DOCSLIB.ORG

Ion Channels and Epilepsy

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Ion Channels and Epilepsy American Journal of Medical Genetics (Semin. Med. Genet.) 106:146±159 (2001) ARTICLE Ion Channels and Epilepsy HOLGER LERCHE, KARIN JURKAT-ROTT, AND FRANK LEHMANN-HORN* Ion channels provide the basis for the regulation of excitability in the central nervous system and in other excitable tissues such as skeletal and heart muscle. Consequently, mutations in ion channel encoding genes are found in a variety of inherited diseases associated with hyper- or hypoexcitability of the affected tissue, the so-called `channelopathies.' An increasing number of epileptic syndromes belongs to this group of rare disorders: Autosomal dominant nocturnal frontal lobe epilepsy is caused by mutations in a neuronal nicotinic acetylcholine receptor (affected genes: CHRNA4, CHRNB2), benign familial neonatal convulsions by mutations in potassium channels constituting the M-current (KCNQ2, KCNQ3), generalized epilepsy with febrile seizures plus by mutations in subunits of the voltage- gated sodium channel or the GABAA receptor (SCN1B, SCN1A, GABRG2), and episodic ataxia type 1Ðwhich is associated with epilepsy in a few patientsÐby mutations within another voltage-gated potassium channel (KCNA1). These rare disorders provide interesting models to study the etiology and pathophysiology of disturbed excitability in molecular detail. On the basis of genetic and electrophysiologic studies of the channelopathies, novel therapeutic strategies can be developed, as has been shown recently for the antiepileptic drug retigabine activating neuronal KCNQ potassium channels. ß 2001 Wiley-Liss, Inc. KEY WORDS: ion channel; epilepsy; genetics; electrophysiology; patch clamp INTRODUCTION between neurons: Axonal conduction is mitters, such as acetylcholine (ACh). mediated by action potentials and signal With regard to these basic principles, Epileptic seizures are induced by abnor- transduction from cell to cell by synaptic two distinct and structurally conserved mal focal or generalized synchronized transmission. Since ion channels provide classes of ion channels emerged during electrical discharges within the central the basis for these processes, any muta- evolution, the voltage-gated and the nervous system (CNS). The equilibrium tion-induced channel malfunction may ligand-gated channels [Hille, 1992]. in communication between neurons is directly alter brain excitability and can regulated by a network of excitatory and induce epileptic seizures. inhibitory circuits. Both enhancement Ion channels are membrane-span- Ion channels are of excitatory and impairment of inhibi- ning proteins forming selective pores for membrane-spanning tory mechanisms will disturb this equili- Na,K,Cl,orCa2 ions. During brium, which may result in epileptic action potentials a precise control of ion proteins forming selective discharges. There are two basic mechan- channel gating is mediated by membrane pores for Na,K, isms underlying the electrophysiological voltage, during synaptic transmission Cl,orCa2 ions. excitability of and the communication by the binding of speci®c neurotrans- Since these two are the only channel Holger Lerche is a neurophysiologist and clinical neurologist in the Departments of Applied types that so far have been shown to Physiology and Neurology, University of Ulm, Germany. Main research interests are the genetics, be affected by mutations causing epi- pathophysiology, and therapy of inherited neurological diseases; in particular, inherited forms of lepsy, other classes of ionic channels, epilepsy and the relationship to molecular mechanisms of ion channel gating. Karin Jurkat-Rott is in the Department of Applied Physiology, University of Ulm, Germany. e.g., those regulated by intracellular ions Research focus: Physiology and pathophysiology of cellular excitation and muscle excitation- such as Ca2, by nucleotides, or by cell contraction coupling; genetics and pathogenesis of hereditary muscle and channel diseases with volume, will not be considered in this respect to skeletal muscle and the central nervous system; data bases on diagnostic criteria. Frank Lohmann-Horn