other fifteen normal tissues including heart, placenta, lung, liver, skeletal muscle, kidney, pancreas, spleen, thymus, prostate, testis, uterus, small intestine, colon, and peripheral blood leukocyte (Fig. 3A (top)). The expression of LRRC4 in mouse tissues including stomach, skeletal muscle, kidney, liver, heart, spleen, uterus, brain and lung, was similar to that in human tissues (Fig. 3A (bottom)). Fig. 4. RT-PCR analysis of LRRC4 mRNA in developing brain of BALB-C mouse. To further characterize the distribution of LRRC4 expression in brain, Northern blot and in situ hybridization were performed. The result showed that LRRC4 expression in human brain was limited to the following areas such as cerebel- detected (Fig. 3B (top)). In mouse brain, LRRC4 displayed lum, cerebral cortex, occipital pole, frontal lobe, temporal similar expression profile. Interestingly, the positive signals lobe, and putamen, of which, cerebellum accounted for the were observed predominantly in neuroglia-like cell (Fig. 3B highest level. In medulla and spinal cord, LRRC4 was not (bottom)).

Fig. 3. Tissue distributions of LRRC4 mRNA in human and mouse. (A) Distribution of LRRC4 mRNA in normal tissues by Northern blot and RT- PCR. The upper picture indicates human tissues; the lower picture indicates mouse tissue. In all cases, RNA integrity and equal loading are confirmed by b-actin or GAPDH. (B) Expression of LRRC4 mRNA in human and mouse brain. The upper picture shows expression of LRRC4 in human brain by Northern blot. In all cases, RNA integrity and equal loading are confirmed by GAPDH. The lower picture shows expression of LRRC4 in mouse brain by in situ hybridization. Picture B and D are magnified images of that in the inset in picture A and C, respectively. Triangle indicates neuron; arrow indicates neuroglia-like cell. 3678 Q. Zhang et al. / FEBS Letters 579 (2005) 3674–3682

3.4. Expression of LRRC4 in developing brain of mouse was lower background and more favorable inductivity than the Sequence character of human LRRC4 implies this gene may others, moreover, the dose–effect curve and time–effect curve be involved in brain development. To test this notion, total all showed that expression of the 22nd clone was highest at RNA from different stage of developing mouse brain was ex- the dosage of 2.0 mg/L doxycycline at 36 h (data not shown). tracted and reversely transcribed into cDNA. RT-PCR was Therefore, this clone was chosen to construct dual stable carried out to examine the expression of LRRC4 mRNA. U251MG Tet-on cell line expressing LRRC4. Twenty cell lines The result indicated that expression of LRRC4 was higher in stably transfected pTRE-2hyg-LRRC4 were obtained. RT- postnatal brain than that in embryonic stage (Fig. 4). In the PCR and Northern blot confirmed that there was a significant early of the brain development, the expression of LRRC4 in- difference in the expression of LRRC4 in the stable cell lines creased with the age, it reached peaked at P2 and then main- P27 and P28 in the absence and presence of doxycycline. High- tained at a relatively stable level, suggesting a possible role er expression of LRRC4 was indicated at the dosage of 2.0 mg/ of LRRC4 in brain development. L doxycycline at 24 h (Fig. 6).

