PDF hosted at the Radboud Repository of the Radboud University Nijmegen

The following full text is a publisher's version.

For additional information about this publication click this link. http://hdl.handle.net/2066/207617

Please be advised that this information was generated on 2021-10-09 and may be subject to change. Rinske van Oorschot van Rinske HEMATOLOGICAL DISORDERS HEMATOLOGICAL TRANSCRIPTION FACTOR GFI1B IN GFI1B IN FACTOR TRANSCRIPTION MOLECULAR MECHANISMS OF THE OF THE MECHANISMS MOLECULAR

RIMLS MOLECULAR MECHANISMS OF THE TRANSCRIPTION FACTOR GFI1B IN HEMATOLOGICAL DISORDERS Rinske van Oorschot 2019-09

MOLECULAR MECHANISMS OF THE TRANSCRIPTION FACTOR GFI1B IN HEMATOLOGICAL DISORDERS

Rinske van Oorschot The cover represents my two playgrounds. The lab where I studied inherited DNA variants, and the ocean with its magical sunsets and beautiful waves where I like to surf and sail.

Research described in this thesis was performed at the Department of Laboratory Medicine, Laboratory of Hematology of the Radboudumc and Radboud Institute for Molecular Life Sciences in Nijmegen, the Netherlands.

ISBN 978-94-028-1584-9 Cover and design by Bregje Jaspers, ProefschriftOntwerp.nl (STUDIO 0404) Printed by Ipskamp Printing

© Rinske van Oorschot, 2019 All rights reserved. No parts of this publication may be reported or transmitted, in any form or by any means, without permission of the author. MOLECULAR MECHANISMS OF THE TRANSCRIPTION FACTOR GFI1B IN HEMATOLOGICAL DISORDERS

Proefschrift ter verkrijging van de graad van doctor aan de Radboud Universiteit Nijmegen op gezag van de rector magnificus prof. dr. J.H.J.M. van Krieken, volgens besluit van het college van decanen in het openbaar te verdedigen op donderdag 3 oktober 2019 om 12.30 uur precies

door

Rinske van Oorschot geboren op 9 januari 1991 te ‘s-Hertogenbosch Promotor Prof. dr. J.H. Jansen

Copromotor Dr. B.A. van der Reijden

Manuscriptcommissie Prof. dr. ir. J.H.L.M. van Bokhoven Prof. dr. M.H.G.P Raaijmakers (Erasmus MC) Dr. C. Logie

TABLE OF CONTENTS

Chapter 1 General introduction 9

Chapter 2 Molecular mechanisms of bleeding disorder-associated GFI1B-Q287* 29 mutation and its affected pathways in megakaryocytes and platelets.

Chapter 3 Inherited missense variants that affect GFI1B function do not necessarily 71 cause bleeding diatheses.

Chapter 4 Functional characterization of the clonal hematopoiesis and 93 myeloproliferative neoplasm associated polymorphism rs621940 located downstream of GFI1B.

Chapter 5 General discussion 119

Chapter 6 English summary 141

Chapter 7 Nederlandse samenvatting 147

Chapter 8 Curriculum vitae, List of publications, and Portfolio 153

Chapter 9 Dankwoord 159

1 General introducti on CHAPTER 1

10 GENERAL INTRODUCTION

MEGAKARYOPOIESIS AND PLATELET PRODUCTION 1 When a blood vessel is damaged due to injury or surgery a process called haemostasis prevents signifi cant blood loss. Blood platelets (thrombocytes) are anucleate discoid cells that have a central role in this process. Platelets, are derived from large (>150 μm) progenitor cells that reside in the bone marrow, called megakaryocytes. Although present at a low frequency of only 1/10000 nucleated cells, megakaryocytes produce approximately 1 x 1011 platelets every day.

Early megakaryopoiesis Like all blood cells, megakaryocytes are derived from hematopoieti c stem cells (HSCs). In the classical model megakaryocytes develop from megakaryocyte-erythrocyte progenitors (MEPs) that are bipotent precursors of both the megakaryocyti c and erythroid lineages.1, 2 However, recent studies have demonstrated that the commitment to the megakaryocyti c lineage is decided earlier than expected previously. The existence of megakaryocyte-biased HSCs suggests that megakaryocytes might be directly diff erenti ated from HSCs, possibly bypassing the MEP stage.3 Either way the process of megakaryocyte development or megakaryopoiesis starts with early megakaryocytes that undergo a normal proliferati ve stage followed by repeated cycles of DNA replicati on without cell division, termed endomitosis, to become polyploid up to 128N.4 Endomitosis is believed to occur during megakaryopoiesis in order to support the large quanti ty of protein and membrane synthesis necessary for platelet producti on.5

Late megakaryopoiesis During late events of megakaryopoiesis, an invaginated membrane system (also known as demarcati on membrane system) is formed that is conti nuous with the plasma membrane and permeates the cytoplasm. This membrane system is thought to functi on as a membrane reservoir for proplatelet formati on.6 Furthermore, alpha (α) and dense (δ) granules are produced. δ-granules are the major source of small molecules such as calcium, magnesium and adenine nucleoti des that sti mulate platelet aggregati on. α-granules, the most abundant platelet organelles, are the major site of protein storage (e.g. fi brinogen, platelet factor 4 (PF4), β-thromboglobulin (β-TG), and von Willebrand factor (VWF)) needed for coagulati on and haemostasis.4, 7, 8 α-granule proteins can have opposing functi ons. This suggests that platelets release diff erent subpopulati ons of α-granules in a regulated manner, depending on the functi on to perform. Finally, mature megakaryocytes will express cell surface receptors that mediate platelet adhesion and aggregati on such as CD41 (integrin αIIb, GPIIb), CD61 (integrin β3, GPIIIa), and CD42b (GPIbα).9

Proplatelet formati on Mature megakaryocytes will generate multi ple, long branching extensions called proplatelets that elongate into the sinusoidal blood vessels of the bone marrow, and functi on as assembly lines of platelet producti on.4, 10 Proplatelets are a string of platelet-sized, bead-like swellings, which are connected by cytoplasmic bridges. Eventually, the blood fl ow will cause the release of the terminal buds into the

11 CHAPTER 1

bloodstream as platelets.4, 9 In this way, a single megakaryocyte can generate thousands of platelets before membrane exhaustion, after which the remaining cell body is degraded.11

Role of platelets in primary haemostasis Under normal conditions platelets have a lifespan of about nine days, and do not interact significantly with the endothelial cells of the blood vessel. However, when a blood vessel is damaged, the subendothelial matrix is exposed, leading to rapid accumulation of platelets at the site of injury to form a fibrin rich plug that stops the bleeding. At sites of low shear such as veins and large arteries, platelet adhesion is mediated through interaction of platelet receptors with collagen and other adhesive proteins. In small arteries or microvasculature, where the shear is high, platelet adhesion is intensified through the platelet glycoprotein (GP) Ib-IX-V receptor (containing CD42b) interaction with VWF which is bound to collagen in the extracellular matrix. This interaction provides a more stable interaction between collagen and its receptors GPVI and integrin α2β1, triggering intracellular pathways that lead to remodelling of the cytoskeleton, and aggregation of platelets via fibrinogen and activated integrin αIIbβ3 (CD41/CD61) receptors.9 Platelets will subsequently release their granule contents (degranulation) e.g. VWF from the α-granules and ADP from δ-granules, contributing to coagulation, wound healing and inflammation. Simultaneously, the coagulation cascade is activated (secondary haemostasis) resulting in fibrin strands, consolidating the platelet aggregate to become a strong fibrin clot. This fibrin clot is eventually degraded in a process called fibrinolysis.

INHERITED BLEEDING AND PLATELET DISORDERS

The above described process of platelet formation and haemostasis is disturbed in inherited bleeding and platelet disorders (IBPDs), which is a heterozygous group of diseases. IBPDs can be divided in coagulation defects and platelet defects. The most common inherited IBPDs are von Willebrand disease (VWD) (1 in 100-1000) and haemophilia A (1 in 5000-10000 males) which are caused by coagulation defects, the remaining IBPDs are very rare. IBPDs with a platelet defect are also called inherited platelet disorders (IPDs).12 IPDs are an extremely heterogeneous group of disorders associated with defective platelet count and/or platelet function, and bleeding diatheses of varying severities. This makes them difficult to properly diagnose even with standardized platelet function testing and bleeding assessment scores. Identification of the pathogenic gene variant is therefore very important in the analysis ofthese patients, as it can provide accurate diagnosis. Genetic variations are nowadays identified using high- throughput sequencing with targeted gene panels and whole-exome sequencing. Detected variants are filtered using their minor allele frequency in the large population cohort database gnomAD and prioritized by comparing the patients’ phenotypes with the clinical and laboratory characteristics of IPDs. The correct interpretation and pathogenicity scoring of variants is crucial for diagnosis, as usually more variants are detected per sequenced sample.13 Guidelines for the interpretation and classification

12 GENERAL INTRODUCTION

of gene variants have been suggested by the American College of Medical Geneti cs and Genomics and the Associati on for Molecular Pathology,14 and we used these guidelines to classify new GFI1B 1 variants in Chapter 3. Following these guidelines, variants identi fi ed in pati ents with rare hereditary disorders should be classifi ed using the terms ‘pathogenic’, ‘likely pathogenic’, ‘variant of uncertain signifi cance (VUS)’, ‘likely benign’, and ‘benign’. These variants can have a parti al or full contributi on to the phenotype. For VUS it is sti ll unclear if they are ‘pathogenic’. Unti l now 63 genes have been identi fi ed with variants in IPDs (Figure 131). These genes play a role in megakaryopoiesis, platelet formati on and platelet functi on. More specifi cally, TPO and MPL signaling, transcripti onal regulati on, granule biogenesis and traffi cking, cytoskeleton regulati on, glycoprotein (GP) signaling, and G-protein coupled receptor (GPCR) signaling. Most gene defects result in bleeding and thrombocytopenia, but some are also associated with defects in other blood cells or even non- hematological phenotypes. For instance, mutati ons in RUNX1, ANKRD26 and ETV6 predispose to hematological malignancies, MYH9 mutati ons increase the risk of developing kidney failure, cataracts and hearing loss at a later stage, while MPL mutati ons almost always evolve into deadly bone marrow failure.15

TRANSCRIPTIONAL REGULATION VARIANTS IN IPD

The identi fi cati on of variants causing IPD have given us insight in the proteins important for the producti on and functi on of platelets. This is relevant for the development of targeted thrombocytopenia therapies. Variants in hematopoieti c transcripti on factors are associated with a multi tude of megakaryocyte and platelet defects, suggesti ng they are involved in many processes during megakaryopoiesis and therefore ideal to study the molecular pathways underlying megakaryopoiesis. In my thesis I will focus on the transcripti on factor GFI1B because it is one of the most recently identi fi ed genes with variants in IPD and therefore less studied. In this chapter I will also discuss the other mutated transcripti on factors to illustrate the diff erences and similariti es in phenotypes with GFI1B variants.

13 CHAPTER 1 Figure 1

HSC Early megakaryocyte Late megakaryocyte Proplatelet-forming megakaryocyte Platelets

TPO/MPL signaling: Transcription regulation: Granulopoiesis and trafficking: Cytoskeleton regulation: GP receptor signaling: GPCR signaling: TPO GATA1 HPS1 MYH9 GP1BA P2RY12 MPL RUNX1 AP3B1 WAS GP1BB TBXA2R FLI1 HPS3 TPM4 GP9 TBXAS1 ETV6 HPS4 ACTN1 ITGA2B PLA2G4A GFI1B HPS5 ARPC1B ITGB3 HOXA11 HPS6 CDC42 VWF Other pathways: MECOM DTNBP1 FLNA RASGRP2 ANO6 ANKRD26 BLOC1S3 TUBB1 FERMT3 THBD RBM8A BLOC1S6 DIAPH1 GP6 PLAU AP3D1 FYB LYST RNU4ATAC VPS33B VIPAS39 STXBP2 NBEA NBEAL2

Pathway incomplete: CYCS, SRC, SLFN14, STIM1, ABCG5, ABCG8, MPIG6B, KDSR, GNE

Figure 1. Affected genes in inherited platelet disorders. The role of inherited platelet disorder genes in megakaryopoiesis, platelet formation, and function. HSC: hematopoietic stem cell, GP: glycoprotein, GPCR: G-protein coupled receptor. Figure adapted from Heremans et al. 2018.

Growth Factor Independence 1B (GFI1B) GFI1B regulates both megakaryopoiesis and erythropoiesis. Patients with GFI1B variants mainly suffer from a bleeding diathesis. Although, there are a few variants for which morphological erythrocyte defects have been described. GFI1B contains an N-terminal Snail/GFI1 (SNAG) domain that can interact with transcriptional regulators, and six zinc fingers of which 3-5 are essential for DNA binding (Figure 2).16 For the remaining zinc fingers the function is unknown. Heterozygous truncating variants in the DNA binding domain (G272fs, Q287*, H294fs)17-19, result in autosomal dominant bleeding diathesis, associated with macro-thrombocytopenia, hypogranular platelets, anisopoikilocytosis, and an increased number of megakaryocytes in the bone marrow which are dysplastic. Furthermore, the platelets and megakaryocytes express CD34, which is normally only found on stem and progenitor cells. These truncating variants are dominant-negative, which means they lost the repressive function of GFI1B and inhibit wild type GFI1B. In one individual a truncating GFI1B variant (K265*) was found in the DNA binding domain, together with a Factor V Leiden variant. This patient had a bleeding diathesis with thrombocytopenia, disturbed platelet aggregation and a reduction in α- en δ-granules. K265* caused a reduction in the number of megakaryocytes, in contrast to the other truncating variants.20 It needs to be investigated whether this variant also acts in a dominant negative manner.

14 GENERAL INTRODUCTION

In additi on to truncati ng variants in the DNA-binding domain, there are also variants found that disturb the rati o between GFI1B isoforms p37 and p32. GFI1B-p37 is the most common isoform, and 1 GFI1B-p32 is formed via alternati ve splicing of coding exon 4. This results in a protein lacking intact zinc fi nger 1 and 2. A homozygous inserti on c.551insG within coding exon 4 results in a premature stopcodon (S185fs*3), aff ecti ng only GFI1B-p37. De majority of the GFI1B-p37 transcript is broken down by nonsense-mediated-mRNA decay, resulti ng in only GFI1B-p32 on protein level. Aff ected family members have a very severe bleeding diathesis and hypogranular platelets with a reduced aggregati on reacti on. The megakaryocytes are small, dysplasti c, and express CD34 like the platelets.21 There is also a family with a heterozygous splice variant c.648+1_648+8delGTGGGCAC (reported as c.2520+1_2520+8delGTGGGCAC by Rabbolini et al.) which is predicted to result in GFI1B-p32 and therefore less expression of GFI1B-p37. Aff ected family members have platelet CD34 expression, but no bleeding diathesis or thrombocytopenia22 possibly because there is enough GFI1B-p37 as result of a heterozygous variant. Finally there are missense variants (C165F,23 C168F,22 and L308P (homozygous)20) located in the non-DNA-binding zinc fi ngers one and six. Variants C165F and L308P result in a mild bleeding diathesis, which is absent in C168F aff ected cases. All three result in macro-thrombocytopenia, either with platelet CD34 expression for C165F and C168F, or a reducti on in α- en δ-granules for L308P. Furthermore, the bone marrow biopsy of an L308P individual showed increased megakaryocyte numbers, which were someti mes immature. Additi onal GFI1B variants located in non-DNA binding domains were reported by Chen et al.24 In chapter 3 we performed a molecular and/or clinicopathological characterizati on to investi gate if these GFI1B variants are pathogenic. Figure 2

GFI1B C165F C168F S185fs K265* G272fs Q287* H294fs L308P

c.648+1_648+8delGTGGGCAC

SNAG znf1 znf2 znf3 znf4 znf5 znf6

LSD1 binding DNA binding

Figure 2. GFI1B variants in inherited platelet disorders. Schemati c overview of GFI1B protein structure with variants identi fi ed in inherited bleeding and platelet disorders. All variants are heterozygous except for S185fs and L308P. There are two isoforms of GFI1B, the full length GFI1B-p37 is presented here, the short isoform GFI1B-p32 lacks intact zinc fi nger (znf) 1 and 2 due to exon 4 skipping. c.648+1_648+8delGTGGGCAC (NM_004188.6) is a splice variant resulti ng in exon 4 skipping and expression of GFI1B-p32.

15 CHAPTER 1

GATA-binding protein 1 (GATA1) Like GFI1B, GATA1 is crucial in erythrocyte and megakaryocyte development. Inherited (X-linked) variants in this gene lead to bleeding diathesis and severe erythrocyte defects in men. The bleeding diathesis presents as bruising, petechia, nose bleeds and sustained bleeding after injury or surgery. The bleeding diathesis is caused by thrombocytopenia in combination with platelet defects such as enlarged platelets, diminished aggregation function, and a reduction of α-granules. Furthermore, the bone marrow of several GATA1 mutated patients show dysmegakaryopoiesis with hyperproliferation of (sometimes immature) megakaryocytes.25-29 GATA1 has two zinc fingers. The C-terminal zinc finger binds the consensus DNA sequence (A/T) GATA(A/G), while the N-terminal zinc finger stabilizes the DNA interaction and binds to co-regulatory proteins like Friend of GATA1 (FOG1) and the pentameric complex consisting of TAL1, LMO2, LDB1, TAL1, and E2A.9 GATA1 and FOG1 can induce both gene activation and repression,30 in contrast to GATA1 and the pentameric complex that will only induce transcriptional activation.31 Until now, all described GATA1 missense variants are located in the N-terminal zincfinger (Figure 3). All missense variants cause thrombocytopenia. However, there are differences in additional phenotypes depending on the location and amino acid change. The V205M, G208R en D218Y variants cause severe dyserythropoietic anemia, G208S, D218G en D218N mild dyserythropoiesis, R216Q β-thalassemia, and R216W erythropoietic porphyria. The phenotypes of V205M, G208R, G208S, and D218Y are a result of a disturbed interaction with FOG1, and R216Q and D218G disturb the interaction with LMO2 (pentameric complex).32 The disease causing mechanism is not studied for R216W. In addition to variants in the N-terminal zinc finger, a rare variant (X414Rext42) was found that elongated the GATA1 protein by changing the stopcodon into an arginine. The index patient suffered from bruising, mild thrombocytopenia with macro-thrombocytes and a reduction in α-granules.33 For thisFigure variant 3 it is also not clear how it contributes to the bleeding diathesis.

GATA1 D218Y G208S R216Q D218G V205M G208R R216W D218N X414Rext42

N-TAD N-znf C-znf C-TAD FOG1/LMO2 DNA binding binding

Figure 3. GATA1 variants in inherited platelet disorders. Schematic overview of GATA1 protein structure with variants identified in inherited bleeding and platelet disorders. Different domains are indicated such asthe N-terminal transactivation domain (N-TAD), N-terminal zinc finger (N-znf), C-terminal zinc finger (C-znf), and C-terminal transactivation domain (C-TAD).

16 GENERAL INTRODUCTION

Runt-related transcripti on factor-1 (RUNX1) There are many diff erent heterozygous variants identi fi ed in RUNX1 (also known as CBFα and AML1), 1 ranging from frameshift , missense, and nonsense mutati ons to big deleti ons. These inherited variants result in bleeding diathesis, thrombocytopenia, and platelet dysfuncti on such as a reducti on in α- and δ-granules or aggregati on defects.34 Like earlier described for GFI1B variants, RUNX1-Q154fs aff ected individuals have CD34+ platelets.35 Characteristi c for inherited RUNX1 variants is the increased risk of developing acute myeloid leukemia (AML) or myelodisplasti c syndrome (MDS).34 The bleeding diathesis is oft en mild and therefore missed resulti ng in only the diagnosis of AML.36 The majority of RUNX1 variants are located in the RUNT domain (Figure 4), which is responsible for nuclear localisati on, DNA binding, and the interacti on with CBFβ. Multi ple studies investi gated the in vitro eff ect of RUNX1 variants on the diff erent functi ons of the RUNT domain. To perform its normal functi on, RUNX1 should migrate to the nucleus together with CBFβ.37 Truncati ng RUNX1 variants R201* and R204* cannot migrate to the nucleus leading to RUNX1 haploinsuffi ciency. Missense variants at this positi on (R201Q and R204Q) do migrate to the nucleus and interact with CBFβ.38 The R201Q variant has disrupted DNA binding and inhibits wild type RUNX1 in a dominant-negati ve manner, possibly through sequestering CBFβ. This dominant-negati ve eff ect was also observed for the K110E variant.38, 39 Normally, K110 can be ubiquiti nated (mark for proteasomal degradati on). However, this is disturbed by the K110E variant resulti ng in a more stable mutant protein that could sequester more CBFβ.40 Although many RUNX1 variants are located in the RUNT domain, there are also variants found in the intermediate domain and the C-terminal transacti vati on domain. RUNX1 can induce acti vati on or repression depending on the co-factors binding to the transacti vati on domain.41, 42 The frameshift variant T246Rfs, located in the intermediate domain, results in loss of the transacti vati on domain. However, the RUNT domain is sti ll intact resulti ng in a mutant protein that inhibits wild type RUNX1 by occupying the target sites without inducing transcripti onal acti vity.43 Another truncati ng variant is located in the transacti vati on domain (Y287*).38 Correcti on of this variant in induced pluripotent stemFigure cells 4 (iPSC) rescued the phenotype and restored megakaryopoiesis, proving the pathogenicity of Y287*.44

RUNX1 c.351+1G>T c.442_449del R201Q, R201* R204Q, R204* K110E A134P Q154fs A156E T246fs Y287* Q335R R166Q

RUNT TAD ID DNA & CBFβ binding NLS

Figure 4. RUNX1 variants in inherited platelet disorders. Schemati c overview of RUNX1 protein structure and variants identi fi ed in inherited platelet disorders. Diff erent domains are indicated such as the RUNTdomain important for DNA and CBFβ binding, the transacti vati on domain (TAD), nuclear localizati on signal (NLS), and the inhibitory domain (ID). Intronic variants, predicted to interfere with splicing are shown in italics.

17 CHAPTER 1

Friend Leukaemia Integration 1 (FLI1) FLI1 is a transcription factor with a E26 transformation specific (ETS) domain for DNA binding (GGA(A/T) motif) and an N-terminal domain important for transactivation. FLI1 acts together with GA binding protein transcription factor α subunit (GABPα) which also belongs to the ETS transcription factor family.45 FLI1 regulates genes important in megakaryocyte development like C-MPL (TPO-receptor).46 FLI1 is located on chromosome 11 (11q23.3) and is monoallelic deleted in Paris-Trousseau and Jacobsen syndrome as a result of the 11q deletion.47 These syndromes are characterized by mild thrombocytopenia, lack of collagen induced aggregation, and fused α-granules.48, 49 Recently it was found that the hemizygotic FLI1 deletion causes the bleeding diathesis in these patients.50 51 Individuals with missense and frameshift variants in FLI1 (R324W, N331Tfs*4, R337W, R337Q, Y343C, K345E) have a bleeding diathesis with macro-thrombocytopenia, fused α-granules, and reduced ATP secretion from the δ-granules. There is no reduction in α-granules like with GATA1, GFI1B, and RUNX1 variants. All identified FLI1 variants are located in the ETS domain (Figure 5). As expected, DNA- binding is disturbed for R324W, R337W, and Y343C variants. For the remaining variants this is not yet studied. Another characteristic of inherited FLI1 defects is increased platelet MYH10 expression.52, 53 RUNX1 regulates the expression of MYH10 via FLI1, and for several RUNX1 variants MYH10 expression Figure 5 was also increased.52 MYH10 might therefore be a good biomarker for both FLI1 and RUNX1 variants.

FLI1 R337Q R324W N331fs R337W Y343C K345E

PNT ETS Transactivation DNA binding

Figure 5. FLI1 variants in inherited platelet disorders. Schematic overview of FLI1 protein structure and variants identified in inherited platelet disorders. The pointed (PNT) domain is involved in transactivation and the ETS domain in DNA binding.

Ets variants 6 (ETV6) ETV6 is, like FLI1, a member of the ETS transcription factor family. In addition to the C-terminal DNA binding ETS domain, ETV6 contains a N-terminal PNT domain which mediates dimerization (e.g. with FLI1 and ETV6 itself) and nuclear localization. These two domains are separated by a central regulatory linker domain. ETV6 specifically acts as a transcriptional repressor that auto-regulates itself and requires homodimerization to exert repression.54 The major domains of ETV6 also appear to bind a plethora of co-repressors, which interact with the PNT-domain (L3MBTL1, KAP1, SIN3A), central regulatory linker domain (HDAC3, N-COR), or ETS-domain (SIN3A, N-COR, SMRT, TIP60).55

18 GENERAL INTRODUCTION

Most pati ents with inherited ETV6 variants present with mild to moderate thrombocytopenia. Other features such as bleeding symptoms, large platelets, dysmegakaryopoiesis, dyserythropoiesis, 1 nuclear hypolobulati on and hypogranulati on of myeloid cells, and increased numbers of circulati ng CD34+ cells, were described in a subset of pati ents.54, 55 In general, ETV6 variants predispose to both lymphoid and myeloid hematological malignancies. Acute lymphoid leukemia (ALL) is most frequent, especially childhood B-ALL. Overall, approximately 30% of all carriers have been diagnosed with a hematologic malignancy.54 The hotspot inherited ETV6 variant P214L (present in fi ve families) is located in the central regulatory linker domain. The remaining variants are located in the ETS domain (Figure 6). It is thought that all variants act in a dominant-negati ve manner either via sequestrati on of the wild type protein to Figure 6 the cytoplasm, competi ti on for co-repressors, or reducing the affi nity of repressive complexes to DNA by changing or deleti ng the DNA-binding acti vity of the ETS-domain.55

Y401N ETV6 N385fs Y401H R359X R369W W380R R399C P214L L349P I358M R369Q A377T R396G R418G

PNT Linker ETS Dimerization DNA binding Nuclear localization

Figure 6. ETV6 variants in inherited platelet disorders. Schemati c overview of ETV6 protein structure and variants identi fi ed in inherited platelet disorders. ETV6 contains a pointed (PNT) domain which mediates homo-and heterodimerizati on and is required for nuclear localizati on of the protein, the linker is a central regulatory domain, and the ETS domain binds DNA.

EVI1, HOXA11, and RBM8A EVI1 is encoded by the MECOM gene and has fi ve N-terminal zinc fi ngers that recognize a GATA-like moti f and three C-terminal zinc fi ngers that recognize an ETS-like moti f. Through the C-terminalth 8 zinc fi nger, EVI1 interacts with itself and other transcripti on factors including RUNX1 and GATA1.56 Gain-of- functi on EVI1 variants (T756A, H751R, and R750W) located in the th8 zinc fi nger have been implicated in radioulnar synostosis with amegakaryocyti c thrombocytopenia (RUSAT), which is an inherited bone marrow failure syndrome, characterized by severe thrombocytopenia due to absence or signifi cant reducti on of megakaryocytes, and congenital fusion of the radius and ulna. Before, RUSAT was found associated with a dominant loss-of-functi on variant in HOXA11 ( N291Tfs*4), which is a transcripti on factor implicated in bone morphogenesis and megakaryocyte diff erenti ati 57,on. 58 EVI1 is also implicated in the pathogenesis of thrombocytopenia–absent radii syndrome. This syndrome is caused by compound inheritance, with a variant in RBM8A on one allele and a variant in an EVI1 regulatory region of RBM8A on the other allele.58

19 CHAPTER 1

Variants in the regulatory region of ANKRD26 In addition to transcription factor mutations, there are also variants in the 5’UTR of ANKRD26 that possibly inhibit binding of RUNX1 and FLI1 causing ANKRD26 related thrombocytopenia. These patients show mild to severe thrombocytopenia, mild bleeding diathesis, increased levels of serum TPO and dysmegakaryopoiesis in the bone marrow. No defects in platelet function or morphology have been found, but several patients displayed defective GPIα expression on platelet surface and a reduction of platelet α-granules. Interestingly, about 10% of patients included in this study developed AML, MDS or chronic myeloid leukemia (CML).59

TRANSCRIPTIONAL REGULATION BY GFI1B

GFI1B has an important role in the endothelial to hematopoiesis transition, the process where endothelial cells become blood cells and the first hematopoietic stem cells (HSCs) are formed.60 In adult hematopoiesis, GFI1B is expressed in HSCs, common myeloid and megakaryocyte/erythroid progenitors, and erythroid and megakaryocyte lineages. Moderate GFI1B levels are also found in immature B-cells, a subset of early T-cell precursors, and peripheral blood granulocytes and monocytes.61 Gfi1b knock- out (KO) mice die because of anemia, and fail to develop megakaryocytes.62 Loss of Gfi1b in adult mice increases the absolute numbers of HSCs that are less quiescent,63 ablates erythropoiesis at an early progenitor stage, and blocks terminal megakaryocyte differentiation in the polyploid promegakaryocyte stage that fail to produce platelets.64 This indicates that GFI1B plays a crucial role in HSCs, erythropoiesis, and megakaryopoiesis. GFI1B is a repressive transcription factor with an N-terminal SNAG domain for nuclear localization and recruitment of co-regulators such as LSD1 and RCOR1. The C-terminus contains six zinc fingers of which 3-5 are essential for DNA binding to a TAAATCAC(T/A)GC(A/T) motif.16 Between these two domains is a less-studied region of which the function is still unknown. As mentioned before there are two GFI1B isoforms, full length GFI1B-p37 and short GFI1B-p32 lacking intact zinc finger 1 and 2. This short isoform seems important for erythroid development65 and indispensable for megakaryocyte development.24 GFI1B target genes have been indentified in different hematopoietic cell types, both myeloid and lymphoid. At the DNA level, GFI1B represses its own expression and that of GFI1;66 proto-oncogenes Myc, Myb,67 and Meis1;68 tumor suppressor genes Socs1 and Socs3;69 the anti-apoptotic gene BCL2L1;70 hematopoietic transcription factors GATA271 and SPI1;72 lymphoid regulators GATA373 and RAG1/2;74 cell cycle regulator CDKN1A (P21);75 and TGFBR3.76 A few studies specifically investigated GFI1B targets in megakaryopoiesis and found regulator of G-protein signaling Rgs18,77 FERMT3 (Kindlin3) which has a role in integrin-mediated platelet adhesion,78 and Talin1 involved in integrin-cytoskeleton interactions.78 These latter two are in line with observations in megakaryocyte-specific Gfi1b KO mice showing loss of integrin signaling response, cytoskeleton reorganization, and proplatelet formation. TheGfi1b -deficient megakaryocytes exhibit aberrant expression of several components of both the actin and microtubule

20 GENERAL INTRODUCTION

cytoskeleton, and inhibiti on of PAK, a regulator of the acti n cytoskeleton, completely rescued their integrin responsiveness.79 1 To regulate hematopoiesis, GFI1B interacts with other transcripti on factors such as the SCL (TAL1) core complex (E2A, LMO2, Ldb1) and GATA1.80 Furthermore several co-repressors have been found associated with GFI1B, such as LSD1 with its partner RCOR1, histon deacetylase 1/2 (HDAC1/2),81 histon methyl transferases SUV39H1 and G9A (EHMT2),82 RUNX1T1 (ETO), and CBFA2T3 (ETO2).83

REGULATION OF GFI1B EXPRESSION

GFI1B expression is controlled by multi ple transcripti on factors binding the promoter, such as GATA1, Oct1, NF-Y, HGMB2, and GFI1B itself.84-86 Furthermore Anguita et al. have identi fi ed three multi species conserved non-coding elements (CNEs) around 12.5kb, 16kb and 17.5kb downstream of the human GFI1B start codon (corresponds to 13, 16 and 17kb in mice). Chromati n immunoprecipitati on studies in human (K562) and murine (MEL, L8057, HPC7) cell lines demonstrated that the positi ve regulators of GFI1B expression, GATA1, TAL1 (SCL), NF-E2, LDB1, LMO2, MYB, TCF3 (E2A),84 and GATA271 are bound to these distant regulatory elements. Interesti ngly, these sites are also bound by repressors of GFI1B expression, GFI1B, RCOR1, and LSD1, and could behave as negati ve regulatory elements depending on the GFI1B levels.84 The three CNEs were validated as hematopoieti c enhancers in transgenic mouse assays,71 and looping to the Gfi 1b promoter was shown for the 13 and 17kb CNEs.84

21 CHAPTER 1

OUTLINE OF THIS THESIS

The aim of this thesis is to gain more insight in molecular mechanisms of the transcription factor GFI1B in hematological disorders. GFI1B is crucial for megakaryopoiesis, and inherited variants in this protein lead to a bleeding diathesis with a multitude of megakaryocyte and platelet defects. In chapter 2 we investigated the molecular mechanism of the IPD causing variant GFI1B-Q287*, that was earlier identified by our research group. Furthermore, we studied molecular pathways downstream of GFI1B-Q287*, to identify GFI1B regulated processes during megakaryopoiesis and platelet formation. In chapter 3 we performed a molecular and clinicopathological characterization of eight GFI1B variants previously identified in cases with unexplained bleeding and/or platelet defects. To improve classification of inherited GFI1B variants we developed assays testing the damaging effect of newly identified inherited GFI1B variants on its function. In addition to IPDs, GFI1B has a pathological role in myeloid malignancies. For example, deregulated GFI1B expression is associated with hematological malignancies including myeloproliferative neoplasms. In chapter 4 we investigated whether the clonal hematopoiesis and myeloproliferative neoplasm predisposing G-allele of rs621940, located ~8 kb downstream of GFI1B, affects GFI1B expression and GFI1B auto-repression. Finally, chapter 5 provides a general discussion and unpublished data related to the research in this thesis.