is in the Department of Applied Physiology, University of Ulm, Germany. article. Research focus: Physio(patho)logy of cellular excitation, particularly structure±function relation- Over the last 10±15 years, the ships of ligand- and voltage-dependent ion channels, etiology and pathogenesis of hereditary ion combination of electrophysiological and channel diseases in neurology. Grant sponsor: the Deutsche Forschungsgemeinschaft; Grant number: DFG Le1030/5-1; Grant genetic studies has revealed an increasing sponsor: the Bundesministerium fuÈ r Bildung und Forschung (BMBF) / InterdisziplinaÈ res Zentrum fuÈr number of inherited diseases associated Klinische Forschung (IZKF) Ulm, projects B1 and B8. with mutations in ion channel encoding *Correspondence to: Frank Lehmann-Horn, Department of Applied Physiology, University of Ulm, D-89069 Ulm, Germany. E-mail: [email protected] genes. The ®rst of these so-called ion DOI 10.1002/ajmg.1582 channel disorders or `channelopathies' ß 2001 Wiley-Liss, Inc. ARTICLE AMERICAN JOURNAL OF MEDICAL GENETICS (SEMIN. MED. GENET.) 147 were found in skeletal muscle, the therapy of the more common forms of four to eight positively charged residues myotonias and periodic paralyses, caused epilepsy. conferring voltage dependence to the by mutations in voltage-gated Na,Cl, channel protein and the S5±S6 loops or Ca2 channels. Subsequently, several form the major part of the ionic pore STRUCTURE AND disorders of the CNS, the episodic with the selectivity ®lter (Figs. 3, 5, 7). FUNCTION OF ataxias, familial hemiplegic migraine, VOLTAGE-GATED There are three main conforma- spinocerebellar ataxia type 6, startle CATION CHANNELS tional states of voltage-gated channels, a disease, and several epileptic syndromes, closed, an open, and an inactivated state. were identi®ed as belonging to the Voltage-gated K,Na, and Ca2 At the resting potential the channels are growing family of channelopathies channels consist of several subunits, a in the closed and activatable state. Upon [Lehmann-Horn and Jurkat-Rott, main a-subunit constituting both the membrane depolarization, the voltage 1999, 2000; Ptacek, 1999; Cannon, gating and permeation machinery of the sensors move outward opening the 2000]. The current review will channel and one or more smaller sub- `activation gate' of the channel on a focus on the pathophysiological mecha- units with modifying functions, called b, time-scale of milliseconds by a yet- nisms of the epileptic channelopathies g,ord. The a-subunits have a common unknown mechanism, and with sus- in man. We will start with a short tetrameric structure of homologous tained depolarization the channels inac- overview of the structure and function domains (I±IV) each with six transmem- tivate spontaneously by closing of a of voltage- and ligand-gated ion chan- brane segments (S1±S6). Whereas K different, `inactivation' gate. Upon nels, then summarize the clinical, channels are constituted by four identical membrane repolarization, inactivated genetic, and pathophysiological con- domains, the about fourfold longer channels remain refractory to further cepts of the known epileptic channel genes of Na- and Ca2-channel a- openings for a certain period deter- syndromes and ®nally discuss the impli- subunits encode four homologous but mined by the time needed for recovery cations of the general contribution of distinct domains. In all voltage-gated from inactivation (Fig. 1). Typical mod- mutated ion channels to the genetics and cation channels, the S4 segments contain ifying properties of the smaller b-, g-, or Figure 1. The three main conformational states of voltage-gated ion channels. From a closed state at the hyperpolarized resting membrane potential, channels open upon depolarization during an action potential via outward movement of the voltage sensors that open the activation gate. Some channels, such as the voltage-gated Na channel, inactivate spontaneously via closing of a different, inactivation gate, when depolarization is maintained. From the inactivated state they can only recover upon repolarization of the cell membrane before they are ready for another opening. 