A Splice-Site Mutation in GABRG2 Associated with Childhood Absence Epilepsy and Febrile Convulsions

ORIGINAL CONTRIBUTION A Splice-Site Mutation in GABRG2 Associated With Childhood Absence Epilepsy and Febrile Convulsions

Colette Kananura, MS; Karsten Haug, MD; Thomas Sander, MD; Uwe Runge, MD; Wenli Gu, MS; Kerstin Hallmann, MS; Johannes Rebstock, MD; Armin Heils, MD; Ortrud K. Steinlein, MD

Context: Missense mutations in the GABRG2 gene, which mutation, which is predicted to lead to a nonfunctional encodes the ␥2 subunit of central nervous ␥-aminobu- protein, cosegregates with the disease status in a family tyric acid (GABA)A receptors, have recently been de- with childhood absence epilepsy and febrile convul- scribed in 2 families with idiopathic epilepsy. In one of these sions. The association study did not find any significant families, the affected individuals predominantly exhibited differences in the allele and genotype frequencies of the childhood absence epilepsy and febrile convulsions. common exon 5 polymorphism (C588T) between patients with idiopathic absence epilepsy and controls Objective: To assess the role of GABRG2 in the ge- (PϾ.35). netic predisposition to idiopathic absence epilepsies. Conclusions: Our study identified a splice–donor-site Design: The GABRG2 gene was screened by single- mutation that was probably causing a nonfunctional strand conformation analysis for mutations. Further- GABRG2 subunit. This mutation occurred in heterozy- more, a population-based association study assessing a gosity in the affected members of a single nuclear fam- common exon 5 polymorphism (C588T) was carried out. ily, exhibiting a phenotypic spectrum of childhood absence epilepsy and febrile convulsions. The GABRG2 gene Patients: The sample was composed of 135 patients with seems to confer a rare rather than a frequent major sus- idiopathic absence epilepsy and 154 unrelated and eth- ceptibility effect to common idiopathic absence epi- nically matched controls. lepsy syndromes.

Results: A point mutation (IVS6+2T→G) leading to a splice–donor site mutation in intron 6 was found. The Arch Neurol. 2002;59:1137-1141

HILDHOOD ABSENCE epi- lap between both of these disorders has lepsy (CAE) is one of the been suggested.6 Such a common molecu- most common subtypes of lar basis is most obvious in the syndrome idiopathic generalized of “generalized epilepsy with febrile sei- epilepsy (IGE). It is char- zures plus” (GEFS+), a monogenic or oli- acterized by daily clusters of absence sei- gogenic epilepsy that was first described From the Institute of Human C 7 zures at an age of onset between 2 and 12 in 1997. Generalized epilepsy with fe- Genetics (Mss Kananura, Gu, years.1 brile seizures plus is characterized by FCs and Hallmann, and Drs Haug, Heils, and Steinlein), and Febrile convulsions (FCs) are the that may persist beyond the age of 6 years Department of Epileptology most common seizure subtypes, affect- and are often followed by generalized sei- (Drs Rebstock and Heils), ing about 3% to 5% of children younger zures, including myoclonic and absence University Hospital Bonn, than 6 years.2-4 While CAE is often fol- seizures.8 Rheinische Friedrich lowed by other IGE syndromes, includ- While the molecular basis of com- Wilhelms-University Bonn, ing generalized tonic-clonic seizures and mon forms of seizure disorders, includ- Bonn; Department of myoclonic seizures, only 3% to 7% of chil- ing FC and CAE has been elusive so far, Neurology, University Hospital dren suffering from FCs develop epi- disease-causing GEFS+ mutations have Charite´, Humboldt University lepsy later in life.5 already been identified in SCN1B, of Berlin, Berlin (Dr Sander); and Department of Neurology, A genetic basis for both CAE and FC SCN1A, SCN2A, and GABRG2, genes is well established.5 Because the inci- encoding neuronal sodium channel sub- University Hospital Greifswald, ␥ Ernst Moritz Arndt-University, dence of FC is significantly increased in types and the 2-subunit of central ner- ␥ Greifswald (Dr Runge), patients with CAE (10%-15%) compared vous -aminobutyric acid (GABA)A Germany. with the general population, a genetic over- receptors, respectively.9-13 A potential

(REPRINTED) ARCH NEUROL / VOL 59, JULY 2002 WWW.ARCHNEUROL.COM 1137

©2002 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 PATIENTS AND METHODS 154 unrelated and ethnically matched controls. All controls were healthy volunteers of German descent.