22 GENERAL INTRODUCTION

REFERENCES 1 1. Guo T, Wang X, Qu Y, Yin Y, Jing T, Zhang Q. Megakaryopoiesis and platelet producti on: insight into hematopoieti c stem cell proliferati on and diff erenti ati on. Stem Cell Investi g. 2015;2(3. 2. Geddis AE. Megakaryopoiesis. Semin Hematol. 2010;47(3):212-219. 3. Nishikii H, Kurita N, Chiba S. The Road Map for Megakaryopoieti c Lineage from Hematopoieti c Stem/Progenitor Cells. Stem Cells Transl Med. 2017; 4. Machlus KR, Thon JN, Italiano JE, Jr. Interpreti ng the developmental dance of the megakaryocyte: a review of the cellular and molecular processes mediati ng platelet formati on. Briti sh journal of haematology. 2014;165(2):227-236. 5. Matti a G, Vulcano F, Milazzo L, et al. Diff erent ploidy levels of megakaryocytes generated from peripheral or cord bood CD34+ cells are correlated with diff erent levels of platelet release. Blood. 2002;99(888-897. 6. Machlus KR, Italiano JE, Jr. The incredible journey: From megakaryocyte development to platelet formati on. J Cell Biol. 2013;201(6):785-796. 7. Golebiewska EM, Poole AW. Platelet secreti on: From haemostasis to wound healing and beyond. Blood Rev. 2015;29(3):153-162. 8. Yadav S, Storrie B. The cellular basis of platelet secreti on: Emerging structure/functi on relati onships. Platelets. 2017;28(2):108-118. 9. Daly ME. Transcripti on factor defects causing platelet disorders. Blood Rev. 2017;31(1):1-10. 10. Lefrancais E, Orti z-Munoz G, Caudrillier A, et al. The lung is a site of platelet biogenesis and a reservoir for haematopoieti c progenitors. Nature. 2017;544(7648):105-109. 11. Eto K, Kunishima S. Linkage between the mechanisms of thrombocytopenia and thrombopoiesis. Blood. 2016;127(10):1234-1241. 12. Freson K, Turro E. High-throughput sequencing approaches for diagnosing hereditary bleeding and platelet disorders. J Thromb Haemost. 2017;15(7):1262-1272. 13. Heremans J, Freson K. High-throughput sequencing for diagnosing platelet disorders: lessons learned from exploring the causes of bleeding disorders. Int J Lab Hematol. 2018;40 Suppl 1(89-96. 14. Richards S, Aziz N, Bale S, et al. Standards and guidelines for the interpretati on of sequence variants: a joint consensus recommendati on of the American College of Medical Geneti cs and Genomics and the Associati on for Molecular Pathology. Genet Med. 2015;17(5):405-424. 15. Melazzini F, Zaninetti C, Balduini CL. Bleeding is not the main clinical issue in many pati ents with inherited thrombocytopaenias. Haemophilia. 2017;23(5):673-681. 16. van der Meer LT, Jansen JH, van der Reijden BA. Gfi 1 and Gfi 1b: key regulators of hematopoiesis. Leukemia. 2010;24(11):1834-1843. 17. Stevenson WS, Morel-Kopp MC, Chen Q, et al. GFI1B mutati on causes a bleeding disorder with abnormal platelet functi on. J Thromb Haemost. 2013;11(11):2039-2047. 18. Monteferrario D, Bolar NA, Marneth AE, et al. A dominant-negati ve GFI1B mutati on in the gray platelet syndrome. N Engl J Med. 2014;370(3):245-253. 19. Kitamura K, Okuno Y, Yoshida K, et al. Functi onal characterizati on of a novel GFI1B mutati on causing congenital macrothrombocytopenia. J Thromb Haemost. 2016;14(7):1462-1469. 20. Ferreira CR, Chen D, Abraham SM, et al. Combined alpha-delta platelet storage pool defi ciency is associated with mutati ons in GFI1B. Molecular geneti cs and metabolism. 2016; 21. Schulze H, Schlagenhauf A, Manukjan G, et al. Recessive grey platelet-like syndrome with unaff ected erythropoiesis in the absence of the splice isoform GFI1B-p37. Haematologica. 2017;102(9):e375-e378.

23 CHAPTER 1

22. Rabbolini DJ, Morel-Kopp MC, Chen Q, et al. Thrombocytopenia and CD34 expression is decoupled from alpha- granule deficiency with mutation of the first GFI1B zinc finger. Journal of thrombosis and haemostasis : JTH. 2017; 23. Uchiyama Y, Ogawa Y, Kunishima S, et al. A novel GFI1B mutation at the first zinc finger domain causes congenital macrothrombocytopenia. British journal of haematology. 2017; 24. Chen L, Kostadima M, Martens JH, et al. Transcriptional diversity during lineage commitment of human blood progenitors. Science. 2014;345(6204):1251033. 25. Nichols KE, Crispino JD, Poncz M, et al. Familial dyserythropoietic anaemia and thrombocytopenia due to an inherited mutation in GATA1. Nat Genet. 2000;24(3):266-270. 26. Mehaffey MG, Newton AL, Gandhi MJ, Crossley M, Drachman JG. X-linked thrombocytopenia caused by a novel mutation of GATA-1. Blood. 2001;98(9):2681-2688. 27. Balduini CL, Pecci A, Loffredo G, et al. Effects of the R216Q mutation of GATA-1 on erythropoiesis and megakaryocytopoiesis. Thromb Haemost. 2004;91(1):129-140. 28. Freson K, Devriendt K, Matthijs G, et al. Platelet characteristics in patients with X-linked macrothrombocytopenia because of a novel GATA1 mutation. Blood. 2001;98(1):85-92. 29. Hermans C, De Waele L, Van Geet C, Freson K. Novel GATA1 mutation in residue D218 leads to macrothrombocytopenia and clinical bleeding problems. Platelets. 2014;25(4):305-307. 30. Miccio A, Wang Y, Hong W, et al. NuRD mediates activating and repressive functions of GATA-1 and FOG-1 during blood development. EMBO J. 2010;29(2):442-456. 31. Tripic T, Deng W, Cheng Y, et al. SCL and associated proteins distinguish active from repressive GATA transcription factor complexes. Blood. 2009;113(10):2191-2201. 32. Freson K, Wijgaerts A, Van Geet C. GATA1 gene variants associated with thrombocytopenia and anemia. Platelets. 2017;1-4. 33. Singleton BK, Roxby DJ, Stirling JW, et al. A novel GATA1 mutation (Stop414Arg) in a family with therare X-linked blood group Lu(a-b-) phenotype and mild macrothrombocytic thrombocytopenia. British journal of haematology. 2013;161(1):139-142. 34. Songdej N, Rao AK. Inherited platelet dysfunction and hematopoietic transcription factor mutations. Platelets. 2017;28(1):20-26. 35. Marneth AE, van Heerde WL, Hebeda KM, et al. Platelet CD34 expression and alpha/delta-granule abnormalities in GFI1B- and RUNX1-related familial bleeding disorders. Blood. 2017;129(12):1733-1736. 36. Jongmans MC, Kuiper RP, Carmichael CL, et al. Novel RUNX1 mutations in familial platelet disorder with enhanced risk for acute myeloid leukemia: clues for improved identification of the FPD/AML syndrome. Leukemia. 2010;24(1):242-246. 37. Lu J, Maruyama M, Satake M, et al. Subcellular localization of the alpha and beta subunits of the acute myeloid leukemia-linked transcription factor PEBP2/CBF. Molecular and Cellular Biology. 1995;15(3):1651-1661. 38. Michaud J, Wu F, Osato M, et al. In vitro analyses of known and novel RUNX1/AML1 mutations in dominant familial platelet disorder with predisposition to acute myelogenous leukemia: implications for mechanisms of pathogenesis. Blood. 2002;99(4):1364-1372. 39. Berardi MJ, Sun C, Zehr M, et al. The Ig fold of the core binding factor alpha Runt domain is a member of a family of structurally and functionally related Ig-fold DNA-binding domains. Structure (London, England : 1993). 999;7(10):1247-1256. 40. Huang G, Shigesada K, Ito K, Wee HJ, Yokomizo T, Ito Y. Dimerization with PEBP2beta protects RUNX1/AML1 from ubiquitin-proteasome-mediated degradation. Embo j. 2001;20(4):723-733.

24 GENERAL INTRODUCTION

41. Imai Y, Kurokawa M, Tanaka K, et al. TLE, the Human Homolog of Groucho, Interacts with AML1 and Acts as a Repressor of AML1-Induced Transacti vati on. Biochemical and Biophysical Research Communicati ons. 1998;252(3):582-589. 1 42. Chuang LSH, Ito K, Ito Y. RUNX family: Regulati on and diversifi cati on of roles through interacti ng proteins. Internati onal Journal of Cancer. 2013;132(6):1260-1271. 43. Heller PG, Glembotsky AC, Gandhi MJ, et al. Low Mpl receptor expression in a pedigree with familial platelet disorder with predispositi on to acute myelogenous leukemia and a novel AML1 mutati on. Blood. 2005;105(12):4664-4670. 44. Connelly JP, Kwon EM, Gao Y, et al. Targeted correcti on of RUNX1 mutati on in FPD pati ent-specifi c induced pluripotent stem cells rescues megakaryopoieti c defects. Blood. 2014;124(12):1926-1930. 45. Pang L, Xue H-H, Szalai G, et al. Maturati on stage–specifi c regulati on of megakaryopoiesis by pointed-domain Ets proteins. Blood. 2006;108(7):2198-2206. 46. Huang H, Yu M, Akie TE, et al. Diff erenti ati on-dependent interacti ons between RUNX-1 and FLI-1 during megakaryocyte development. Molecular and cellular biology. 2009;29(15):4103-4115. 47. Jacobsen P, Hauge M, Henningsen K, Hobolth N, Mikkelsen M, Philip J. An (11;21) Translocati on in Four Generati ons with Chromosome 11 Abnormaliti es in the Off spring. Human Heredity. 1973;23(6):568-585. 48. Stevenson WS, Rabbolini DJ, Beutler L, et al. Paris-Trousseau thrombocytopenia is phenocopied by the autosomal recessive inheritance of a DNA-binding domain mutati on in FLI1. Blood. 2015;126(17):2027-2030. 49. Favier R, Douay L, Esteva B, et al. A novel geneti c thrombocytopenia (Paris-Trousseau) associated with platelet inclusions, dysmegakaryopoiesis and chromosome deleti on AT 11q23. C R Acad Sci III. 1993;316(7):698-701. 50. Favier R, Jondeau K, Boutard P, et al. Paris-Trousseau syndrome : clinical, hematological, molecular data of ten new cases. Thromb Haemost. 2003;90(5):893-897. 51. Vo KK, Jarocha DJ, Lyde RB, et al. FLI1 level during megakaryopoiesis aff ects thrombopoiesis and platelet biology. Blood. 2017;129(26):3486-3494. 52. Antony-Debré I, Bluteau D, Itzykson R, et al. MYH10 protein expression in platelets as a biomarker of RUNX1 and FLI1 alterati ons. Blood. 2012;120(13):2719-2722. 53. Saulti er P, Vidal L, Canault M, et al. Macrothrombocytopenia and dense granule defi ciency associated with FLI1 variants: ultrastructural and pathogenic features. Haematologica. 2017;102(6):1006-1016. 54. Feurstein S, Godley LA. Germline ETV6 mutati ons and predispositi on to hematological malignancies. Int J Hematol. 2017;106(2):189-195. 55. Hock H, Shimamura A. ETV6 in hematopoiesis and leukemia predispositi on. Semin Hematol. 2017;54(2):98- 104. 56. Songdej N, Rao AK. Hematopoieti c transcripti on factor mutati ons: important players in inherited platelet defects. Blood. 2017;129(21):2873-2881. 57. Niihori T, Ouchi-Uchiyama M, Sasahara Y, et al. Mutati ons in MECOM, Encoding Oncoprotein EVI1, Cause Radioulnar Synostosis with Amegakaryocyti c Thrombocytopenia. American journal of human geneti cs. 2015;97(6):848-854. 58. Savoia A. Molecular basis of inherited thrombocytopenias: an update. Curr Opin Hematol. 2016;23(5):486-492. 59. Balduini A, Raslova H, Di Buduo CA, et al. Clinic, pathogenic mechanisms and drug testi ng of two inherited thrombocytopenias, ANKRD26-related Thrombocytopenia and MYH9-related diseases. Eur J Med Genet. 2018; 60. Thambyrajah R, Mazan M, Patel R, et al. GFI1 proteins orchestrate the emergence of haematopoieti c stem cells through recruitment of LSD1. Nature cell biology. 2016;18(1):21-32. 61. Anguita E, Candel FJ, Chaparro A, Roldan-Etcheverry JJ. Transcripti on Factor GFI1B in Health and Disease. Front Oncol. 2017;7(54.

25 CHAPTER 1

62. Saleque S, Cameron S, Orkin SH. The zinc-finger proto-oncogene Gfi-1b is essential for development of the erythroid and megakaryocytic lineages. Genes & development. 2002;16(3):301-306. 63. Khandanpour C, Sharif-Askari E, Vassen L, et al. Evidence that growth factor independence 1b regulates dormancy and peripheral blood mobilization of hematopoietic stem cells. Blood. 2010;116(24):5149-5161. 64. Foudi A, Kramer DJ, Qin J, et al. Distinct, strict requirements for Gfi-1b in adult bone marrow red cell and platelet generation. J Exp Med. 2014;211(5):909-927. 65. Laurent B, Randrianarison-Huetz V, Frisan E, et al. A short Gfi-1B isoform controls erythroid differentiation by recruiting the LSD1-CoREST complex through the dimethylation of its SNAG domain. Journal of cell science. 2012;125(Pt 4):993-1002. 66. Vassen L, Fiolka K, Mahlmann S, Moroy T. Direct transcriptional repression of the genes encoding the zinc-finger proteins Gfi1b and Gfi1 by Gfi1b. Nucleic Acids Res. 2005;33(3):987-998. 67. Rodriguez P, Bonte E, Krijgsveld J, et al. GATA-1 forms distinct activating and repressive complexes in erythroid cells. EMBO J. 2005;24(13):2354-2366. 68. Chowdhury AH, Ramroop JR, Upadhyay G, Sengupta A, Andrzejczyk A, Saleque S. Differential transcriptional regulation of meis1 by Gfi1b and its co-factors LSD1 and CoREST. PLoS One. 2013;8(1):e53666. 69. Jegalian AG, Wu H. Regulation of Socs gene expression by the proto-oncoprotein GFI-1B: two routes for STAT5 target gene induction by erythropoietin. J Biol Chem. 2002;277(3):2345-2352. 70. Kuo YY, Chang ZF. GATA-1 and Gfi-1B interplay to regulate Bcl-xL transcription. Mol Cell Biol. 2007;27(12):4261- 4272. 71. Moignard V, Macaulay IC, Swiers G, et al. Characterization of transcriptional networks in blood stem and progenitor cells using high-throughput single-cell gene expression analysis. Nat Cell Biol. 2013;15(4):363-372. 72. Anguita E, Gupta R, Olariu V, et al. A somatic mutation of GFI1B identified in leukemia alters cell fate via a SPI1 (PU.1) centered genetic regulatory network. Dev Biol. 2016;411(2):277-286. 73. Xu W, Kee BL. Growth factor independent 1B (Gfi1b) is an E2A target gene that modulates Gata3 in T-cell lymphomas. Blood. 2007;109(10):4406-4414. 74. Schulz D, Vassen L, Chow KT, et al. Gfi1b negatively regulates Rag expression directly and via the repression of FoxO1. J Exp Med. 2012;209(1):187-199. 75. Tong B, Grimes HL, Yang TY, et al. The Gfi-1B proto-oncoprotein represses p21WAF1 and inhibits myeloid cell differentiation. Mol Cell Biol. 1998;18(5):2462-2473. 76. Randrianarison-Huetz V, Laurent B, Bardet V, Blobe GC, Huetz F, Dumenil D. Gfi-1B controls human erythroid and megakaryocytic differentiation by regulating TGF-beta signaling at the bipotent erythro-megakaryocytic progenitor stage. Blood. 2010;115(14):2784-2795. 77. Sengupta A, Upadhyay G, Sen S, Saleque S. Reciprocal regulation of alternative lineages by Rgs18 and its transcriptional repressor Gfi1b. Journal of cell science. 2016;129(1):145-154. 78. Singh D, Upadhyay G, Sengupta A, et al. Cooperative Stimulation of Megakaryocytic Differentiation by Gfi1b Gene Targets Kindlin3 and Talin1. PLoS One. 2016;11(10):e0164506. 79. Beauchemin H, Shooshtarizadeh P, Vadnais C, Vassen L, Pastore YD, Moroy T. Gfi1b controls integrin signaling- dependent cytoskeleton dynamics and organization in megakaryocytes. Haematologica. 2017;102(3):484-497. 80. Hamlett I, Draper J, Strouboulis J, Iborra F, Porcher C, Vyas P. Characterization of megakaryocyte GATA1- interacting proteins: the corepressor ETO2 and GATA1 interact to regulate terminal megakaryocyte maturation. Blood. 2008;112(7):2738-2749. 81. Saleque S, Kim J, Rooke HM, Orkin SH. Epigenetic regulation of hematopoietic differentiation by Gfi-1 and Gfi- 1b is mediated by the cofactors CoREST and LSD1. Mol Cell. 2007;27(4):562-572. 82. Vassen L, Fiolka K, Moroy T. Gfi1b alters histone methylation at target gene promoters and sites of gamma- satellite containing heterochromatin. EMBO J. 2006;25(11):2409-2419.

26 GENERAL INTRODUCTION

83. Schuh AH, Tipping AJ, Clark AJ, et al. ETO-2 associates with SCL in erythroid cells and megakaryocytes and provides repressor functi ons in erythropoiesis. Mol Cell Biol. 2005;25(23):10235-10250. 84. Anguita E, Villegas A, Iborra F, Hernandez A. GFI1B controls its own expression binding to multi ple sites. 1 Haematologica. 2010;95(1):36-46. 85. Hernandez A, Villegas A, Anguita E. Human promoter mutati ons unveil Oct-1 and GATA-1 opposite acti on on Gfi 1b regulati on. Annals of hematology. 2010;89(8):759-765. 86. Laurent B, Randrianarison-Huetz V, Marechal V, Mayeux P, Dusanter-Fourt I, Dumenil D. High-mobility group protein HMGB2 regulates human erythroid diff erenti ati on through trans-acti vati on of GFI1B transcripti on. Blood. 2010;115(3):687-695.

27

2 Molecular mechanisms of bleeding disorder-associated GFI1B-Q287* mutati on and its aff ected pathways in megakaryocytes and platelets.

Rinske van Oorschot,1 Marten Hansen,2 Johanna M. Koornneef,3 Anna E. Marneth,1 Saskia M. Bergevoet,1 Maaike G.J.M. van Bergen,1 Floris P.J. van Alphen,4 Carmen van der Zwaan,3 Joost H.A. Martens,5 Michiel Vermeulen,5 Pascal W.T.C. Jansen,5 Marijke P.A. Balti ssen,5 Britt a A.P. Laros-van Gorkom,6 Hans Janssen,7 Joop H. Jansen,1 Marieke von Lindern,2 Alexander B. Meijer,3 Emile van den Akker,2 and Bert A. van der Reijden1

1Department of Laboratory Medicine, Laboratory of Hematology, Radboud University Medical Center, Radboud Insti tute for Molecular Life Sciences, Nijmegen, The Netherlands 2Department of Hematopoiesis, Sanquin Research-Academic Medical Center Landsteiner Laboratory, Amsterdam, The Netherlands 3Department of Plasma Proteins, Sanquin Research, Amsterdam, The Netherlands 4Department of Research Faciliti es, Sanquin Research, Amsterdam, The Netherlands 5Department of Molecular Biology, Faculty of Science, Radboud University Nijmegen, Radboud Insti tute for Molecular Life Sciences, Nijmegen, the Netherlands 6Department of Hematology, Radboud University Medical Center, Nijmegen, The Netherlands 7Department of Biochemistry, The Netherlands Cancer Insti tute, Amsterdam, The Netherlands

R.O., M.H., and J.M.K contributed equally to this work.

Haematologica. 2019 Jan 17. Epub ahead of print. CHAPTER 2

ABSTRACT

Dominant-negative mutations in the transcription factor Growth Factor Independence-1B (GFI1B) like GFI1B-Q287*, cause a bleeding disorder characterized by a plethora of megakaryocyte and platelet abnormalities. The deregulated molecular mechanisms and pathways are unknown. Here we show that both normal and Q287* mutant GFI1B interacted most strongly with the LSD1-RCOR-HDAC co-repressor complex in megakaryoblasts. Sequestration of this complex by GFI1B-Q287* and chemical separation of GFI1B from LSD1, induced abnormalities in normal megakaryocytes comparable to those seen in patients. Megakaryocytes derived from GFI1B-Q287* induced pluripotent stem cells also phenocopied abnormalities seen in patients. Proteome studies on normal and mutant induced pluripotent stem cell derived megakaryocytes identified a multitude of deregulated pathways downstream of GFI1B-Q287* including cell division and interferon signaling. Proteome studies on platelets from GFI1B-Q287* patients showed reduced expression of proteins implicated in platelet function, and elevated expression of proteins normally downregulated during megakaryocyte differentiation. Thus, GFI1B and LSD1 regulate a broad developmental program during megakaryopoiesis, and GFI1B-Q287* deregulates this program through LSD1-RCOR-HDAC sequestering.

30 MOLECULAR CHARACTERIZATION OF THE GFI1B-Q287* MUTATION

I NTRODUCTION

Platelets are specialized cell fragments that functi on to prevent excessive bleeding upon blood vessel injury.1 During megakaryopoiesis, megakaryoblasts undergo endomitosis followed by cytoplasmic maturati on, during which α- and δ-granules are formed. Subsequently, mature megakaryocytes migrate to blood vessels in the bone marrow or lung, where they form protrusions and shed proplatelets into the bloodstream.2, 3 2 The identi fi cati on of inherited bleeding and platelet disorder mutati ons has provided insight into proteins crucial for platelet producti on and functi on. Genes mutated in these disorders range from proteins involved in α-granule biology like NBEAL2, to transcripti on factors controlling a wide range of megakaryocyte processes.4 One of the transcripti on factors mutated in inherited bleeding and platelet disorders is Growth Factor Independence 1B (GFI1B). To date, truncati ng mutati ons aff ecti ng DNA binding,5-8 missense mutati ons,9-11 and mutati ons that change the amount and rati o of the two naturally occurring GFI1B isoforms (p37 and p32) have been described.11, 12 Bleeding tendencies may vary depending on the type of mutati ons, being severe for cases that express only GFI1B-p32,12 moderate to severe for dominant-negati ve truncati ng mutati ons,5-8 and mild to even absent for the missense mutati ons.9-11 Most, but not all mutati ons associate with macrothrombocytopenia, a reducti onin platelet α-granules, and increased CD34 expression. For some mutati ons, a reducti on in CD42b expression, paucity of platelet δ-granules, and an increase in morphologically abnormal megakaryocyte numbers in the bone marrow have been described as well. Based on these observati ons it can be concluded that normal GFI1B regulates a multi tude of megakaryocyte-specifi c processes, and that the molecular mechanisms causing the abnormaliti es may diff er. GFI1B is a transcripti onal repressor containing six C-terminal zinc fi ngers (in case of the GFI1B-p37 isoform) and an N-terminal Snail/GFI1 (SNAG) domain, important for lysine specifi c demethylase (LSD1/ KMD1A), REST Corepressor 1 (CoREST/RCOR1) recruitment.13 The GFI1B-p32 isoform that lacks intact zinc fi nger 1 and 2, also associates with LSD1-RCOR1 and is suffi cient for erythropoiesis.12, 14 In additi on to LSD1, GFI1B recruits histone methyl transferases and histone deacetylases (HDACs) to target gene promoters and enhancers to induce transcripti onal repression, among which GFI1B itself.15, 16 Of the co-factors, LSD1 may be especially important because the majority (80%) of Gfi 1b bound regions in murine MEL cells are also enriched for Lsd1 occupancy, suggesti ng a strong interdependency.13 LSD1 is an essenti al gene in mammalian diff erenti ati on and functi on, including hematopoiesis. In vitro and in vivo Lsd1 knockdown studies showed that normal granulopoiesis, erythropoiesis and megakaryopoiesis all depend on Lsd1.13, 17, 18 Inherited mutati ons in GFI1B disrupti ng its DNA binding zinc fi ngers, such as GFI1B-Q287*, are known to act in a dominant-negati ve manner.5 The GFI1B p.Q287* mutati on is located within the fi ft h zinc fi nger of GFI1B and leads to a protein truncated in its DNA-binding region. As a consequence, GFI1B-Q287* is disrupted in its ability to bind GFI1B sequence moti fs.8 Importantly, its SNAG domain, crucial for LSD1 binding, remains intact. In this study we use the dominant-negati ve GFI1B-Q287*

31 CHAPTER 2

mutant to unravel the mechanism by which it inhibits wild type GFI1B and identify GFI1B regulated pathways during megakaryopoiesis.

METHODS

Mass spectrometry analysis of GFI1B interacting proteins in MEG-01 cells MEG-01 cells were lentivirally transduced with FUW, FUW-GFI1B-GFP and FUW-GFI1B-Q287*-GFP and nuclear extracts were prepared as described in Dignam et al.19 Label-free GFP-pulldowns were performed using GFP-Trap beads (ChromoTek) as described in Smits et al.20 Subsequently, the proteins were subjected to on-bead trypsin digestion and peptides were acidified and desalted using C18- Stagetips.21 Peptides were recorded with an LC-MS/MS Orbitrap Fusion Tribrid mass spectrometer (ThermoFisher Scientific). Raw data were analyzed by MaxQuant (version 1.5.7.0). Differential proteins between empty vector and GFI1B or GFI1B-Q287* were determined using a t-test with FDR<0.01 and fold change (FC)>9.2. The stoichiometry of the identified complexes was determined by dividing the iBAQ intensity in the GFI1B/GFI1B-Q287* samples with the iBAQ intensity in the empty vector samples.

Proliferation of GFI1B transduced MEG-01 cells MEG-01 cells were retrovirally transduced with pMIGR1-GFI1B variant-flag-IRES-GFP resulting in mixed cultures of GFP positive and negative cells. The GFP% was followed using flow cytometry for 26 days. GFP% were normalized to the starting point of the culture (day 5) using the following formula: (GFP% day X/(100 – GFP% day X))/(GFP% day 5/(100 – GFP% day 5)). On day 23, GFP positive cells were FACS- sorted to determine total and endogenous GFI1B expression using quantitative RT-PCR.

Primary megakaryocyte cultures CD34+ hematopoietic stem and progenitor cells were isolated from mobilized peripheral blood of healthy donors. Informed consent was given in accordance with the Declaration of Helsinki and the Dutch national and Sanquin internal ethical review boards. CD34+ cells were differentiated to megakaryocytes in modified IMDM (HEMAdef)22 supplemented with 50 ng/ml stem cell factor (SCF), 50 ng/ml TPO, 1 ng/ml IL-3 and 20 ng/ml IL-6 for 4 days, followed by culturing in 50 ng/ml TPO and 10 ng/ml IL-1β for 7 more days (Peprotech).23 Where indicated, 4 µM GSK-LSD1 (Sigma) was added subsequently and cells were cultured for an additional 2-6 days depending on the read out (2 days: expansion, CD34 and CD42b expression; 2-6 days: prolonged effect on CD42b expression and proplatelet formation).

Proteomics mass spectrometry analysis of platelets and megakaryocytic cells Blood was taken from healthy donors and patients to generate induced pluripotent stem cells (iPSC) and isolate platelets. The study was approved by the Medical Ethical Committee of the Radboudumc Nijmegen (2013/064) and conducted in accordance with the Declaration of Helsinki. The control iPSC line MML-6838-Cl224 and GFI1B-Q287* patient iPSC lines BEL-5-Cl1 and Cl2 (Supplementary Figure S1)

32 MOLECULAR CHARACTERIZATION OF THE GFI1B-Q287* MUTATION

were diff erenti ated towards megakaryocytes as described before.25 For label-free quanti fi cati on proteins were reduced, alkylated, trypsin-digested, desalted and concentrated. Trypti c pepti des were separated by nanoscale C18 reverse phase chromatography coupled on-line to an Orbitrap Fusion Tribrid mass spectrometer (ThermoFisher Scienti fi c) via a nanoelectrospray ion source (Nanospray Flex Ion Source, ThermoFisher Scienti fi c). All mass spectrometry data were acquired with Xcalibur soft ware (Thermo Scienti fi c) and processed with MaxQuant computati onal platf orm, 1.5.2.8. The RAW fi les, MaxQuant search results, and details about the setti ngs are available in the PRIDE repository database26 with the 2 dataset identi fi er PXD009020.

Stati sti cal analysis Stati sti cal analysis for non-mass spectrometry experiments was performed in GraphPad Prism.

For more details see Supplementary Methods.

RESULTS

GFI1B and GFI1B-Q287* interact with LSD1-RCOR1-HDAC1/2 complex. Several GFI1B variants have been identi fi ed in inherited bleeding and platelet disorders.5, 6, 8, 9 The majority of the pathogenic variants, like GFI1B p.Q287*, result in a truncati on disrupti ng the DNA binding capacity. Truncated GFI1B inhibits the wild type protein in a dominant-negati ve manner.5, 8 With the SNAG domain intact, we hypothesized that GFI1B-Q287* can compete with GFI1B for the recruitment of epigeneti c modifi ers. To test this hypothesis, we fi rst identi fi ed proteins interacti ng with GFI1B and GFI1B-Q287*. To this end, C-terminally GFP-tagged GFI1B and GFI1B-Q287* were expressed in megakaryoblasti c MEG-01 cells. GFP-pull down followed by on-bead trypsin digesti on and mass spectrometry analysis identi fi ed the following GFI1B interacti ng proteins: LSD1, RCOR1/3, HDAC1/2, GSE1, HMG20B, PHF21A, and GFI1 (Figure 1A). Of the detected GFI1B interactors, LSD1 was most abundant together with RCOR1/3 and HDAC1/2 (Figure 1B). The proteins GSE1, HMG20B, and PHF21A are all known to be subunits of the LSD1-RCOR-HDAC complex, also known as the CoREST (RCOR1) complex.27 The identi fi ed interactome of GFI1B-Q287* was highly similar to GFI1B, with ZMYM3 as the only signifi cant diff erenti al interactor (Figure 1C; Supplementary Figure S2), indicati ng that the DNA- binding defecti ve GFI1B-Q287* mutant recruits virtually the same co-factors as GFI1B.