148 AMERICAN JOURNAL OF MEDICAL GENETICS (SEMIN. MED. GENET.) ARTICLE d-subunits are the regulation of the neuronal voltage-gated Ca2 channels physiological properties is known amount of functional protein in the are the regulation of transmitter release [Chandy and Gutman, 1995; Leh- membrane or minor alterations of the in presynaptic nerve-terminals. mann-Horn and Jurkat-Rott, 1999]. kinetics or voltage dependence of chan- The different subunits, in particular For example, there are inactivating nel gating [Lehmann-Horn and Jurkat- the channel a-subunits, are expressed (e.g., KCNA1) and noninactivating Rott, 1999; Catterall, 2000; Siegelbaum tissue speci®cally. For example, there are (e.g., KCNQ1-5) K channels and large and Koester, 2000]. several genes encoding different Na differences in the kinetics of activation The time course of depolarization channel a-subunits (SCN1A-SCN11A) and inactivation have been described. and repolarization during an action that are expressed in skeletal muscle potential is conveyed by the gating of (SCN4A), heart muscle (SCN5A) or STRUCTURE AND voltage-dependent Na and K chan- neuronal tissue; four of these subunits FUNCTION OF LIGAND- nels: Activation of the Na inward (SCN1A, SCN2A, SCN3A, and GATED ION CHANNELS current mediates the steep depolarizing
Load more

Recommended publications
  • Characterization of Zebrafish GABAA Receptor Subunits
    www.nature.com/scientificreports OPEN Characterization of zebrafsh GABAA receptor subunits Kenichiro Sadamitsu, Leona Shigemitsu, Marina Suzuki, Daishi Ito, Makoto Kashima & Hiromi Hirata* γ-Aminobutyric acid (GABA), the major inhibitory neurotransmitter in the central nervous system, exerts its efect through the activation of GABA receptors. GABAA receptors are ligand-gated chloride channels composed of fve subunit proteins. Mammals have 19 diferent GABAA receptor subunits (α1–6, β1–3, γ1–3, δ, ε, π, θ, and ρ1–3), the physiological properties of which have been assayed by electrophysiology. However, the evolutionary conservation of the physiological characteristics of diverged GABAA receptor subunits remains unclear. Zebrafsh have 23 subunits (α1, α2a, α2b, α3–5, α6a, α6b, β1–4, γ1–3, δ, π, ζ, ρ1, ρ2a, ρ2b, ρ3a, and ρ3b), but the electrophysiological properties of these subunits have not been explored. In this study, we cloned the coding sequences for zebrafsh GABAA receptor subunits and investigated their expression patterns in larval zebrafsh by whole- mount in situ hybridization. We also performed electrophysiological recordings of GABA-evoked currents from Xenopus oocytes injected with one or multiple zebrafsh GABAA receptor subunit cRNAs and calculated the half-maximal efective concentrations (EC50s) for each. Our results revealed the spatial expressions and electrophysiological GABA sensitivities of zebrafsh GABAA receptors, suggesting that the properties of GABAA receptor subunits are conserved among vertebrates. γ-Aminobutyric acid (GABA), the major inhibitory neurotransmitter in the central nervous system of vertebrates, 1 controls the excitability of neural networks mainly through GABA A receptors . Te GABAA receptor mediates two types of inhibition, known as phasic and tonic inhibition2.
    [Show full text]
  • Excluded Test List – As of 08/01/2016
    Excluded Test List – as of 08/01/2016 CPT As Gene Code 81161 DMD, dup_del 81200 ASPA, cv 81201 APC, fgs 81202 APC, kfv 81203 APC, dup_del 81205 BCKDHA, cv 81205 BCKDHB, cv 81209 BLM, 2281del6ins7 81220 CFTR, cv 81221 CFTR, kfv 81222 CFTR, dup_del 81223 CFTR, fgs 81224 CFTR, intron 8 poly-T 81228 Microarray, CNV 81229 Microarray, SNP 81240 F2, 20210G>A 81241 F5, Leiden (1691G>A) 81242 FANCC, cv 81243 FMR1 81244 FMR1, ma 81250 G6PC, cv 81251 GBA, cv 81252 GJB2, fgs 81253 GJB2, kfv 81254 GJB6, cv 81255 HEXA, cv 81257 HBA1_HBA2, cdel or v 81260 IKBKAP, cv 81271 SRY-FISH 81280 LQT, fgs 12 genes 81281 LQT, kfv 81282 LQT, dup_del 12 genes 81290 MCOLN1, cv 81291 MTHFR, cv 81302 MECP2, fgs 81304 MECP2, dup_del 81324 PMP22, dup_del 81325 PMP22, fgs 1, V14 81326 PMP22, kfv 81330 SMPD1, cv 81331 SNRPN_UBE3A, ma 81350 UGT1A1, cv 81400 ABCC8, F1388del 81400 ACADM, K304E 81400 AGTR1, 1166A>C 81400 BCKDHA, Y438n 81400 CCR5, del 81400 CLRN1, N48K 81400 DPYD, IVS14+1G>A 81400 FGFR1, P252R 81400 FGFR3, P250R 81400 FKTN, retro ins v 81400 GNE, M712T 81400 HPA-6 81400 HPA-9 81400 IVD, A282V 81400 LCT, 13910 C>T 81400 NEB, exon 55 81400 PCDH15, R245X 81400 SHOC2, S2G 81400 SLCO1B1, V174A 81400 SMN1, exon 7 del 81400 SRY, fgs 81400 TOR1A, var 81401 ABCC8, cv 81401 ACADM, cv 81401 ADRB2, cv 81401 AFF2, detect abn 81401 APOB, cv 81401 APOE, cv 81401 AR, alleles 81401 ATN1 81401 ATXN1 81401 ATXN10 81401 ATXN2 81401 ATXN3 81401 ATXN7 81401 ATXN8OS 81401 CACNA1A 2, V14 81401 CBS, cv 81401 CFH_ARMS2, cv 81401 CNBP 81401 CSTB 81401 CYP3A4, cv 81401 CYP3A5, cv 81401