PATIENTS FAMILY 510 The 15-year-old index patient (II-1) had exhibited typical The study sample included 135 unrelated German pa- pyknoleptic absence seizures starting at the age of 4 years tients with IAE at the University Hospital Rudolf Virchow (syndrome diagnosis: CAE) and experienced 3 uncompli- at the Free University of Berlin (Berlin, Germany) and at cated FCs at age 4 years. In addition, he had 1 generalized the University Hospital of Bonn (Bonn, Germany). The tonic-clonic seizure at age 10 and 1 at age 11 years. His in- sample consisted of 59 patients with juvenile AE and 46 terictal EEG results showed 3/s generalized spike-wave dis- patients with CAE who had at least 1 first-degree family charges during resting as well as photosensitivity. At age member affected by IGE. In addition, 19 patients with ju- 12 years, he began daily treatment with 1800 mg of val- venile AE and 11 with CAE were included as sporadic cases. proic acid and had been free of seizures since that time. His The study protocol was approved by the local ethics com- 13-year-old sister (II-2) had 4 uncomplicated FCs at age 3 mittees, and written informed consent was obtained from years. She exhibited typical absence seizures and several all participants. Diagnostic criteria for IAE (CAE or juve- generalized tonic-clonic seizures at age 4 years (syndrome nile AE) were: (1) onset with typical absence seizures; (2) diagnosis: CAE). Results of her interictal EEG showed 3/s age at onset of typical absence seizures between 3 and 20 generalized spike-wave discharges while resting. Valproic years; (3) electroencephalographic (EEG) findings of nor- acid treatment was started and she had been seizure-free mal background activity and paroxysmal generalized spike- since then. The 42-year-old father (I-1) had experienced wave EEG discharges; and (4) normal intellectual and neu- 20 uncomplicated FCs between the ages of 3 and 6 years. rological status apart from seizures. Exclusion criteria From ages 6 to 15 years, he was treated with phenobarbi- included (1) evidence for structural lesions or metabolic tal and ethosuximide and remained seizure-free without an- or degenerative diseases of the brain; (2) atonic/astatic or tiepileptic treatment. He had no siblings and his parents tonic seizures; (3) complex partial seizures; (4) epilepsy had no known history of seizures. The 43-year-old mother with myoclonic absences; and (5) exclusively stimulus- (I-2) reported no history of epileptic seizures. induced seizures.17 In case of a rare mutation in the sample of patients with IAE, we assessed the presence of the latter MUTATION SCREENING in a sample comprising 88 unrelated and ethnically matched controls. For the association study, we obtained the geno- Genomic DNA was extracted either from 10-mL aliquots type and allele frequencies in all 135 patients as well as in of EDTA-anticoagulated blood samples or from lympho-

role of the GABAergic system has often been implicated sition 770, which is located at the boundary between ex- in epileptogenesis14-16; however, genetic evidence for ons 6 and 7. Compared with the previous GABRG2 this hypothesis has been obtained only recently by the sequence, the additional guanine would result in an in- discovery of different GABRG2 mutations identified in 2 frame stop codon following amino acid position 227 up- families. The phenotype in one of these families was stream of the first transmembrane domain. Reverse tran- described to be compatible with GEFS+, but no further scriptase PCR amplification of the respective region could details regarding the seizure types observed in the not verify the extra guanine. These results were further affected pedigree members were given.12 In the second confirmed by amplification from genomic DNA and di- family affected, individuals predominantly had CAE rect sequencing of both the exon 6/intron 6 and intron and FC.13 Accordingly, these findings raise the question 6/exon 7 boundaries (data not shown). whether genetic variation of the GABRG2 gene confers susceptibility to the epileptogenesis of common sub- DETECTION OF types of idiopathic absence epilepsies (IAEs). We there- A SPLICE–DONOR SITE MUTATION fore systematically searched for mutations and common IN A FAMILY WITH CAE AND FC sequence variants in a sample comprising a total of 135 patients with IAE and performed a population-based The coding region and exon/intron boundaries of GABRG2 association study assessing a frequent silent polymor- were screened by single-strand conformation analysis for phism (C588T) in exon 5 of the GABRG2 gene. mutations in genomic DNA samples derived from 135 patients. The DNA of the index patient (II-1) from fam- RESULTS ily 510 showed aberrant electrophoresis patterns indica- tive of a sequence variation in the respective PCR frag- VERIFICATION OF ment containing exon 6. Direct sequencing revealed a THE GABRG2 WILD TYPE SEQUENCE single base pair exchange at the splice–donor site of intron 6, substituting a thymine with a guanine (IVS6+2T→G) The GABRG2 cDNA sequence (XM_003986.2), which had (Figure 1). No further mutations were found by screen- been deposited into Genbank on April 6, 2001, differed ing the entire GABRG2 coding region. from the previous sequence (XM_003986.1) by the pres- For evaluating the segregation of the IVS6+2T→G ence of an additional guanine following nucleotide po- mutation, exon 6 and the adjacent part of intron 6 were