GFI1B-Q287* functi ons in a dominant-negati ve manner by sequestering LSD1 The GFI1B p.Q287* mutati on results in an increase in megakaryocyte expansionin vivo and in vitro.5 To investi gate whether sequestering of LSD1 by GFI1B-Q287* is important for this eff ect, we introduced a P2A or K8A mutati on in the SNAG domain, previously described to disrupt effi cient LSD1 recruitment to GFI1 and GFI1B.13, 28 We confi rmed impaired LSD1 recruitment in GFI1B-P2A/K8A-GFP transduced MEG- 01 cells, using GFP-trap bead mediated pull down (Figure 1D). Further, GFI1B-Q287*, GFI1B-

33 CHAPTER 2 Figure 1

A C

ZMYM2 GFI1B RCOR1 GFI1B HMG20B 5

5 RCOR3 HMG20B RCOR1 RCOR3 PHF21A PHF21A

/6' 4 GSE1

4 /6' GSE1 ZMYM3 (FDR (t-test)) (FDR (t-test)) HDAC1 10 10 3

3 HDAC2 GFI1 -Log -Log

C20orf112 2 2 1 1

Log2 FC > 3.2 Log2 FC > 3.2 0 FDR < 0.01 0 FDR < 0.01

-15 -10 -5 0 5 10 15 -10 -5 0 5 10

Log2 (GFI1B/EV) Log2 (GFI1B4 /EV)

B D

Input IP 0.05 GFI1B NT WT Q287* P2A K8A NT WT Q287* P2A K8A y

r 0.04

t Q287*

e GFI1B

m 0.03 o

i LSD1 h c 0.02 o i S t 0.01 GFI1B-GFP 0.00 2 2 3 3 1 1 2 A B 1 / E / 1 0 M 1 M 1 SD S 1 2 2 Y rf Y R L G C F G M o M O A H Z 0 Z D P M 2 RC H C H

E F

NT WT Q287* P2A K8A n o s i s e

GFI1B-GFP r 0.3

p * x * e B 1

I 0.2 GFI1B endogenous F G R T 0.1 Actin U ' 5 e v i t a

l 0.0

e * A A 7 2 8 V B 8 P K R E 1 2 FI Q B B G B I1 I1 1 F F FI G G G

Figure 1. GFI1B and GFI1B-Q287* interact with the LSD1-RCOR-HDAC complex. (A,C) Nuclear extracts of MEG-01 cells transduced with empty vector (EV), GFI1B-GFP, or GFI1B-Q287*-GFP were analyzed by mass spectrometry. Stati sti cally enriched proteins are identi fi ed by a permutati on-based false discovery rate (FDR)-corrected t-test (FDR<0.01). The volcano plot shows the diff erence between label free quanti fi cati on (LFQ) intensiti es of the GFI1B-

GFP or GFI1B-Q287*-GFP pulldown and the EV control (log2-transformed fold change (FC)) on the x-axis, and the

-log10-transformed p-value on the y-axis. Dott ed grey lines represent the stati sti cal cut-off s, which were chosen such that no proteins were present as outliers on the empty vector control side of the volcano plot. The proteins in the upper right corner represent the bait (GFI1B) and its interactors. We cannot exclude the possibility that we missed interacti ons due to steric hindrance by the GFP-tag, especially at the C-terminal end. (B) Stoichiometry analysis of >>

34 MOLECULAR CHARACTERIZATION OF THE GFI1B-Q287* MUTATION

GFI1B interactors in MEG-01 showing relati ve abundances. Discriminati on between GFI1B;GFI1, HDAC1;HDAC2, and RCOR1;RCOR3 was not possible because of the presence of common pepti des. The iBAQ value of each interacti ng protein is graphed with GFI1B;GFI1 set to 1. GFI1 was identi fi ed as interactor of both GFI1B (all three replicates) and GFI1B-Q287* (two/three replicates, therefore fi ltered out). As pepti des common to GFI1B and GFI1 were included in the normalizati on this may aff ect stoichiometry values. Data are shown as mean ± standard deviati on of three pulldowns. (D) Western blot analysis of co-immunoprecipitated (IP) LSD1 aft er GFP-trap bead pulldown in MEG- 01 cells transduced with GFI1B-GFP (WT), GFI1B-Q287*-GFP (Q287*), GFI1B-P2A-GFP (P2A), GFI1B-K8A-GFP (K8A). Non-transduced (NT) cells were used as negati ve control. The upper panel shows LSD1 (~90kDa) and the lower panel 2 GFI1B variants-GFP (~58kDa). The left side of the blot shows LSD1 and GFI1B-GFP expression in the input samples. (E) Western blot analysis of MEG-01 cells transduced with empty vector (EV), and GFI1B-GFP, GFI1B-Q287*-GFP, GFI1B-P2A-GFP, and GFI1B-K8A-GFP stained with an anti body against GFI1B, identi fying both exogenous GFI1B-GFP fusions (~58kDa) and endogenous GFI1B (~37kDa). Acti n staining was used as loading control. (F) EndogenousGFI1B expression (qPCR on 5’UTR GFI1B that is not present in overexpression constructs) relati ve to GAPDH expression following exogenous expression of empty vector (EV) or indicated fl ag-tagged GFI1B variants in MEG-01 cultures from Figure 2. Results show mean ± standard deviati on (n=3-11).

P2A and GFI1B-K8A failed to inhibit endogenous GFI1B expression in MEG-01 cells, in contrast to wild type GFI1B (Figure 1E-F). Next, we used MEG-01 as a megakaryoblast model to study the eff ect of GFI1B-Q287* on cell expansion. In expansion-competi ti on cultures containing transduced and non- transduced cells, GFI1B overexpressing cells were rapidly overgrown by non-transduced cells, while the opposite was observed following expression of dominant-negati ve GFI1B-Q287* (Figure 2A). Thus, forced GFI1B expression inhibits MEG-01 expansion and dominant-negati ve GFI1B-Q287* results in enhanced expansion, the latt er being in line with observati ons in GFI1B p.Q287* aff ected individuals. To determine whether the interacti on with LSD1 is important for the inhibitory eff ect on expansion of GFI1B, we separately introduced the P2A and K8A mutati ons in GFI1B. Expression of GFI1B-P2A or GFI1B-K8A nullifi ed the inhibitory eff ect of GFI1B on expansion (Figure 2B-C; Supplementary Figure S3). Thus, an intact LSD1 interacti ng SNAG domain is required for both inhibiti on of MEG-01 expansion and repression of the endogenous GFI1B locus. To investi gate whether the LSD1 interacti on is relevant for the dominant-negati ve eff ect in MEG- 01, we introduced the P2A and K8A mutati ons into GFI1B-Q287*. This showed that similar levels of ectopic GFI1B-P2A+Q287* and GFI1B-K8A+Q287* expression did not aff ect MEG-01 expansion, in contrast to GFI1B-Q287* (Figure 2D-E; Supplementary Figure S3). Together, these data indicate that GFI1B limits MEG-01 expansion through the LSD1 interacti ng SNAG domain. GFI1B-Q287* may aff ect this functi on in a dominant-negati ve manner by sequestering LSD1.

35 CHAPTER 2 Figure 2

A B               



   " %    "   !            
$# 
!  C D

                  



 

 % "!(  "  %#

!  $      
$# !#
 '& E

         



!  #")

&$

%

"$!
 ('

Figure 2. GFI1B and GFI1B-Q287* regulate MEG-01 expansion via LSD1 recruitment. (A) Normalized GFP% of MEG-01 cells transduced with empty vector (EV)-IRES-GFP, GFI1B-IRES-GFP and GFI1B-Q287*-IRES-GFP for 26 days (n=8). GFP percentages were normalized to day 5 after transduction (starting point of the culture) as described in the Methods. Results show mean ± standard error of the mean. (B) Normalized GFP% of MEG-01 cells transduced with empty vector (EV)-IRES-GFP, GFI1B-IRES-GFP, and GFI1B-P2A-IRES-GFP (n=4). (C) Normalized GFP% of MEG-01 cells transduced with empty vector (EV)-IRES-GFP, GFI1B-IRES-GFP, and GFI1B-K8A-IRES-GFP (n=3). (D) Normalized GFP% of MEG-01 cells transduced with empty vector (EV)-IRES-GFP, GFI1B-Q287*-IRES-GFP, and GFI1B-P2A+Q287*-IRES- GFP (n=3). (E) Normalized GFP% of MEG-01 cells transduced with empty vector (EV)-IRES-GFP, GFI1B-Q287*-IRES- GFP, and GFI1B-K8A+Q287*-IRES-GFP (n=4). *P<0.05, **P<0.01 ***P<0.001.

36 MOLECULAR CHARACTERIZATION OF THE GFI1B-Q287* MUTATION

Chemical disrupti on of the GFI1B-LSD1 interacti on in normal megakaryocytes results in abnormaliti es seen in GFI1B p.Q287* mutated megakaryocytes. LSD1 sequestering by GFI1B-Q287* in MEG-01 resulted in enhanced proliferati on. To determine whether LSD1 sequestrati on is relevant for other megakaryocyte abnormaliti es, we inhibited the GFI1B- LSD1 interacti on during megakaryocyte diff erenti ati on by treati ng+ CD34 cell-derived megakaryoblasts with the small molecule GSK-LSD1. This inhibitor binds covalently to LSD1 cofactor FAD, and thereby sterically hinders binding of GFI1B.29 We confi rmed the disrupted LSD1-GFI1B binding by the absence 2 of co-precipitated LSD1 upon GFP-trap bead mediated pulldown in the presence of GSK-LSD1 (Figure 3A). To study eff ects on megakaryopoiesis, CD34+ cells were diff erenti ated towards megakaryocytes in the presence of GSK-LSD1 for 48 hours. Quanti fi cati on of cell surface marker expression showed sustained CD34 expression and impaired CD42b expression compared to mock-treated cells (Figure 3B-D). Besides this, a 2-fold increase in megakaryoblast expansion was observed in the presence of GSK- LSD1 (Figure 3E). CD42b expression remained low aft er 3-6 days exposure to GSK-LSD1 (Supplementary Figure S4C) and we observed that these cells were unable to form proplatelets aft er 6 days (Figure 3F, Supplementary Figure S4). These phenotypes are in line with observati ons in individuals with the GFI1B p.Q287* mutati on.5 Together with data presented in the previous secti on, this strongly suggests that mutant GFI1B-Q287* functi ons in a dominant-negati ve manner by sequestering LSD1, resulti ng in developmental megakaryocyte abnormaliti es.

37 CHAPTER 2

Figure 3

A Input IP Control GSK-LSD1 Control GSK-LSD1 NT WT NT WT NT WT NT WT

LSD1

GFI1B-GFP

B Control 27.3% 34.2% 1.37% 20.2% CD42b CD34

27.2% 11.3% 59.2% 19.2%

CD41a CD41a GSK-LSD1 22.0% 40.4% 0.69% 1.35% CD34 CD42b

26.4% 11.2% 54.6% 43.4%

CD41a CD41a C D

14,000 60 ***

* )

12,000 % ( 4 3 s 40 l l e C D c

I 10,000 + F b M 4,000 2 n

4 20 D

2,000 C

0 0 Control GSK-LSD1 Control GSK-LSD1

E F 3

s 40 l ) * l e C ) c F r ( e g b n

n 30 i

o 2 i m s m u r n n o a f e p

t 20 t x e u e l l

l 1 e o l t s e a b l C 10 a p ( o r 0 P Control GSK-LSD1 0 Control GSK-LSD1

Figure 3. Chemical disrupti on of the GFI1B-LSD1 interacti on by GSK-LSD1 recapitulates GFI1B-Q287* hallmarks in vitro. (A) Western blot on co-immunoprecipitated (IP) LSD1 aft er GFP-trap bead pulldown in DMSO control or >>

38 MOLECULAR CHARACTERIZATION OF THE GFI1B-Q287* MUTATION

GSK-LSD1 treated MEG-01 cells transduced with GFI1B-GFP (WT). Non-transduced (NT) cells were used as negati ve control. The upper panel shows LSD1 (~90kDa) and the lower panel GFI1B variants-GFP (~58kDa). The left side of the blot shows LSD1 and GFI1B-GFP expression in the input samples. (B) Cell surface expression of megakaryocyte associated markers CD34, CD41a, and CD42b, to measure megakaryocyte maturati on. Represented are results from megakaryocyti c cultures 2 days aft er additi on of DMSO control or 4µM GSK-LSD1. (C) CD34 nMFI from CD34+/CD41a+ megakaryoblasts. (D) Percentage of CD42b positi vity on CD41a+ megakaryoblasts. The connecti ng lines (C-D) indicate which samples are from the same experiment. (E) Expansion of CD34+/CD41a+ megakaryoblasts during two days of DMSO control or GSK-LSD1 treatment. (F) Absolute number of proplatelet forming megakaryocyti c cells per view 2 (based on Supplementary Figure S4A-B) 6 days aft er additi on of DMSO or 4 µM GSK-LSD1, n=6.P * <0.05, ***P<0.001.

GFI1B-Q287* iPSC-derived megakaryocyti c cells show disturbed megakaryocyte diff erenti ati on. The morphological megakaryocyte abnormaliti es, their increased expansion, and sustained CD34 expression, indicates that megakaryocyte diff erenti ati on is severely disturbed in GFI1B-Q287* mutated individuals. As the availability of CD34+ progenitors and megakaryocytes from pati ents is limited, we generated iPSC lines from a control individual (MML-6838-Cl2)24 and an individual harboring the GFI1B-Q287* mutati on (BEL-5-Cl1/2) to study megakaryopoiesis in more detail (Supplementary Figure S1). iPSC colonies were diff erenti ated towards megakaryocytes using a 2D diff erenti ati on protocol.25 May-Grünwald Giemsa stained cytospins and fl ow cytometry revealed enlarged cells with someti mes polyploidizati on for control megakaryocyti c cells, with co-expression of CD41a and CD42b confi rming megakaryocyte diff erenti ati on (Figure 4A-B). In contrast, diff erenti ati on of GFI1B-Q287* iPSCs resulted in a homogeneous appearance of small and pale cells (Figure 4A). In additi on, GFI1B-Q287* iPSC- derived megakaryocyti c cells expressed elevated levels of CD34 in line with primary GFI1B-Q287* megakaryocytes,5 while CD41a and CD42b expression was not diff erent (Figure 4C-E). Quanti fi cati on of the total number of CD41a+ cells between day 14-18 of iPSC diff erenti ati on showed that GFI1B-Q287* iPSCs produced 55-fold more megakaryocyti c cells compared to control iPSCs (Figure 4F), in line with the increased bone marrow megakaryocyte numbers observed in GFI1B-Q287* aff ected individuals. Electron microscopy of control and GFI1B-Q287* megakaryocyti c cells showed the presence of α-granules in both conditi ons (Supplementary Figure S5). Together, these data indicate that the GFI1B-Q287* iPSC-derived megakaryocyti c cells resemble micromegakaryocytes that exhibit some phenotypes (CD34 expression, increased expansion) also observed in aff ected individuals.

39 CHAPTER 2 Figure 4

A B

Control Control 4.47% 26.2% 2.69% 42.0% CD42b CD34

GFI1B-Q287* 48.9% 20.4% 51.7% 3.69%

CD41a CD41a GFI1B-Q287* 7.93% 62.6% 1.20% 44.6% CD42b CD34

28.4% 1.04% 35.1% 19.0%

CD41a CD41a C D

100,000 50,000 **** 40,000 b 4 2 3 4 D

D 30,000 C C

10,000 I F I F

M 20,000 M n n 10,000

1,000 0 Control GFI1BQ287* Control GFI1BQ287*

E F

40,000 100,000 ** ) C F ( a 30,000 10,000 1 n 4 o i D s n C a I 20,000 1,000 F p x M e l n l

10,000 e 100 C

0 10 Control GFI1BQ287* Control GFI1BQ287*

Figure 4. GFI1B-Q287* of iPSC derived megakaroid cells phenocopy disease characteristi cs (A) Cytospins of control and GFI1B-Q287* iPSC lines diff erenti ated towards megakaryocytes and stained with May-Grünwald Giemsa. Pictures were taken at 40x magnifi cati on using a Zeiss Scope.A1 microscope (Zeiss) and images were processed with Zen blue editi on. (B) Representati ve fl ow-cytometric analysis of control and GFI1B-Q287* iPSC derived cells for surface expression of megakaryocyte associated markers CD34, CD41a and CD42b. (C) nMFI of CD34 and (D) CD42b. (E) CD41a (F) Quanti fi cati on of CD41a+ megakaryocyti c cells per seeded iPSC to measure expansion potenti al. >>

40 MOLECULAR CHARACTERIZATION OF THE GFI1B-Q287* MUTATION

CD41a+ cells were negati ve for erythroid, myeloid and endothelial makers indicati ng that these cells represent true megakaryocyti c cells (data not shown) **P<0.01, ****P<0.0001

Identi fi cati on of GFI1B-regulated processes in early megakaryocyte diff erenti ati on. To determine deregulated protein expression downstream of GFI1B-Q287*, we compared the 2 proteomes of GFI1B-Q287* iPSC-derived CD41a+ megakaryocyti c cells (n=6) with those of controls (n=6). In total 2906 proteins were quanti fi ed (Supplementary Table 1). We detected CD34 expression in GFI1B-Q287* iPSC-derived cells, while it was not detected in control cells (Supplementary Table 1). The mass spectrometer was not sensiti ve enough to detect the lower CD34 expression on control cells versus GFI1B-Q287* cells observed with fl ow cytometry. The results confi rm the increased CD34 expression observed in the iPSC model system and pati ent platelets (Figure 4C). Major platelet receptors, including glycoprotein (GP)-IB, GPIX, and integrin αIIbβ3, as well as α-granule proteins such as Von Willebrand Factor (VWF) and thrombospondin-1 (THBS1), were not diff erenti ally expressed between control and GFI1B-Q287* iPSC-derived megakaryocyti c cells. However, a total of 396 proteins were diff erenti ally expressed between the GFI1B-Q287* and control iPSC-derived megakaryocyti c cells, of which 252 were up-regulated and 144 down-regulated (Figure 5A-B; Supplementary Table 1). One of the most strongly down-regulated proteins in GFI1B-Q287* iPSCs was the interferon-induced GTP-binding protein MX1, showing high expression in control iPSC derived cells but no detectable levels in GFI1B-Q287* iPSC- derived cells (Supplementary Figure S6B). Other proteins related to interferon signaling, i.e. STAT1, IFI16, IFI30, IFI35, IFIT1, IFIT3, OAS2, and OAS3 were also signifi cantly reduced in GFI1B-Q287* iPSC- derived megakaryocyti c cells compared to controls (Supplementary Table 1). Because the control and GFI1B-Q287* lines are derived from diff erent individuals, diff erences in individual protein expression might be caused by variati on in geneti c makeup of the lines. Therefore, gene ontology (GO) term analyses were performed to identi fy multi ple diff erenti ally expressed proteins assigned to specifi c pathways/ functi ons. This identi fi ed down-regulated proteins related to diverse functi ons, including mitochondria, response to sti muli, and transmembrane transport (Figure 5C; Supplementary Table 2). On the other hand, strongly enriched proteins in the GFI1B-Q287* iPSC-derived megakaryocyti c cells were all members of the minichromosome maintenance complex (DNA replicati on licensing factor proteins, MCM2-7; Supplementary Figure S6A, D) and structural maintenance of chromosome proteins (SMC1A, SMC2-4, SMCHD; Supplementary Table 1), which are required for DNA replicati on and chromosome condensati on, respecti vely (Figure 5D; Supplementary Table 2). Furthermore, MEIS1, a key player in megakaryocyte diff erenti ati on which is normally down-regulated at fi nal stages of megakaryocyte diff erenti ati 30on, showed consistent expression in GFI1B-Q287* iPSC-derived megakaryocyti c cells while it was never detected in control iPSC-derived cells (Supplementary Figure S6C). Thus, the GFI1B-Q287* protein infl uences the expression of a large number of proteins during megakaryopoiesis.

41 CHAPTER 2 Figure 5

A B

C D

Overlap index iPSC MK GO-terms down regulated iPSC GO-Terms UP

0 0.2 0.4 0.6 0.8 1 1

Granule lumen; leukocyte activation 0.1 Lysosome e u l

Extracellular region; immune response a

v 0.01 -

Defense response; interferon signaling p

Heme binding 0.001

Mitochondria

Ion (transmembrane) transport 0.0001 n n x y y o o le it it ti ti p iv iv a ia t t ic it m c c l n co a a ep i r r r n M to to A io C ac ac N t f f a M e e D lic g g p n n ent e a a d r h h n A xc xc e N e e p D e de de -d ti ti o o NA le le D uc uc -n -n yl l an any gu gu as R

Figure 5. Diff erenti al protein expression between GFI1B-Q287* and control iPSC-derived megakaryocyti c cells. (A) Protein levels in control and GFI1B-Q287* iPSC-derived megakaryocyti c cells were determined using label free quanti fi cati on (LFQ) and diff erenti ally expressed proteins were determined using a two-sided t-test (p<0.05 and s0=0.5). The volcano plot shows the -log10-transformed p-value against the log2 fold change (FC) in relati ve protein levels between control and GFI1B-Q287* iPSC-derived megakaryocyti c cells, with each protein represented by a single point in the graph. Dashed lines represent the stati sti cal cut-off . A negati ve FC indicates proteins with reduced levels and a positi ve FC indicates elevated proteins in GFI1B-Q287* iPSC-derived cells. (B) Heat-map and hierarchical clustering of the 396 diff erenti ally expressed proteins between control and GFI1B-Q287* iPSC-derived cells. >>

42 MOLECULAR CHARACTERIZATION OF THE GFI1B-Q287* MUTATION

Heat-map colors are based on the z-scored (log2) LFQ values. Blue shades correspond to decreased expression levels and yellow shades to increased expression levels. Imputed values are shown in case a protein was not detected. (C) Enrichment of GO terms based on biological process, molecular functi on and cellular components was assessed as described in Materials and Methods. The overlap heatmap shows signifi cant GO terms related to down-regulated proteins in GFI1B-Q287* iPSC-derived megakaryocyti c cells. For each cluster, one or two summarizing terms are indicated. For a full list of signifi cant GO-terms see Supplementary Table 2. (D) The signifi cant GO-terms with corresponding p-values for up-regulated proteins in GFI1B-Q287* iPSC-derived megakaryocyti c cells are shown. 2

Proteome changes in GFI1B p.Q287* platelets are not limited to α-granule protein depleti on. GFI1B-Q287* iPSC derived megakaryocyti c cells show phenotypes that indicate aberrant diff erenti ati on. With platelets representi ng the fi nal stage of megakaryopoiesis, we asked how this is translated to the platelet proteome. To identi fy the deregulated proteins, platelet protein levels of four GFI1B-Q287* aff ected individuals were compared to those of four healthy individuals using label free quanti tati ve mass spectrometry. Out of 2550 quanti fi ed proteins, 1005 proteins were diff erenti ally expressed between normal and GFI1B-Q287* platelets, with 395 proteins being reduced and 610 elevated in case of the GFI1B-Q287* mutati on (Figure 6A-B; Supplementary Table 3). In line with the reported α-granule defi ciency,5 α-granule proteins such as VWF, THBS1, and platelet factor 4, showed markedly reduced levels in GFI1B-Q287* platelets (Figure 6C). Of note, NBEAL2, which is mutated and causati ve for the α-granule defi ciency in classical Gray Platelet Syndrome,31-33 was not among the reduced proteins in GFI1B-Q287* platelets, but in fact mildly elevated (Supplementary Table 3). In additi on, strongly elevated expression of CD34 was observed in GFI1B-Q287* platelets, compati ble with fi ndings reported above and published reports.5, 8 Other proteins enriched in GFI1B-Q287* platelets were proteasomal, ribosomal, and mitochondrial proteins (Supplementary Figure S7; Supplementary Table 3). GO terms associated with down-regulated proteins in GFI1B-Q287* platelets were strongly related to platelet functi ons and α-granules, including wound healing, chemotaxis, immune response, and vesicle secreti on (Figure 6D; Supplementary Table 2). Proteins elevated in GFI1B-Q287* platelets were parti cularly enriched for GO terms on mitochondrial functi on and the respiratory electron transport chain (Figure 6E; Supplementary Table 2). In additi on, a multi tude of other cellular processes associated with underrepresented (e.g. the Golgi and ER systems, adhesion, and the cytoskeleton) and overrepresented proteins (e.g. ubiquiti nati on, RNA processing, hematopoieti c diff erenti ati on, and several metabolic functi ons) were observed (Figure 6D-E; Supplementary Table 2). Thus, in additi on to a major reducti on in α-granule proteins, GFI1B-Q287* platelets exhibit aberrant expression of many other proteins with various functi ons.

43 CHAPTER 2 Figure 6

A B

C

ANGPT1 FGA SPARC 32 40 36 30 **** 38 *** 34 ***** LFQ LFQ LFQ 2 28 2 36 2 32 Log Log Log 26 34 30 24 32 28 Control GFI1BQ287* Control GFI1BQ287* Control GFI1BQ287* PF4 THBS1 VWF 38 38 38 ***** ***** ***** 36 36 36 LFQ LFQ LFQ 2 2 34 2 34 34 Log Log Log 32 32 32 30 30 30 Control GFI1BQ287* Control GFI1BQ287* Control GFI1BQ287*

D E

Overlap index Overlap index Platelet GO-terms down regulated Platelet GO-terms up regulated

0 0.2 0.4 0.6 0.8 1 0 0.2 0.4 0.6 0.8 1

ŽĂŐƵůĂƟŽŶ Mitochondria; respiratory electron transfer chain tŽƵŶĚŚĞĂůŝŶŐ͖ƌĞƐƉŽŶƐĞƚŽƐƟŵƵůƵƐ ĂƚĂďŽůŝĐƉƌŽĐĞƐƐĞƐ͖ŽdžŝĚŽƌĞĚƵĐƚĂƐĞĂĐƟǀŝƚLJ Adhesion; developmental process ,ĞŵĂƚŽƉŽŝĞƟĐĚŝīĞƌĞŶƟĂƟŽŶ͖ƵďŝƋƵŝƟŶĂƟŽŶ ;ůƉŚĂͿŐƌĂŶƵůĞƐĞĐƌĞƟŽŶ Metabolic processes ĞůůŵŝŐƌĂƟŽŶ Ribosome; RNA processing; ER ZĞĐĞƉƚŽƌďŝŶĚŝŶŐ͕ƌĞĐĞƉƚŽƌĂĐƟǀŝƚLJ

/ŵŵƵŶĞƌĞƐƉŽŶƐĞ͖ƉƌŽƚĞŽůLJƐŝƐ

44 MOLECULAR CHARACTERIZATION OF THE GFI1B-Q287* MUTATION

Figure 6. Diff erenti al protein levels between GFI1B-Q287* and control platelets.Platelets from four GFI1B-Q287* pati ents and four healthy individuals were isolated and protein levels were assessed using mass spectrometry. Diff erenti ally expressed proteins were determined using a two-sided t-test (p<0.05 and s0=0.5). (A) Volcano plot showing the -log10-transformed p-value against the log2 fold change (FC) in relati ve protein levels between control and GFI1B-Q287* platelets. Dashed lines represent the stati sti cal cut-off . A negati ve FC indicates proteins with reduced levels and a positi ve FC indicates increased levels in GFI1B-Q287* platelets. (B) Heat-map with hierarchical clustering for the 1007 diff erenti ally expressed proteins between control and GFI1B-Q287* platelets. Heat-map colors are based on the z-scored (log ) LFQ values. Blue shades correspond to decreased expression levels and yellow shades 2 2 to increased expression levels. Imputed values are shown in case a protein was not detected. (C) Relati ve protein levels (log2 LFQ values) of selected α-granule proteins in platelets of healthy controls (circles) and GFI1B-Q287* pati ents (squares). ANGPT1, Angiopoieti n-1; FGA, Fibrinogen alpha chain; SPARC, Secreted protein acidic and rich in cysteine; PF4, Platelet Factor 4; THBS1, Thrombospondin-1; VWF, Von Willebrand Factor. (D-E) GO term enrichment analysis of the signifi cantly expressed proteins in GFI1B-Q287* platelets. Overlap heatmaps of signifi cant GO terms associated with (D) down-regulated and (E) up-regulated proteins in GFI1B-Q287* platelets. For each cluster, one or two summarizing terms are indicated. For a full list of signifi cant GO-terms see Supplementary Table 2.

The GFI1B-Q287* platelet proteome resembles early megakaryoblasts. As both platelets and cultured megakaryocyti c cells harboring the GFI1B-Q287* mutati on express the early progenitor marker CD34, we next asked whether GFI1B-Q287* platelets also express other early megakaryocyte proteins that are normally down-regulated upon terminal diff erenti ati on. To study this, we compared protein profi les of healthy maturing megakaryocytes with GFI1B-Q287* pati ent derived platelets. To this end, CD34+ cells were diff erenti ated to megakaryocytes and harvested for mass spectrometry analysis between days 4 and 14 of diff erenti ati on. A total of 3733 proteins were quanti fi ed, of which 1668 proteins showed signifi cantly diff erent expression levels during megakaryocyte maturati on (Figure 7A; Supplementary Table 4). Two main clusters of proteins showed strong up- regulati on (578 proteins) or down-regulati on (1026 proteins) towards the late stages of megakaryocyte diff erenti ati on. Compati ble with the role of megakaryocytes as the platelet progenitor cells, platelet α-granule proteins and receptors were strongly increased during megakaryocyte diff erenti ati on (Figure 7B-C). GO term analyses showed that up-regulated proteins were indeed strongly related to platelet biogenesis and functi on, including wound healing, (alpha) granules, the cytoskeleton, and cell acti vati on (Supplementary Figure S8A; Supplementary Table 2). Down-regulated proteins were associated with several GO terms related to ribosome functi on, RNA processing, DNA replicati on (including the MCM proteins) and other metabolic and biosyntheti c processes (Supplementary Figure S8B; Supplementary Table 2). Next, the over- and underrepresented proteins in GFI1B-Q287* platelets were compared with the protein profi les of the maturati ng megakaryocytes. The majority of down-regulated proteins in GFI1B-Q287* platelets showed a clear patt ern of up-regulati on in diff erenti ati ng megakaryocytes (~80%; Figure 7D), whereas the proteins that showed up-regulati on in GFI1B-Q287* platelets were generally down-modulated during megakaryocyte diff erenti ati on (~60%; Figure 7E). As platelets represent the terminal stage of megakaryocyte maturati on, our proteomic data show that the GFI1B-Q287* platelets resemble poorly diff erenti ated megakaryocytes.

45 CHAPTER 2 Figure 7

A D

E

B C

40 40 THBS1 ITGA2B n n o o i i ITGB3 s s VWF 35

35 ) s ) s e e Q Q r r CD36 F F

PF4 p p L L x x 2 e 2 e 30 30 GP1BA g g ANGPT1 n n o i o i l l e ( e ( GP9 t t

SELP o o r r 25 25 P P

20 20 4 6 8 10 12 14 4 6 8 10 12 14 Differentiation (day) Differentiation (day)

Figure 7. The GFI1B-Q287* platelet proteome reveals impaired megakaryocyte diff erenti ati on. The proteome of in vitro-diff erenti ati ng megakaryocytes (MK) was analyzed by label-free mass spectrometry (see Methods). Diff erenti ally expressed proteins were determined using ANOVA (false discovery rate <0.05, s0=0.5). (A) Heat-map with hierarchical clustering of the 1,668 proteins showing signifi cantly expression between any of the analyzed days of MK diff erenti ati on, i.e. day 4, 5, 6, 7, 8, 9, 10, 11, and 14 of diff erenti ati on (from left to right) with three replicates per day of culture. Relati ve protein levels [z-scored log2 label-free quanti fi cati on (LFQ)] are shown with imputed values in the case a protein was not detected. (B) Expression levels in cultured MK of platelet α-granule proteins during MK diff erenti ati on. (C) Expression levels in cultured MK of platelet receptors during MK diff erenti ati on. (D-E) Relati ve expression levels in cultured MK of proteins with signifi cantly increased or decreased levels in GFI1BQ287* >>

46 MOLECULAR CHARACTERIZATION OF THE GFI1B-Q287* MUTATION

platelets: 272 of the 395 downregulated proteins (D) and 503 of the 610 upregulated proteins (E) in GFI1BQ287* platelets were identi fi ed in the MK. Magenta/blue shades in the heat-maps correspond to decreased expression levels and yellow/orange shades to increased expression levels; a gray color indicates that a protein was not identi fi ed in a given MK sample (Panels D and E only). THBS1: thrombospondin-1; VWF: von Willebrand factor; PF4: platelet factor 4; ANGPT1: angiopoieti n-1; SELP: selecti n P; ITGA2B: integrin subunit alpha 2b; ITGB: integrin subunit beta; CD36: cluster of diff erenti ati on 36; GP1BA: glycoprotein Ib platelet subunit alpha; GP9: glycoprotein 9.