    [Show full text]
  • Stem Cells and Ion Channels
    Stem Cells International Stem Cells and Ion Channels Guest Editors: Stefan Liebau, Alexander Kleger, Michael Levin, and Shan Ping Yu Stem Cells and Ion Channels Stem Cells International Stem Cells and Ion Channels Guest Editors: Stefan Liebau, Alexander Kleger, Michael Levin, and Shan Ping Yu Copyright © 2013 Hindawi Publishing Corporation. All rights reserved. This is a special issue published in “Stem Cells International.” All articles are open access articles distributed under the Creative Com- mons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Editorial Board Nadire N. Ali, UK Joseph Itskovitz-Eldor, Israel Pranela Rameshwar, USA Anthony Atala, USA Pavla Jendelova, Czech Republic Hannele T. Ruohola-Baker, USA Nissim Benvenisty, Israel Arne Jensen, Germany D. S. Sakaguchi, USA Kenneth Boheler, USA Sue Kimber, UK Paul R. Sanberg, USA Dominique Bonnet, UK Mark D. Kirk, USA Paul T. Sharpe, UK B. Bunnell, USA Gary E. Lyons, USA Ashok Shetty, USA Kevin D. Bunting, USA Athanasios Mantalaris, UK Igor Slukvin, USA Richard K. Burt, USA Pilar Martin-Duque, Spain Ann Steele, USA Gerald A. Colvin, USA EvaMezey,USA Alexander Storch, Germany Stephen Dalton, USA Karim Nayernia, UK Marc Turner, UK Leonard M. Eisenberg, USA K. Sue O’Shea, USA Su-Chun Zhang, USA Marina Emborg, USA J. Parent, USA Weian Zhao, USA Josef Fulka, Czech Republic Bruno Peault, USA Joel C. Glover, Norway Stefan Przyborski, UK Contents Stem Cells and Ion Channels, Stefan Liebau,
    [Show full text]
  • Ion Channels
    UC Davis UC Davis Previously Published Works Title THE CONCISE GUIDE TO PHARMACOLOGY 2019/20: Ion channels. Permalink https://escholarship.org/uc/item/1442g5hg Journal British journal of pharmacology, 176 Suppl 1(S1) ISSN 0007-1188 Authors Alexander, Stephen PH Mathie, Alistair Peters, John A et al. Publication Date 2019-12-01 DOI 10.1111/bph.14749 License https://creativecommons.org/licenses/by/4.0/ 4.0 Peer reviewed eScholarship.org Powered by the California Digital Library University of California S.P.H. Alexander et al. The Concise Guide to PHARMACOLOGY 2019/20: Ion channels. British Journal of Pharmacology (2019) 176, S142–S228 THE CONCISE GUIDE TO PHARMACOLOGY 2019/20: Ion channels Stephen PH Alexander1 , Alistair Mathie2 ,JohnAPeters3 , Emma L Veale2 , Jörg Striessnig4 , Eamonn Kelly5, Jane F Armstrong6 , Elena Faccenda6 ,SimonDHarding6 ,AdamJPawson6 , Joanna L Sharman6 , Christopher Southan6 , Jamie A Davies6 and CGTP Collaborators 1School of Life Sciences, University of Nottingham Medical School, Nottingham, NG7 2UH, UK 2Medway School of Pharmacy, The Universities of Greenwich and Kent at Medway, Anson Building, Central Avenue, Chatham Maritime, Chatham, Kent, ME4 4TB, UK 3Neuroscience Division, Medical Education Institute, Ninewells Hospital and Medical School, University of Dundee, Dundee, DD1 9SY, UK 4Pharmacology and Toxicology, Institute of Pharmacy, University of Innsbruck, A-6020 Innsbruck, Austria 5School of Physiology, Pharmacology and Neuroscience, University of Bristol, Bristol, BS8 1TD, UK 6Centre for Discovery Brain Science, University of Edinburgh, Edinburgh, EH8 9XD, UK Abstract The Concise Guide to PHARMACOLOGY 2019/20 is the fourth in this series of biennial publications. The Concise Guide provides concise overviews of the key properties of nearly 1800 human drug targets with an emphasis on selective pharmacology (where available), plus links to the open access knowledgebase source of drug targets and their ligands (www.guidetopharmacology.org), which provides more detailed views of target and ligand properties.