3.5. Differential expression of LRRC4 in normal and tumor 3.7. Cell-cycle kinetics of U251MG Tet-on cell lines expressing tissue biopsies LRRC4 In order to investigate the possible role of LRRC4 in pri- To test whether the decreased tumorigenesis and cell prolif- mary tumorigenesis, LRRC4 mRNA expression in 448 speci- eration of U251MG reflected a block at a specific stage in the mens was examined by in situ hybridization on multi-tumor cell cycle or apoptosis product, we analyzed their DNA con- tissue microarrays. Fig. 5A showed that expression of LRRC4 tent by PI staining and flow cytometry. Results showed an in- was brain-specific and significant down-regulated in brain tu- creased fraction of cells in the G1-phase and subsequent mor biopsies. Northern blot also showed that LRRC4 expres- decrease in both S- and G2/M-phase in U251MG Tet- sion similar to that by in situ hybridization (Fig. 5B). on-LRRC4 (P27, P28) cell lines after induction by doxycycline (Fig. 7A). But results failed to reveal significant differences in 3.6. Generation of U251MG Tet-on cell lines expressing LRRC4 apoptosis (data not shown). This data suggested that To determine the possible mechanism of LRRC4 for inhibit- LRRC4-mediated growth inhibition may result from a delay ing tumorigenicity, first we established the stable U251MG in G1/S transition rather than from apoptosis. Tet-on cell line and the doxycycline-inducible cell lines Further to analyze the change of cyclins by flow cytometry, U251MG Tet-on with plasmid pTRE-2hyg-LRRC4, 80 cell we found that cyclinD1 and cyclinE was increased, but cyclinA clones were screened by luciferase expressing system measured was markedly decreased when the U251MG Tet-on-LRRC4 by scintillation counting. The results indicated the 22nd clone positive clones (P27 and P28) were exposed to doxycycline

Fig. 5. Expression of LRRC4 mRNA in 14 sorts human normal and neoplastic tissues and expression of LRRC4 mRNA in typical samples of glioma and U251MG cell line by Northern blot. (A) Expression of LRRC4 mRNA in 14 sorts human normal and neoplastic tissues by in situ hybridization on multi-tumor tissue microarrays including 448 specimens. LRRC4 displayed brain-specific expression and significant down-regulation in brain tumor biopsies. (C) LRRC4 displayed significant down-regulation in glioma biopsies and expressed deletion in U251MG cell line. Q. Zhang et al. / FEBS Letters 579 (2005) 3674–3682 3679

Fig. 7. Alteration of cell cycle kinetics in LRRC4 cell lines. (A) Compared with control cell line (U251MG), P27 and P28 all showed a marked delay in accumulation at the G0/G1 phase in the presence of doxycycline (2.0 mg/L). (B) Cyclin analysis showed that cyclinD1 and cyclinE was increased, while cyclinA was markedly decreased when the U251MG Tet-On-LRRC4 positive clones (P27 and P28) induction with doxycycline.

Fig. 6. Generations of U251MG Tet-on cell lines expressing LRRC4. Construction of stable U251MG Tet-on cell lines expressing LRRC4. 20 cell lines stably transfected pTRE-2hyg-LRRC4 cultured with or without doxycycline was analyzed by RT-PCR (not shown) and Northern blot, P27 and P28 were lower basal expression and higher induction with doxycycline. The dose–eﬀect curve and time–eﬀect curve showed that expression of the P27 and P28 clones were highest when the clones were induced by 2.0 mg/L doxycycline at 24 h.

(Fig. 7B). Together, the data indicated that LRRC4 induced a delay of cell cycle in late G1 phase.