(REPRINTED) ARCH NEUROL / VOL 59, JULY 2002 WWW.ARCHNEUROL.COM 1138

©2002 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 blastoid cell lines, using a salting-out method.18 For single- EXON 5 POLYMORPHISM (C588T) strand conformation analysis, we designed specific primer sets Exon 5 and the adjacent parts of introns 4 and 5 were am- amplifying all GABRG2 exons and adjacent exon-intron plified using primers n1065 (5ЈCCATCTTATGTT- boundaries (primer sequences are available on request). Poly- TAATATCTTTCT) and n1066 (5ЈACTGTAGGTGAGG- merase chain reactions (PCRs) were carried out in a PTC 200 GAGGATAC). Digestion of the PCR product with restriction (MJ Research, Waltham, Mass), that contained a total 25-µL endonuclease TasI (MBI Fermentas) resulted in fragments of volume comprised of 50 ng of genomic DNA, 5 pmol each the following sizes: 99 bp + 36 bp + 17 bp+6bp(C-allele) of forward and reverse primers, 200µM each of dinucleotide and91bp+36bp+17bp+8bp+6bp(T-allele). The C588T triphosphate, 1.5mM of magnesium chloride, 50mM of po- polymorphism is probably identical to a previously de- tassium chloride, 20mM of Tris hydrochloride (pH 8.3), and scribed and incorrectly numbered exon 5 variant.12 Allele and 0.1UofTaq DNA polymerase. Polymerase chain reaction pa- genotype frequencies, ␹2 tests, power calculations, and the rameters were as follows: denaturation at 95°C for 5 min- test for Hardy-Weinberg equilibrium were calculated using utes followed by 33 cycles at 95°C for 30 seconds, annealing the SAS computer program (SAS Institute, Cary, NC).19 A at 58°Cto64°C for 30 seconds, and extension at 72°C for 30 2-tailed type I error rate of 5% was chosen for the analyses. seconds followed by a final extension step of 5 minutes at 72°C. The obtained PCR products were denatured and run on 10% Reverse Transcriptase (RT) PCR polyacrylamide gels for 14 to 16 hours at room temperature and at 4°C, respectively. After the run, the bands were visu- Reverse transcription PCR was performed using the Titan alized using a standard silver-staining protocol. Polymerase One Tube RT-PCR-System (Roche Diagnostics, Mann- chain reaction products showing aberrant patterns were am- heim, Germany) according to the manufacturer’s protocol. plified again prior to direct sequencing with an ABI 377 se- The following complementary DNA (cDNA) primers were quencer (Applied Biosystems, Foster City, Calif). For verifi- designed for verification of the wild type GABRG2 sequence: cation of the mutation and screening of the control sample, n1024, 5ЈGCGACACAAGATCCTGGAGGCTTTA, n1025, we developed a restriction fragment length assay using prim- 5ЈCCCAGGATAGGACGACAATGAGTGT. Annealing tem- ers n1005 (5ЈATGTGAGCTTTCCTATCTCACG) and Z peratures were optimal at 65°C, and human brain RNA (Clon- n1070 (5ЈTGAGAGGTATTGAAAAATCCTCTA). The re- tech,PaloAlto,Calif)wassuccessfullyusedastemplate.Single- sulting PCR fragment included exon 6 and adjacent se- and nested-PCR attempts, however, failed to amplify the quences from introns 5 and 6. MboII (MBI Fermentas, St Leon GABRG2 cDNA from total RNA derived from leukocytes. Roth, Germany) digests of PCR products gave the following For the prediction of possible cryptic splice–donor sites fragments: wild type allele, 110 base pair (bp) + 90 bp + 53 within intron 6, the 1998 version of an online splice site bp; mutant allele, 110 bp + 75 bp + 53 bp + 15 bp. predictor program was used (www.fruitfly.org).