    [Show full text]
  • Replicated Risk Nicotinic Cholinergic Receptor Genes for Nicotine Dependence
    G C A T T A C G G C A T genes Article Replicated Risk Nicotinic Cholinergic Receptor Genes for Nicotine Dependence Lingjun Zuo 1, Rolando Garcia-Milian 2, Xiaoyun Guo 1,3,4,*, Chunlong Zhong 5,*, Yunlong Tan 6, Zhiren Wang 6, Jijun Wang 3, Xiaoping Wang 7, Longli Kang 8, Lu Lu 9,10, Xiangning Chen 11,12, Chiang-Shan R. Li 1 and Xingguang Luo 1,6,* 1 Department of Psychiatry, Yale University School of Medicine, New Haven, CT 06510, USA; [email protected] (L.Z.); [email protected] (C.-S.R.L.) 2 Curriculum & Research Support Department, Cushing/Whitney Medical Library, Yale University School of Medicine, New Haven, CT 06510, USA; [email protected] 3 Shanghai Mental Health Center, Shanghai 200030, China; [email protected] 4 Department of Cellular and Molecular Physiology, Yale University School of Medicine, New Haven, CT 06510, USA 5 Department of Neurosurgery, Ren Ji Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai 200127, China 6 Biological Psychiatry Research Center, Beijing Huilongguan Hospital, Beijing 100096, China; [email protected] (Y.T.); [email protected] (Z.W.) 7 Department of Neurology, Shanghai First People’s Hospital, Shanghai Jiao Tong University, Shanghai 200080, China; [email protected] 8 Key Laboratory for Molecular Genetic Mechanisms and Intervention Research on High Altitude Diseases of Tibet Autonomous Region, Xizang Minzu University School of Medicine, Xianyang, Shanxi 712082, China; [email protected] 9 Provincial Key Laboratory for Inflammation and Molecular Drug Target, Medical
    [Show full text]
  • Structural Analysis of Pathogenic Missense Mutations in GABRA2 and Identification of a Novel De Novo Variant in the Desensitization Gate
    Received: 22 October 2019 | Revised: 29 November 2019 | Accepted: 10 December 2019 DOI: 10.1002/mgg3.1106 ORIGINAL ARTICLE Structural analysis of pathogenic missense mutations in GABRA2 and identification of a novel de novo variant in the desensitization gate Alba Sanchis-Juan1,2 | Marcia A. Hasenahuer3,4 | James A. Baker3 | Amy McTague5 | Katy Barwick5 | Manju A. Kurian5 | Sofia T. Duarte6 | NIHR BioResource | Keren J. Carss1,2 | Janet Thornton3 | F. Lucy Raymond2,4 1Department of Haematology, University of Cambridge, NHS Blood and Transplant Abstract Centre, Cambridge, UK Background: Cys-loop receptors control neuronal excitability in the brain and their 2NIHR BioResource, Cambridge dysfunction results in numerous neurological disorders. Recently, six missense vari- University Hospitals NHS Foundation ants in GABRA2, a member of this family, have been associated with early infantile Trust, Cambridge Biomedical Campus, Cambridge, UK epileptic encephalopathy (EIEE). We identified a novel de novo missense variant 3European Molecular Biology Laboratory, in GABRA2 in a patient with EIEE and performed protein structural analysis of the European Bioinformatics Institute, seven variants. Wellcome Genome Campus, Hinxton, . Cambridge, UK Methods: The novel variant was identified by trio whole-genome sequencing We 4Department of Medical Genetics, performed protein structural analysis of the seven variants, and compared them to Cambridge Institute for Medical Research, previously reported pathogenic mutations at equivalent positions in other Cys-loop University of Cambridge, Cambridge, UK receptors. Additionally, we studied the distribution of disease-associated variants in 5Developmental Neurosciences, Great the transmembrane helices of these proteins. Ormond Street Institute of Child Health, University College London, London, UK Results: The seven variants are in the transmembrane domain, either close to the de- 6Hospital Dona Estefânia, Centro Hospitalar sensitization gate, the activation gate, or in inter-subunit interfaces.