2 DISCUSSION

The work presented here furthers our understanding on deregulated and disease-causing processes in GFI1B-related bleeding and platelet disorders. Earlier we proposed that GFI1B-Q287*, observed in individuals with an inherited bleeding diathesis, may inhibit the functi on of wild type GFI1B in a dominant- negati ve manner by sequestering co-repressors.5 Indeed, mutant GFI1B-Q287* sti ll interacts with LSD1 and its associated proteins in MEG-01. Unlike GFI1B causing a decrease in proliferati ve capacity, forced expression of GFI1B-Q287* in MEG-01 resulted in increased proliferati on. This increase was nullifi ed upon introducti on of single point mutati ons in GFI1B-Q287* that abrogate the interacti on with LSD1. In line with these fi ndings we observed that disrupti on of the GFI1B-LSD1 interacti on using GSK-LSD1 induces GFI1B-Q287*-like phenotypes in CD34+ cell derived megakaryocytes, including the down- regulati on of CD42b. Yet, GFI1B-Q287* iPSC-derived megakaryocytes did not show impaired CD42b expression. This could be explained by variati on in CD42b expression observed in aff ected individuals, with highest levels being comparable to those observed in non-aff ected individuals.5 Alternati vely, this may be explained by diff erences in in vivo and in vitro diff erenti ati on cues. Nevertheless, we propose that GFI1B-Q287* inhibits wild type GFI1B by inhibiti ng LSD1-dependent processes through competi ti ve sequestrati on of LSD1 and its binding partners. The relevance of the GFI1B-LSD1 interacti on in megakaryoblast expansion is substanti ated by observati ons in mice following in vivo Lsd1 silencing. This resulted in Meis1 overexpression and increased megakaryocyte numbers in the bone marrow as well. Of note, here we found MEIS1 only in GFI1B-Q287*iPSC-derived megakaryocyti c cells but not in control iPSC-derived cells, indicati ng elevated expression in the former. Interesti ngly, Lsd1-silenced mice also exhibited megakaryocyte abnormaliti es, thrombocytopenia and a reducti on of platelet granules, similar to the phenotypes of pati ents harboring the dominant-negati ve GFI1B-Q287* mutati on.18 This could mean that the functi onal interplay between GFI1B and LSD1 is not limited to controlling megakaryoblast proliferati on and diff erenti ati on, but that it is also required for terminal maturati on and the generati on of granules and platelets. In additi on, this interplay is not restricted to megakaryopoiesis, but has also been shown to be essenti al for the transiti on of endothelial to hematopoieti c stem cells (HSCs) and erythrocyte development.13, 14, 34 In additi on to GFI1B-Q287*, two other truncati ng GFI1B mutati ons have been identi fiedthat disrupt the DNA binding domain: G272fs8 and H294fs,6 both leading to a similar bleeding and platelet disorder. These GFI1B mutati ons also act in a dominant-negati ve manner. Thus, LSD1 sequestrati on by mutant GFI1B that cannot bind its transcripti onal targets may be a general mechanism through which

47 CHAPTER 2

a collection of GFI1B mutations is acting. In these cases, the mutation is present in both GFI1B isoforms and they will inhibit wild-type GFI1B-p37 and GFI1B-p32. However, because GFI1B-p32 expression is much lower than GFI1B-p37,14 LSD1 sequestration by GFI1B-Q287*-p32 will be less than that for GFI1B- Q287*-p37. The molecular mechanisms causing megakaryocyte and platelet defects for other reported GFI1B mutations are likely different because the DNA binding and LSD1-interacting domains remain intact in these mutants. We observed that GFI1B mainly associates with the LSD1-RCOR-HDAC repressor complex (also called BRAF-HDAC complex in neural development) containing LSD1, RCOR1, HDAC1/2, PHF21A (BHC80), and HMG20B (BRAF35).35 The other proteins found, GSE1, RCOR3, and ZMYM2/3, are also known LSD1 interactors,36 of which ZMYM2/3 have not been reported in complex with GFI1B before. ZMYM3 was identified as the only significantly different interacting protein between GFI1Band GFI1B-Q287*. Whether this is relevant for disease pathogenesis remains to be seen. Most interactors (LSD1, RCOR1/3, HDAC1/2, GSE1, ZMYM2/3) are detected in differentiating megakaryocytes as well (Supplementary Table 4), suggesting that they may be relevant for megakaryocyte development. Proteome comparison of different iPSC-derived megakaryocytic cell cultures showed a uniform expression pattern in GFI1B-Q287* cells compared to wild type cells. The latter might bemore variable due to differences in megakaryocytic differentiation stages between cultures. GFI1B-Q287* megakaryocytes exhibit a more uniform, micromegakaryocyte-like appearance, suggesting that they are arrested before polyploidization. This is in contrast with megakaryocytes observed in GFI1B-Q287* individuals5 and conditional GFI1B knockout mice,37 where a block after polyploidization but before cytoplasmic maturation is observed. Possibly, environmental cues that are absent in in vitro cultures may stimulate differentiation of GFI1B-Q287* megakaryocytesin vivo. In GFI1B-Q287* iPSC-derived megakaryocytic cells we observed a down-regulation of downstream IFN-γ signaling targets like STAT1, MX1, IFI16, IFI30, IFI35, IFIT3, OAS2, and OAS3. IFN-γ and its downstream effector STAT1 stimulate megakaryocyte differentiation and platelet production. STAT1 promotes polyploidization, and loss of STAT1 in JAK2 V617F mice resulted in reduced platelet numbers through interference with megakaryocyte development.38, 39 The failure to activate interferon target genes in GFI1B-Q287* megakaryocytes may inhibit differentiation and explain the micromegakaryocyte- like appearance of iPSC-derived megakaryocytes. GFI1B-Q287* iPSC-derived megakaryocytic cells further revealed significantly increased levels of the MCM complex and MEIS1. This might be relevant as the MCM complex is involved in DNA replication/ cell cycle progression and, in accordance with several studies,40, 41 we observed that MCM proteins are downregulated upon megakaryocyte differentiation (Supplementary Figure S6D).40, 41 In addition, we showed earlier that forced MEIS1 expression in CD34+ cells results in larger and more colonies in CFU-MK assays.30 Thus, failure of down-modulation of DNA-replication associated genes by GFI1B as a consequence of sequestering LSD1 and associated proteins by GFI1B-Q287* might contribute to increased proliferation and lack of polyploidization. The platelets of GFI1B-Q287* patients showed a major reduction in α-granule proteins, ranging from a mild <2-fold decrease (e.g. SPARC, fibrinogen α and β chains) to a severe >10-fold depletion (e.g.

48 MOLECULAR CHARACTERIZATION OF THE GFI1B-Q287* MUTATION

VEGF, P-selecti n). To our surprise, NBEAL2 showed signifi cantly increased expression in both platelets and iPSC-derived cells harboring the GFI1B-Q287* mutati on. Inacti vati ng mutati ons in NBEAL2 cause recessive gray platelet syndrome, a bleeding disorder characterized by a severe paucity in α-granules.31-33 Although its exact functi on is sti ll unclear, NBEAL2 is thought to be required for the biogenesis and/or retenti on of α-granules in megakaryocytes.42-44 Other proteins with putati ve roles in α-granule formati on, such as VPS33B45 and VIPAS3946, and proposed NBEAL2 interactors DOCK7, SEC16A and VAC1447 were mostly unaff ected in both GFI1B-Q287* platelets and iPSC derived cells, except SEC16A and VAC14, 2 which showed a mild (<2-fold) decrease and increase in GFI1B-Q287* platelets, respecti vely. Possibly, these proteins are under diff erenti al control of GFI1B. In contrast to the GFI1B-Q287* platelets there was no change in α-granule proteins observed in GFI1B-Q287* iPSC derived megakaryocyti c cells. This could suggest that the observed α-granule defect in primary GFI1B-Q287* platelets may not be caused by defecti ve protein expression, but possibly originates from defecti ve transport from proteins to α-granules and/or defecti ve traffi cking of α-granules to proplatelets. In additi on to the reducti on in α-granule proteins, the proteome of GFI1B-Q287*platelets showed additi onal abnormaliti es including increased expression of ribosomal, proteasomal and mitochondrial proteins. These fi ndings imply that proplatelet forming megakaryocytes of GFI1B-Q287* pati ents may diff er from normal mature megakaryocytes at the metabolic level. Part of the up-regulated platelet proteins, in parti cular the ribosome subunits, showed signifi cant down-regulati on during in vitro megakaryocyte diff erenti ati on, in line with the presumed maturati on defect in GFI1B-Q287* megakaryocytes. Indeed, early megakaryocytes exhibit high protein synthesis rates to support their increasing cellular mass, while this is ceased at fi nal maturati on stages.48 In additi on, proteasomal and mitochondrial acti viti es are closely related to the regulati on of cell fate 49,decisions. 50 Highly proliferati ng cells, including cancer cells and (hematopoieti c) stem cells, show disti nct mitochondrial acti viti es, and proliferati ng HSCs have increased mitochondrial mass compared to quiescent HSCs.51, 52 Thus, the increase in mitochondrial proteins might support the hyperproliferati on of GFI1B-Q287* megakaryocytes. In conclusion, GFI1B regulates protein expression in megakaryocytes through recruitment of the LSD1-RCOR-HDAC co-repressor complex. During megakaryopoiesis many proteins are regulated by GFI1B, that associate with expected but also new processes. GFI1B-Q287* may inhibit GFI1B by specifi cally sequestering the LSD1-RCOR-HDAC complex, making it less available for GFI1B. The normal and aff ected megakaryocyte and platelet proteomes reported here may serve as a reference to bett er understand other platelet disorders and the molecular pathways that drive megakaryopoiesis and platelet development.

Acknowledgements The authors would like to thank Clemens Mellink and Anne-Marie van der Kevie-Kersemaekers from the Academic Medical Centre Amsterdam, Dept. Clinical geneti cs, Amsterdam, The Netherlands for performing the karyotyping of BEL-5-Cl2 and Konnie M. Hebeda from Dept. Pathology, Radboudumc, Nijmegen, the Netherlands for her experti se opinion on the megakaryocyte electron microscopy results.

49 CHAPTER 2

This work was supported by the Landsteiner Foundation for Blood Transfusion Research (project 1531), Sanquin PPOC 15-25p-2089 and the Radboudumc.

Authorship contributions R.O., M.H., J.M.K, A.B.M., E.A., and B.A.R. coordinated the research and wrote the majority of the manuscript. R.O., M.H., J.M.K, A.E.M., S.M.B, J.H.A.M., and M.G.J.M.B. conducted and analyzed the majority of the experiments. C.V.D.Z. and F.P.J.A. performed the proteomics mass spectrometry analysis. M.V., P.J., and M.B. performed the mass spectrometry analysis of GFI1B interacting proteins. H.J. performed the EM analysis. B.A.P.L.G. provided patient samples. J.H.J., M.L., A.B.M., E.A. and B.A.R. provided funding. All authors critically revised the paper and approved the final version.

Conflict-of-interest disclosure The authors declare no competing financial interests.

Corresponding author Bert A. van der Reijden, Geert Grooteplein zuid 8, 6525 GA Nijmegen, The Netherlands. [email protected]

50 MOLECULAR CHARACTERIZATION OF THE GFI1B-Q287* MUTATION

REFERENCES

1. Machlus KR, Thon JN, Italiano JE, Jr. Interpreti ng the developmental dance of the megakaryocyte: a review of the cellular and molecular processes mediati ng platelet formati on. Br J Haematol. 2014;165(2):227-236. 2. Bianchi E, Norfo R, Pennucci V, Zini R, Manfredini R. Genomic landscape of megakaryopoiesis and platelet functi on defects. Blood. 2016;127(10):1249-1259. 3. Lefrancais E, Orti z-Munoz G, Caudrillier A, et al. The lung is a site of platelet biogenesis and a reservoir for 2 haematopoieti c progenitors. Nat New Biol. 2017;544(7648):105-109. 4. Eto K, Kunishima S. Linkage between the mechanisms of thrombocytopenia and thrombopoiesis. Blood. 2016;127(10):1234-1241. 5. Monteferrario D, Bolar NA, Marneth AE, et al. A dominant-negati ve GFI1B mutati on in the gray platelet syndrome. N Engl J Med. 2014;370(3):245-253. 6. Stevenson WS, Morel-Kopp MC, Chen Q, et al. GFI1B mutati on causes a bleeding disorder with abnormal platelet functi on. J Thromb Haemost. 2013;11(11):2039-2047. 7. Marneth AE, van Heerde WL, Hebeda KM, et al. Platelet CD34 expression and alpha/delta-granule abnormaliti es in GFI1B and RUNX1-related familial bleeding disorders. Blood. 2017;129(12):1733-1736. 8. Kitamura K, Okuno Y, Yoshida K, et al. Functi onal characterizati on of a novel GFI1B mutati on causing congenital macrothrombocytopenia. J Thromb Haemost. 2016;14(7):1462-1469. 9. Ferreira CR, Chen D, Abraham SM, et al. Combined alpha-delta platelet storage pool defi ciency is associated with mutati ons in GFI1B. Mol Genet Metab. 2016;120(3):288-294. 10. Uchiyama Y, Ogawa Y, Kunishima S, et al. A novel GFI1B mutati on at the fi rst zinc fi nger domain causes congenital macrothrombocytopenia. Br J Haematol. 2017;181(6):843-847. 11. Rabbolini DJ, Morel-Kopp MC, Chen Q, et al. Thrombocytopenia and CD34 expression is decoupled from alpha- granule defi ciency with mutati on of the fi rst GFI1B zinc fi nger. J Thromb Haemost. 2017;15(11):2245-2258. 12. Schulze H, Schlagenhauf A, Manukjan G, et al. Recessive grey platelet-like syndrome with unaff ected erythropoiesis in the absence of the splice isoform GFI1B-p37. Haematologica. 2017;102(9):e375-e378. 13. Saleque S, Kim J, Rooke HM, Orkin SH. Epigeneti c regulati on of hematopoieti c diff erenti ati on by Gfi -1 and Gfi- 1b is mediated by the cofactors CoREST and LSD1. Mol Cell. 2007;27(4):562-572. 14. Laurent B, Randrianarison-Huetz V, Frisan E, et al. A short Gfi -1B isoform controls erythroid diff erenti ati on by recruiti ng the LSD1-CoREST complex through the dimethylati on of its SNAG domain. J Cell Sci. 2012;125(Pt 4):993-1002. 15. van der Meer LT, Jansen JH, van der Reijden BA. Gfi 1 and Gfi 1b: key regulators of hematopoiesis. Leukemia. 2010;24(11):1834-1843. 16. Cai C, He HH, Gao S, et al. Lysine-specifi c demethylase 1 has dual functi ons as a major regulator of androgen receptor transcripti onal acti vity. Cell reports. 2014;9(5):1618-1627. 17. Kerenyi MA, Shao Z, Hsu YJ, et al. Histone demethylase Lsd1 represses hematopoieti c stem and progenitor cell signatures during blood cell maturati on. Elife. 2013;2(e00633. 18. Sprussel A, Schulte JH, Weber S, et al. Lysine-specifi c demethylase 1 restricts hematopoieti c progenitor proliferati on and is essenti al for terminal diff erenti ati on. Leukemia. 2012;26(9):2039-2051. 19. Dignam JD, Lebovitz RM, Roeder RG. Accurate transcripti on initi ati on by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 1983;11(5):1475-1489. 20. Smits AH, Jansen PW, Poser I, Hyman AA, Vermeulen M. Stoichiometry of chromati n-associated protein complexes revealed by label-free quanti tati ve mass spectrometry-based proteomics. Nucleic Acids Res. 2013;41(1):e28.

51 CHAPTER 2

21. Rappsilber J, Ishihama Y, Mann M. Stop and go extraction tips for matrix-assisted laser desorption/ionization, nanoelectrospray, and LC/MS sample pretreatment in proteomics. Anal Chem. 2003;75(3):663-670. 22. Migliaccio G, Sanchez M, Masiello F, et al. Humanized culture medium for clinical expansion of human erythroblasts. Cell Transplant. 2010;19(4):453-469. 23. Heideveld E, Masiello F, Marra M, et al. CD14+ cells from peripheral blood positively regulate hematopoietic stem and progenitor cell survival resulting in increased erythroid yield. Haematologica. 2015;100(11):1396- 1406. 24. Hansen M, Varga E, Wust T, et al. Generation and characterization of human iPSC line MML-6838-Cl2 from mobilized peripheral blood derived megakaryoblasts. Stem Cell Res. 2017;18(26-28. 25. Hansen M, Varga E, Aarts C, et al. Efficient production of erythroid, megakaryocytic and myeloid cells, using single cell-derived iPSC colony differentiation. Stem Cell Res. 2018;29(232-244. 26. Vizcaino JA, Deutsch EW, Wang R, et al. ProteomeXchange provides globally coordinated proteomics data submission and dissemination. Nat Biotechnol. 2014;32(3):223-226. 27. Bantscheff M, Hopf C, Savitski MM, et al. Chemoproteomics profiling of HDAC inhibitors reveals selective targeting of HDAC complexes. Nat Biotechnol. 2011;29(3):255-265. 28. Fiolka K, Hertzano R, Vassen L, et al. Gfi1 and Gfi1b act equivalently in haematopoiesis, but have distinct, non- verlapping functions in inner ear development. EMBO Rep. 2006;7(3):326-333. 29. Ishikawa Y, Gamo K, Yabuki M, et al. A Novel LSD1 Inhibitor T-3775440 Disrupts GFI1B-Containing Complex Leading to Transdifferentiation and Impaired Growth of AML Cells. Mol Cancer Ther. 2017;16(2):273-284. 30. Zeddies S, Jansen SB, di Summa F, et al. MEIS1 regulates early erythroid and megakaryocytic cell fate. Haematologica. 2014;99(10):1555-1564. 31. Albers CA, Cvejic A, Favier R, et al. Exome sequencing identifies NBEAL2 as the causative gene for gray platelet syndrome. Nat Genet. 2011;43(8):735-737. 32. Gunay-Aygun M, Falik-Zaccai TC, Vilboux T, et al. NBEAL2 is mutated in gray platelet syndrome and is required for biogenesis of platelet alpha-granules. Nat Genet. 2011;43(8):732-734. 33. Kahr WH, Hinckley J, Li L, et al. Mutations in NBEAL2, encoding a BEACH protein, cause gray platelet syndrome. Nat Genet. 2011;43(8):738-740. 34. Thambyrajah R, Mazan M, Patel R, et al. GFI1 proteins orchestrate the emergence of haematopoietic stem cells through recruitment of LSD1. Nat Cell Biol. 2016;18(1):21-32. 35. Ceballos-Chavez M, Rivero S, Garcia-Gutierrez P, et al. Control of neuronal differentiation by sumoylation of BRAF35, a subunit of the LSD1-CoREST histone demethylase complex. Proc Natl Acad Sci U S A. 2012;109(21):8085-8090. 36. Maiques-Diaz A, Somervaille TC. LSD1: biologic roles and therapeutic targeting. Epigenomics. 2016;8(8):1103- 1116. 37. Foudi A, Kramer DJ, Qin J, et al. Distinct, strict requirements for Gfi-1b in adult bone marrow red cell and platelet generation. J Exp Med. 2014;211(5):909-927. 38. Duek A, Lundberg P, Shimizu T, et al. Loss of Stat1 decreases megakaryopoiesis and favors erythropoiesis in a JAK2-V617F-driven mouse model of MPNs. Blood. 2014;123(25):3943-3950. 39. Huang Z, Richmond TD, Muntean AG, Barber DL, Weiss MJ, Crispino JD. STAT1 promotes megakaryopoiesis downstream of GATA-1 in mice. J Clin Invest. 2007;117(12):3890-3899. 40. Haldar S, Roy A, Banerjee S. Differential regulation of MCM7 and its intronic miRNA cluster miR-106b-25 during megakaryopoiesis induced polyploidy. RNA Biol. 2014;11(9):1137-1147. 41. Raslova H, Kauffmann A, Sekkai D, et al. Interrelation between polyploidization and megakaryocyte differentiation: a gene profiling approach. Blood. 2007;109(8):3225-3234.

52 MOLECULAR CHARACTERIZATION OF THE GFI1B-Q287* MUTATION

42. Deppermann C, Cherpokova D, Nurden P, et al. Gray platelet syndrome and defecti ve thrombo-infl ammati on in Nbeal2-defi cient mice. J Clin Invest. 2013;123(8):3331-3342. 43. Guerrero JA, Bennett C, van der Weyden L, et al. Gray platelet syndrome: proinfl ammatory megakaryocytes and alpha-granule loss cause myelofi brosis and confer metastasis resistance in mice. Blood. 2014;124(24):3624- 3635. 44. Kahr WH, Lo RW, Li L, et al. Abnormal megakaryocyte development and platelet functi on in Nbeal2(-/-) mice. Blood. 2013;122(19):3349-3358. 45. Urban D, Li L, Christensen H, et al. The VPS33B-binding protein VPS16B is required in megakaryocyte and 2 platelet alpha-granule biogenesis. Blood. 2012;120(25):5032-5040. 46. Lo B, Li L, Gissen P, et al. Requirement of VPS33B, a member of the Sec1/Munc18 protein family, in megakaryocyte and platelet alpha-granule biogenesis. Blood. 2005;106(13):4159-4166. 47. Mayer L, Jasztal M, Pardo M, et al. The BEACH-domain containing protein, Nbeal2, interacts with Dock7, Sec16a and Vac14. Blood. 2017; 48. Ru YX, Zhao SX, Dong SX, Yang YQ, Eyden B. On the maturati on of megakaryocytes: a review with original observati ons on human in vivo cells emphasizing morphology and ultrastructure. Ultrastruct Pathol. 2015;39(2):79-87. 49. Bassermann F, Eichner R, Pagano M. The ubiquiti n proteasome system - implicati ons for cell cycle control and the targeted treatment of cancer. Biochim Biophys Acta. 2014;1843(1):150-162. 50. Schrepfer E, Scorrano L. Mitofusins, from Mitochondria to Metabolism. Mol Cell. 2016;61(5):683-694. 51. Joshi A, Kundu M. Mitophagy in hematopoieti c stem cells: the case for explorati on. Autophagy. 2013;9(11):1737- 1749. 52. Wallace DC. Mitochondria and cancer. Nat Rev Cancer. 2012;12(10):685-698.

53 CHAPTER 2

SUPPLEMENTARY METHODS

Lentiviral transduction of MEG-01 cells with GFI1B-GFP and GFI1B-Q287*-GFP GFI1B variant-GFP fusions (wild type GFI1B, Q287*, P2A, and K8A) were cloned in the FUW lentiviral vector. Lentivirus was produced using 293FT cells. After seeding 293FT cells onto 9 cm dishes, cells were transfected at 60% confluency with calcium phosphate. Transfection was performed using 3.68 µg pLP1, 1.84 µg pLP2, and 2.30 µg pLP/VSVG packaging vectors and 14.4 µg FUW construct. After 16-18 hours, the medium was replaced with 5 ml fresh medium. Viral supernatant was harvested ~48 hours after transfection. MEG-01 cells were transduced with FUW, FUW-GFI1B-GFP or FUW-GFI1B-Q287* viral supernatant by spinning down the virus on a retronectin coated 6-wells plate. Subsequently, the MEG-01 cells were added and incubated with virus for 24 hours.

Nuclear extracts MEG-01 and GFP-pull down GFI1B interacting proteins Nuclear extracts from 100 million lentivirally transduced MEG-01 cells were generated according to Dignam et al.1 Cells were harvested and washed twice with PBS. Cells were incubated for 10 minutes at

4°C in 5 volumes of Buffer A (10 mM Hepes KOH pH 7.9, 1.5 mM MgCl2, and 10 mM KCl), and then pelleted at 400g for 5 minutes at 4°C. Swollen cells were resuspended in 2 volumes of buffer A supplemented with complete protease inhibitors (Roche) and 0.15% NP40 (Sigma), followed by homogenization on ice using 30 strokes with a type B (tight) pestle. The nuclei were pelleted and washed two times with PBS at 3200g, 4°C for 15 minutes. This was followed by incubation in 2 volumes of Buffer C (420 mM NaCl,

20 mM Hepes KOH pH 7.9, 20% v/v glycerol, 2 mM MgCl2, 0.1% NP40, complete protease inhibitors, and 0.5 mM DTT) for 1 hour at 4°C to extract nuclear proteins. The nuclear extract (supernatant) was obtained by centrifugation at 21.000g for 30 minutes at 4°C. Label-free GFP-pulldowns were performed in triplicate as described in Smits et al.2 For GFP-pulldowns, 0.6 mg of nuclear extract was incubated with 7.5 µl GFP-Trap beads (ChromoTek) in incubation buffer

(300 mM NaCl, 20 mM Hepes KOH pH 7.9, 20% v/v glycerol, 2 mM MgCl2, 0.2 mM EDTA, 0.25% NP40, complete protease inhibitors, and 0.5 mM DTT) in the presence of 50 µg/ml ethidium bromide (Sigma) to prevent indirect DNA mediated interactions. Beads were washed twice with incubation buffer (0.5% NP40), twice with PBS (0.5% NP40) and finally twice with PBS. Subsequently, the proteins were subjected to on-bead trypsin digestion and peptides were acidified and desalted using C18-Stagetips.

Mass spectrometry and data analysis GFI1B interacting proteins Just before mass spectrometry analysis, peptides were eluted from the C18 Stagetips and recorded with LC-MS/MS LTXQ-Orbitrap Fusion Tribrid mass spectrometer (ThermoFisher Scientific) at top speed mode of 3 seconds cycle. Raw data were analyzed by MaxQuant (1.5.7.0) using default settings and blasted against the Human Uniprot database downloaded on 17-02-2017. Statistical outliers for the GFP-pulldown of the empty vector compared to wild type GFI1B or GFI1B-Q287* were determined using a two-tailed t-test. Multiple testing correction was applied by using a permutation-based false discovery rate (FDR) method in Perseus (from MaxQuant package). Statistical cut-offs (FDR<0.01 and fold change

54 MOLECULAR CHARACTERIZATION OF THE GFI1B-Q287* MUTATION

>9.2) were chosen such that no proteins were present as outliers on the empty vector control side of the volcano plot. To determine the stoichiometry of the identi fi ed complexes, we compared the relati ve abundance of interactors by calculati ng iBAQ intensiti es (sum of all identi fi ed pepti de intensiti es for a certain protein, divided by the number of theoreti cally observed pepti des). Next, the iBAQ intensiti es were compensated for the iBAQ intensity in the empty vector samples representi ng the background binding level. Finally, these relati ve abundance values were normalized by setti ng the abundance of GFI1B;GFI1 to 1. 2

Co-immunoprecipitati on and western blotti ng MEG-01 cells were lenti virally transduced with FUW-GFI1B-(WT, Q287*, P2A, or K8A)-GFP, and when indicated treated with 4μM GSK-LSD1 (Sigma) for 48 hours. Nuclear extracts were made using the NE-PER Nuclear and Cytoplasmic Extracti on Kit (ThermoFisher). Co-immunoprecipitati on was performed with GFP-Trap beads. For normal western blot, whole cell extracts were prepared in SDS gel-loading buff er (2% SDS, 0.1% bromphenol blue, 50 mM Tris-HCl (pH 6.8), 100 mM DTT, 10% glycerol, water). PVDF membranes were stained with rabbit anti -LSD1 (Abcam), mouse anti -GFI1B (Santa Cruz Biotechnology), or rabbit anti -Acti n (Sigma). Luminescence signal was visualized using a ChemiDox XRSþ (Bio-Rad).

Proliferati on of GFI1B and GFI1B mutant transduced MEG-01 cells Flag-tagged GFI1B constructs were cloned into the retroviral vector pMIGR1-IRES-GFP to generate pMIGR1-GFI1B-fl ag-IRES-GFP. Retrovirus was produced using PhoenixA cells, which were cultured in DMEM supplemented with 10% heat inacti vated FCS at 37˚C supplied with 5% CO2. Aft er seeding onto 9cm dishes, cells were transfected at 60% confl uency with calcium phosphate. Transfecti on was performed using 3.15 µg pCL-Ampho retroviral packaging vector and 18.4 µg pMIGR1 construct. Aft er 16-18 hours, the medium was replaced with 5ml fresh medium. Viral supernatant was harvested 30 hours aft er transfecti on. MEG-01 cells were maintained between 2x105 and 8x105 cells/ml in RPMI

1640 (GIBCO) supplemented with 10% heat inacti vated FCS, at 37˚C and 5% CO2. MEG-01 cells were transduced with 2.5 ml pMIGR1 virus. Briefl y, 1.25 ml viral supernatant plus 2x105 MEG-01 cells (in 1ml) were added to retronecti n (Takara Bio Inc.)-coated non-ti ssue culture treated 33 mm dishes. Aft er 24 hours, 1.25 ml medium was removed from the plates and 1.25 ml fresh viral supernatant was added. Aft er an additi onal 24 hours MEG-01 cells were harvested from retronecti n plates, spun down and resuspended in 1 ml fresh culture medium. The GFP% was followed using fl ow cytometry for 26 days with 2-3 day intervals. GFP percentages were normalized to the start point of the culture (day 5 aft er transducti on) using the following formula: (GFP% day X/(100 - GFP% day X))/(GFP% day 5/(100 - GFP% day 5)) to correct for diff erences in start GFP%. On day 23, 2x105 GFP+ cells were FACS-sorted to determine GFI1B expression using quanti tati ve RT-PCR.

Quanti tati ve RT-qPCR RNA was isolated using the Quick-RNATM kit (Zymo Research). RNA was treated with DNAse (Zymo Research) and reverse transcribed using M-MLV reverse transcriptase (Invitrogen). For quanti tati ve Real

55 CHAPTER 2

Time Polymerase Chain Reaction (RT-qPCR), cDNA was amplified using Taqman 2x Universal PCR Master Mix (Applied biosystems) as recommended by the manufacturer. GFI1B expression was determined using the following primers and probe: forward primer 5’-CCCGTGTGCAGGAAGATGA, reverse primer 5’-CAGGCACTGGTTTGGGAATAGA, probe 5’-FAM-TTACCCCGGTGCCCAGA-MGB. Endogenous GFI1B expression (5’UTR) was determined using TaqMan Gene Expression Assay Hs01062474_m1 (Applied Biosystems). GAPDH expression was determined using Human GAPDH mix (FAMTM Dye/MGB Probe) (Applied biosystems) to correct for differences in input. RT-qPCR was performed on the 7500 Real Time PCR System (Applied Biosystems). Data were analyzed using 7500 Fast System Software (version 1.3.1).

BEL-5-Cl1/2 iPSC line generation To generate blood-derived induced pluripotent stem cells (iPSC), patient blood (5-10ml) was collected after written informed consent. Peripheral blood mononuclear cells were expanded and differentiated to erythroblasts within 8 days as described in Heideveld et al.3 The polycystronic Oct4/KLF4/SOX2/c- Myc lentiviral plasmid4, 5 was used to transduce erythroblasts for reprogramming as described in Hansen et al.6 After transduction, cells were cultured in IMDM (Biochrome, Merk) supplemented with 1U/ml erythropoietin, 100ng/ml SCF, 1uM Dexamethason, 10µg/ml polybrene (Sigma) and 2mmol/ml valproic acid (VPA, Sigma) for 1 day. Cells were subsequently plated on 0.1% gelatine (Sigma) coated plates containing a confluent layer of irradiated mouse embryonic fibroblasts (iMEF, GlobalStem). Cells were incubated with VPA for an additional 7 days. The medium was changed to E8 (ThermoFisher Scientific) on day 10 and iPS colonies were harvested between days 14-20. iPSCs were tested for pluripotency as we previously described in Hansen et al.6 iPSC megakaryocytic differentiation iPSC lines MML-6838-Cl26 and BEL-5-Cl1/2 were maintained on Matrigel coated (BD Biosciences) plates in E8 medium (ThermoFisher Scientific) following manufacturer’s instructions. For differentiation, iPS colonies were made single cell with TrypleSelect (ThermoFisher Scientific), and 120-250 cells were seeded in E8 with RevitaCell (ThermoFisher Scientific) on 6cm matrigel coated dishes. Colonies were grown until a size of 400-600µm. Differentiation was initiated with StemLine II (Sigma) supplemented with 50ng/ml bFGF, 40ng/ml VEGF, 20ng/ml BMP4 and insulin transferrin selenium (1:100, ITS) (ThermoFisher Scientific). At day 6 of differentiation, medium was changed to IMDM (Biochrom, Merck) with 10ng/ml VEGF, 20ng/ml BMP4, 10ng/ml IL-1β, 1ng/ml IL-3, 10ng/ml IL-6, 50ng/ml TPO, 50ng/ml SCF and 1:100 ITS. All growth factors were purchased from PeproTech. Cells were harvested from the supernatant between days 14-18, for flow cytometry and on day 18 for sorting CD41a+ cells for mass spectrometry.

Electron Microscopy (EM) iPSC-derived megakaryocytic cells For EM, tissue culture samples were fixed in Karnovsky’s fixative. Postfixation was donewith1% Osmiumtetroxide in 0,1 M cacodylatebuffer, after washing tissues were stained en bloc with Ultrastain

56 MOLECULAR CHARACTERIZATION OF THE GFI1B-Q287* MUTATION

1 (Leica, Vienna, Austria), followed by ethanol dehydrati on series. Finally the samples were embedded in a mixture of DDSA/NMA/Embed-812 (EMS, Hatf ield, U.S.A), secti oned and stained with Ultrastain 2 (Leica, Vienna, Austria) and analyzed with a CM10 electron microscope (Thermo Fisher, Eindhoven, the Netherlands).

Primary megakaryocyte culture Mobilized peripheral blood was provided by the Sanquin Laboratory for Cell Therapy and obtained 2 from leukopheresis material of healthy donors treated with G-CSF (2x5 µg/kg/day subcutaneously, Filgastrim, Amgen) as described.7 Informed consent was given in accordance with the Declarati on of Helsinki and the Dutch nati onal and Sanquin internal ethical review boards. CD34+ hematopoieti c stem and progenitor cells were isolated from mobilized peripheral blood using CD34 Microbeads (Miltenyi Biotec) and magneti c-acti vated cell sorti ng according to the manufacturer’s instructi ons. +CD34 cells were diff erenti ated to megakaryocytes in modifi ed IMDM (HEMAdef8) supplemented with 50 ng/ml stem cell factor (SCF), 50 ng/ml TPO, 1 ng/ml IL-3 and 20 ng/ml IL-6 for 4 days, followed by culturing in 50 ng/ml TPO and 10 ng/ml IL-1β for 7 more days.3 All growth factors were from Peprotech. To study the eff ect of LSD1 inhibiti on on megakaryocyte diff erenti ati on, 4 µM GSK-LSD1 (Sigma) was added to the IL- 1β and TPO culture at day 7, and cells were followed for 2-6 days. CD34/CD41a/CD42b expression and expansion was measured aft er 2 days of GSK-LSD1 treatment. In the experiment with 6 days exposure to GSK-LSD1, CD42b expression and proplatelet formati on was analyzed. The number of proplatelet forming megakaryocytes was based on 6 photos from each culture (n=3) and quanti fi ed by ImageJ counti ng.

Flow cytometry The Coulter FC500 fl ow cytometer (Beckman Coulter) was used to determine the percentage of GFP positi ve MEG-01 cells, and the BD FACSAria (BD Bioscience) to sort these GFP positi ve cells. Expression of surface molecules on cultured megakaryocytes either originati ng from mobilized blood CD34+ cells or iPSCs were analyzed by staining with the following fl uorochrome-conjugated anti bodies: CD34-APC (Biolegend), ITGA2B/CD41a-PE-Cy7 (Biolegend), and GP1BA/CD42b-FITC (Sanquin). Aft er staining, cells were analyzed using the LSR-II (BD Bioscience). FACS beads (BD Bioscience) were taken along to determine the expansion of the CD34+/CD41a+ megakaryoblast populati on. Geometric mean fl uorescent intensity (MFI) was normalized to isotype control geometric MFI, generati ng nMFI for normalized MFI.