directly sequenced in all available members of family 510. tect a susceptibility factor with a genotypic relative risk The IVS6+2T→G mutation was found in the affected sis- of 2.50, assuming a type I error rate of 5% and a preva- ter and affected father of the index patient but not in the lence of the risk factor (T-allele) of 30% (SAS version clinically unaffected mother (Figure 1). The mutation was 1988). The genotype distribution did not deviate signifi- also absent in 176 control chromosomes. These results cantly from that expected according to the Hardy- ␹2 were confirmed by restriction analysis, which showed an Weinberg equilibrium. The allele frequencies ( 1=0.47; ␹2 additional MboII restriction site in the carriers of the P=.49) and genotype frequencies ( 2=2.09; P=.35) did IVS6+2T→G mutation. not differ significantly between patients with IAE and con- The IVS6+2T→G mutation destroys the controls (Table). served splice site motif (gt) of intron 6, changing it to (gg). Sequence analysis using the splice site predictor pro- COMMENT gram yielded the maximum score of 1.0 for the wild type constitutive splice–donor mutation site of intron 6 but The IVS6+2T→G mutation found in family 510 classified the mutated splice site as nonfunctional. Two destroys the 5Ј-splice site of intron 6, thus preventing strong cryptic splice–donor mutation sites were identi- the correct cleavage and removal of the intervening fied at positions IVS6+375 (score 0.98) and IVS6+758 sequences from the pre–messenger RNA (mRNA). (score 0.94). Since it was not possible to amplify the GABRG2 cDNA from peripheral blood cell templates, the effect of the A FREQUENT POLYMORPHISM mutation could not be analyzed directly. However, IN THE GABRG2 GENE based on previous studies concerned with splice–donor IS NOT ASSOCIATED WITH IAE site mutations (for example, 20-22) some predictions can be made. Most splice–donor site mutations lead to To further analyze the possible role of the GABRG2 gene (1) exon skipping, (2) use of cryptic splice sites within in epileptogenesis, we determined the genotype and al- the downstream intron, or, if the intron is small, to (3) lele frequencies of the exon 5 C588T polymorphism in intron inclusion.20 Because of the size of the GABRG2 the entire sample of 135 IAE patients as well as in 154 intron 6 (approximately 38 kb), the latter is very controls. Power calculation showed that the employed unlikely. Alternatively, the IVS6+2T→G mutation sample should provide a statistical power of 93.3% to de- could lead to the use of 1 of the 2 strong cryptic splice

(REPRINTED) ARCH NEUROL / VOL 59, JULY 2002 WWW.ARCHNEUROL.COM 1139

II-1 II-2

C D bp bp 110 90 99 75 91

53 T C C/T

Figure 1. Family with childhood absence epilepsy with IVS6+2T→G mutation. A, Pedigree of family 510. Affected individuals are indicated by solid symbols. B, Sequencing of genomic DNA from the index patient II-1. C, MboII restriction analysis of the IVS6+2T→G splice–donor site mutation in family 510. The 15–base pair (bp) restriction fragment is not shown. D, TasI restriction analysis of the C588T polymorphism in exon 5. Homozygote or heterozygote from control DNA for both alleles are shown. Smaller fragments (36 bp, 17 bp, 8 bp, 6 bp) are not shown.