    [Show full text]
  • Distinct Diagnostic and Prognostic Values of Γ‑Aminobutyric Acid Type a Receptor Family Genes in Patients with Colon Adenocarcinoma
    ONCOLOGY LETTERS 20: 275-291, 2020 Distinct diagnostic and prognostic values of γ‑aminobutyric acid type A receptor family genes in patients with colon adenocarcinoma LING YAN1, YI‑ZHEN GONG1, MENG‑NAN SHAO2, GUO‑TIAN RUAN1, HAI‑LUN XIE1, XI‑WEN LIAO3, XIANG‑KUN WANG3, QUAN‑FA HAN3, XIN ZHOU3, LI‑CHENG ZHU4, FENG GAO1 and JIA‑LIANG GAN1 1Department of Colorectal and Anal Surgery, The First Affiliated Hospital of Guangxi Medical University; 2Life Sciences Institute, Guangxi Medical University; 3Department of Hepatobiliary Surgery, The First Affiliated Hospital of Guangxi Medical University; 4Department of Immunology, School of Preclinical Medicine, Guangxi Medical University, Nanning, Guangxi Zhuang Autonomous Region 530021, P.R. China Received July 11, 2019; Accepted February 7, 2020 DOI: 10.3892/ol.2020.11573 Abstract. In the present study, the significance of GABAA of cell matrix adhesion, integrin binding, angiogenesis, endo- genes in colon adenocarcinoma (COAD) were investigated thelial growth factor and endothelial migration regulation in from the view of diagnosis and prognosis. All data were patients with COAD with GABRD overexpression. GABRB1, achieved from The Cancer Genome Atlas. Overall survival GABRD, GABRP and GABRQ were associated with the was analyzed by the Kaplan‑Meier analyses and Cox prognostic factors of COAD. The expression levels of regression model and the hazard ratios and 95% confidence GABRA2, GABRA3, GABRB2, GABRB3, GABRG2, GABRD interval were calculated for computation. The Database for and GABRE may allow differentiation between tumor tissues Annotation, Visualization and Integrated Discovery, and the and adjacent normal tissues. Biological Networks Gene Ontology (BiNGO) softwares were applied to assess the biological processes and Kyoto Introduction Encyclopedia of Genes and Genomes (KEGG) was used for pathway analysis to predict the biological function of GABAA Colorectal cancer (CRC) is a type of malignant tumor origi- genes.
    [Show full text]
  • Gene List of the Targeted NGS MCD and CCA Gene Panel AKT3,ALX1
    Gene List of the targeted NGS MCD and CCA gene panel AKT3,ALX1,ALX3,ALX4,AMPD2,ARFGEF2,ARID1B,ARX,ASPM,ATR,ATRX,B3GALTL,BRPF1,c12orf57,C6orf70,CASK,CCND2,CDK5RAP2,CDON,C ENPJ,CEP170,CHMP1A,COL4A1,CREBBP,CYP11A1,DCHS1,DCLK1,DCX,DHCR24,DHCR7,DIS3L2,DISC1,DISP1,DLL1,DMRTA2,DYNC1H1,DYRK1 A,EARS2,EFNB1,EMX1,EOMES,EP300,ERBB4,ERMARD,EXOSC3,FAM36A,FGF8,FGFR1,FGFR2,FLNA,FOXC1,FOXG1,FOXH1,FZD10,GLI2,GLI3,GP R56,GPSM2,HCCS,HESX1,HNRNPU,IGBP1,IGFBP1,ISPD,ITPA,KAL1,KAT6B,KATNB1,KIAA1279,KIF14,KIF1A,KIF1B,KIF21A,KIF2A,KIF5C,KIF7,L1 CAM,LAMB1,LAMC3,LRP2,MCPH1,MED12,MID1,NDE1,NFIB,NPC1,NR2F1,NSD1,NTRK1,NTRK3,OCEL1,OPA1,OTX2,PAFAH1B1,PAX6,PEX1,PHF1 0,PIK3R2,POLR3A,POLR3B,POMT1,POMT2,PTCH1,PTPRS,PYCR1,RAB3GAP1,RARS2,RELN,RFX3,ROBO1,ROBO3,RPS6KA3,RTTN,SATB2,SEPSEC S,SHH,SIX3,SLC12A6,SOX2,SPOCK1,SRPX2,TBCD,TBCE,TCF4,TDGF1,TEAD1,THBS2,TMEM5,TSC1,TSC2,TSEN15,TSEN2,TSEN34,TSEN54,TUBA1 A,TUBA8,TUBB,TUBB2A,TUBB2B,TUBB3,TUBB4A,TUBG1,VAX1,VRK1,WDR47,WDR62,ZBTB18,ZEB2,ZIC2. Gene List of the targeted NGS epilepsy gene panel AARS, ADGRV1, ADRA2B, ADSL, ALDH4A1, ALDH7A1, ALG13, ALPL, ARHGEF15, ARHGEF9, ARX, ASAH1, ATP1A2, ATP1A3, BRD2, CACNA1A, CACNA1H, CACNA2D2, CACNB4, CBL, CDKL5, CERS1, CHD2, CHRNA2, CHRNA4, CHRNB2, CLCN2, CLCN4, CLN8, CLTC, CNKSR2, CNTNAP2, CPA6, CPLX1, CSNK1G1, CSNK2B, CTNND2, DEPDC5, DHDDS, DNM1, DOCK7, DYNC1H1, EEF1A2, EFHC1, EIF2S3, EMC1, EPM2A, FASN, FLNA, FOXG1, GABBR2, GABRA1, GABRA2, GABRA3, GABRB2, GABRB3, GABRD, GABRG2, GAL, GNAO1, GOSR2, GRIA1, GRIN1, GRIN2A, GRIN2B, HCN1, HCN4, HDAC4, HNRNPU, IDH3A, IQSEC2, JRK, KCNA1, KCNA2, KCNB1,