Platelet isolati on The study was approved by the Medical Ethical Committ ee of the Radboudumc Nijmegen (2013/064) and conducted in accordance with the Declarati on of Helsinki. Venous blood was collected from healthy volunteers and from GFI1B-Q287* pati ents aft er obtaining writt en informed consent. The clinical parameters of the GFI1B-Q287* pati ents have been described previously.9 Platelet-rich plasma was obtained via centrifugati on of whole blood for 20 min gat 120 . Platelets were spun down by centrifugati on for 10 minutes at 2000g, washed and resuspended in a buff er comprising 36 mM Citric

57 CHAPTER 2

acid, 103 mM NaCl, 5 mM KCl, 5 mM EDTA, 5.6 mM D-glucose, 1 nM Prostaglandin E1 (PGE1) and 10% (v/v) ACD-A (BD-Plymouth) at pH 6.5. Platelets were again washed and resuspended in the same buffer but with 0.1 nM PGE1. Finally, platelets were collected by centrifugation for 10 minutes at 2000g and processed for MS analysis.

Sample preparation for proteomics mass spectrometry. All fine chemicals were from Thermo Scientific unless indicated otherwise. 100 x 10⁶ washed platelets per donor or 1 x 106 cultured megakaryocytic cells were lysed in 100 μl 8 M Urea, 100 mM Tris-HCl (Life Technologies) at pH 8. For iPSC MK, sorted CD41a+ cells were used. Samples were sonicated for 10 minutes and centrifuged at 12000g to remove insoluble material. The protein concentration of the lysates was measured using a Bradford assay. For label-free quantification, three replicates of 5 µg protein from platelets or from cultured megakaryocytic cells were taken. The same amount of protein was used for each iPSC sample. Samples were diluted at least 7-fold (v/v) in 50 mM ammonium bicarbonate (Fluka). Proteins were reduced for 60 minutes at 25°C in 10 mM dithiothreithol (DTT) and alkylated using 55 mM iodoacetamide (IAM) for 45 minutes at room temperature in the dark. Finally, proteins were proteolysed by trypsin (Promega) overnight at 25°C using a protein:trypsin ratio of 1:20 (mg/mg). Protein samples were acidified with 5 μl 99% formic acid, and prepared for MS analysis using Empore-C18 StageTips.10

Proteomics mass spectrometry data acquisition. Tryptic peptides were separated by nanoscale C18 reverse phase chromatography coupled on-line to an Orbitrap Fusion Tribrid mass spectrometer (Thermo Scientific) via a nano-electrospray ion source (Nanospray Flex Ion Source, Thermo Scientific). Peptides were loaded on a 20 cm 75–360 µm inner- outer diameter fused silica emitter (New Objective) packed in-house with ReproSil-Pur C18-AQ, 1.9 μm resin (Dr Maisch GmbH). The column was installed on a Dionex Ultimate3000 RSLC nanoSystem (Thermo Scientific) using a MicroTee union formatted for 360 μm outer diameter columns (IDEX) and a liquid junction. The gradient that was employed to separate the peptides as well as the top-speed method to acquire MS/MS spectra on the Fusion are described previously.11 All MS data were acquired with Xcalibur software (Thermo Scientific).

Proteomics mass spectrometry data analysis The RAW mass spectrometry files were processed with the MaxQuant computational platform, 1.5.2.8. Proteins and peptides were identified using the Andromeda search engine by querying the human Uniprot database (89796 entries; downloaded February 2015). Standard settings with the additional options ‘match between runs’, ‘Label Free Quantification (LFQ)’, and ‘unique peptides for quantification’ were selected. The RAW files, MaxQuant search results, and details about the settings are available in the PRIDE repository database12 with the dataset identifier PXD009020. The generated ‘proteingroups. txt’ table was imported into Perseus 1.5.1.6 and filtered for ‘only identified by site’ and reverse hits. The LFQ values were transformed in log2 scale and potential contaminant proteins were removed,

58 MOLECULAR CHARACTERIZATION OF THE GFI1B-Q287* MUTATION

except for ALB and THBS1. For primary cultured megakaryocyte and platelet samples, the three technical replicates of samples were grouped, and the proteins were fi ltered for three valid values in at least one of these groups. The three replicates of the control and GFI1B-Q287* platelet samples were then averaged. For the analysis of diff erenti ally expressed proteins between GFI1B-Q287* and control platelets, only proteins that were detected in four pati ent and/or four control platelet samples were included. For iPSC-derived samples, proteins detected in at least fi ve control and/or fi ve GFI1B-Q287* samples were included. Missing values were imputed by normal distributi on (width = 0.3, shift = 1.8), 2 assuming these proteins were close to the detecti on limit.

Gene ontology term enrichment analysis. Enrichment of gene ontology (GO) terms based on biological processes, molecular functi ons and cellular components was performed and visualized with the R package gogadget13, by comparing up- and down-regulated proteins against the background of total detected proteins. For comparison of signifi cantly enriched proteins to all identi fi ed proteins, a p-value cut-off of 0.05 was used. Heatmaps were generated based on overlapping proteins between GO terms, and k-means was determined separately for each clustering. One or two overlapping terms were assigned for each cluster of GO terms. The full lists of GO terms, including cluster numbers, is provided in Supplementary Table 2.

Supplementary Tables can be found in the online publicati on of this paper at www.haematologica.org.

59 CHAPTER 2

SUPPLEMENTARYFigure S1 FIGURES

A B

BEL-5-Cl2 SANi003-B 0.21% 0.47% FCS

GFP

C 98.7% 96.3% 96.9% 83% FCS FCS FCS FCS

Anti-SSEA4 Anti-OCT4 Anti-SOX2 Anti-TRA-1-80

D Alkaline phosphatase F

E

c.859C-->T

G H

Anti-Alpha-SMA and Anti-Cytokeratin Anti-Beta Tubulin Class III

60 MOLECULAR CHARACTERIZATION OF THE GFI1B-Q287* MUTATION

Figure S1. Generati on of the GFI1B-Q287* iPSC BEL-5-Cl.2(A) Morphology of BEL-5-Cl2, 4x magnifi cati on, EVOS XL (Thermo Fisher Scienti fi c). (B) Silencing of the reprogramming cassett e measured by fl ow cytometry as the absence of green fl uorescent protein (GFP; left ); an episomal reprogramed iPSC SANi003-B serves as negati ve control (right). (C) Expression of pluripotency associated markers SSEA4, OCT4, SOX2 and TRA1-81 by fl ow cytometry. Gati ng was set based on isotype control. (D) Alkaline phosphatase staining showing bright fi eld (left ) and green fl uorescence channel (right). (E) Sanger sequencing showing the heterozygous GFI1B-Q287* mutati on in BEL5 Cl.2 (F) Representati ve G-banded karyogram. (G) Teratomas stained for mesoderm (Alpha-SMA, red), endoderm (cytokerati n, green), and (H) ectoderm (BetaFigure Tubulin S2 Class III, green) and Dapi (blue). 2

*),%4 *),% 4

ZMYM3 3 (FDR (t-test)) 10 -Log 2 1

Log2 FC > 3.2 0 FDR < 0.01

-6 -4 -2 0 2 4 6

Log2 (*),% / *),%4 )

Figure S2. ZMYM3 binds signifi cantly diff erent to GFI1B-Q287* compared to GFI1B. Nuclear extracts of MEG-01 cells transduced with GFI1B-GFP, or GFI1B-Q287*-GFP were analyzed by mass spectrometry. Stati sti cally enriched proteins are identi fi ed by a permutati on-based false discovery rate (FDR)-corrected t-test (FDR<0.01). The volcano plot shows the diff erence between label free quanti fi cati on (LFQ) intensiti es of GFI1B-GFP and GFI1B-Q287*-GFP pulldown (log2-transformed fold change (FC)) on the x-axis, and the -log10-transformed p-value on the y-axis. Dott ed grey lines represent the stati sti cal cut-off s, which were kept the same as in the other volcano plots in Figure 1.

61 CHAPTER 2

Figure S3

n 10 o i s s

e 8 r p x e 6 B 1 I F

G 4

e v i t

a 2 l e R 0 * s * * 7 f A 7 A 7 8 4 2 8 8 8 B 2 9 P 2 K 2 EV I1 2 Q F Q H B +Q B + A A G B I1 2 I1 8 1 B F P F K I I1 G G F F B G G 1 1B FI FI G G

Figure S3. Overexpression of GFI1B in MEG-01 competition cultures. GFI1B RNA expression in sorted GFP positive MEG-01 cells transduced with empty vector (EV), GFI1B-flag, GFI1B-Q287*-flag, GFI1B-H294fs-IRES-GFP, GFI1B- P2A-flag, GFI1B-P2A+Q287*-flag, GFI1B-K8A-flag, or GFI1B-K8A+Q287*-flag at day 23 after transduction. GFI1B expression is normalized to GAPDH and endogenous GFI1B expression in empty vector (EV). Error bars represent mean ± standard deviation (n=3-11).

62 MOLECULAR CHARACTERIZATION OF THE GFI1B-Q287* MUTATION

Figure S4

A Control

2

B GSK-LSD1

C

100 **

) ***

% *

( 10

s l l e c

+ 1 b 2 4 D

C 0.1

0.01 0 1 2 3 6 Time (days)

Figure S4. LSD1 is essenti al for proplatelet formati .on CD34+ cells were diff erenti ated towards megakaryocytes and treated with GSK-LSD1 for 6 days. On day 6 aft er additi on of GSK-LSD1 photos were taken of (A) DMSO and (B) GSK- LSD1 megakaryocyte cultures. (C) During GSK-LSD1 treatment the percentage of CD42b cell surface expression was monitored by fl ow cytometry (n=3, control , GSK-LSD1 ).

63 CHAPTER 2

Figure S5

A B

α-granules

N N N DMS N DMS

Figure S5. Granule formation in iPSC derived megakaryocytic cells. (A)Control iPSC derived megakaryocytic cells have characteristics of a mature megakaryocyte such as the demarcation membrane system (DMS) on the outside of the cell and an intermediary zone close to the nucleus rich of organelles including α-granules . (B) In the GFI1B-Q287* iPSC derived megakaryocytic cells the DMS is more pronounced and there are also some α-granules present. Some of the α-granules are indicated with black arrows. The scale bars represent 2 μm except for the zoomed in picture of (A), here it represents 500 nm.

64 MOLECULAR CHARACTERIZATION OF THE GFI1B-Q287* MUTATION

Figure S6

A

34 n o

i 32 s ) s e Q r F

p 30 L

x control 2 e

g Q287* n o i

l 28 GFI1B e ( t o r

P 26 2 24 MCM2 MCM3 MCM4 MCM5 MCM6 MCM7

B C

MX1 MEIS1 34 34 n n o o i i 32 32 s s ) s ) s e e Q Q r r F F p

p 30 30 L L

x

x 2 e 2 e

g g n n o i o i l l 28 28 e ( e ( t t o o r r P P 26 26 N.D. N.D. 24 24 Q287* control GFI1BQ287* control GFI1B

D

34

n MCM2 o i

s 33

) MCM3 s e Q r F p

L MCM4

x 32 2 e

g MCM5 n o i l e (

t 31

o MCM6 r P 30 MCM7

4 6 8 10 12 14 MK differentiation (day)

Figure S6. MCM complex proteins are elevated in GFI1B-Q287* iPSC derived megakaryocyti c cells.Relati ve protein levels (log2 LFQ values) of (A) the minichromosome maintenance (MCM) complex subunits 2-7, (B) MX1, and (C) MEIS1 in control and GFI1B-Q287* iPSC-derived megakaryocyti c cells. In case the protein was not detected in one or more of the samples, fewer than six points are shown. N.D. indicates the protein was not detected at all in a sample group. (D) Expression patt erns of the MCM proteins during the diff erenti ati on of cultured primary megakaryocytes.

65 CHAPTER 2

Figure S7

A

e 32 c n a ) d Q n

F 30 u L

b 2 a

g n o i ( l e 28 t o r P 26

PSMA1 PSMA2 PSMB1 PSMB2 PSMB3 PSMB6

B

32 e c n a ) d Q

n 28 F u L

b 2 a

g n o i ( l e 24 t o r P 20 RPS6 RPS9 RPS20 RPL7A RPL12 RPLP1

C

36 e c n a )

d 32 Q n F u L

b 2 a 28

g n o i ( l e t 24 o r P 20

ATP5A1 ATP5B ATP5C1 NDUFA4 NDUFA8 NDUFS1

Control GFI1B Q287*

Figure S7. GFI1B-Q287* platelets show elevated levels of proteasomal, ribosomal, and mitochondrial proteins.

Relati ve protein levels (log2 LFQ values) are shown for the indicated proteins of (A) proteasomal, (B) ribosomal, and (C) mitochondrial complexes in the platelets of control individuals and GFI1B-Q287* pati ents.

66 MOLECULAR CHARACTERIZATION OF THE GFI1B-Q287* MUTATION ession GO terms associated with associated terms GO cle xp r 2 ene e ene ati on; cell c y ed t ani z abolism; g g t a egul omosome o r wn r DNA replication DNA transcription processes; metabolic DNA expression gene of regulation transport; RNA ribosome function processing; RNA to ER targeting Ribosome; protein of macromolecules Biosynthesis Ribosome assembly; translation Ch r RNA splicingRNA acidNucleic m e erms d o erms MK GO- t 1 0.8 x

0.6

erlap inderlap e 0.4 O v 0.2 0 enesis th CM oagul ati on ammed cell ammed de a anes; E ati on; Cell morpho g og r osis t esponse ansport ani z g ed oc y t x ocesses; Cell ocesses; signaling on o r t anule; memb r anule; ounding; adhesion; c al p r el e t ane (ion) t r egul a o w os k esponse; e t ati on; cellular r ati on; signaling; p r t alpha g r elopme n el e t v ansmemb r esponse t r D e Cell acti v Immune r R Cell mig r T c y (Actin) Pl a erms up r MK GO- t 1 x 0.8

0.6

erlap ind e 0.4 O v 0.2 0 Figure S8 Figure A B the up-regulated proteins (A) and down-regulated proteins (B) during megakaryocyte diff erenti ati on are presented. For full list of GO terms and clustering see Supplementary Supplementary see clustering and terms GO of list full For presented. ati are on erenti diff megakaryocyte during (B) proteins down-regulated and (A) proteins up-regulated the 2. Table Figure S8. Full GO term enrichment analysis of the signifi cantly up-regulated and down-regulated proteins during megakaryocyte diff erenti ati on. erenti diff megakaryocyte during proteins down-regulated and up-regulated cantly signifi the of analysis enrichment term GO Full S8. Figure

67 CHAPTER 2

SUPPLEMENTARY REFERENCES

1. Dignam JD, Lebovitz RM, Roeder RG. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic acids research. 1983;11(5):1475-1489. 2. Smits AH, Jansen PW, Poser I, Hyman AA, Vermeulen M. Stoichiometry of chromatin-associated protein complexes revealed by label-free quantitative mass spectrometry-based proteomics. Nucleic acids research. 2013;41(1):e28. 3. Heideveld E, Masiello F, Marra M, et al. CD14+ cells from peripheral blood positively regulate hematopoietic stem and progenitor cell survival resulting in increased erythroid yield. Haematologica. 2015;100(11):1396- 1406. 4. Warlich E, Kuehle J, Cantz T, et al. Lentiviral vector design and imaging approaches to visualize the early stages of cellular reprogramming. Molecular therapy : the journal of the American Society of Gene Therapy. 2011;19(4):782-789. 5. Voelkel C, Galla M, Maetzig T, et al. Protein transduction from retroviral Gag precursors. Proceedings of the National Academy of Sciences of the United States of America. 2010;107(17):7805-7810. 6. Hansen M, Varga E, Wust T, et al. Generation and characterization of human iPSC line MML-6838-Cl2 from mobilized peripheral blood derived megakaryoblasts. Stem Cell Res. 2017;18(26-28. 7. Zeddies S, Jansen SB, di Summa F, et al. MEIS1 regulates early erythroid and megakaryocytic cell fate. Haematologica. 2014;99(10):1555-1564. 8. Migliaccio G, Sanchez M, Masiello F, et al. Humanized culture medium for clinical expansion of human erythroblasts. Cell Transplant. 2010;19(4):453-469. 9. Monteferrario D, Bolar NA, Marneth AE, et al. A dominant-negative GFI1B mutation in the gray platelet syndrome. N Engl J Med. 2014;370(3):245-253. 10. Rappsilber J, Ishihama Y, Mann M. Stop and go extraction tips for matrix-assisted laser desorption/ionization, nanoelectrospray, and LC/MS sample pretreatment in proteomics. Anal Chem. 2003;75(3):663-670. 11. Stokhuijzen E, Koornneef JM, Nota B, et al. Differences between Platelets Derived from Neonatal Cord Blood and Adult Peripheral Blood Assessed by Mass Spectrometry. J Proteome Res. 2017; 12. Vizcaino JA, Deutsch EW, Wang R, et al. ProteomeXchange provides globally coordinated proteomics data submission and dissemination. Nat Biotechnol. 2014;32(3):223-226. 13. Nota B. Gogadget: An R Package for Interpretation and Visualization of GO Enrichment Results. Mol Inform. 2017;36(5-6):

68 MOLECULAR CHARACTERIZATION OF THE GFI1B-Q287* MUTATION

2

69

3 Inherited missense variants that aff ect GFI1B functi on do not necessarily cause bleeding diatheses.

Rinske van Oorschot,1 Anna E. Marneth,1 Saskia M. Bergevoet,1 Maaike G.J.M. van Bergen,1 Kathelijne Peerlinck,2 Claire E. Lentaigne,3 Carolyn M. Millar,3,4 Sarah K. Westbury,5 Remi Favier,6 Wendy N. Erber,7 Ernest Turro,8-11 Joop H. Jansen,1 Willem H. Ouwehand,8-10, 12-14 Harriet L. McKinney,8-10 NIHR BioResource (collaborati ve group),10 Kate Downes,8-10 Kathleen Freson,2,10 and Bert A. van der Reijden1

1Department of Laboratory Medicine, Laboratory of Hematology, Radboudumc, Radboud Insti tute for Molecular Life Sciences (RIMLS), Nijmegen, The Netherlands 2Department of Cardiovascular Sciences, Center for Molecular and Vascular Biology, University of Leuven, Leuven, Belgium 3Centre for Haematology, Hammersmith Campus, Imperial College Academic Health Sciences Centre, Imperial College London, London, United Kingdom 4Imperial College Healthcare NHS Trust, London, United Kingdom 5School of Cellular and Molecular Medicine, University of Bristol, Bristol, United Kingdom 6Service d’Hematologie Biologique, Assistance-Publique Hôpitaux de Paris, Centre de Référence des Pathologies Plaquett aires, Hôpital Armand Trousseau, Paris, France. 7School of Biomedical Sciences, University of Western Australia, Crawley, Western Australia, Australia; PathWest Laboratory Medicine, Nedlands, Western Australia, Australia 8Department of Haematology, University of Cambridge, Cambridge Biomedical Campus, Cambridge, United Kingdom 9Nati onal Health Service Blood and Transplant (NHSBT), Cambridge Biomedical Campus, Cambridge United Kingdom 10NIHR BioResource, Cambridge University Hospitals, Cambridge Biomedical Campus, Cambridge, United Kingdom 11Medical Research Council Biostati sti cs Unit, University of Cambridge, Forvie Site, Cambridge Biomedical Campus, Cambridge, United Kingdom 12Department of Human Geneti cs, The Wellcome Trust Sanger Insti tute, Wellcome Trust Genome Campus, Hinxton, Cambridge, United Kingdom 13Strangeways Research Laboratory, The Nati onal Insti tute for Health Research (NIHR) Blood and Transplant Unit in Donor Health and Genomics at the University of Cambridge, University of Cambridge, Cambridge, United Kingdom 14BHF Centre of Excellence, Division of Cardiovascular Medicine, Addenbrooke’s Hospital, Cambridge Biomedical Campus, Cambridge, United Kingdom

R.O. and A.E.M. contributed equally to this work.

Haematologica. 2019 Jun;104(6):e260-e264 CHAPTER 3

72 CHARACTERIZATION OF GFI1B VARIANTS

LETTER TO THE EDITOR

Several types of GFI1B variants have been identi fi ed in pati ents with inherited bleeding and platelet disorders. This includes dominant-negati ve truncati ng variants aff ecti ng DNA 1-4 binding, missense variants of which the molecular mechanism is unclear,5-7 and variants changing the amount and rati o of GFI1B isoforms (Figure7, S1). 8 The severity of the bleeding disorder may diff er depending on the type of variant, but frequent abnormaliti es include macrothrombocytopenia, a reducti on in α-granule numbers, and platelet CD34 expression. In this study we performed a molecular and/or clinicopathological characterizati on of eight GFI1B variants in non-DNA binding domains (Figure S1). These variants were previously identi fi ed by the NIHR BioResource rare disease study in cases with an assumed inherited bleeding or platelet disorder.9 Molecular characterizati on was not performed for 3 D23N, since the minor allele frequency in the gnomAD database deemed too high for a causal variant. From the characterizati on of the other variants we can conclude that although some have a clear eff ect on GFI1B functi on, they are not necessarily suffi cient to cause bleedings on their own. Previously, we used the megakaryoblast cell line MEG-01 to study the eff ect of GFI1B and the proven pathogenic GFI1B-Q287* variant on cell expansion. In expansion-competi ti on cultures containing transduced and non-transduced cells, MEG-01 cells ectopically expressing GFI1B were overgrown by non-transduced cells, while the opposite was observed following expression of GFI1B-Q287* (Figure 1; manuscript resubmitt ed September 2018). Thus, forced GFI1B expression inhibits MEG-01 cell expansion whereas dominant-negati ve GFI1B-Q287* results in enhanced expansion. The latt er is in line with elevated megakaryocyte numbers observed in a bone marrow specimen of a GFI1B p.Q287* aff ected individual.1 To investi gate the (functi onal) eff ect of GFI1B variants, we retrovirally expressed them in MEG-01 cells and performed the expansion-competi ti on culture described above. GFI1B and GFI1B-Q287* were taken along as references. Two variants, one in the intermediate domain (G139S) and one in zinc fi nger (znf) 2 (G198S), did not aff ect the inhibitory functi on of wild type GFI1B on MEG- 01 proliferati on (Figure 1A, Figure 1B). The R190W variant, located between znf1 and znf2, rendered the protein less eff ecti ve at inhibiti ng MEG-01 proliferati on (Figure 1C), whilst both the znf1 variant C168F and the truncated variant Q89fs rendered the protein completely inacti ve (Figure 1D, Figure 1E). Interesti ngly, expression of znf1 H181Y and R184P variants resulted in increased MEG-01 cell proliferati on, although to a lesser extent than cells expressing GFI1B-Q287* (Figure 1F, Figure 1G). To further study H181Y and R184P, we introduced these variants separately in GFI1B-Q287*. This led to parti al inhibiti on of the growth sti mulati ng eff ect of GFI1B-Q287* (Figure 2A, Figure 2B), indicati ng that amino acids H181 and R184 are important for the eff ect of GFI1B-Q287* on MEG-01 proliferati on. These fi ndings clearly demonstrate that diff erent variants have qualitati vely disti nct eff ects onthe functi on of GFI1B, and that znf1 is important in regulati ng MEG-01 proliferati on.

73 CHAPTER 3

Figure 1

A B

! !

   

              ! 
! 




    " "            
$#  
$# C D

" !                  " 
! 


      #  "            !
%$  
$# E F

" "  

  

         $   

" 
 " 

 
 

   # #            !
%$  !
%$ G

!

         ! 



  "       
$#

Figure 1. GFI1B variants have different effects on GFI1B function. Expansion competition cultures of MEG-01 cells transduced with flag-tagged GFI1B variants (A) G139S (B) G198S (C) R190W (D) C168F (E) Q89fs (F) H181Y (G) R184P. GFI1B-Q287*-flag, GFI1B-p37-flag wild type (WT), and empty vector (EV) were taken along as controls. Fold change of GFP% to GFP% at day 5 (first GFP measurement) is presented on the y-axis. Results show mean ± standard error of the mean, and two-tailed paired t-tests were performed on day 26 to determine statistical significanceP * <0.05, **P <0.01. Of note, all MEG-01 transduced cells showed increased GFI1B mRNA expression indicating expression of the retroviral vector (Figure S2).

74 CHARACTERIZATION OF GFI1B VARIANTS

The increased MEG-01 expansion caused by GFI1B-H181Y and GFI1B-R184P suggests that these variants, like GFI1B-Q287*, act in a dominant-negati ve manner. However, the molecular mechanism might be diff erent, because these variants are not located in the DNA binding domain like GFI1B-Q287*. GFI1B is a repressive transcripti on factor that inhibits its own transcripti on and that of its paralogue GFI1.10, 11 GFI1B-Q287* has lost this repressive functi on.1 To study if the variants aff ect the repressive functi on of GFI1B, we performed gene reporter assays using the G fi 1 promoter. Remarkably, all tested GFI1B missense variants, including GFI1B-H181Y and GFI1B-R184P, repressed the G fi 1 promoter to a similar extent as wild type GFI1B (Figure 2C). However, results obtained in transient gene repression assays may not refl ect eff ects on endogenous target genes. We therefore analyzed the eff ects of GFI1B-H181Y and GFI1B-R184P on endogenous GFI1B expression. Wild type GFI1B, GFI1B-Q287*, GFI1B-H181Y, and GFI1B-R184P were expressed in MEG-01 cells, followed by endogenous GFI1B 3 mRNA expression analysis. In line with earlier reports, wild type GFI1B inhibited endogenous GFI1B expression.12 In contrast, GFI1B-Q287*, as well as GFI1B-H181Y and GFI1B-R184P did not repress endogenous GFI1B expression to the same extent as wild type GFI1B (Figure 2D). This indicates that not only the DNA binding znfs, but also amino acids H181 and R184 are required for effi cient repression of endogenous GFI1B. The LSD1-RCOR1-HDAC co-repressor complex is one of the main epigeneti c regulatory complexes recruited by GFI1B to induce transcripti onal repression. To study whether GFI1B-H181Y- and GFI1B- R184P-induced MEG-01 expansion depends on an interacti on with this complex, we co-introduced a P2A mutati on in the GFI1B-H181Y or GFI1B-R184P variants. The P2A mutati on in the N-terminal SNAG domain of GFI1B abrogates its interacti on with LSD1,13 and nullifi es the inhibitory eff ect of wild type GFI1B and sti mulatory eff ect of GFI1B-Q287* on MEG-01 proliferati on (manuscript resubmitt ed September 2018). Expression of the P2A-H181Y and P2A-R184P double mutants resulted in expansion rates similar to empty vector transduced cells (Figure 2E). This strongly suggests that H181Y and R184P variants require the LSD1 interacti on to exert their eff ect on MEG-01 expansion.

75 CHAPTER 3 Figure 2

A B

! !  

      

         



! 
! 




    " "            
$#  
$#

C D

&) 

(!   &! # 
 % $ ! '

"  ( &! "

  %                # #

α-flag

α-GAPDH

E



  

  

  



  !       
#"

Figure 2. Functional effect of GFI1B variants H181Y and R184P. (A-B) Expansion competition cultures of MEG- 01 cells transduced with flag-tagged GFI1B-H181Y+Q287* (A), or GFI1B-R184P-Q287* (B). Empty vector (EV) and GFI1B-Q287*-flag transduced cells taken along as reference. (C) Dual luciferase reporter assays in HEK293FT cells transfected with Renilla luciferase construct, Gfi1 promoter Firefly luciferase construct, and empty vector (EV), wild type GFI1B-p37-flag (WT-p37), wild type GFI1B-p32-flag (WT-p32, lacking coding exon 4 and therefore amino acids 171-216 corresponding to zinc finger 1 and 2), or GFI1B-flag variants. Firefly/Renilla luciferase ratios are normalized to EV transfected cells. Results show mean ± standard deviation, and two-tailed paired t-tests were performed to determine statistical significance between WT-p37 and the other conditions. Corresponding Western blots showing expression of the flag-tagged GFI1B proteins and the GAPDH loading control are depicted below the graph. (D) 5’UTR GFI1B expression in GFP positive cells from MEG-01 expansion competition cultures, FACS-sorted 23 days after transduction.GFI1B expression is normalized to GAPDH expression. Results show mean ± standard deviation, and >>

76 CHARACTERIZATION OF GFI1B VARIANTS

two-tailed paired t-tests were performed to determine stati sti cal signifi cance. (E) Expansion competi ti on cultures of MEG-01 cells transduced with fl ag-tagged GFI1B-H181Y+P2A, or GFI1B-R184P-P2A. EV transduced cells taken along as reference. *P<0.05, **P <0.01, ***P <0.001

The functi onal data were subsequently correlated with clinical and laboratory features of pati ent samples to improve classifi cati on of the GFI1B variants according to ACMG guidelines14 (Table S1). A minimal set of geneti c, clinical and laboratory features have already been published in Chen et al., supplementary table ST15.9 For this study, we expanded clinical and laboratory phenotype studies for the H181Y and R184P variants, because these GFI1B variants had similar functi onal eff ects in the MEG- 01 cell models as the proven pathogenic GFI1B-Q287* variant. In additi on, we performed clinical and 3 laboratory phenotype studies for R190W variant carriers. The variants G139S and G198S were classifi ed as ‘Benign’ as they showed similar inhibiti on of MEG-01 expansion as wild type GFI1B, and have a relati vely high minor allele frequency in gnomAD. Further, the thrombocytopenia in pati ent P9 with G198S was explained by a pathogenic ACTN1 variant (p.R46Q)15. Variants R190W, C168F and Q89fs did not inhibit MEG-01 expansion to the same extent as wild type GFI1B (loss of functi on eff ect). R190W platelets were weakly CD34-positi ve, but R190W in pati ents P8.1 and P8.2 did not co-segregate with bleeding or result in abnormal α-granules (Table S1; Figures S3-5). Moreover, pati ent P7 with the same R190W variant was explained bya pathogenic variant in WAS (p.R364*), resulti ng in a ‘Benign’ classifi cati on for R190W. Pati ent P4 with a homozygous C168F variant suff ered from clinical bleeding symptoms with thrombocytopenia and platelet aggregati on dysfuncti on. Unlike P4, heterozygous C168F pati ents studied by Rabbolini and colleagues only displayed macrothrombocytopenia with platelet CD34 expression (parti al eff ect on the phenotype).7 C168F is predicted to disrupt znf1 structure and thereby GFI1B functi on.9 This was confi rmed in functi onal experiments performed here (Figure 1D) and by Rabbolini et al. showing that C168F disrupts the repressive functi on of GFI1B gene expression.7 C168F was classifi ed as a ‘variant of unknown signifi cance’ (VUS); further studies in the aff ected pati ent or of family members was not possible. A 90-year old woman (deceased) carrying the Q89fs variant and without aff ected siblings had mild thrombocytopenia with bleeding, platelet dysfuncti on and signifi cantly reduced α-granule numbers; a phenotype very similar to previously described GFI1B pathogenic variants (Table S1; Figure S5).1, 2, 4 The Q89fs variant does not repress the Gfi 1 promoter to the same degree as wild type GFI1B and the missense variants. However, it must be noted that we could only detect the truncated protein aft er proteasome inhibiti on, suggesti ng it is instable (Figure S6). If this is also the case in pati ent cells, the Q89fs variant would lead to haploinsuffi ciency. This variant was classifi ed as VUS. The R184P and H181Y variants sti mulated MEG-01 proliferati on and failed to repress endogenous GFI1B expression in a similar way as the pathogenic Q287* variant. These missense variants were absent from the gnomAD database and co-segregati on studies were performed (Figure 3). Both the propositus (P6.1) and her father (P6.2), who are carriers of R184P, showed a small number of hypogranular platelets and platelet CD34 expression (Table S1; Figures S3-4). P6.1 had a normal platelet count

77 CHAPTER 3

whereas her father (P6.2) had mild thrombocytopenia. Importantly, neither parent had clinical bleeding symptoms or platelet dysfunction (Table S1; Figure 3A). Following ACMG criteria, the R184P variant was classified as VUS. For the propositus (P5.1) with the H181Y variant, three affected relatives (P5.2, P5.4-5) and one non-affected (P5.3) relative were screened and the variant co-segregated with clinical bleeding symptoms, platelet dysfunction and CD34-positive platelets (Table S1; Figure S3; Figure 3B). Affected individuals P5.1 and P5.2 had normal platelet counts with few large platelets and a significant reduction of α-granules (Table S1; Figures S4-5). The functional and segregation data suggest that the H181Y variant is causal of bleeding and platelet dysfunction but does not result in thrombocytopenia. Following ACMG guidelines, H181Y was classified as a VUS (Table S1). Figure 3

A

P6.1 P6.2 WT R184P PLT 242 PLT 124 CD34 absent CD34 high BAT 0

P6.3 P6.4 R184P WT PLT 196 PLT 200 CD34 high CD34 absent BAT 7

B

P5.1 P5.2 P5.3 P5.4 H181Y H181Y WT H181Y PLT 184 PLT 152 PLT 237 PLT 178 CD34 high CD34 high CD34 ND CD34 high BAT 10 BAT 11 BAT -1 BAT 4

P5.5 H181Y PLT 257 CD34 ND BAT 8 Figure 3. Pedigrees for families harboring GFI1B variants H181Y (A) and R184P (B). The propositus (arrow) and the family members with signs of pathological bleeding are indicated with a black filled symbol. GFI1B variant status, patient identifier, platelet count (PLT), platelet CD34 expression, and the ISTH bleeding assessment tool (BAT) score are indicated for each patient. Normal range for the ISTH BAT score is <4 in adult males, <6 in adult females and <3 in children. P5.4 has less haemostatic challenges than the other siblings. ND= not determined. Additional clinical and laboratory data obtained in patient samples can be found in Table S1.