3.8. Expression alterations of cell cycle associated molecules regulated by LRRC4 To seek for possible factors involved in a delay in late G1 phase in U251MG, we examined the dynamic changes of cell cycle-related molecules in by Western blot (Fig. 8). We found that in the U251MG Tet-on-LRRC4 cell treated with doxycycline, the expression of Cdk2 was decreased at 4 h and more apparently at 8 h. LRRC4 cause a durative upregulation in expression of p21Waf/Cip and p27Kip1 at the U251MG Tet-on- LRRC4 cell treated with doxycycline from 4 h up to 36 h. As proliferating-cell nuclear antigen (PCNA) and ERK1/2, which mediated, respectively, DNA replication and cell proliferation, are regulated by the CDKs inhibitors p21Waf/Cip and p27Kip1, we investigated the changes in PCNA expression and the Erk1/2 phosphorylation. The results indicated that LRRC4 cause a downregulation in PCNA expression at the Fig. 8. Dynamic expression of cell cycle associated molecules regu- U251MG Tet-on-LRRC4 cell treated with doxycycline from lated by LRRC4. Western blot analysis identities that LRRC4 cause a durative upregulation in p21Waf/Cip and p27Kip1 and resulted in a 16 to 24 h, the reduction was more apparent at 20 h; Similar sequential time-dependent change in the molecules associated with cell to PCNA, the Erk1/2 phosphorylation state was downregula- cycle progression and cell proliferation, such as Cdk2 PCNA and tion from 8 to 24 h, more apparent at 12 h. ERK1/2. 3680 Q. Zhang et al. / FEBS Letters 579 (2005) 3674–3682

4. Discussion LRRC4 cell lines we investigated the potential molecular mechanism of LRRC4 inhibiting tumorigenesis. Cell cycle LRRC4 is a novel brain-specific gene on 7q31-32, encoding studies indicated that the proliferation defect resulted from a putative type Ia transmembrane protein containing nine a G1/S delay in cell-cycle kinetics. The cyclin analysis led to and a half LRRs, a single C2-type Ig-like domain, and is con- the speculation that the delay in G1/S transition might be in- sidered to be a new member of the LRR and Ig superfamily. duced by interrupting the connection between cyclin E and LRRC4 predicted protein structure and its similarity to ner- cyclin A. vous system-expressed LRR proteins such as NGL-1 [15] The eukaryotic cell cycle transition is regulated by the action and LRRN6A [19], suggesting that it is a novel gene of rele- of the cyclin-dependent kinases (CDKs), cdk subunit and a vance in the molecular and cellular neurobiology of verte- regulatory cyclin subunit [38,39]. CyclinE is a necessary and brates. LRR is a repetitive motif made up of several copies rate limiting for the passage of mammalian cells through the of amino acid residues with the conserved sequence G1 phase of the cell cycle, which is expressed in mid G1 phase LxxLxxLxLxxNxLxxLxxxxFxx. This motif is thought to be and associates with Cdk2 kinase [40], while Cdk2 accelerates involved in highly specific protein–protein interactions or cell G1/S transition and S phase progression by combining cyclinE adhesion [9,10]. The Ig C2 has also been implicated in adhe- and activating cyclinA transcription [41]. In addition, mamma- sion or binding to other proteins [20,21]. These motifs can be lian cell cycle is also controlled by antimitogenic signals med- adapted to specific functions by variation and repetition or by iated by the members of p21 family, such as p21Waf1/Cip1 and combination with other motifs. Members containing both p27Kip1. The protein p21Waf1/Cip1, induced by the tumor-sup- LRR and the Ig C2 domain have only been cloned from a pressor protein p53, interacts with and inhibits two different few genes such as Trk receptors [22–24], LIG-1 [25] and ISLR targets essential for cell-cycle progression. One of these is the [26]. Most of these proteins play significant roles in differen- cyclin-CDK family of kinases and the other is the essential tiation and development of tissues such as the CNS. Trk DNA replication factor, PCNA [42–45]. p21Waf1/Cip1 shows receptors are transmembrane glycoproteins containing LRR, to play an essential role in G1 arrest by inhibiting cyclinE- Ig C2, and a cytosolic tyrosine kinase domain [27]. The cdk2 activities [46]; similarly, p27Kip1 blocks cyclinE-depen- LRR and Ig-like domain of Trk receptors have been indi- dent transactivation of cyclinA gene expression causing G1 cated as being important for specific ligand binding [28–30]. arrest [38]. Impairment of a growth stimulatory signaling NGL-1 (Netrin-G1 ligand), a novel transmembrane protein pathway (such as erbB1, raf and MAPK) has been shown to containing LRR and Ig C2 domains, can promote the out- be induced by p21Waf1/Cip1 and p27Kip1 [47–50]. Many antipro- growth of thalamocortical axon via specifically interacting liferative factors mediated an arrest in the G0/G1 cell-cycle with netrin-G1 through its LRR region [15]. NCAM, an phase by induced expression p21Waf1/Cip1 and p27Kip1, result- adhesion molecule containing Ig C2 domain [16], is also able ing in Cdk2 kinase activity inhibition [51–56]. Therefore, in to stimulate neuronal outgrowth and differentiation by acti- order to characterize the molecular pathway by which LRRC4 vating some signaling pathways [31]. These findings suggested mediates its antiproliferative action upon the U251MG cell that LRRC4 might play an essential role in the development line, a complete analysis of the cell cycle events in these cells and maintenance of normal function in the nervous system. both prior to and consequent of the initial observed G1 arrest In support of this notion, we found the distribution of at 36 h was performed (Fig. 8). The finding that after overex- LRRC4 displays a brain-specific pattern both in normal hu- pression of LRRC4, the expressions of p21Waf1/Cip1 and man and mouse tissues. Furthermore, LRRC4 expression p27Kip1 were upregulated following by the downregulation of exhibited a development-regulated pattern in different stage Cdk2, PCNA and the Erk1/2 phosphorylation state, suggests of brain. an involvement of p21Waf1/Cip1 and p27Kip1 in the regulation Recently, LRR proteins have also been implied to be in- of Cdk2, PCNA and the Erk1/2 phosphorylation state. There- volved in nervous system tumors. Overexpression of Pur (al- fore, it is conceived that the increase in p21Waf1/Cip1 and pha), a protein containing three basic aromatic (class I) and p27Kip1 expressions and the reduction in Cdk2 kinase activity two acidic leucine-rich (class II) repeats in the central region, might be the mechanism responsible for the cell cycle delay has been found to be able to suppress proliferation of a variety in G1/S phase during the early phase of tet-regulatable LRRC4 of transformed tumor cells including human glioblastoma treated with doxycycline. The reduction of PCNA and the through the region spanning the first class II repeat and the ERK1/2 phosphorylation state would appear to be a conse- second class I repeat [32]. It has also been reported that activa- quence of the upregulations of p21Waf1/Cip1 and p27Kip1 tion of Trk A receptor can lead to extensive apoptosis in and the reduction of Cdk2 activity, and a method of maintain- medullblastoma cells [33,34]. LGI-1 is rearranged and down- ing the LRRC4-induced delay in G1/S transition. Taken regulated in malignant brain tumors [35]. Our data is consis- together, the data implies that LRRC4 is a membrane protein tent with above reports by showing the absence or very low and a trigger for the late G1 delay through a cascade of molec- level of LRRC4 in primary brain tumors (Fig. 5), also confirm- ular expression alterations inhibiting DNA replication and ing a previous study which suggests LRRC4 has the potential MAPK pathway. of suppressing U251MG tumorigenesis and cell proliferation In conclusion, we characterized the expression and function [8]. Taken together, we think that LRRC4 might act as a recep- of LRRC4, a brain-specific novel member of LRR superfamily, tor for a certain trophic factor or for an adhesion molecule by showing LRRC4 as a negative regulator of cell growth and contributing to maintenance of normal brain function and underscore a link between above-mentioned cyclins, cyclin- inhibition of tumorigenesis. associated molecules and tumorigenicity. This data may serve Inducibility is desirable for gene function study, since it as a spring board for further study of the role of LRRC4 in provides a more flexible control of gene expression [36,37]. maintenance of normal function and inhibition of tumorigen- In the present study, using two stable U251MG Tet-on- esis in the central nervous system. Q. Zhang et al. / FEBS Letters 579 (2005) 3674–3682 3681