    [Show full text]
  • GSE50161, (C) GSE66354, (D) GSE74195 and (E) GSE86574
    Figure S1. Boxplots of normalized samples in five datasets. (A) GSE25604, (B) GSE50161, (C) GSE66354, (D) GSE74195 and (E) GSE86574. The x‑axes indicate samples, and the y‑axes represent the expression of genes. Figure S2. Volanco plots of DEGs in five datasets. (A) GSE25604, (B) GSE50161, (C) GSE66354, (D) GSE74195 and (E) GSE86574. Red nodes represent upregulated DEGs and green nodes indicate downregulated DEGs. Cut‑off criteria were P<0.05 and |log2 FC|>1. DEGs, differentially expressed genes; FC, fold change; adj.P.Val, adjusted P‑value. Figure S3. Transcription factor‑gene regulatory network constructed using the Cytoscape iRegulion plug‑in. Table SI. Primer sequences for reverse transcription‑quantitative polymerase chain reaction. Genes Sequences hsa‑miR‑124 F: 5'‑ACACTCCAGCTGGGCAGCAGCAATTCATGTTT‑3' R: 5'‑CTCAACTGGTGTCGTGGA‑3' hsa‑miR‑330‑3p F: 5'‑CATGAATTCACTCTCCCCGTTTCTCCCTCTGC‑3' R: 5'‑CCTGCGGCCGCGAGCCGCCCTGTTTGTCTGAG‑3' hsa‑miR‑34a‑5p F: 5'‑TGGCAGTGTCTTAGCTGGTTGT‑3' R: 5'‑GCGAGCACAGAATTAATACGAC‑3' hsa‑miR‑449a F: 5'‑TGCGGTGGCAGTGTATTGTTAGC‑3' R: 5'‑CCAGTGCAGGGTCCGAGGT‑3' CD44 F: 5'‑CGGACACCATGGACAAGTTT‑3' R: 5'‑TGTCAATCCAGTTTCAGCATCA‑3' PCNA F: 5'‑GAACTGGTTCATTCATCTCTATGG‑3' F: 5'‑TGTCACAGACAAGTAATGTCGATAAA‑3' SYT1 F: 5'‑CAATAGCCATAGTCGCAGTCCT‑3' R: 5'‑TGTCAATCCAGTTTCAGCATCA‑3' U6 F: 5'‑GCTTCGGCAGCACATATACTAAAAT‑3' R: 5'‑CGCTTCACGAATTTGCGTGTCAT‑3' GAPDH F: 5'‑GGAAAGCTGTGGCGTGAT‑3' R: 5'‑AAGGTGGAAGAATGGGAGTT‑3' hsa, homo sapiens; miR, microRNA; CD44, CD44 molecule (Indian blood group); PCNA, proliferating cell nuclear antigen;
    [Show full text]
  • Epilepsy, E/I Balance and GABA Receptor Plasticity
    Epilepsy, E/I balance and GABAA receptor plasticity Jean-Marc Fritschy* Institute of Pharmacology and Toxicology, University of Zurich, Zurich, Switzerland Edited by: Jochen C. Meier, Max Delbrück Center for Molecular Medicine, Germany Reviewed by: Robert J. Harvey, University of London, UK GABAA receptors mediate most of the fast inhibitory transmission in the CNS. They form heteromeric complexes assembled from a large family of subunit genes. The existence of multiple GABAA receptor subtypes differing in subunit composition, localization and functional properties underlies their role for fi ne-tuning of neuronal circuits and genesis of network oscillations. The differential regulation of GABAA receptor subtypes represents a major facet of homeostatic synaptic plasticity and contributes to the excitation/inhibition (E/I) balance under physiological conditions and upon pathological challenges. The purpose of this review is to discuss recent fi ndings highlighting the signifi cance of GABAA receptor heterogeneity for the concept of E/I balance and its relevance for epilepsy. Specifi cally, we address the following issues: (1) role for tonic inhibition, mediated by extrasynaptic GABAA receptors, for controlling neuronal excitability; (2) signifi cance of chloride ion transport for maintenance of the E/I balance in adult brain; and (3) molecular mechanisms underlying GABAA receptor regulation (traffi cking, posttranslational modifi cation, gene transcription) that are important for homoeostatic plasticity. Finally, the relevance of these fi ndings is discussed in light of the involvement of GABAA receptors in epileptic disorders, based on recent experimental studies of temporal lobe epilepsy (TLE) and absence seizures and on the identifi cation of mutations in GABAA receptor subunit genes underlying familial forms of epilepsy.