78 CHARACTERIZATION OF GFI1B VARIANTS

We conclude Q89fs, C168F, H181Y, and R184P aff ect GFI1B functi on, but are not necessarily suffi cient to cause bleedings on their own. Sti ll, their identi fi cati on and documentati on, even when classifi ed as VUS, will help to disti nguish pathological from non-pathologicalGFI1B variants and increase our understanding of GFI1B functi onal domains. The identi fi cati on of additi onal pati ents with similar variants will be essenti al to clarify their exact role for platelet phenotypes and bleeding.

Acknowledgements This work was supported by grants from the Radboudumc (R.O.), the Landsteiner Foundati on for Blood Transfusion Research (project 1531) (M.G.J.M.B.), and the Nati onal Insti tute for Health Research (NIHR, grant number RG65966). A.E.M. is supported by EMBO long-term fellowship grant ATLF 268-2017. K.D. is a HSST trainee supported by Health Educati on England. K.F. and K.P. are holders of the SOBI 3 chair and are supported by the Research Council of the University of Leuven (BOF KU Leuven‚ Belgium, OT/14/098). C.M.M. is supported by the NIHR Imperial College Biomedical Research Centre.

Authorship contributi ons R.O., A.E.M., S.M.B., and M.G.J.M.B performed in vitro experiments; K.F., W.N.E., H.M. and K.D. performed EM, blood smears and CD34 expression measurements; Pati ents were followed by K.P., C.L., C.M.M., S.K.W., R.F., and W.H.O.; E.T. and W.H.O. analyzed and coordinated the geneti c studies; R.O., A.E.M., and K.F. analyzed results and made the fi gures; R.O., A.E.M., B.A.R., J.H.J., and K.F. designed the research and wrote the paper; All authors have read and agreed to the contents of the paper.

Confl ict-of-interest disclosure The authors declare no competi ng fi nancial interests.

Corresponding author Bert A. van der Reijden, Geert Grooteplein zuid 8, 6525 GA Nijmegen, The Netherlands. Bert. [email protected]

79 CHAPTER 3

REFERENCES

1. Monteferrario D, Bolar NA, Marneth AE, et al. A dominant-negative GFI1B mutation in the gray platelet syndrome. N Engl J Med. 2014;370(3):245-253. 2. Stevenson WS, Morel-Kopp MC, Chen Q, et al. GFI1B mutation causes a bleeding disorder with abnormal platelet function. J Thromb Haemost. 2013;11(11):2039-2047. 3. Marneth AE, van Heerde WL, Hebeda KM, et al. Platelet CD34 expression and alpha/delta-granule abnormalities in GFI1B- and RUNX1-related familial bleeding disorders. Blood. 2017;129(12):1733-1736. 4. Kitamura K, Okuno Y, Yoshida K, et al. Functional characterization of a novel GFI1B mutation causing congenital macrothrombocytopenia. J Thromb Haemost. 2016;14(7):1462-1469. 5. Uchiyama Y, Ogawa Y, Kunishima S, et al. A novel GFI1B mutation at the first zinc finger domain causes congenital macrothrombocytopenia. Br J Haematol. 2017; 6. Ferreira CR, Chen D, Abraham SM, et al. Combined alpha-delta platelet storage pool deficiency is associated with mutations in GFI1B. Mol Genet Metab. 2017;120(3):288-294. 7. Rabbolini DJ, Morel-Kopp MC, Chen Q, et al. Thrombocytopenia and CD34 expression is decoupled from alpha- granule deficiency with mutation of the first growth factor-independent 1B zinc finger.J Thromb Haemost. 2017;15(11):2245-2258. 8. Schulze H, Schlagenhauf A, Manukjan G, et al. Recessive grey platelet-like syndrome with unaffected erythropoiesis in the absence of the Splice Isoform GFI1B-p37. Haematologica. 2017;102(9):102(109):e375-e378. 9. Chen L, Kostadima M, Martens JH, et al. Transcriptional diversity during lineage commitment of human blood progenitors. Science. 2014;345(6204):1251033. 10. Anguita E, Villegas A, Iborra F, Hernandez A. GFI1B controls its own expression binding to multiple sites. Haematologica. 2010;95(1):36-46. 11. Vassen L, Fiolka K, Mahlmann S, Moroy T. Direct transcriptional repression of the genes encoding the zinc- finger proteins Gfi1b and Gfi1 by Gfi1b. Nucleic acids research. 2005;33(3):987-998. 12. Huang DY, Kuo YY, Chang ZF. GATA-1 mediates auto-regulation of Gfi-1B transcription in K562 cells. Nucleic acids research. 2005;33(16):5331-5342. 13. Saleque S, Kim J, Rooke HM, Orkin SH. Epigenetic regulation of hematopoietic differentiation by Gfi-1 and Gfi- 1b is mediated by the cofactors CoREST and LSD1. Molecular cell. 2007;27(4):562-572. 14. Richards S, Aziz N, Bale S, et al. Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet Med. 2015;17(5):405-424. 15. Westbury SK, Turro E, Greene D, et al. Human phenotype ontology annotation and cluster analysis to unravel genetic defects in 707 cases with unexplained bleeding and platelet disorders. Genome Med. 2015;7(1):36.

80 CHARACTERIZATION OF GFI1B VARIANTS

SUPPLEMENTARY METHODS

Pati ent recruitment and ethics The NIHR BioResource (NBR) – Rare Disease Study is a multi -centre whole-exome and whole-genome sequencing study including approximately 10,000 pati ents. The NBR–Rare Diseases study was approved by the East of England Cambridge South nati onal research ethics committ ee (REC) under reference number: 13/EE/0325. The inclusion and exclusion criteria were as described before.1 In short, the inclusion criteria for enrolment are: (i) positi ve history of bleeding, (ii) abnormal platelets (abnormal count, volume, aggregati on, morphology). In additi on, pati ents were only included when their disease was highly likely of geneti c eti ology (e.g. early onset, informati ve pedigrees, absence of acquired cause). Variant classifi cati on was performed according to the ACMG criteria19 and using SapientaTM soft ware 3 (Congenica).

Clinical evaluati on and laboratory tests The clinical and laboratory phenotypes including electron microscopy and CD34 expression were determined as previously described.1, 2 Pati ents from the pedigrees with the H181Y, R184P, and R190W variants were recalled for this study.

Expansion of GFI1B variant transduced MEG-01 cells MEG-01 cells were maintained in RPMI 1640 (GIBCO) supplemented with 10% heat inacti vated FCS and retrovirally transduced with pMIGR1-GFI1B variant-fl ag-IRES-GFP constructs. The GFP% was measured on the Coulter FC500 fl ow cytometer (Beckman Coulter) for 26 days with 2-3 day intervals. GFP percentages were normalized to the FACS measurement of day 5 using the following formula: (GFP% day X/(100 - GFP% day X))/(GFP% day 5/(100 - GFP% day 5)). On day 23, GFP+ cells were sorted using the BD FACSAria (BD Bioscience) to determine total and endogenous GFI1B expression using quanti tati ve RT-PCR. GFI1B exon 1-2 primers and probe are as follows: forward 5’-CCCGTGTGCAGGAAGATGA, reverse 5’-CAGGCACTGGTTTGGGAATAGA, probe 5’-FAM-TTACCCCGGTGCCCAGA-MGB. 5’UTR GFI1B expression was determined using the TaqMan gene expression assay Hs01062474_m1. GAPDH expression was determined using Human GAPDH mix Hs99999905_m1 (FAMTM Dye/MGB Probe) (Applied biosystems).

GFI1B variant reporter assays To determine GFI1B transcripti onal acti vity, we performed Dual-Luciferase Reporter Assays (Promega) in 293FT cells. 293FT cells were maintained in DMEM (GIBCO) supplemented with 10% non-heat inacti vated fetal calf serum (FCS), 1% glutamine, 1% non-essenti al amino acids, 1% pyruvate, and 1% penicillin/streptomycin (MP Biomedical). 293FT cells were transfected using Lipofectamine 2000 (Invitrogen). A total of 2μg DNA was used for transfecti on consisti ng of 0.5μg pcDNA3.1 fl ag-tagged wild type or variant GFI1B, 0.5μg pcDNA3.1-empty vector, 0.8μg pGL3-basic Firefl y Luciferase vector harboring the Gfi 1 promoter, and 0.2μg pGL3-basic Renilla Luciferase vector. Forty-eight hours aft er transfecti on, cells were washed with PBS and lysed in 100μl of passive lysis buff er (Dual-Luciferase

81 CHAPTER 3

Reporter Assay System, Promega) for 1 hour. Luciferase signal from 1.5μl lysate was detected using 10μl LAR II and 10μl Stop&Glo (Dual-Luciferase Reporter Assay System, Promega) on the Fluostar Optima (BMG LABTECH). Experiments were performed at least three times, in duplicate. Firefly Luciferase activity was normalized to Renilla activity and each condition was normalized to empty vector.

Statistics Two-tailed paired t-tests or one-way Anova testing was performed with Graphpad Prism version 5.03 to determine statistically significant differences.

GFI1B-Q89fs-flag expression after MG132 treatment 293FT cells were transfected in duplo with 20μg pcDNA3.1 (empty vector), pcDNA3.1-GFI1B-Q89fs-flag, or pcDNA3.1-GFI1B-Q287*-flag using calcium phosphate. Sixteen hours after transfection, the medium was refreshed, and 24 hours after transfection 5μM MG132 or 1μl DMSO was added to the cells. After 16 hours of MG132 proteasome inhibitor treatment cells were lysed in passive lysis buffer (Promega) and loaded on a SDS-PAGE gel. The proteins were transferred to a PVDF membrane which was stained with mouse α-flag (SIGMA-ALDRICH, Merck) and mouse α-GAPDH (Abcam) followed by probing with goat α-mouse HRP-conjugated secondary antibody (Santa Cruz Biotechnology). Luminescence signal was visualized using a ChemiDox XRSþ (Bio-Rad).

82 CHARACTERIZATION OF GFI1B VARIANTS PM2, PS3-P, PP3, PM2, PS3-P, PP1: VUS PP5: VUS + parti al PP5: VUS + parti to on contributi the phenotype (previously reported to as linked thrombocytopenia but not bleeding) BS1, BS3: Benign PM2, PM4: VUS BS1: Benign Classifi cati on of cati Classifi GFI1B variant using ACMG (6) criteria No WGS data No WGS No No No No Other in a variant BPD known gene Abnormal ADP, for Epinephrine n. & ristoceti de Nucleoti low assay: ADP and abnormal ATP:ADP r a ti o . Abnormal ADP and for Epinephrine. ND Abnormal ADP, for Collagen, Aracidonic acid and n. Ristoceti Abnormal for Epinephrine only. Platelet Platelet on aggregati and other onal functi assays 4.5 ± 2.88** ND ND 7.2 ± 3.93* ND Electron Electron Microscopy: Number of α-granules (normal 15.7 range: ± 7.45)

3 5.67 ± 2.27 ND ND 7.98 ± 3.37 ND Electron Electron (4): Microscopy area platelet (μm2) (normal 6.2 ± range: 2.15) Mild thrombocytopenia Mild thrombocytopenia with platelet large Few anisocytosis. (agranular) “grey” and others platelets The hypogranular. are however majority are and normal in size on. granulati ND ND ND ND Blinded blood smear (3) analysis Yes ND ND ND ND CD34 expression (2) FACS by 11.5 ND 9.7 11.5 ND Mean Platelet (fL) Volum (normal range: 8-12) 152 100 81 119 408 Platelets Platelets (109/L) (normal range: 150-450) Yes Yes BAT ISTH 10 score: Yes Yes Yes Yes Bleeding Absent 1 2 2 - 1 /(Asian: 121 - 2 4 3 9 0 4 1/30762) 29 - 0/277110 Absent 401 - 5/274546 GnomAD (heterozyous- homozygous/ alleles) total H181Y C168F homozygous G139S Q89fs D23N GFI1B variant P5.1 (female) P4 (female) P3 female) P2 (female) P1 (female) Pati ent identi fi er identi ent Pati (1) Gender sibling B200597 (Asian) B200721 B200217 B200037 BRIDGE fi er identi RFH000098F TRS13 ipd85 RFH000073X Identi fi er used Identi clinician by SUPPLEMENTARY TABLE SUPPLEMENTARY Table S1. Clinical characteristi cs GFI1B variants cs GFI1B characteristi S1. Clinical Table 83 CHAPTER 3 BS1: Benign BS1, BP5: Benign PM2, PS3-P, PP3: PM2, PS3-P, VUS No No Confirmed Confirmed defect: WAS p.Arg364Ter No WGS data No WGS No WGS data No WGS No WGS data No WGS No ND Normal Normal ND Normal ND Abnormal ADP, for Epinephrine, Aracidonic acid (low dose) & Collagen. Decreased release ATP in response ADP. to ND Not done but PFA prolonged in both cartridges. Abnormal ADP, for Collagen, Aracidonic acid and Ristocetin. 11.2 ± 6.68 ND ND ND ND ND ND ND ND 5.3 ±3.30*** 7.11 ± 4.01 ND (sample issue) ND ND ND ND ND ND ND 5.75 ± 1.59 Normal count, large large Normal count, platelets. Mild platelet Mild platelet with some anisocytosis and a hypogranular agranular large few platelets. Normal ND Normal Mild thrombocytopenia with platelet Some anisocytosis. hypogranular large agranular and a few platelets. ND ND Thrombocytopenia hypogranular with large platelets. Mild platelet Mild platelet and anisocytosis granulation. variable Yes - weak Yes Yes Normal ND Normal Yes ND ND Yes Yes 12.9 10.2 11.1 8.3 9.1 12.6 10.8 10.4 12.4 12.7 167 196 200 44 242 124 257 237 178 184 No Yes Yes BAT ISTH 7 score: No Yes No No BAT ISTH 0 score: Yes Yes BAT ISTH 8 score: No BAT ISTH -1 score: Yes BAT ISTH 4 score: Yes Yes BAT ISTH 11 score: 33 - 0/246058 33 - 0/246058 Absent Absent R190W R184P Normal R190W Normal R184P H181Y Normal H181Y H181Y P8.1 (female) P6.3 (female) P6.4 (female) P7 (male) P6.1 (female) P6.2 (male) P5.5 (female) P5.3 (male) P5.4 (female) P5.2 (male) B200077 B200600 sibling B200239 mother father niece sibling sibling B200645 ADD000021H BRI000015D IPD11 5H10000348

84 CHARACTERIZATION OF GFI1B VARIANTS BS1, BS3, BP5: Benign No rmed Confi ACTN1 defect: p.R46Q (5) ND Abnormal ADP. for 10.2 ± 5.05 ND

3 7.43 ± 2.50 ND Macrothrombocytopenia ND Yes - weak Yes ND 12.1 12 103 52 Yes No 40 - 1/276984 G198S R190W P9 (female) P8.2 (male) B200735 relati ve relati TRS28 Values outside the normal range for number of platelets, mean platelet volume, platelet area and number of α-granules are underlined. are and number of α-granules area platelet volume, mean platelet number of platelets, for outside the normal range Values *p=0.0069, **p=0.0002 and ***p=0.0005 number of α-granules test Anova One way 4 in Figure of P5 and P6 shown (1) Pedigrees S3 in Figure shown CD34 expression for cytometry 2) Flow S4 in Figure of blood smears ve images (3) Representati S5 in Figure microscopy of electron ve images (4) Representati al, Genome Medicine 2015, et Westbury 5) ACTN1 variant: Med 2015, 17(5), 405-24 al, Genet S et Richards criteria: 6) ACMG cance Signifi of Unknown VUS= Variant ND= not determined; and <3 in children. is <4 in adult males, <6 females score BAT the ISTH is for Normal range tool, bleeding assesment ISTH BAT= ISTH for benign evidence strong expected, on higher then populati in control BS1: allele frequency evidence benign strong studies, onal BS3: functi for benign evidence ng on, supporti locus observati BP5: alternate for pathogenic evidence on, moderate populati in control frequency or low PM2: absent pathogenic for evidence stop losses, moderate ons and ons/inserti deleti in-frame due to changes length PM4: protein pathogenic for ng evidence supporti aff family members, ected ple on with disease in multi PP1: cosegregati pathogenic for evidence ng supporti data, onal (in silico) PP3: computati for pathogenic evidence ng supporti source, PP5: reputable evidence pathogenic strong studies, onal PS3-P: functi

85 CHAPTER 3 Figure S1

SUPPLEMENTARY FIGURES C165F S185fs K265* G272fs Q287* H294fs L308P

c.648+1_648+8delGTGGGCAC

SNAG znf1 znf2 znf3 znf4 znf5 znf6

DNA binding

D23N Q89fs G139S C168F H181Y R184P R190W G198S

Figure S1. Overview of reported GFI1B variants. Schematic overview of GFI1B protein structure with variants identified in inherited bleeding and platelet disorders. The variants displayed below are analyzed in thisstudy (C168F also identified in another study1). The upper variants have been published and studied before: C165F,4 S185fs (homozygous, GFI1B-p37 transcript is mostly degraded and the short GFI1B-p32 isoform, lacking intact zinc finger (znf) 1 and 2, is unaffected),5 c.648+1_648+8delGTGGGCAC7 (NM_004188.6; splice variant resulting in coding exon 4 skipping and expression of GFI1B-p32),3 K265*,6 G272fs,7 Q287*,8 H294fs,9 and L308P.6 GFI1B contains an N-terminal SNAG domain and six FigureC-terminal S2 znfs, of which znf 3-5 are involved in DNA binding. &%  ))"

'( *




 

#"+  

($  ) &    !                        

Figure S2. Expression of GFI1B in MEG-01 expansion cultures. GFI1B expression in FACS-sorted GFP positive MEG-01 cells transduced with empty vector (EV) or GFI1B variant-flag at day 23 following transduction. These data correspond to the cultures in Figures 1 and 2. GFI1B expression is normalized to GAPDH and endogenous GFI1B expression in the empty vector (EV) condition. Error bars represent mean ± standard deviation of at least three experiments.

86 Figure S3 CHARACTERIZATION OF GFI1B VARIANTS

<0.0001

0.0087 <0.0001 <0.0001

P5.1 P5.2

P5.4

P6.3 0.0009 P6.3 P8.1 P6.2 3 P8.2 P6.1 P6.4

L1 L2

Figure S3. CD34 expression on platelets. Flow cytometry of CD34 expression on pati ents’ platelets carrying GFI1B H181Y, R184P, or R190W variants. Measurements were performed in two laboratories (L1 and L2) using 169 (L1) and three (L2) unrelated healthy individuals as controls (see Table 1). Subjects P6.1 and P6.4 are wild type for GFI1B (R184R) and do not have bleeding symptoms or platelet defects. Error bars represent mean ± standard deviati on. P values were determined by one-way ANOVA (Tukey’s multi ple comparisons test).

87 CHAPTER 3

Figure S4

Control

H181Y (P5.1) H181Y (P5.2) H181Y (P5.4)

WT (P6.1) R184P (P6.2) R184P (P6.3)

R190W (P8.1) R190W (P8.2)

Figure S4. May-Grünwald-Giemsa stained peripheral blood smears of control and patients with the H181Y, R184P, or R190W variant. Overall analysis of the blood smears is presented in Table 1. Representative photos are depicted. Several macrothrombocytes and/or hypogranular platelets are indicated by arrows. Photo P6.3 is a 100x magnification. The remaining photos are a 40x magnification.

88 Figure S5 CHARACTERIZATION OF GFI1B VARIANTS

Control Q89fs (P2)

H181Y (P5.1) H181Y (P5.2) 3

R190W (P8.1) R190W (P8.2)

Figure S5. Platelet electron microscopy for control and pati ents with Q89fs, H181Y, and R190W variants.Platelet area and α- granule number was quanti fi ed and reported in Table 1. Representati ve photos are depicted. α-granule numbers were reduced in P2 (Q89fs), P5.1 (H181Y) and P5.2 (H181Y). Platelet area was in the normal range for all presented cases.

89 CHAPTER 3 Figure S6

DMSO MG132 NT EV Q287* Q89fs NT EV Q287* Q89fs

α-flag ~ 32 kD

~ 17 kD

α-GAPDH

Figure S6. GFI1B Q89fs is only detected after proteasome inhibition treatment. Protein expression of transfected GFI1B-Q287*-flag (~32kD) and GFI1B-Q89fs-flag (~17kD) in HEK293FT cells 24 hour after treatment with5μM MG132 or DMSO (solvent control). PVDF membrane was stained with α-flag and α-GAPDH antibodies.

90 CHARACTERIZATION OF GFI1B VARIANTS

SUPPLEMENTARY REFERENCES

1. Chen L, Kostadima M, Martens JH, et al. Transcripti onal diversity during lineage commitment of human blood progenitors. Science. 2014;345(6204):1251033. 2. Di Michele M, Thys C, Waelkens E, et al. An integrated proteomics and genomics analysis to unravel a heterogeneous platelet secreti on defect. J Proteomics. 2011;74(6):902-913. 3. Rabbolini DJ, Morel-Kopp MC, Chen Q, et al. Thrombocytopenia and CD34 expression is decoupled from alpha- granule defi ciency with mutati on of the fi rst growth factor-independent 1B zinc fi nger.J Thromb Haemost. 2017;15(11):2245-2258. 4. Uchiyama Y, Ogawa Y, Kunishima S, et al. A novel GFI1B mutati on at the fi rst zinc fi nger domain causes congenital macrothrombocytopenia. Briti sh journal of haematology. 2017; 3 5. Schulze H, Schlagenhauf A, Manukjan G, et al. Recessive grey platelet-like syndrome with unaff ected erythropoiesis in the absence of the Splice Isoform GFI1B-p37. Haematologica. 2017;102(9):102(109):e375-e378. 6. Ferreira CR, Chen D, Abraham SM, et al. Combined alpha-delta platelet storage pool defi ciency is associated with mutati ons in GFI1B. Molecular geneti cs and metabolism. 2017;120(3):288-294. 7. Kitamura K, Okuno Y, Yoshida K, et al. Functi onal characterizati on of a novel GFI1B mutati on causing congenital macrothrombocytopenia. J Thromb Haemost. 2016;14(7):1462-1469. 8. Monteferrario D, Bolar NA, Marneth AE, et al. A dominant-negati ve GFI1B mutati on in the gray platelet syndrome. The New England journal of medicine. 2014;370(3):245-253. 9. Stevenson WS, Morel-Kopp MC, Chen Q, et al. GFI1B mutati on causes a bleeding disorder with abnormal platelet functi on. J Thromb Haemost. 2013;11(11):2039-2047.

91

4 Functi onal characterizati on of the clonal hematopoiesis and myeloproliferati ve neoplasm associated polymorphism rs621940 located downstream of GFI1B.

Rinske van Oorschot,1 Saskia M. Bergevoet,1 Aniek O. de Graaf,1 Evelyn L. R. T. M. Tönnissen,1 Kornelia Neveling,2 Pascal W.T.C. Jansen,3 Marijke P.A. Balti ssen,3 Michiel Vermeulen,3 Amit Mandoli,3 Joost H.A. Martens,3 Joop H. Jansen,1 and Bert A. van der Reijden1

1 Department of Laboratory Medicine, Laboratory of Hematology, Radboud Insti tute for Molecular Life Sciences, Radboudumc, Nijmegen, 6525GA, The Netherlands 2 Department Human Geneti cs, Radboudumc, Nijmegen, 6525GA, The Netherlands 3 Department of Molecular Biology, Radboud Insti tute for Molecular Life Sciences, Nijmegen, 6525GA, The Netherlands

To be submitt ed- CHAPTER 4

ABSTRACT

Transcription factor GFI1B suppresses its own gene expression, and deregulated GFI1B expression contributes to myeloid neoplasms. The DNA polymorphism rs621940 located 8 kb downstream of GFI1B predisposes for clonal hematopoiesis and myeloproliferative neoplasms. Whether rs621940 affects GFI1B expression is unknown. We observed clear GFI1B binding around the rs621940 locus in megakaryoblast MEG-01 cells using ChIP-seq. Pull-downs using DNA-sequences with either rs621940- allele followed by protein identification using mass spectrometry detected 24 differentially bound proteins in MEG-01 cells, but GFI1B was not among these. Also, GFI1B auto-repression was not different between either rs621940-allele in transient gene reporter assays. Deletion of an 1.6 kb fragment encompassing rs621940 in K562 cells did not alter GFI1B expression nor GFI1B auto-repression. In primary peripheral blood mononuclear cells from healthy donors, absolute GFI1B expression did not differ consistently between the rs621940 alleles. Finally, GFI1B haplotyping using long range DNA sequencing detected 3’ non-coding polymorphisms on the same chromosome as the rs621940 polymorphism. Yet, targeted deep RNA sequencing did not detect consistent effects of rs621940 on allelic GFI1B expression. These studies find no evidence that rs621940 affects GFI1B expression nor GFI1B auto-repression.

94 FUNCTIONAL CHARACTERIZATION OF RS621940

INTRODUCTION

Genome wide associati on studies (GWAS) have identi fi ed numerous common single nucleoti de polymorphisms (SNPs) associated with human diseases, including cancer. These SNPs are located in genes, promoters, and undefi ned geneti c regions. Several studies have shown that the latter can modulate gene transcripti on through long range cis eff1 ects. Recently a GWAS was conducted that identi fi ed eight predisposing alleles for JAK2 + V617F clonal hematopoiesis and Philadelphia chromosome-negati ve myeloproliferati ve neoplasms (MPN). One of these SNPs was located inan undefi ned region ~8 kb downstream of the startcodon of GFI1B.2 It is unclear whether this SNP aff ects GFI1B gene expression. The transcripti on factor Growth Factor Independence-1B (GFI1B) regulates dormancy and proliferati on of hematopoieti c stem cells (HSCs),3 and sti mulates the development of erythroid and megakaryocyti c cells,4-7 as well as B and T cells.8-10 Inherited GFI1B variants result in a bleeding diathesis with quanti tati ve and qualitati ve platelet defects. In additi on, bone marrow from individuals with the inherited dominant-negati ve GFI1B-Q287* variant showed increased megakaryocyte expansion.11 4 Furthermore, GFI1B is found upregulated in peripheral blood cells from pati ents with both leukemia and MPN,12 and leukemic cell lines.13 GFI1B silencing in these cell lines resulted in decreased proliferati on and increased apoptosis.13 In contrast, reduced levels or absence of GFI1B negati vely infl uences the prognosis of myelodysplasti c syndrome (MDS) and acute myeloid leukemia (AML) pati ents. Furthermore, in diff erent human AML mouse models loss or reduced expression of Gfi 1b promotes AML development and leads to a higher number of leukemic stem cells.14 This is in line with a somati c dominant-negati ve GFI1B mutant found to contribute to AML development,15 and conditi onal Gfi 1b knockout mice showing increased proliferati on of HSCs.3 Summarizing, GFI1B expression needs to be ti ghtly controlled as both too much and too litt le expression is associated with hematological disorders. GFI1B is a transcripti onal repressor that regulates its own gene expression via the N-terminal SNAG domain. This domain recruits epigeneti c modifi ers such as LSD1, RCOR1, HDAC1/2 and G9a to induce deacetylati on of H3K9, demethylati on of H3K4, and/or methylati on of H3K916, 17 (van Oorschot et al in press). Furthermore, multi ple other transcripti on factors bind tothe GFI1B promoter, such as GATA1, Oct1, NF-Y, and HGMB2.5, 18, 19 In additi on, Anguita et al. have identi fi ed three multi species conserved non-coding elements around 12.5 kb, 16 kb and 17.5 kb downstream of the human GFI1B start codon (corresponding to 13 kb, 16 kb and 17 kb in mice). Chromati n immunoprecipitati on (ChIP)- PCR studies in human (K562) and murine (MEL, L8057, HPC7) cell lines demonstrated that positi ve regulators of GFI1B expression including GATA1, TAL1 (SCL), NF-E2, LDB1, LMO2, MYB, TCF3 (E2A),18 and GATA2 20 are bound to these regulatory elements. Interesti ngly, these sites are also bound by repressors of GFI1B expression, such as GFI1B, RCOR1, and LSD1 (KDM1A), and hence could behave as negati ve regulatory elements depending on the GFI1B levels.18 The three regulatory elements were validated as hematopoieti c enhancers in transgenic mouse assays,20 and looping to the Gfi 1b promoter was shown for the elements 13 kb and 17 kb downstream of Gfi 1b.18

95 CHAPTER 4

The GWAS described above, identified rs621940[C/G] which is located 8 kb downstream ofGFI1B .2 The minor G allele occurs with a frequency of 0.15 in different populations, and is among the identified polymorphisms that also associate with higher JAK2 V617F burden and risk of uniparental disomy of chromosome 9p. Since deregulated GFI1B expression is associated with MPN, we investigated whether rs621940 and the relevant surrounding region contributes to regulation ofGFI1B expression.

METHODS

GFI1B ChIP-seq in MEG-01 cells Chromatin from MEG-01 cells was isolated as described by Mandoli et al.21 Sonicated chromatin was centrifuged at maximum speed for 10 minutes followed by overnight incubation at 4°C in incubation buffer supplemented with 0.1% BSA, protein A Dynabeads (ThermoFisher Scientific) and 2 µg of GFI1B B7 antibody (Santa Cruz, sc-28356). Beads were washed with four different buffers at 4°C: TEE (10 mM Tris pH 8, 0.1 mM EDTA and 0.5 mM EGTA) + 0.1% SDS, 0.1% DOC, 1% Triton, and 150 mM NaCl, the former buffer with 500 mM NaCl, TEE + 0.25 M LiCl, 0.5% DOC, 0.5% NP-40, and TEE. Subsequently, precipitated chromatin was eluted from the beads with 400 ul elution buffer (1% SDS, 0.1 M NaHCO3) at room temperature for 20 minutes. Protein-DNA complexes were decrosslinked at 65°C for 4 hours, after which DNA was isolated by Qiagen column (QIAquick MinElute PCR Purification Kit). ChIP-seq libraries were prepared as followed; end repair was performed using Klenow and T4 PNK, a 3’ A-overhang was generated using Taq polymerase, and adaptors were ligated. The DNA was loaded on E-gel and fragments corresponding to ~300 bp were excised being the length of ChIP-fragment plus adaptors. The DNA was isolated, amplified by PCR, and used for cluster generation and sequencing on the HiSeq 2000 (Illumina).

Biotin labeled oligo pull-down and mass spectrometry Biotin labeled double strand oligos harboring either the C- or G-allele of rs621940 (Supplementary Table S1) were prepared and bound to streptavadin sepharose beads. Pull-downs for the C- and G-alleles were performed in duplo. Nuclear extracts from MEG-01 cells were generated according to Dignam et al.22 450 ug MEG-01 nuclear extract in a total volume of 600 ul protein incubation buffer (150 mM NaCl, 50 mM Tris pH 8.0, 0.25% NP-40, 1 mM DTT, 1x Complete proteinase inhibitor) supplemented with 5 µg dIdC, 5 µg dAdT and 5 µg tRNA was added to the beads and incubated for 1.5 hours at 4°C on a rotating wheel. Subsequently the beads were washed, and the proteins on-bead digested with trypsin. After this the proteins were eluted from the beads and further digested overnight. The next day, the digested samples were loaded on C18 stage tips and labelled with light (10 mM monosodium phosphate, 35 mM disodium phosphate, 16.2 μl 37% CH2O, 6 mg NaBH3CN) or medium dimethyl labeling (10 mM monosodium phosphate, 35 mM disodium phosphate, 30 μl 20% CD2O, 6 mg NaBH3CN). After labeling the tips were washed and stored at 4°C. For mass spectrometry analysis C-allele pull-down light was combined with G-allele pull-down medium (“forward experiment” and the other way around (“reverse

96 FUNCTIONAL CHARACTERIZATION OF RS621940

experiment”). Mass spec runs and raw data analysis was performed as described for standard dimethyl pull down.23 Raw data were processed by MaxQuant soft ware, and scatt er plots were generated using Perseus.

Dual-Luciferase Reporter Assay in HEK293FT cells Dual-Luciferase Reporter Assay (Promega) were performed according to the manufacturers’ recommendati ons. HEK293FT cells were transfected using Lipofectamine 2000 (Invitrogen) with 0.2 µg pGL3-basic Renilla Luciferase vector, 0.8 µg pGL3-basic Firefl y Luciferase vector with diff erent inserts, 0.5 µg pcDNA3.1-GFI1B-fl ag or pcDNA3.1-HA-GATA1, and 0.5 µg pcDNA3.1-empty vector. In the empty vector conditi on, the 0.5 µg pcDNA3.1-GFI1B-fl ag/pcDNA3.1-HA-GATA1 was replaced by an additi onal 0.5 µg pcDNA3.1-empty vector. The pGL3-basic Firefl y Luciferase vector contains the GFI1B promoter (GRCh37/hg19 Chr9: 135,853,012 – 135,854,484) with or without a 645 bp region containing rs621940 C/G-allele (GRCh37/hg19 Chr9: 135,869,978 – 135,870,622). Experiments were performed four ti mes, in duplicate. Luciferase signal was detected on the Fluostar Opti ma (BMG LABTECH). Firefl y Luciferase acti vity was normalized to Renilla Luciferase acti vity. 4 CRISPR-Cas9 mediated deleti on of rs621940 locus in K562 Two pairs of single guide RNAs (sgRNAs) to delete a 1.6 kb region encompassing rs621940 and located ~8 kb downstream of GFI1B were designed using CRISPR Design (Zhang lab, MIT 2013, crispr.mit.edu). For each guide an oligo pair (Supplementary Table S1) was ligated into the BbsI digested pSpCas9(BB)-2A- GFP (PX458) backbone vector according to Ran et al.24 Subsequently, 1*106 K562 cells were nucleofected with either sgRNA1.1-PX458 and sgRNA2.1-PX458 or sgRNA1.2-PX458 and sgRNA2.2-PX458 plasmids using Amaxa cell line nucleofector kit V and program T-016 of the Nucleofector II device (LONZA). Three days aft er nucleofecti on, GFP positi ve cells were single cell FACS sorted in a 96-wells plate and expanded in RPMI medium supplemented with 10% heat inacti vated FCS to generate clones. DNA was isolated using the QIAamp DNA Blood mini kit (QIAGEN). Deleti on of the 1.6 kb region was validated using PCR and Sanger sequencing with primers outside the expected deleted region (Supplementary Table S1). For the clones with a deleti on, a Sybr Green qPCR (on DNA) with primers inside the deleted region (Supplementary Table S1) was used to confi rm that all alleles were deleted. An albumin qPCR (Hs00910225_m1; Applied Biosystems) was performed to check for equal input in this qPCR.