Acknowledgements: The authors are grateful to Dr. Weijun Cai (The [19] Carim-Todd, L., Escarceller, M., Estivill, X. and Sumoy, L. Department of Human Anatomy, Central South University), Hongbin (2003) LRRN6A/LERN1 (leucine-rich repeat neuronal protein 1), Shu (National Jewish Medical and Research Center), and Dr. Zhuo- a novel gene with enriched expression in limbic system and hua Zhang (The Burnham Institute, La Jolla) for reviewing this paper neocortex. Eur. J. Neurosci. 18, 3167–3182. and giving helpful suggestions, the project was supported by the Na- [20] Williams, A.F. and Barclay, A.N. (1988) The immunoglobulin tional Natural Science Foundation of China (Grant Nos. 30100191 superfamily – domains for cell surface recognition. Annu. Rev. and 30270429) and the Province Natural Science Foundation of Hu- Immunol. 6, 381–405. nan (Grant Nos. 03JJY3062). [21] Holness, C.L. and Simmons, D.L. (1994) Structural motifs for recognition and adhesion in members of the immunoglobulin superfamily. J. Cell Sci. 107, 2065–2070. References [22] Martin-Zanca, D., Oskam, R., Mitra, G., Copeland, T. and Barbacid, M. (1989) Molecular and biochemical characterization [1] Zenclusen, J.C., Hodges, L.C., Lacava, M., Green, E.D. and of the human trk proto-oncogene. Mol. Cell Biol. 9, 24–33. Conti, C.J. (2000) Mutation of the ST7 tumor suppressor gene on [23] Klein, R., Parada, L.F., Coulier, F. and Barbacid, M. (1989) trkB, 7q31.1 is rare in breast, ovarian and colorectal cancers. Oncogene a novel tyrosine protein kinase receptor expressed during mouse 19, 1729–1733. neural development. EMBO J. 8, 3701–3709. [2] Zenclusen, J.C., Conti, C.J. and Green, E.D. (2001) Mutational [24] Lamballe, F., Klein, R. and Barbacid, M. (1991) Brain-derived and function analyses reveal that ST7 is a highly conserved neurotrophic factor rapidly enhances phosphorylation of the tumor-suppressor gene on human chromosome 7q31. Nat. Genet. postsynaptic N-methyl-D-aspartate receptor subunit 1. Cell 66, 274, 392–398. 967–979. [3] Tang, X.N., Yang, J.B. and Deng, L.W. (2000) Study on micro- [25] Suzuki, Y., Sato, N., Tohyama, M., Wanaka, A. and Takagi, T. deletion in chromosome 7q31 of nasopharyngeal carcinoma. J. (1996) cDNA cloning of a novel membrane glycoprotein that is Genetics CH 17, 153–156. expressed specifically in glial cells in the mouse brain. LIG-1, a [4] Tan, G.L., Xiao, J.Y. and Tian, Y.Q. (2002) Microsatellite protein with leucine-rich repeats and immunoglobulin-like do- analysis of loci at 7q31-36 reveals a minimum of two common mains. J. Biol. Chem. 271, 22522–22527. regions of deletion in nasopharyngeal carcinoma. Otolarygol. [26] Nagasawa, A., Kubota, R., Imamura, Y., Nagamine, K., Wang, Head Neck Surg. 126, 296–300. Y., Asakawa, S., Kudoh, J., Minoshima, S., Mashima, Y., [5] Ogata, T., Ayusawa, D., Namba, M., Takahashi, E., Oshimura, Oguchi, Y. and Shimizu, N. (1997) Cloning of the cDNA for a M. and Oishi, M. (1993) Chromosome 7 suppresses indefinite new member of the immunoglobulin superfamily (ISLR) contain- division of nontumorigenic immortalized human fibroblast cell ing leucine-rich repeat (LRR). Genomics 44, 273–279. lines KMST-6 and SUSM-1. Mol. Cell Biol. 10, 6036–6043. [27] Schneider, R. and Schweiger, M. (1991) The extracellular domains [6] Claverie, J.M. (1997) Computational methods for the identifica- of the TrkA and TrkB neurotrophin receptors contain defined tion of genes in vertebrate genomic sequences. Hum. Mol. Genet. structural modules such as immunoglobulin-like domains and 6, 1735–1744. leucine-rich motifs (LRMs). Oncogene 6, 1807–1811. [7] Wang, J.R., Qian, J., Dong, L., Li, X.L., Tan, C., Li, J., Zhang, [28] Pe´rez, P., Coll, P.M., Hempstead, B.L., Martıń-Zanca, D. and B.C., Zhou, J. and Li, G.Y. (2002) Identification of LRRC4, a Chao, M.V. (1995) NGF binding to the Trk tyrosine kinase novel member of Leucine-rich repest (LRR) superfamily, and its receptor requires the extracellular immunoglobolin-like domain. expression analysis in brain tumor. Prog. Biochem. Biophys. 