    [Show full text]
  • A Splice-Site Mutation in GABRG2 Associated with Childhood Absence Epilepsy and Febrile Convulsions
    ORIGINAL CONTRIBUTION A Splice-Site Mutation in GABRG2 Associated With Childhood Absence Epilepsy and Febrile Convulsions Colette Kananura, MS; Karsten Haug, MD; Thomas Sander, MD; Uwe Runge, MD; Wenli Gu, MS; Kerstin Hallmann, MS; Johannes Rebstock, MD; Armin Heils, MD; Ortrud K. Steinlein, MD Context: Missense mutations in the GABRG2 gene, which mutation, which is predicted to lead to a nonfunctional encodes the ␥2 subunit of central nervous ␥-aminobu- protein, cosegregates with the disease status in a family tyric acid (GABA)A receptors, have recently been de- with childhood absence epilepsy and febrile convul- scribed in 2 families with idiopathic epilepsy. In one of these sions. The association study did not find any significant families, the affected individuals predominantly exhibited differences in the allele and genotype frequencies of the childhood absence epilepsy and febrile convulsions. common exon 5 polymorphism (C588T) between pa- tients with idiopathic absence epilepsy and controls Objective: To assess the role of GABRG2 in the ge- (PϾ.35). netic predisposition to idiopathic absence epilepsies. Conclusions: Our study identified a splice–donor-site Design: The GABRG2 gene was screened by single- mutation that was probably causing a nonfunctional strand conformation analysis for mutations. Further- GABRG2 subunit. This mutation occurred in heterozy- more, a population-based association study assessing a gosity in the affected members of a single nuclear fam- common exon 5 polymorphism (C588T) was carried out. ily, exhibiting a phenotypic spectrum of childhood ab- sence epilepsy and febrile convulsions. The GABRG2 gene Patients: The sample was composed of 135 patients with seems to confer a rare rather than a frequent major sus- idiopathic absence epilepsy and 154 unrelated and eth- ceptibility effect to common idiopathic absence epi- nically matched controls.
    [Show full text]
  • Altered Expression of Genes Encoding Neurotransmitter Receptors in Gnrh Neurons of Proestrous Mice
    ORIGINAL RESEARCH published: 07 October 2016 doi: 10.3389/fncel.2016.00230 Altered Expression of Genes Encoding Neurotransmitter Receptors in GnRH Neurons of Proestrous Mice Csaba Vastagh 1*, Annie Rodolosse 2, Norbert Solymosi 3 and Zsolt Liposits 1, 4 1 Laboratory of Endocrine Neurobiology, Institute of Experimental Medicine, Hungarian Academy of Sciences, Budapest, Hungary, 2 Functional Genomics Core, Institute for Research in Biomedicine (IRB Barcelona), Barcelona, Spain, 3 Department of Animal Hygiene, Herd-Health and Veterinary Ethology, University of Veterinary Medicine, Budapest, Hungary, 4 Department of Neuroscience, Faculty of Information Technology and Bionics, Pázmány Péter Catholic University, Budapest, Hungary Gonadotropin-releasing hormone (GnRH) neurons play a key role in the central regulation of reproduction. In proestrous female mice, estradiol triggers the pre-ovulatory GnRH surge, however, its impact on the expression of neurotransmitter receptor genes in GnRH neurons has not been explored yet. We hypothesized that proestrus is accompanied by substantial changes in the expression profile of genes coding for neurotransmitter Edited by: receptors in GnRH neurons. We compared the transcriptome of GnRH neurons obtained Hansen Wang, from intact, proestrous, and metestrous female GnRH-GFP transgenic mice, respectively. University of Toronto, Canada About 1500 individual GnRH neurons were sampled from both groups and their Reviewed by: Pamela L. Mellon, transcriptome was analyzed using microarray hybridization and real-time
    [Show full text]