Allele specifi c GFI1B expression in peripheral blood mononuclear cells Peripheral blood was collected in EDTA tubes from 30 healthy volunteers (SPB1-30) aft er informed consent was obtained (Sanquin blood supply, 2006-10-bc-MAS). For DNA and RNA isolati on see Supplementary Methods. The SPB panel was genotyped for rs621940 with a Sybr Green qPCR using allele specifi c primers (Supplementary Table S1). SNPs in the GFI1B 3’UTR were genotyped using a PCR and Sanger sequencing (Supplementary Table S1). The same GFI1B 3’UTR PCR was performed on cDNA followed by Ion Torrent next generati on sequencing to determine allele specifi GFI1Bc expression using the heterozygous SNPs present in the 3’UTR. A long range PCR (Supplementary Table S1) was performed

97 CHAPTER 4

with PrimeSTAR GXL DNA Polymerase according to the manufacturers’ recommendations, to haplotype the SNPs in samples where heterozygous rs621940 and heterozygous GFI1B 3’UTR SNPs co-occur. The long range PCR product was sequenced with Single Molecule Real-Time (SMRT) sequencing on the Sequel system (ICS v.5.1, Pacific Biosciences) (Nevelinget al. in preparation).

For more details see Supplementary Methods.

RESULTS

GFI1B and many other epigenetic regulators bind the rs621940 locus in leukemia cell lines. The minor G-allele of rs621940, located ~8 kb downstream of GFI1B, associates with MPN and JAK2 V617F+ clonal hematopoiesis.2 Here, we investigated the consequence of rs621940 onGFI1B expression regulation. As part of a negative feedback loop, the GFI1B protein represses its own gene expression through multiple sites.18 To investigate if the rs621940 locus is bound by GFI1B, we generated a genome wide binding profile in the GFI1B expressing cell line MEG-01, which is homozygous for the major C-allele of rs621940 (Supplementary Table S2). We observed clear GFI1B enrichment at the rs621940 locus and confirmed earlier identified binding of GFI1B to the regulatory elements 12.5 kb, 16 kb, and 17.5 kb downstream of human GFI1B (Figure 1). The latter three loci were earlier identified as GFI1B regulatory elements based on multispecies conservation, binding of erythrocyte and megakaryocyte transcription factors like GFI1B and GATA1, histon 4 acetylation, and looping to the GFI1B promoter.18 To investigate if the rs621940 locus represents a putative regulatory element, we analyzed publically available chromatin data of the GFI1B expressing cell line K562, generated by the ENCODE Consortium. The rs621940 locus was hypersensitive for DNAseI, had strong enrichment for H3K4me1, and weak enrichment for H3K27ac (Supplementary Figure S1). However, compared to the earlier identified regulatory elements that show both enrichment of H3K4me1 and H3K27ac, the latter signal was Figure 1 clearly lower at the region containing rs621940. Furthermore, binding of erythrocyte/megakaryocyte transcription factors (EGR1, TAL1, CMYC, GATA1/2) and histon modifiers (LSD1, HDAC1/2) was observed. The Chromatin State Segmentation prediction from ENCODE/Broad institute suggested that the rs621940 region is an enhancer (Supplementary Figure S1).

rs621940 Scale 10 kb hg19 chr9: 135,855,000 135,860,000 135,865,000 135,870,000 135,875,000 135,880,000 GFI1B GFI1B 99 - * * *

MEG-01 GFI1B

1 _

Figure 1. GFI1B binds to the rs621940 locus in MEG-01 cells. GFI1B ChIP profile in MEG-01 cells (GRCh37/hg19). The location of rs621940 is indicated, MEG-01 cells are homozygous for the major C-allele. Previously identified GFI1B regulatory elements at 12.5 kb, 16 kb, and 17.5 kb downstream of GFI1B are indicated with the asterisks.

98 FUNCTIONAL CHARACTERIZATION OF RS621940

Diff erenti al transcripti on factor binding to the rs621940 C- and G-allele. The region encompassing the rs621940 C-allele is bound by GFI1B in MEG-01 cells. To investi gate if GFI1B binding is altered by the G-allele, we performed a pull-down experiment with bioti n labeled oligonucleoti des containing either the C- or G-allele using MEG-01 nuclear extracts, followed by dimethyl labeling and mass spectrometry analysis. This approach is specifi cally suited to identi fy diff erenti ally bound factors. Indeed, a total of 24 diff erenti ally bound proteins were identi fi ed; 7 binding stronger to the C-allele and 17 binding more effi cient to the G-allele (Figure 2). However, GFI1B was not among them, suggesti ng that GFI1B binding is not aff ected by either rs621940 allele. All enriched interactors of the C-allele, except BANP/BEND1, are transcripti on factors (NFIA, NFIX, NFIC, KLF3, SOX4, MBD4) known to be involved in hematopoiesis.25-31 The 17 proteins enriched for the G-allele contain 9 transcripti on factors of which ZBTB7A and ZNF148/ZBP-89 have a described role in hematopoiesis.25, 32, 33 None of the Figure 2 diff erenti ally binding interactors are known to bind GFI1B, currently. However, ZBTB7A and ZNF148 do interact with GATA1,32, 33 a known interacti on partner of GFI1B and regulator of its gene expression.34

4 6

- G-allele PCBP2 HNRNPK 4

- ZBTB10 ZBTB7A ZBTB7B PATZ1 ZBTB48 ZNF148 2 - ZSCAN21 VEZF1 FP972 FAM120A (log2) PCBP1 RBM39 BEND7 CDKN2AIP

M/L ZNF281 XRN2

MBD4 SOX4 KLF3 Reverse BANP

NFIC NFIX 42 0 NFIX NFIA

C-allele

-6 -4 -2 0 2 4 6

Forward M/L (log2) Figure 2. Diff erenti al protein binding between rs621940 C- and G-allele. Mass spectrometry analysis on bioti n- tagged oligo pull-down in MEG-01 nuclear lysates. One oligo contained the major C-allele and the other the minor G-allele. In the “Forward” sample the pepti des from the C-allele pull-down are light (L) dimethyl labeled and the pepti des from the G-allele medium (M) dimethyl labeled. This is vice versa in the “Reverse” sample. Presented here are the proteins binding diff erenti ally to the C- and G-allele of rs621940. Proteins binding more effi ciently to the C-allele are red and the ones binding more effi ciently to the G-allele are blue. NFIX is presented twice because there are NFIX two isoforms in the Uniprot database, which is used to map the pepti des.

99 CHAPTER 4

Rs621940 alleles do not differentially affect GFI1B promoter activity in gene reporter assays. To study if the rs621940 alleles affectGFI1B promoter activity we used luciferase reporter assays in the context of forced GFI1B and GATA1 expression. To this end, HEK293FT cells were transfected with the pGL3 vector containing the GFI1B promoter followed by the luciferase reporter, or the GFI1B promoter and the reporter followed by a ~645 bp element containing rs621940 either with the C- or G-allele. For all conditions we observed that GFI1B repressed, and that GATA1 stimulated the promoter (Figure 3). The addition of the region containing rs621940 resulted in lower basal promoter activity with the C-allele having a more pronounced effect than the G-allele. However, both constructs were equally well repressed and activated by GFI1B and GATA1, respectively. Thus, the region encompassing rs621940 negatively affects GFI1B promoter activity in gene reporter assays, with a stronger effect for the C- than the G-allele. Yet, these alleles do not affect the ability of GFI1B nor GATA1 to influence gene expression.

The rs621940 locus does not affect GFI1B expression nor GFI1B auto-repression in K562 cells. To investigate the contribution of the rs621940 locus on GFI1B expression and auto-repression in a physiological model, we deleted a ~1.6 kb fragment encompassing rs621940 by CRISPR-Cas9 DNA editing in K562 cells. We used K562 cells because they highly expressGFI1B , are easily gene-edited, and have been extensively studied by the ENCODE consortium. Cells were electroporated with two sgRNA- Cas9 constructs and single cells were subsequently sorted using the FACS BD Aria sorter. Clones with deletion of the rs621940 locus were identified using a PCR with primers encompassing the expected deletion followed by Sanger sequencing (Supplementary Figure S2A-B). Subsequently, a DNA based qPCR amplifying ~120 bp within the deleted region was performed to validate that the rs621940 locus was deleted in all alleles (Supplementary Figure S2A, C). This identified three clones with complete loss of the rs621940 locus (1-9, 1-11, and 2-10). Compared to wild type K562 cells, basal GFI1B expression did not differ consistently in cells lacking the rs621940 region (Figure 4A). Because the variation in GFI1B expression was almost 2-fold between the different clones, we determined GFI1B expression variation in cloned wild type K562 cells. This showed that GFI1B expression relative to bulk K562 cells ranged between 0.55-2.0 (Figure 4B), indicating that the GFI1B expression variation in the rs621940 deleted clones is within the normal range. Subsequently, we studied if auto-repression is disturbed in the rs621940 deleted clones by overexpressing GFI1B using retroviral transduction (Figure 4C). The auto-repression observed in the wild type K562 cells appeared to be unchanged in the rs621940 deleted clones (Figure 4D). In conclusion, we did not find a functional consequence of the rs621940 locus deletion GFI1Bon expression and auto- repression in K562 cells.

100 FUNCTIONAL CHARACTERIZATION OF RS621940

Figure 3

A

Firefly luciferase

GFI1B promoter Firefly luciferase

rs621940

GFI1B promoter Firefly luciferase C rs621940

GFI1B promoter Firefly luciferase G

B

) 3 a l l i n e r / y

l 2 f e r i f

( 4

co-transfected conditions e s

a 1 EV r e

f GFI1B i c

u GATA1 L 0

V le le E m. e e o ll ll r a a p - - B C G I1 + + F G m. m. ro ro p p B B I1 I1 F F G G

Figure 3. Rs621940 does not aff ect GFI1B promoter acti vity in luciferase reporter assays. (A) Schemati c representati on of used pGL3 fi refl y luciferase contructs. The GFI1B promoter is cloned upstream, and the ~645 bp region encompassing rs621940[C/G] downstream of the fi refl y luciferase gene. (B) Gene reporter luciferase assays in HEK293FT cells transfected with pGL3 backbone only, or pGL3 with either the GFI1B promoter, GFI1B promoter + rs621940[C], or GFI1B promoter + rs621940[G]. For every promoter construct three conditi ons were tested, overexpression of empty vector, GFI1B, or GATA1. On the y-axis are the Firefl y Luciferase signals normalized with Renilla Luciferase signals (n=4).

101 CHAPTER 4

Figure 4

A B      

     

         
 


 

                   









 
 




C D   

      


     

  

  

   


   

 

 



 


 
    



Figure 4. Deletion of the rs621940 locus does not influence GFI1B expression or GFI1B auto-repression in K562 cells. (A) Relative GFI1B expression in K562 CRISPR-Cas9 genome edited clones that have a complete deletion of the ~1.6 kb region encompassing rs621940. GFI1B expression in the deleted clones is presented relative to the GFI1B expression in the wild type (WT) bulk K562 cells. Results show mean with standard deviation (n=2). (B) RelativeGFI1B expression in K562 WT clones. GFI1B expression in the clones is presented relative to the GFI1B expression in the WT bulk K562 cells. (C) GFI1B expression in rs621940 deleted clones retrovirally transduced with GFI1B, relative to the same clone transduced with empty vector (EV). (D) Endogenous GFI1B expression in rs621940 deleted clones retrovirally transduced with GFI1B, relative to endogenous GFI1B expression in the same clone transduced with EV. GFI1B expression was normalized to GAPDH expression in all sub panels.

102 FUNCTIONAL CHARACTERIZATION OF RS621940

Rs621940 does not aff ect allele-specifi c GFI1B expression in mononuclear cells. Finally, we investi gated if the rs621940 G-allele infl uences GFI1B expression in peripheral blood mononuclear cells from 30 healthy donors. Genomic DNA from these individuals was fi rst genotyped for rs621940 using a Sybr Green qPCR with allele specifi c primers for the C- and G-allele. Sanger sequencing was used for validati on. This identi fi ed 10 individuals with rs621940[C/G] and 20 individuals that were homozygous C (Supplementary Table S2). GFI1B expression was not signifi cantly diff erent between the two groups (Figure 5A). Because the rs621940 G-allele carrying individuals were heterozygous, subtle eff ects on GFI1B expression by the G-allele might be missed. Therefore, we examined allele specifi c GFI1B expression in rs621940[C/G] and [C/C] cases based on non-coding SNPs present in the 3’UTR of the GFI1B transcript (rs4962034, rs667805, and rs15906). First, we genotyped the 3’UTR of GFI1B by genomic PCR followed by Sanger sequencing. Next, we selected samples with informati ve 3’UTR SNPs (5 with rs621940[C/G] and 9 with rs621940 [C/C]). Subsequently, the 3’UTR SNPs and rs621940 were haplotyped using long range PCR and SMRT sequencing to determine which alleles of the 3’UTR SNPs are on the same chromosome as the rs621940[G] minor allele. Having established this, we measured allele specifi c expression by performing an RT-PCR of the expressed informati ve 3’UTRs followed by Ion 4 Torrent next generati on sequencing to determine the variant allele frequency of the polymorphisms. We observed no consistent eff ect of the rs621940 minor allele on allelic GFI1B expression. Among the rs621940[C/G] samples was one sample where the C-allele and two samples where the G-allele correlated with higher GFI1B expression. In additi on, in two samples there was no expression diff erence between the two alleles. In controls lacking the minor allele [C/C], variant allele frequencies also diff ered indicati ng that other factors than rs621940 determine allelicGFI1B expression (Figure 5B).

103 CHAPTER 4

Figure 5

A



     

  



 

B

rs4962034 rs667805 rs15906 rs621940 haplotyping rs621940 allele associated sample ID c.*211C>G c.*256A>G c.*530T>A C>G with higher GFI1B G-allele % G-allele % A-allele % expression SPB001 53% CC SPB006 21% 54% CC SPB007 14% CC SPB009 45% 45% CC SPB013 35% CC SPB019 59% CC SPB020 40% 56% 42% CC SPB024 29% CC SPB028 23% 74% CC SPB003 24% CG C-A-T-G G-allele SPB005 80% CG C-A-T-G C-allele SPB010 53% CG G-A-T-G 50/50 SPB014 68% CG G-A-T-G G-allele SPB021 45% 52% 50% CG G-A-T-G 50/50

Figure 5. Rs621940 does not influence (allele specific) GFI1B expression in mononuclear cells of healthy donors. (A) Total GFI1B expression in donors with CC or CG at the rs621940 locus normalized to GAPDH expression. (B) The second column shows the variant allele frequency (frequency of minor allele) of heterozygous GFI1B 3’UTR SNPs (rs4962034, rs667805, rs15906) in cDNA of mononuclear cells from healthy donors. Rs621940 genotype is presented in the third column. Haplotype of 3’UTR SNP with rs621940 G-allele is shown in the fourth column. The order of alleles is rs4962034, rs667805, rs15906, and rs621940. Informative GFI1B 3’UTR SNP alleles are indicated in red. The last column shows which rs621940 allele is associated with higher GFI1B expression based on the variant allele frequency of the GFI1B 3’UTR SNPs and haplotyping. For example, in SPB003 the informative SNP is rs15906[T>A]. The minor A-allele is present in 24%, meaning that the major T-allele is higher expressed. Rs15906 T-allele is on the same chromosome as rs621940 G-allele, so rs621940 G-allele is associated with higher GFI1B expression.

104 FUNCTIONAL CHARACTERIZATION OF RS621940

DISCUSSION

The G-allele of rs621940 located ~8 kb downstream of GFI1B associates with JAK2 V617F+ clonal hematopoiesis in healthy individuals and MPN.2 GFI1B regulates HSC proliferati on, and diff erenti ati on of erythrocyte and megakaryocyte lineages.3-7 GFI1B expression is deregulated in various hematological malignancies, including MPN.12 Here, we investi gated whether the G-allele of rs621940 aff ects GFI1B expression. We observed that GFI1B binds the rs621940 locus in MEG-01 cells, being homozygous for the major C-allele. However, GFI1B was not among the 24 MEG-01 expressed proteins that diff erenti ally bind to either rs621940 allele. Luciferase gene reporter assays suggested that the rs621940 locus inhibits GFI1B promoter acti vity in HEK293FT cells. This eff ect is stronger for the C-allele than the G-allele. However, there was no signifi cant diff erence in GFI1B auto-repression (and GATA1 acti vati on) between the C- and G-allele. Thus, if the rs621940 alleles aff ect GFI1B expression this is likely not mediated by GFI1B itself. In chronic myeloid leukemia K562 cells, the rs621940 locus exhibits an open chromati n architecture and is bound by many transcripti on factors. Yet, deleti on of an 1.6 kb fragment encompassing rs621940 4 in these cells did not alter GFI1B expression nor GFI1B-mediated auto-repression. Importantly, we also did not observe altered GFI1B expression in mononuclear leukocytes from healthy individuals heterozygous for the minor rs621940 G-allele compared to individuals homozygous for the major allele. Likewise, we did not detect consistent diff erences in allele specifi c GFI1B expression in mononuclear leukocytes of healthy donors with rs621940[C/G]. In fact, diff erences in allelic GFI1B expression were observed in mononuclear leukocytes from healthy individuals homozygous for the major rs621940-C allele. Thus, we fi nd no evidence that the rs621940 G-allele has a dominant eff ect onGFI1B expression, although in K562 cells the locus is accessible and bound by many transcripti onal regulators. Regarding histone modifi cati ons, the rs621940 locus is specifi cally enriched for H3K4me1 but not H3K27ac in K562 cells (Supplementary Figure S1), suggesti ng that this region is a poised enhancer that is not required for GFI1B expression in cycling K562 cells. Possibly, the earlier identi fi ed elements 12.5 kb, 16 kb and 17.5 kb downstream of GFI1B are suffi cient to maintain GFI1B expression. Other possibiliti es are that the rs621940 locus regulates GFI1B expression in other cell types and/or diff erent hematopoieti c developmental phases. It is also possible that this locus regulates other genes. To test this, we measured expression of TSC1 and GTF3C5, the genes respecti vely up- and downstream of GFI1B but did not observe any diff erences in the K562 clones (Supplementary Figure S3). Genome-wide chromati n capture experiments using the rs621940 locus as viewpoint could show which genes might be regulated through this region. This may be relevant as we observed interesti ng proteins binding diff erenti ally to the rs621940-alleles. The transcripti on factors ZBTB7A (a.k.a LRF) and ZNF-148 (a.k.a. ZBP-89) specifi cally bind the minor allele and interact with GATA1 at regulatory elements of key erythroid genes.32, 35 GATA1 is a regulator of GFI1B expression, and can be an acti vator or repressor depending on the presence of other co-(transcripti on)factors.34 It would be interesti ng to study if ZBTB7A and ZNF-148 regulate GFI1B expression together with GATA1. Furthermore, ZBTB7A mutati ons occur in ~23% of AML pati ents that harbor the translocati on t(8;21).36 These mutati ons disrupt the transcripti onal repressor

105 CHAPTER 4

potential and the anti-proliferative effect of ZBTB7A. NFIX, binding more efficient to the C-allele, can also be mutated in acute erythroid leukemia (ASH 2018 abstract, Lacobucci et al). Possibly, changed ZBTB7A and/or NFIX binding due to rs621940 can contribute to myeloid transformation. Further studies are warranted to test the contribution of these factor inGFI1B expression regulation during hematopoiesis.

Data availability Raw ChIP sequencing data of the GFI1B binding profile in MEG-01 cells has been deposited with the Gene Expression Omnibus (GEO) database under accession number GSE125246.

Acknowledgements We thank the Genome Technology Center of the Radboud university medical center for support with Sanger, Ion Torrent and SMRT sequencing. Furthermore, we would like to thank the ENCODE Consortium and the ENCODE production laboratories from Broad, the University of Washington, UCDavis, Stanford, and HudsonAlpha for generating the epigenetic datasets on K562.

Authorship contributions R.O. and B.A.R. coordinated the research and wrote the majority of the manuscript. R.O., S.M.B., A.O.G., E.L.R.T.M.T., K.N., P.W.T.C.J., M.P.A.B., A.M., and J.H.A.M. conducted and analyzed the majority of the experiments. J.H.J, M.V., and B.A.R. provided funding. All authors critically revised the paper and approved the final version.

Conflict-of-interest disclosure The authors declare no competing financial interests.

Corresponding author Bert A. van der Reijden, Geert Grooteplein zuid 8, 6525 GA Nijmegen, The Netherlands. Bert. [email protected]

106 FUNCTIONAL CHARACTERIZATION OF RS621940

REFERENCES

1. Deng N, Zhou H, Fan H, Yuan Y. Single nucleoti de polymorphisms and cancer suscepti bility. Oncotarget. 2017;8(66):110635-110649. 2. Hinds DA, Barnholt KE, Mesa RA, et al. Germ line variants predispose to both JAK2 V617F clonal hematopoiesis and myeloproliferati ve neoplasms. Blood. 2016;128(8):1121-1128. 3. Khandanpour C, Sharif-Askari E, Vassen L, et al. Evidence that growth factor independence 1b regulates dormancy and peripheral blood mobilizati on of hematopoieti c stem cells. Blood. 2010;116(24):5149-5161. 4. Foudi A, Kramer DJ, Qin J, et al. Disti nct, strict requirements for Gfi -1b in adult bone marrow red cell and platelet generati on. J Exp Med. 2014;211(5):909-927. 5. Laurent B, Randrianarison-Huetz V, Marechal V, Mayeux P, Dusanter-Fourt I, Dumenil D. High-mobility group protein HMGB2 regulates human erythroid diff erenti ati on through trans-acti vati on of GFI1B transcripti on. Blood. 2010;115(3):687-695. 6. Saleque S, Cameron S, Orkin SH. The zinc-fi nger proto-oncogene Gfi -1b is essenti al for development of the erythroid and megakaryocyti c lineages. Genes & development. 2002;16(3):301-306. 7. Vassen L, Beauchemin H, Lemsaddek W, Krongold J, Trudel M, Moroy T. Growth factor independence 1b (gfi 1b) is important for the maturati on of erythroid cells and the regulati on of embryonic globin expression. PloS one. 2014;9(5):e96636. 4 8. Schulz D, Vassen L, Chow KT, et al. Gfi 1b negati vely regulates Rag expression directly and via the repression of FoxO1. J Exp Med. 2012;209(1):187-199. 9. Vassen L, Okayama T, Moroy T. Gfi 1b:green fl uorescent protein knock-in mice reveal a dynamic expression patt ern of Gfi 1b during hematopoiesis that is largely complementary to Gfi 1. Blood. 2007;109(6):2356-2364. 10. van der Meer LT, Jansen JH, van der Reijden BA. Gfi 1 and Gfi 1b: key regulators of hematopoiesis. Leukemia. 2010;24(11):1834-1843. 11. Monteferrario D, Bolar NA, Marneth AE, et al. A dominant-negati ve GFI1B mutati on in the gray platelet syndrome. N Engl J Med. 2014;370(3):245-253. 12. Vassen L, Khandanpour C, Ebeling P, et al. Growth factor independent 1b (Gfi 1b) and a new splice variant of Gfi 1b are highly expressed in pati ents with acute and chronic leukemia. Int J Hematol. 2009;89(4):422-430. 13. Elmaagacli AH, Koldehoff M, Zakrzewski JL, Steckel NK, Otti nger H, Beelen DW. Growth factor-independent 1B gene (GFI1B) is overexpressed in erythropoieti c and megakaryocyti c malignancies and increases their proliferati on rate. Br J Haematol. 2007;136(2):212-219. 14. Thivakaran A, Botezatu L, Hones JM, et al. Gfi 1b: a key player in the genesis and maintenance of acute myeloid leukemia and myelodysplasti c syndrome. Haematologica. 2018;103(4):614-625. 15. Anguita E, Gupta R, Olariu V, et al. A somati c mutati on of GFI1B identi fi ed in leukemia alters cell fate via a SPI1 (PU.1) centered geneti c regulatory network. Dev Biol. 2016;411(2):277-286. 16. Vassen L, Fiolka K, Moroy T. Gfi 1b alters histone methylati on at target gene promoters and sites of gamma- satellite containing heterochromati n. EMBO J. 2006;25(11):2409-2419. 17. Saleque S, Kim J, Rooke HM, Orkin SH. Epigeneti c regulati on of hematopoieti c diff erenti ati on by Gfi -1 and Gfi- 1b is mediated by the cofactors CoREST and LSD1. Mol Cell. 2007;27(4):562-572. 18. Anguita E, Villegas A, Iborra F, Hernandez A. GFI1B controls its own expression binding to multi ple sites. Haematologica. 2010;95(1):36-46. 19. Hernandez A, Villegas A, Anguita E. Human promoter mutati ons unveil Oct-1 and GATA-1 opposite acti on on Gfi 1b regulati on. Annals of hematology. 2010;89(8):759-765.

107 CHAPTER 4

20. Moignard V, Macaulay IC, Swiers G, et al. Characterization of transcriptional networks in blood stem and progenitor cells using high-throughput single-cell gene expression analysis. Nat Cell Biol. 2013;15(4):363-372. 21. Mandoli A, Prange K, Martens JH. Genome-wide binding of transcription factors in inv(16) acute myeloid leukemia. Genom Data. 2014;2(170-172. 22. Dignam JD, Lebovitz RM, Roeder RG. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 1983;11(5):1475-1489. 23. Hubner NC, Nguyen LN, Hornig NC, Stunnenberg HG. A quantitative proteomics tool to identify DNA-protein interactions in primary cells or blood. J Proteome Res. 2015;14(2):1315-1329. 24. Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F. Genome engineering using the CRISPR-Cas9 system. Nat Protoc. 2013;8(11):2281-2308. 25. Lambert SA, Jolma A, Campitelli LF, et al. The Human Transcription Factors. Cell. 2018;172(4):650-665. 26. Holmfeldt P, Pardieck J, Saulsberry AC, et al. Nfix is a novel regulator of murine hematopoietic stem and progenitor cell survival. Blood. 2013;122(17):2987-2996. 27. Mei S, Liu Y, Wu X, et al. TNF-alpha-mediated microRNA-136 induces differentiation of myeloid cells by targeting NFIA. J Leukoc Biol. 2016;99(2):301-310. 28. Ilsley MD, Gillinder KR, Magor GW, et al. Kruppel-like factors compete for promoters and enhancers to fine- tune transcription. Nucleic Acids Res. 2017;45(11):6572-6588. 29. Sandoval S, Kraus C, Cho EC, et al. Sox4 cooperates with CREB in myeloid transformation. Blood. 2012;120(1):155- 165. 30. Sanders MA, Chew E, Flensburg C, et al. MBD4 guards against methylation damage and germ line deficiency predisposes to clonal hematopoiesis and early-onset AML. Blood. 2018;132(14):1526-1534. 31. Wahlestedt M, Ladopoulos V, Hidalgo I, et al. Critical Modulation of Hematopoietic Lineage Fate by Hepatic Leukemia Factor. Cell Rep. 2017;21(8):2251-2263. 32. Woo AJ, Moran TB, Schindler YL, et al. Identification of ZBP-89 as a novel GATA-1-associated transcription factor involved in megakaryocytic and erythroid development. Mol Cell Biol. 2008;28(8):2675-2689. 33. Stumpf M, Waskow C, Krotschel M, et al. The mediator complex functions as a coactivator for GATA-1 in erythropoiesis via subunit Med1/TRAP220. Proc Natl Acad Sci U S A. 2006;103(49):18504-18509. 34. Huang DY, Kuo YY, Chang ZF. GATA-1 mediates auto-regulation of Gfi-1B transcription in K562 cells. Nucleic Acids Res. 2005;33(16):5331-5342. 35. Lunardi A, Guarnerio J, Wang G, Maeda T, Pandolfi PP. Role of LRF/Pokemon in lineage fate decisions. Blood. 2013;121(15):2845-2853. 36. Hartmann L, Dutta S, Opatz S, et al. ZBTB7A mutations in acute myeloid leukaemia with t(8;21) translocation. Nat Commun. 2016;7(11733. 37. Kent WJ, Sugnet CW, Furey TS, et al. The human genome browser at UCSC. Genome Res. 2002;12(6):996-1006. 38. Haeussler M, Zweig AS, Tyner C, et al. The UCSC Genome Browser database: 2019 update. Nucleic Acids Res. 39. Consortium EP. An integrated encyclopedia of DNA elements in the human genome. Nature. 2012;489(7414):57- 74.

108 FUNCTIONAL CHARACTERIZATION OF RS621940

SUPPLEMENTARY METHODS

Cell culture K562 and MEG-01 cells were cultured in RPMI 1640 (GIBCO) supplemented with 10% heat inacti vated

FCS, at 37˚C and 5% CO2. PhoenixA cells were cultured in DMEM (GIBCO) supplemented with 10% heat inacti vated FCS, at 37˚C supplied with 5% CO2. HEK293FT cells were maintained in DMEM supplemented with 10% non-heat inacti vated FCS, 1% glutamine, 1% non-essenti al amino acids, 1% pyruvate, and 1% penicillin/streptomycin (MP Biomedical).

Chromati n isolati on from MEG-01 cells Chromati n from ~18 million MEG-01 cells was isolated as described by Mandoliet al.1 Briefl y, cells were crosslinked with 1% formaldehyde for 10 minutes at room temperature. The crosslinking reacti on was stopped by adding 0.125 M glycine, followed by washing with three diff erent buff ers to isolate the nuclei (1) PBS, (2) 0.25% Triton X 100, 10 mM EDTA, 0.5 mM EGTA, 20 mM HEPES pH 7.6 and (3) 0.15 M NaCl, 10 mM EDTA, 0.5 mM EGTA, 20 mM HEPES pH 7.6. Nuclei were then incubated in ChIP incubati on 4 buff er (0.15% SDS, 1% Triton X 100, 150 mM NaCl, 10 mM EDTA, 0.5 mM EGTA, 20 mM HEPES pH 7.6) and sonicated using Bioruptur sonicator (Diagenode) for 20 minutes at high power, 30 seconds on and 30 seconds off .

UCSC genome browser screenshot Profi les of DNAseI, histone modifi cati ons, binding of transcripti onal regulators, and Chromati n State Segmentati on by Hidden Markov Model in K562 cells were presented in UCSC Genome Browser with genome assembly GRCh37/hg19.2, 3 The epigeneti c K562 data was generated by the ENCODE Consorti um.4

Bioti n labeled oligo pull-down and mass spectrometry Double strand oligos harboring either the C or G allele of rs621940 were prepared by annealing 5 ul (100 uM) of bioti nylated sense oligo and 7.5ul (100 uM) of anti sense oligo in 12.5 ul annealing buff er (100 mM NaCl, 20 mM Tris pH8, 2 mM EDTA). See Supplementary Table S1 for oligo sequences. This mixture was heated for 10 minutes at 95°C and cooled down in the heatblock to room temperature. Subsequently the bioti nylated double strand oligos were bound to streptavadin sepharose beads. Pull- downs for the C- and G-allele were performed in duplo, per pull-down 20 ul streptavadin sepharose beads (50% slurry) was used. Beads were washed once with PBS + 0.1% NP40 and once with DNA binding buff er (DBB) (1 M NaCl + 10 mM Tris pH 8.0 + 1 mM EDTA + 0.05% NP40). To the beads, 575 ul DBB and 25 ul bioti nylated double strand oligos was added. The mixture was incubated for 30 minutes to let the oligos anneal to the beads. Aft erwards the beads were washed once with DBB and twice with protein incubati on buff er (PIB) (150 mM NaCl, 50 mM Tris pH 8.0, 0.25% NP-40, 1 mM DTT, 1x Complete proteinase inhibitor).