rantly spliced RNA would be truncated upstream from Genotype and Allele Frequencies the first transmembrane domain and would therefore be of the GABRG2 Exon 5 Polymorphism, C588T* predicted to be nonfunctional. Thus, we propose that the GABRG2 splice–donor site mutation reported here Sample T/T C/T C/C f(T) leads to a nonfunctional allele, which is likely to be the Patients with IAE (n = 135) 0.037 0.348 0.615 0.211 primary cause for epileptic seizures in this family. Controls (n = 154) 0.052 0.273 0.675 0.188 The findings reported here suggest that a novel splice mutation of the GABRG2 gene causes a nonfunctional *f(T) indicates frequency of T-allele; IAE, idiopathic absence epilepsies. ␥ truncation of the GABAA receptor -subunit, contribut- ing a major susceptibility effect to the pathogenesis of A CAE and FC in a single family. Together with 2 previ- 6 12,13 CSP CSP 100 bp ously identified amino acid exchanges, this trunca- TGA tion mutation extends the spectrum of GABRG2 muta- G tions that confers monogenic effects to the pathogenesis

B GT of FC and CAE. Because the screening of 135 patients with IAE did not reveal more than 1 functional muta- 1 2 34 5 6 7 89 tion and because of the negative results obtained in the association study, it is obvious that GABRG2 is not play- 10 kb ing a major role in the pathogenesis of common IAE subtypes.

C 1234578910 TCC AGT T GA GAT TAT G 100 bp SS ∗ Accepted for publication March 25, 2002. Figure 2. Probable effect of the IVS6+2T→GonGABRG2 structure. A, Exon This work was supported by grants Ste769/2-1 (Dr 6 and the adjacent part of intron 6, including an in-frame stop codon and 2 Steinlein), Sa434/2-2 (Dr Sander), and For423 (Dr Heils) strong cryptic splice–donor sites within the intron. B, Exon-intron structure from the Deutsche Forschungsgemeinschaft, Bonn, and grants of GABRG2. The intron 6-splice–donor site mutation is indicated by the from the German Bundesministerium fuer Bildung und For- arrow. Exons are not drawn according to size. C, Schematic representation of the probable outcome of exon 6 skipping. The excision of introns 5 and 6 schung, Berlin, and BONFOR, Bonn (Dr Heils). Dr Haug and exon 6 followed by the fusion of exons 5 and 7 would create an in-frame is also supported by the German Volkswagenstiftung, Ha- stop codon. bp indicates base pair; kb, kilobase. nover, Germany. Author contributions: Study concept and design (Mss sites found at positions IVS6+375 and IVS6+758. This Kananura, Gu, and Hallmann, and Drs Haug, Sander, Reb- would result in a truncated protein due to the presence stock, Heils, and Steinlein); acquisition of data (Mss Ka- of an in-frame stop codon located at position IVS6+65 nanura, Gu, and Hallmann, and Drs Haug, Sander, Runge, (Figure 2). However, since almost all of the major Rebstock, Heils, and Steinlein); analysis and interpreta- cryptic sites that have been found to be activated by tion of data (Mss Kananura, Gu, and Hallman, and Drs mutations are mapped within a 100-bp region from the Haug, Sander, Runge, Rebstock, Heils, and Steinlein); authentic splice sites, the use of sites located so much drafting of the manuscript (Mss Kananura, Gu, and Hall- further downstream seem to be less likely.21 Exon- mann, and Drs Haug, Sander, Runge, Rebstock, Heils, and skipping is therefore the most plausible mutational Steinlein); critical revision of the manuscript for impor- mechanism caused by the IVS6+2T→G mutation. Skip- tant intellectual content (Mss Kananura, Gu, and Hall- ping of exon 6 would lead to an RNA containing an mann, and Drs Haug, Sander, Runge, Rebstock, Heils, and in-frame stop codon at the joining site of exons 5 and 7 Steinlein); statistical expertise (Ms Kananura); and ad- (Figure 2). The predicted protein coded by this aber- ministrative, technical, and material support (Mss Kan-