29, Mol. Cell Neurosci. 6, 97–105. 233–239. [29] Urfer, R., Tsoulfas, P., OÕConnell, L., Shelton, D.L., Parada, L.F. [8] Wang, J.R., Li, X.L., Fan, S.Q., Tan, C., Xiang, J.J., Tang, K., and Presta, L.G. (1995) An immunoglobulin-like domain deter- Wang, R. and Li, G.Y. (2003) Expression of LRRC4 has the mines the specificity of neurotrophin receptors. EMBO J. 14, potential to decrease the growth rate and tumorigenesis of 2795–2805. glioblastoma cell line U251. J. Cancer CH 22, 897–902. [30] Windisch, J.M., Marksteiner, R., Lang, M.E., Auer, B. and [9] Kobe, B. and Deisenhofer, J. (1994) The leucine-rich repeat: a Schneider, R. (1995) Brain-derived neurotrophic factor, neuro- versatile binding motif. Trends Biochem. Sci. 19, 415–421. trophin-3, and neurotrophin-4 bind to a single leucine-rich motif [10] Kobe, B. and Kajava, A.V. (2001) The leucine-rich repeat as a of TrkB. Biochemistry 34, 11256–11263. protein recognition motif. Curr. Opin. Struct. Biol. 11, 725–732. [31] Walsh, F.S. and Doherty, P. (1997) Neural cell adhesion [11] Gossen, M. and Bujard, H. (1992) Tight control of gene molecules of the immunoglobulin superfamily: role in axon expression in mammalian cells by tetracycline-responsive pro- growth and guidance. Annu. Rev. Cell Dev. Biol. 13, 425–456. moters. Proc. Natl. Acad. Sci. USA 89, 5547–5551. [32] Darbinian, N., Gallia, G.L., King, J., Del Valle, L., Johnson, [12] Gossen, M., Freundlieb, S., Bender, G., Muller, G., Hillen, W. E.M. and Khalili, K. (2001) Growth inhibition of glioblastoma and Bujard, H. (1995) Transcriptional activation by tetracyclines cells by human Pur (alpha). J. Cell Physiol. 189, 334–340. in mammalian cells. Science 268, 1766–1769. [33] Chou, T.T., Trojanowski, J.Q. and Lee, V.M. (2000) A novel [13] Davison, J.M., Morgan, T.W., His, B.L., Xiao, S. and Fletcher, apoptotic pathway induced by nerve growth factor-mediated J.A. (1998) Subtracted, unique-sequence, in situ hybridization: TrkA activation in medulloblastoma. J. Biol. Chem. 275, 565– experimental and diagnostic applications. Am. J. Pathol. 153, 570. 1401–1409. [34] Bredel, M. and Pollack, I.F. (1999) The p21-Ras signal transduc- [14] Buchanan, S.G. and Gay, N.J. (1996) Structural and functional tion pathway and growth regulation in human high grade diversity in the leucine-rich repeat family of proteins. Prog. gliomas. Brain. Res. Rev. 29, 232–249. Biophys. Mol. Biol. 65, 1–44. [35] Chernova, O.B., Somerville, R.P. and Cowell, J.K. (1998) A novel [15] Lin, J.C., Ho, W.H., Gurney, A. and Rosenthal, A. (2003) The gene, LGI1, from 10q24 is rearranged and downregulated in netrin-G1 ligand NGL-1 promotes the outgrowth of thalamocor- malignant brain tumors. Oncogene 17, 2873–2881. tical axons. Nat. Neurosci. 6, 1270–1276. [36] Shockett, P.E. and Scheantz, D.G. (1996) Diverse strategies for [16] Buchstaller, A., Kunz, S., Berger, P., Kunz, B., Ziegler, U., Rader, tetracycline-regulated inducible gene expression. Proc. Natl. C. and Sonderegger, P. (1996) Cell adhesion molecules NgCAM Acad. Sci. USA 93, 5173–5176. and axonin-1 form heterodimers in the neuronal membrane and [37] Van Craenenbroeck, K., Vanhoenacker, P., Leysen, J.E. and cooperate in neurite outgrowth promotion. J. Cell Biol. 135, Haegeman, G. (2001) Evaluation of the tetracycline- and ecdy- 1593–1607. sone-inducible systems for expression of neurotransmitter recep- [17] Brose, K., Bland, K.S., Wang, K.H., Arnott, D., Henzel, W., tors in mammalian cells. Eur. J. Neurosci. 14, 968–976. Goodman, C.S., Tessier-Lavigne, M. and Kidd, T. (1999) Slit [38] McDonald, E.R. and El-Deiry, W.S. (2001) Checkpoint genes in proteins bind Robo receptors and have an evolutionarily con- cancer. Ann. Med. 33, 113–122. served role in repulsive axon guidance. Cell 96, 795–806. [39] Harper, J.W. and Adams, P.D. (2001) Cyclin-dependent kinases. [18] Lee, J.S., Ray, R. and Chien, C.B. (2001) Cloning and expression Chem. Rev. 101, 2511–2526. of three zebrafish roundabout homologs suggest roles in axon [40] Koff, A., Giordano, A., Desai, D., Yamashita, K., Harper, J.W., guidance and cell migration. Dev. Dyn. 221, 216–230. Elledge, S., Nishimoto, T., Morgan, D.O., Franza, B.R. and 3682 Q. Zhang et al. / FEBS Letters 579 (2005) 3674–3682