(REPRINTED) ARCH NEUROL / VOL 59, JULY 2002 WWW.ARCHNEUROL.COM 1140

©2002 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 anura, Gu, and Hallman, and Drs Haug, Sander, Runge, 10. Escayg A, MacDonald BT, Meisler MH, et al. Mutations of SCN1A, encoding a Rebstock, Heils, and Steinlein). neuronal sodium channel, in two families with GEFS+2. Nat Genet. 2000;24:343- 345. Corresponding author and reprints: Ortrud K. Stein- 11. Sugawara T, Tsurubuchi Y, Agarwala KL, et al. A missense mutation of the Na+ lein, MD, Institute of Human Genetics, University Hospital channel alpha II subunit gene Na(v)1.2 in a patient with febrile and afebrile sei- Bonn, Wilhelmstr 31, D-53111 Bonn, Germany (e-mail: zures causes channel dysfunction. Proc Natl Acad Sci U S A. 2001;98:6384- [email protected]). 6389. 12. Baulac S, Huberfeld G, Gourfinkel-An I, et al. First genetic evidence of GABA(A) receptor dysfunction in epilepsy: a mutation in the gamma2-subunit gene. Nat REFERENCES Genet. 2001;28:46-48. 13. Wallace RH, Marini C, Petrou S, et al. Mutant GABA(A) receptor gamma2- subunit in childhood absence epilepsy and febrile seizures. Nat Genet. 2001;28: 1. Duncan JS. Idiopathic generalized epilepsies with typical absences. J Neurol. 1997; 49-52. 244:403-411. 14. Olsen RW, Avoli M. GABA and epileptogenesis. Epilepsia. 1997;38:399-407. 2. Schuman SH, Miller LJ. Febrile convulsions in families: findings in an epidemio- 15. Snodgrass SR. GABA and epilepsy: their complex relationship and the evolution logic survey. Clin Pediatr. 1966;5:604-608. 3. Van der Berg BJ, Yerushalmy J. Studies on convulsive disorders in young chil- of our understanding. J Child Neurol. 1992;7:77-86. dren, I: incidence of febrile and nonfebrile convulsions by age and other factors. 16. Gadea A, Lopez-Colome AM. Glial transporters for glutamate, glycine, and GABA, Pediatr Res. 1969;3:298-304. II: GABA transporters. J Neurosci Res. 2001;63:461-468. 4. Nelson KB, Ellenberg JH. Prognosis in children with febrile seizures. Pediatrics. 17. Commission on Classification and Terminology of the International League Against 1978;61:720-727. Epilepsy proposal for revised classification of epilepsies and epileptic syn- 5. Berkovic SF, Scheffer IE. Febrile seizures: genetics and relationship to other epi- dromes. Epilepsia. 1998;30:389-399. lepsy syndromes. Curr Opin Neurol. 1998;11:129-134. 18. Miller SA, Dykes D, Plesky HF. A simple salting out procedure for extracting DNA 6. Italian League Against Epilepsy Genetic Collaborative Group. Concordance of clini- from human nucleated cells. Nucleic Acids Res. 1988;16:1215. cal forms of epilepsy in families with several affected members. Epilepsia. 1993; 19. SAS/STAT User’s Guide, Release 6.03 Edition. Cary, NC: SAS Institute; 1988. 34:819-826. 20. Talerico M, Berget SM. Effect of 5Ј splice site mutations on splicing of the pre- 7. Scheffer IE, Berkovic SF. Generalized epilepsy with febrile seizures plus: a ge- ceding intron. Mol Cell Biol. 1990;10:6299-6305. netic disorder with heterogeneous clinical phenotypes. Brain. 1997;120:479- 21. Nakai K, Sakamoto H. Construction of a novel database containing aberrant splic- 490. ing mutations of mammalian genes. Gene. 1994;141:171-177. 8. Singh R, Scheffer IE, Crossland K, Berkovic SF. Generalized epilepsy with febrile 22. Anderson SL, Coli R, Daly IW, et al. Familial dysautonomia is caused by muta- seizures plus: a common childhood-onset genetic epilepsy syndrome. Ann Neu- tions of the IKAP gene. Am J Hum Genet. 2001;68:753-758. rol. 1999;45:75-81. 23. Whiting P, McKernan RM, Iversen LL. Another mechanism for creating diversity 9. Wallace RH, Wang DW, Singh R, et al. Febrile seizures and generalized epilepsy in gamma-aminobutyrate type A receptors: RNA splicing directs expression of associated with a mutation in the Na+-channel beta1 subunit gene SCN1B. Nat two forms of gamma 2 phosphorylation site. Proc Natl Acad SciUSA. 1990; Genet. 1998;19:366-370. 87:9966-9970.

(REPRINTED) ARCH NEUROL / VOL 59, JULY 2002 WWW.ARCHNEUROL.COM 1141