Roberts, N. () Formation and activation of a cyclin E-cdk2 [49] Blagosklonny, M.V., Prabhu, N.S. and El-Deiry, W.S. (1997) complex during the G1 phase of the human cell cycle. Science 257, Defects in p21WAF1/CIP1, Rb, and c-myc signaling in phorbol 1689–1694. ester-resistant cancer cells. Cancer Res. 57, 320–325. [41] Zerfass-Thome, K., Schulze, A., Zwerschke, W., Vogt, B., Helin, [50] Wu, X., Rubin, M., Fan, Z., DeBlasio, T., Soos, T., Koﬀ, A. and K., Bartek, J., Henglein, B. and Jansen-Durr, P. (1997) p27KIP1 Mendelsohn, J. (1996) Involvement of p27KIP1 in G1 arrest blocks cyclin E-dependent transactivation of cyclin A gene mediated by an anti-epidermal growth factor receptor monoclonal expression. Mol. Cell Biol. 17, 407–415. antibody. Oncogene 12, 1397–1403. [42] Chen, J., Jackson, P.K., Kirschner, M.W. and Dutta, A. (1995) [51] Rao, S., Lowe, M., Herliczek, T.W. and Keyomarsi, K. (1998) Separate domains of p21 involved in the inhibition of cdk kinase Lovastatin mediated G1 arrest in normal and tumor breast cells is and PCNA. Nature 374, 386–388. through inhibition of CDK2 activity and redistribution of p21 [43] Chen, J., Jackson, P.K., Kirschner, M.W. and Dutta, A. (1995) and p27, independent of p53. Oncogene 17, 2393–2402. Inhibition of cdk2 kinase, but not PCNA, is essential for the [52] Rao, S., Porter, D., Chen, X., Herliczek, T., Lowe, M. and growth suppression activity of p21. Nature 374, 386–388. Keyomarsi, K. (1999) Lovastatin-mediated G1 arrest is through [44] Luo, Y., Hurwitz, J. and Massague, J. (1995) Cell-cycle inhibition inhibition of the proteasome, independent of hydroxymethyl by independent CDK and PCNA binding domains in p21Cip1. glutaryl-CoA reductase. Proc. Nat. Acad. Sci. USA 96, 7797–7802. Nature 375, 159–161. [53] Chen, W.J., Chang, C.Y. and Lin, J.K. (2003) Induction of G1 [45] Jonsson, Z.O., Hindges, R. and Hubscher, U. (1998) Regulation phase arrest in MCF human breast cancer cells by pentagalloyl- of DNA replication and repair proteins through interaction with glucose through the down-regulation of CDK4 and CDK2 the frontside of proliferating cell nuclear antigen. EMBO J. 17, activities and up-regulation of the CDK inhibitors p27 (Kip) 2412–2425. and p21 (Cip). Biochem. Pharmacol. 65, 1777–1785. [46] Bunz, F., Dutriaux, A., Lengauer, C., Waldman, T., Zhou, S., [54] Franzen, A. and Heldin, N.E. (2001) BMP-7-induced cell cycle Brown, J.P., Sedivy, J.M., Kinzler, K.W. and Vogelstein, B. arrest of anaplastic thyroid carcinoma cells via p21CIP1 and KIP1 (1998) Requirement for p53 and p21 to sustain G2 arrest after p27 . Biochem. Biophys. Res. Commun. 285, 773–781. DNA damage. Science 282, 1497–1501. [55] Kano, H., Arakawa, Y., Takahashi, J.A., Nozaki, K., Kawabata, [47] Peng, D., Fan, Z., Lu, Y., DeBlasio, T., Scher, H. and Y., Takatsuka, K., Kageyama, R., Ueba, T. and Hashimoto, N. Mendelsohn, J. (1996) Anti-epidermal growth factor receptor (2004) Overexpression of RFT induces G1-S arrest and apoptosis monoclonal antibody 225 up-regulates p27 KIP1 and induces G1 via p53/p21 (Waf1) pathway in glioma cell. Biochem. Biophys. arrest in prostatic cancer cell line DU145. Cancer Res. 56, 3666– Res. Commun. 317, 902–908. 3669. [56] Cho, J.W., Jeong, Y.W., Kim, K.S., Oh, J.Y., Park, J.C., Lee, [48] Liu, Y., Martindale, J.L., Gorospe, M. and Holbrook, N.J. (1996) J.C., Baek, W.K., Suh, S.I. and Suh, M.H. (2001) p21 (WAF1) is Regulation of p21WAF1/CIP1 expression through mitogen-acti- associated with CDK2 and CDK4 protein during HL-60 cell vated protein kinase signaling pathway. Cancer Res. 56, 31–35. diﬀerentiation by TPA treatment. Cell Prolif. 34, 267–274.