109 CHAPTER 4

Nuclear extracts from MEG-01 cells were generated according to Dignam et al.5 450 ug MEG-01 nuclear extract in a total volume of 600 ul PIB supplemented with with 5 µg dIdC, 5 µg dAdT and 5 µg tRNA was added to the beads and incubated for 1.5 hours at 4°C on a rotating wheel. Subsequently the beads were washed thrice with 1 ml PIB and twice with 1 ml PBS. After which the PBS was removed completely with 30G needles. Beads were resuspended in 50 ul elution buffer (2M urea, 100 mM ammonium bicarbonate, 10 mM DTT) and incubated for 20 minutes in a shaker at 1400 rpm and room temperature. Subsequently IAA was added to a final concentration of 50 mM and incubated for 10 minutes in shaker in the dark at 1400 rpm and room temperature. Proteins were on-bead digested by adding 0.25 ug trypsin and two hour incubation in a shaker at 1400 rpm and room temperature. The beads were spun down and the supernatant transferred to a new tube. Again 50 ul of elution buffer was added to the beads and incubated for 5 minutes. The beads were spun down and the supernatant was combined with the previous one. Digestion was continued over night using 0.1 ug trypsin. The next day, C18 stage tips were prepared and washed once with 50 ul MeOH, once with 50 ul buffer B, and twice with 50 ul buffer A. Subsequently, the digested samples were loaded on the stage tip and washed once with 50 ul buffer A. Of the duplos, one was treated with light dimethyl labelling

(10 mM monosodium phosphate, 35 mM disodium phosphate, 16.2 μl 37% CH2O, 6 mg NaBH3CN) and one with medium dimethyl labelling (10 mM monosodium phosphate, 35 mM disodium phosphate,

30 μl 20% CD2O, 6 mg NaBH3CN). After labeling the tips were washed with 100 ul buffer A and stored at 4°C. For mass spectrometry analysis C-allele pull-down light was combined with G-allele pull-down medium and the other way around. Mass spec run and raw data analysis was performed as described for standard dimethyl pull down.6 Raw data were processed by MaxQuant software, and scatter plots were generated using Perseus.

RT-qPCR RNA was isolated using the Quick-RNATM kit (Zymo Research). RNA was treated with DNAse (Zymo Research) and reverse transcribed using M-MLV reverse transcriptase (Invitrogen). For RT-qPCR, cDNA was amplified using Taqman 2x Universal PCR Master Mix (Applied biosystems) as recommended by the manufacturer. Primer-probe sets for total GFI1B expression and endogenous GFI1B expression are presented in Supplementary Table 1. Endogenous GFI1B expression was determined using primers targeting the 5’UTR which is not present in the overexpression construct. TSC1 expression was determined with Taqman gene expression assay Hs01060648_m1. GTF3C5 expression was determined with Taqman gene expression assay Hs01034267_m1. GAPDH expression was determined using GAPDH Endogenous Control (Hs99999905_m1) (Applied biosystems) to correct for differences in input. RT- qPCR was performed on the 7500 Real Time PCR System (Applied Biosystems). Data were analyzed using 7500 Fast System Software (version 1.3.1).

Retrovirus production and transduction K562 cells Retrovirus of pMIGR1-IRES-GFP and pMIGR1-GFI1B-flag-IRES-GFP was produced using PhoenixA cells. Cells were transfected using calcium phosphate with 3.15 µg pCL-Ampho retroviral packaging vector

110 FUNCTIONAL CHARACTERIZATION OF RS621940

and 18.4 µg pMIGR1 construct. Aft er 16-18 hours, the medium was replaced with 5 ml fresh medium. Viral supernatant was harvested 30 hours aft er transfecti on. Subsequently, 2.5 ml viral supernatant was spun down on retronecti n (Takara Bio Inc.)-coated non-ti ssue culture treated 6-wells plates for 1.5 hours at maximum speed and 4°C. Aft er which the viral supernatant was removed from the plates and 1*106 K562 cells were added per well. The plate with K562 cells was spun down for 5 minutes at 500g and room temperature. Aft er 2 days the cells were harvested from the retronecti n and cultured for an additi onal 2 days. Finally GFP+ cells were sorted using the BD FACSAria (BD Bioscience) and prepared for RNA isolati on.

DNA and RNA isolati on from peripheral blood mononuclear cells Peripheral blood was collected in EDTA tubes from 30 healthy volunteers (SPB1-30) aft er informed consent (Sanquin blood supply, 2006-10-bc-MAS). The tubes were centrifuged for 10 minutes at 1800 rpm. This created three phases, of which the middle phase was taken containing the mononuclear cells. Remaining red cells were lysed at 4°C using 0.9xNH4Cl soluti on. Mononuclear cells were washed in PBS+0.5%FCS and divided for DNA and RNA isolati on. RNA was isolated from 60*106 cells using 4 ml 4 RNAbee. DNA from 20-100*106 cells was isolated using Nucleospin Blood XL kit (MACHEREY-NAGEL) according to the manufactures’ recommendati ons.

Single molecule real-ti me (SMRT) sequencing Long-range amplicons were purifi ed using AMPure BP beads (Pacifi c Biosciences). Library preparati on was performed according to protocol ‘Procedure and Checklist – Preparing SMRTbell Libraries using PacBio Barcoded Adapters for Multi plex SMRT Sequencing’ (Pacifi c Biosciences, Part Number 100-538- 700-02), using barcoded hairpin adapters. During library preparati on, the here described amplicons were pooled equimolarly with other amplicons that were sequenced on the same sequencing run. The concentrati on of the fi nal SMRTbell library was measured by Qubit 3.0 (ThermoFisher Scienti fi c). To generate polymerase-bound SMRTbell complexes, both sequencing primers and sequencing polymerase were annealed to the SMRTbell library. Sequencing was performed on a Sequel system (ICS v.5.1, Pacifi c Biosciences), with an on-plate concentrati on of 4.5 pM, a 600 minutes movie ti me and pre-extension. Following sequencing, demulti plexing and CCSmapping (circular consensus sequencing, mapped against hg19) was performed using SMRTLink 5.1. For more detailed descripti on of the used sequencing workfl ow, see Nevelinget al (in preparati on).

111 CHAPTER 4

Table S1. Oligos and primers

Application Orientation Sequence

pull-down forward Biotin-TCCTTCTTTGTCGACTGAGGTTTGGCGAGATCGAGATTAAGCTTGTCG rs621940[C] reverse GG CCCGACAAGCTTAATCTCGATCTCGCCAAACCTCAGTCGACAAAGAAGGA

pull-down forward Biotin-TCCTTCTTTGTCGACTGAGGTTTGGGGAGATCGAGATTAAGCTTGTCG rs621940[G] reverse GG CCCGACAAGCTTAATCTCGATCTCCCCAAACCTCAGTCGACAAAGAAGGA

sgRNA1.1* forward CACCGCCAAAAAGATAGCCTCAACT reverse AAACAGTTGAGGCTATCTTTTTGGC

sgRNA1.2* forward CACCGCTGGTTCCCAAATTAACCTT reverse AAACAAGGTTAATTTGGGAACCAGC

sgRNA2.1* forward CACCGACGAGTCCCCATTCAATCCT reverse AAACAGGATTGAATGGGGACTCGTC

sgRNA2.2* forward CACCGGGGGTCAGTGCCACAGTCTA reverse AAACTAGACTGTGGCACTGACCCCC CRISPR-Cas9 check forward GGGTTCGTTTGCTTTAGACG PCR reverse TGTCACCACGAACAGGACAT

CRISPR-Cas9 check forward CTGACTCATCTCTTACACACACATG qPCR reverse CGATACTGGTTTGGTTTTGTTTAG

GFI1B RT-qPCR forward CCCGTGTGCAGGAAGATGA reverse CAGGCACTGGTTTGGGAATAGA probe FAM-TTACCCCGGTGCCCAGA-MGB endogenous GFI1B forward CCGAGAGAGGCTTTGCAGTT RT-qPCR reverse probe TGTGAGCCTTCTTGCTCTTCAC FAM- CCACCTCGGGAAGC-MGB genotyping forward GCATACTCCCTGTTTGCTAAACAAA rs621940[C] qPCR reverse CGACAAGCTTAATCTCGATCTCG

genotyping forward CTTTGTCGACTGAGGTTTGGG rs621940[G] qPCR reverse CCCTCTTTCTCTGCTGTATGCA

genotyping GFI1B forward CTACCAGCTTGTTTTGAGACTCAT 3’UTR SNPs reverse TATTGACAGCAGTTGAGAGAACAG

haplotyping forward CTACCAGCTTGTTTTGAGACTCAT rs621940+GFI1B reverse CCCTCTTTCTCTGCTGTATGCA 3’UTR SNPs

*All four sgRNA guides are targeted to the antisense strand. The bold sequences will generate the restriction sites that anneal to a BbsI cut pSpCas9(BB)-2A-GFP (PX458) backbone vector.

112 FUNCTIONAL CHARACTERIZATION OF RS621940

Table S2. Genotyping rs621940 of peripheral blood mononuclear cell samples and cell lines.

sample ID Sybr green qPCR Sanger sequencing SPB001 CC CC SPB002* CC CC SPB003 CG CG SPB004* CG CG SPB005 CG SPB006 CC SPB007 CC SPB008* CC SPB009 CC SPB010 CG SPB011* CC SPB012* CC CC SPB013 CC SPB014 CG 4 SPB015* CC SPB016* CC SPB017 CC SPB018* CG SPB019 CC SPB020 CC SPB021 CG SPB022* CG CG SPB023* CG CG SPB024 CC CC SPB025* CC SPB026 CC SPB027* CC SPB028 CC SPB029* CG SPB030* CC MEG-01* CC K562* CC

* no heterozygous GFI1B 3’UTR SNPs

113 CHAPTER 4

SUPPLEMENTARYFigure S1 FIGURES

rs621940

Scale 10 kb hg19 chr9: 135,855,000 135,860,000 135,865,000 135,870,000 135,875,000 135,880,000 GFI1B GFI1B 4.88 _ 100 vertebrates Basewise Conservation by PhyloP * * * 100 Vert. Cons 0 - -4.5 Chromatin State Segmentation by HMM from ENCODE/Broad K562 ChromHMM 127 _ K562 DNAseI UW 0 200 _ K562 H3K4me1 ENCODE/SYDH 0 200 _ K562 H3K4me1 ENCODE/Broad 0 200 _ K562 H3K4me2 ENCODE/Broad 0 200 _ K562 H3K4me3 ENCODE/Broad 0 200 _ K562 H3K9ac ENCODE/Broad 0 200 _ K562 H3K9me1 ENCODE/Broad 0 200 _ K562 H3K9me3 ENCODE/Broad 0 200 _ K562 H3K27ac ENCODE/Broad 0 200 _ K562 H3K27me3 ENCODE/Broad 0 200 _ K562 H3K36me3 ENCODE/Broad 0 200 _ K562 H3K79me2 ENCODE/Broad 0 200 _ K562 H4K20me1 ENCODE/Broad 0 200 _ K562 HDAC1 ENCODE/Broad 0 200 _ K562 HDAC2 ENCODE/Broad 0 200 _ K562 LSD1 ENCODE/Broad 0 200 _ K562 PLU1 ENCODE/Broad 0 200 _ K562 RBBP5 ENCODE/Broad 0 200 _ K562 P300 ENCODE/Broad 0 200 _ K562 Pol2 ENCODE/Broad 0 200 _ K562 CTCF ENCODE/Broad 0 200 _ K562 EGR1 HudsonAlpha 0 200 _ K562 TAL1 Stanford 0 200 _ K562 CMYC Standford 0 200 _ K562 HDAC2 HudsonAlpha 0 200 _ K562 GATA1 UCD 0 200 _ K562 GATA2 UCD 0 200 _ K562 MAX HudsonAlpha 0 200 _ K562 ZBTB7A HudsonAlpha 0

Figure S1. Rs621940 is located in a predicted regulatory element downstream of GFI1B. UCSC genome browser screenshot https://genome.ucsc.edu/cgi-bin/hgTracks?db=hg19&lastVirtModeType=default&lastVirtModeExtra >>

114 FUNCTIONAL CHARACTERIZATION OF RS621940

State=&virtModeType=default&virtMode=0&nonVirtPosition=&position=chr9%3A135849904-135883721) showing 100 vertebrates Basewise Conservati on by PhyloP; Chromati n State Segmentati on by Hidden Markov Model (HMM) from ENCODE/Broad (the colors indicate the diff erent states such as weak/strong promoter (pink/red), weak/ strong enhancer (yellow/orange), transcripti onal transiti on/transcripti onal elongati on/weak transcribed (green)); DNaseI signal of open chromati n from University of Washington (UW); histone modifi cati ons by ChIP signal from ENCODE/SYDH and ENCODE/Broad; binding of transcripti onal regulators by ChIP-seq signal from ENCODE/Broad, UCD, Stanford, and HudsonAlpha. All experiments were performed in K562 cells. The rs621940 locus is indicated with a black line. Previously identi fi ed GFI1B regulatory elements at 12.5 kb, 16 kb, and 17.5 kb downstream of the GFI1B startFigure codon S2 are indicated with asterisks.

A

GFI1B rs621940 encompassing element

F sgRNA1.1 sgRNA2.1 qPCR primers gRNA1.2 sgRNA2.2 R

B C 4 1-2 1-3 1-6 1-9 1-11 2-4 2-10 WT albumin rs621940 locus Ct-value Ct-value WT bulk 24,77 21,76 1-2 24,63 22,21 1-3 24,97 23,27 1-6 24,66 22,9 1-9 24,24 >40 1-11 24,29 39,42 2-4 24,01 23,11 2-10 24,17 >40

Figure S2. Selecti on of homozygous rs621940 locus deleted clones. (A) Schemati c overview of sgRNA locati ons used to delete the rs621940 locus in K562 cells, and primer locati ons to validate if the rs621940 locus was deleted in all alleles. sgRNA1.1 was combined with sgRNA1.2 to generate 1-x clones, and sgRNA2.1 was combined with sgRNA2.2 to generate 2-x clones. A PCR with primers (F and R) outside the deleted region was used to select clones that at least had one allele deleted. A Sybr Green qPCR was performed with primers inside the deleted region to validate if the deleti on had occurred on all alleles. (B) Agarose gel with PCR products (primers F and R) from K562 clones. K562 wild type (WT) bulk DNA was taken along as negati ve control. PCR product size 1-x clones: ~440 bp, 2-x clones: ~360 bp, and WT: 2025 bp. Lack of 2025 bp WT fragment amplifi cati on in clones 1-2, 1-3, 1-6, and 2-4 could be caused by preferenti al amplifi cati on of the smaller fragment. (C) Ct values of Sybr Green qPCR with primers in rs621940 locus deleti on on DNA of K562 clones. K562 WT bulk DNA was taken along as control. An albumin qPCR was performed to check for equal input.

115 CHAPTER 4

Figure S3

A B 

          

    

    
               



Figure S3. Deletion of rs621940 locus does not affect expression of other close by genes. Relative TSC1 (A) and GTF3C5 (B) expression in K562 CRISPR-Cas9 genome edited clones that have a deletion of the ~1.6 kb rs621940 locus (n=2). K562 wild type (WT) bulk cells were taken along as control, and TSC1 and GTF3C5 expression was normalized to GAPDH expression. TSC1 is the gene upstream of GFI1B and its first exon is ~50 kb upstream of rs621940. GTF3C5 is the downstream gene of GFI1B and its first exon is ~36 kb downstream of rs621940.

116 FUNCTIONAL CHARACTERIZATION OF RS621940

SUPPLEMENTARY REFERENCES

1. Mandoli A, Prange K, Martens JH. Genome-wide binding of transcripti on factors in inv(16) acute myeloid leukemia. Genom Data. 2014;2(170-172. 2. Kent WJ, Sugnet CW, Furey TS, et al. The human genome browser at UCSC. Genome Res. 2002;12(6):996-1006. 3. Haeussler M, Zweig AS, Tyner C, et al. The UCSC Genome Browser database: 2019 update. Nucleic Acids Res. 2018; 4. Consorti um EP. An integrated encyclopedia of DNA elements in the human genome. Nature. 2012;489(7414):57- 74. 5. Dignam JD, Lebovitz RM, Roeder RG. Accurate transcripti on initi ati on by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 1983;11(5):1475-1489. 6. Hubner NC, Nguyen LN, Hornig NC, Stunnenberg HG. A quanti tati ve proteomics tool to identi fy DNA-protein interacti ons in primary cells or blood. J Proteome Res. 2015;14(2):1315-1329.

4

117

5 General discussion CHAPTER 5

120 GENERAL DISCUSSION

THESIS OBJECTIVE

Thrombocytopenia and platelet dysfuncti on resulti ng in bleedings is a frequent occurring problem in the clinic and can have various causes. To bett er prevent and treat these platelet defects we need more insight in the molecular pathways underlying megakaryocyte development and platelet formati on. GFI1B is one of the transcripti on factors crucial for megakaryopoiesis, and inherited variants in this protein lead to a bleeding diathesis with a multi tude of megakaryocyte and platelet defects. In this thesis we investi gated the molecular mechanism of the bleeding disorder causing GFI1B-Q287* variant that was earlier identi fi ed by our research group. Furthermore, we studied the molecular pathways downstream of GFI1B-Q287*, to identi fy GFI1B regulated processes during megakaryopoiesis and platelet formati on. The identi fi cati on of GFI1B-Q287* molecular mechanisms and downstream pathways may eventually contribute to targeted drug development for thrombocytopenia and thrombopathy, and help to understand and maybe prevent drug-induced thrombocytopenia. There are sti ll many cases with inherited bleeding and platelet defects for which the underlying geneti c defect is unknown. The identi fi cati on of molecular pathways driving megakaryopoiesis can expand the panel of possible mutated genes in inherited platelet disorders and thereby improve molecular diagnosis. When a variant is found, determinati on of its pathogenicity is challenging especially in small families. To improve classifi cati on of inherited GFI1B variants we developed assays testi ng the damaging eff ect of newly identi fi ed inherited GFI1B variants on its functi on. These assays were used to gain insight in the molecular mechanisms of the newly identi fi edGFI1B variants. 5 GFI1B is not only pathologically involved in inherited bleeding and platelet disorders, but also in hematological malignancies. Deregulated GFI1B expression and a somati c mutati on disrupti ng GFI1B functi on are associated with myeloid malignancies. This highlights the importance of balanced GFI1B expression, which is normally mediated by multi ple epigeneti c regulators binding the GFI1B promoter and downstream regulatory elements. In this thesis we also investi gated whether the clonal hematopoiesis and myeloproliferati ve neoplasm (MPN) predisposing G-allele of rs621940, located ~8 kb downstream of GFI1B, aff ectsGFI1B expression and GFI1B auto-repression. In the rest of this chapter I will touch upon several topics related to our research stated above and presented in chapters 2-4. Furthermore, I will show some additi onal non-published data and highlight important remaining research questi ons.

121 CHAPTER 5

MOLECULAR MECHANISMS OF GFI1B VARIANTS IDENTIFIED IN CASES WITH INHERITED BLEEDING AND PLATELET DISORDERS.

Nonsense and frameshift variants causing a truncation of the DNA binding domain In the last five years several types of GFI1B variants have been identified in patients with inherited bleeding and platelet disorders.1-8 The first identified variants cause a heterozygous truncation of the DNA binding domain. These proven pathogenic variants (G272fs4, Q287*1, H294fs2) act in a dominant- negative manner over wild type GFI1B, likely by sequestering the LSD1 containing CoREST co-repressor complex with its N-terminal SNAG domain (Chapter 2, Figure 1A-B). At the protein level there are at least two GFI1B isoforms expressed, full length GFI1B-p37 and the shorter isoform GFI1B-p32. GFI1B-p32 lacks intact zinc finger 1 and 2 due to (coding) exon 4 skipping. The dominant-negative truncating variants will be present in both GFI1B isoforms, as they are located in DNA-binding zinc finger 5 and the loop between zinc finger 4 and 5. The SNAG domain is still intact in both isoforms and GFI1B-p32 also interacts with the CoREST complex,9 suggesting that mutant GFI1B-p37/p32 will inhibit wild type GFI1B-p37/p32. In line with this, overexpression of GFI1B–p32-Q287* resulted in a similar increase of MEG-01 expansion as GFI1B-p37-Q287* (Figure 2).

Variants affecting expression of GFI1B isoforms p37 and p32 Furthermore, a pathogenic homozygous truncating variant has been described in non-DNA binding zinc finger 1 (S185fs).8 This variant only affects GFI1B-p37 because GFI1B-p32 lacks intact zinc finger 1 and 2. Thus, S185fs results in loss of GFI1B-p37. Homozygously mutated family members have a severe bleeding diathesis, while heterozygous family members are unaffected, indicating that GFI1B-p37 is crucial for platelet development. Apparently, the remaining GFI1B-p32 levels in the homozygous mutated family members are not sufficient for normal platelet development, suggesting that GFI1B-p32 is not involved in this process. However, the expression level of GFI1B-p32 is ~5 times lower than that of GFI1B-p37.9 Therefore it is possible that the total protein level of GFI1B, independent of the isoform, is causing the phenotypes in GFI1B-S185fs patients, instead of absence of GFI1B-p37. So far, GFI1B-p32 has only been described to regulate erythropoiesis.9 We observed that megakaryoblastic MEG-01 cells overexpressing GFI1B-p32 are growing at a similar rate as non-transduced cells, in contrast to GFI1B-p37 transduced cells which are overgrown by non-transduced cells (Figure 3). This shows that GFI1B-p32 does not affect megakaryoblast expansion, and supports the theory that GFI1B-p32 does not control megakaryopoiesis. The generation of megakaryocyte differentiation models exclusively expressing GFI1B-p32 at a level comparable to the p37 isoform may proof this assumption.

122 GENERAL DISCUSSION

Figure 1

A

GSE1 HMG20B

PHF21A RCOR1 HDAC1/2 LSD1 P2 K8 H3K27ac GFI1B H3K9ac

DNA H3K4me1/2

Histones

B GSE1 HMG20B

PHF21A RCOR1 GFI1B- HDAC1/2 LSD1 Q287*

H3K27ac GFI1B H3K9ac 5 DNA H3K4me1/2

Histones

C GSE1 ? HMG20B RCOR1 PHF21A ZF1/2 missense variant HDAC1/2 LSD1

H3K27ac GFI1B H3K9ac

DNA H3K4me1/2

Histones Figure 1. Molecular mechanism of GFI1B wild type and variants. (A) GFI1B interacts via LSD1 with the CoREST complex (LSD1, RCOR1, HDAC1/2, GSE1, HMG20B PHF21A). Proline 2 (P2) and lysine 8 (K8) of GFI1B are crucial this interacti on. LSD1 can demethylate H3Kme1/2. However it remains to be investi gated if this is also possible when LSD1 is recruited by GFI1B, because H3K4me1/2 and GFI1B bind the same pocket of LSD1. HDAC1/2 can deacetylate H3K27ac and H3K9ac. (B) GFI1B-Q287* cannot bind DNA anymore and inhibits wild type GFI1B by sequestering the CoREST complex. (C) The mechanism of zinc fi nger 1 (Znf1) missense variants is sti ll unclear. The mutated proteins can bind DNA, but the repressive functi on is disrupted. This could be caused by a lost interacti on with a yet to be identi fi ed co-factor.

123 CHAPTER 5

Figure 2


   

  "  

  "    

  !       
$#

Figure 2. Overexpression of Q287* mutated GFI1B-p37 and GFI1B–p32 result in increased MEG-01 expansion. Expansion competition cultures of MEG-01 cells retrovirally transduced with empty vector (EV), GFI1B-P37+Q287*- flag, or GFI1B-p32+Q287*-flag. Fold change of GFP% to GFP% at day 5 (first GFP measurement) is presented on the y-axis. Results show mean ± standard error of the mean (n=5).

Missense variants In addition, several GFI1B missense variants (C165F,5 C168F,7 H181Y, and R184P) have been described in non-DNA binding zinc finger 1. Most of these variants are of unknown significance as they do not necessarily lead to bleedings on their own, although they do affect GFI1B function. Identification of additional families will help to better classify these variants. GFI1B variants C165F, C168F and H181Y affect zinc coordinating amino acids suggesting that the tertiary structure of zinc finger 1 is disrupted by these variants and thereby GFI1B function. Indeed, although the DNA binding domain is still intact, C168F, H181Y, and R184P were reported to decrease the transcriptional repression at endogenous promoters (Chapter 3).7 The majority of these zinc finger 1 missense variants is associated with a bleeding diathesis and/or thrombocytopenia. In contrast, individuals with a heterozygous splice site variant resulting in expression of GFI1B-p32 (lacks intact zinc finger 1) instead of GFI1B-p37, do not suffer from a bleeding diathesis or thrombocytopenia.7, 8 This indicates that loss of zinc finger 1 in one allele is less damaging than missense variants in this region, suggesting that the missense variants are not merely loss of function but do somehow interfere with wild type GFI1B or have a changed function. Possibly the missense mutated proteins have lost the interaction with a co-(transcription) factor and inhibit wild type GFI1B by occupying the target sites or might even have new target sites (Figure 1C). Further studies are necessary to unravel the molecular mechanism of these missense variants and clarify the function of zinc finger 1.

124 GENERAL DISCUSSION

Finally, a reported homozygous missense variant in zinc fi nger 6 (L308P) may result in a mild bleeding diathesis with macrothrombocytopenia and a reducti on in δ-granules,6 indicati ng that the th6 zinc fi nger is also important for GFI1B and its role in megakaryopoiesis and platelet development. This is supported by our observati on that GFI1B without zinc fi nger 6 does not inhibit MEG-01 proliferati on like wild type GFI1B (Figure 4). Further studies are required to unravel the molecular mechanism of this variant and theFigure normal 3 functi on of zinc fi nger 6.


 



   

     



         
!  Figure 3. GFI1B-p32 does not inhibit expansion of MEG-01. Expansion competi ti on cultures of MEG-01 cells 5 retrovirally transduced with empty vector (EV), GFI1B-P37-fl ag, or GFI1B-p32-fl ag. Fold change of GFP% to GFP% at day 5 (fi rst GFP measurement) is presented on the y-axis. Results show mean ± standard error of the mean (n=5), and two-tailed paired t-tests were performed on day 26 to determine stati sti cal signifi canceP * <0.05 Figure 4


    

 

 
! 
  

         
"

Figure 4. GFI1B without zinc fi nger 6 does not inhibit expansion of MEG-01. Expansion competi ti on culture of MEG-01 cells retrovirally transduced with empty vector (EV), GFI1B-fl ag, or GFI1B-fl ag without zinc fi nger 6 (ZF6). Fold change of GFP% to GFP% at day 5 (fi rst GFP measurement) is presented on the y-axis. All constructs are in GFI1B-p37 isoform context. N=1

125 CHAPTER 5

GFI1B REGULATES GENE EXPRESSION BY RECRUITING THE COREST COMPLEX

GFI1B interacts with LSD1 via its N-terminal SNAG domain.10 This interaction can be disrupted by introducing a P2A or K8A mutation in GFI1B (Figure 1A). In Chapter 2 we showed that GFI1B-P2A and GFI1B-K8A have lost the biochemical function of gene repression and the biological function of inhibiting MEG-01 expansion. Furthermore, disruption of the GFI1B-LSD1 interaction with the small molecule GSK-LSD1 disrupted the differentiation of primary megakaryoblasts. Together, this indicates that the GFI1B-LSD1 interaction plays a crucial role in regulating megakaryoblast proliferation and differentiation. GFI1B pull-downs in MEG-01 cells showed that GFI1B associates with LSD1 and other components of the CoREST co-repressor complex such as RCOR1 (CoREST), HDAC1/2, PHF21A (BHC80), and HMG20B (BRAF35) (Figure 1). The other proteins found, GSE1, RCOR3, and ZMYM2/3, are also known LSD1 interactors.11 ZMYM2/3 and PHF21A have not been reported in complex with GFI1B before.10 Remarkably, ZMYM3 (binding to GFI1B-Q287*) was identified as the only significantly differentially interacting protein between GFI1B and GFI1B-Q287*. Whether the ZMYM3 interaction with GFI1B-Q287* is relevant for disease pathogenesis remains to be seen. HDAC1/2 and LSD1 are the histone modifying proteins in the CoREST complex. HDAC1/2 bind the ELM2 and SANT domain of RCOR1, and deacetylates histone 3 lysines.12 LSD1 consists of a SWIRM domain that contributes to protein-protein interactions, the amine oxidase-like (AOL) domain with the catalytic activity, and a tower domain interacting with RCOR1. The AOL domain has two subdomains, one binds the cofactor flavine-adenine dinucleotide (FAD) and the other recognizes substrates. Through a FAD-dependent oxidative reaction, LSD1 demethylates H3K4me1/2. However, LSD1 can also act as an co-activator through binding of the androgen or estrogen receptor and H3K9me1/2 demethylation, or demethylate non-histone proteins such as DNMT1 and TP53. In hematopoietic cells, LSD1 is recruited to chromatin by transcription factors such as GFI1B, GFI1, TAL1, GATA2 and SALL4.13 The SNAG domain sequence of GFI1B and GFI1 mimics the histone 3 tail and binds the same pocket in LSD1.14 Interestingly, the SNAG domain has a stronger affinity for LSD1 than histone 3, suggesting that GFI1B must be released from LSD1 before H3K4me1/2 demethylation can take place. Furthermore, GFI1B-p32 needs to be methylated at lysine 8 for LSD1 and CoREST complex recruitment.9 Whether this is also the case for GFI1B-p37 remains to be seen. We did show that lysine 8 is important for the LSD1-GFI1B-p37 interaction (Chapter 2). Possibly LSD1 demethylates GFI1B-K8 and is thereby released from GFI1B, making the substrate pocket available for the histone 3 tail. The methyl transferase that methylates GFI1B-K8 is still unknown. The dynamics and role of different members of the CoREST complex in combination with GFI1B is not exactly clear. Based on current knowledge GFI1B could recruit the CoREST complex to DNA via the SNAG domain-LSD1 interaction, after which HDAC1 and HDAC2 first deacetylate the histone 3 tail. RCOR1 recognizes hypoacetylated histone 3, bridging LSD1 with nucleosomal substrates.11 RCOR1 and HMG20B can also bind DNA (non specifically),15, 16 stabilizing the complex which might be enough for GFI1B to release LSD1 and opening the LSD1 substrate pocket for H3K4me1/2. In addition to DNA,

126 GENERAL DISCUSSION

HMG20B also interacts with PHF21A.16 PHF21A binds unmethylated H3K4 and stabilizes the associati on of LSD1 with chromati n, consequently promoti ng the acti vity of LSD1 as a transcripti onal repressor. Binding of PHF21A to demethylated H3K4 might be important for LSD1 to mediate demethylati on of the neighbouring nucleosome.17 There is also data which suggests that some CoREST complex components inhibit LSD1 functi on, for example PHF21A18 and RCOR3.19 RCOR3 inhibits LSD1 demethylati on acti vity and competes with RCOR1. In line with this, LSD1 and RCOR1 silencing suppressed erythro-megakaryocyti c diff erenti ati on in fetal liver hematopoieti c progenitors, while RCOR3 silencing sti mulated diff erenti ati on of these cells.19 Furthermore, HMG20B silencing causes spontaneous erythroid diff erenti ati on in mouse fetal liver cells. In contrast to silencing of LSD1 and GFI1B, which inhibits erythroid diff erenti ati 20on. Altogether this suggests that there are diff erent CoREST complexes at work during erythro-megakaryocyte development. ChIP sequencing of GFI1B, CoREST complex components, and histone modifi cati ons could identi fy the combinati ons of factors at GFI1B target genes and their epigeneti c acti ons during megakaryopoiesis.

LSD1 inhibitors to investi gate the GFI1B-CoREST complex dynamics. LSD1 is overexpressed in approximately 60% of the acute myeloid leukemia (AML) cases. Recent publicati ons suggest that LSD1 contributes to leukemia development and propagati on by inducing an arrest in myeloid diff erenti ati on and promoti ng proliferati on. A number of phase I/II clinical trials are ongoing to investi gate the safety and effi cacy of LSD1 inhibitors in AML. Overall these compounds appear 5 to exert a promising anti -leukemic eff ect by inhibiti ng proliferati on and restoring myeloid diff erenti ati on in AML cells. There is an increased effi cacy for leukemia subtypes carrying MLL and AML1 (RUNX1) rearrangements, NPM1 variants, and erythroid/megakaryoblasti c diff erenti ati on block.21 Most LSD1 inhibitors have been designed by modifying the structure of tranylcypromine ((±)-trans-2-phenylcyclopropylamine; abbreviated 2-PCPA), an anti depressant originally developed to target monoamine oxidase A and B, which are structurally related to LSD1. Tranylcypromine derivati ves use LSD1’s catalyti c machinery to covalently modify FAD and irreversible inacti vate LSD1, with the assumpti on that these LSD1 inhibitors block the histone demethylase acti vity.22, 23 Indeed, H3K4me1/2 levels are increased upon LSD1-inhibitor treatment in diff erent cell types.24, 25 In contrast, two separate studies treati ng either THP1 or HEL cells with tranylcypromine derivati ves OG86 or NCD38 showed unchanged H3K4me1/2 levels (LSD1 target), and increased H3K9ac and/or H3K27ac levels (HDAC1/2 targets).26, 27 This could suggest that LSD1 rather functi ons as a scaff olding protein instead of a demethylase in these leukemia cell lines, and that the HDAC acti vity of the CoREST complex is more important than LSD1’s demethylase acti vity. It would be interesti ng to investi gate if H3K4me1/2 levels are unchanged aft er LSD1 inhibitor treatment because LSD1 is mainly recruited by GFI1B or GFI1 in these cell lines. This could be possible because the SNAG domain of GFI1B and GFI1 binds the same pocket as the histone 3 tail, making it impossible for LSD1 to demethylate H3K4me1/2 when recruited by these transcripti on factors. Additi on of an LSD1 inhibitor in this scenario would not induce changed H3K4me1/2 levels.

127 CHAPTER 5

Furthermore, multiple studies in leukemia cell lines have shown that tranylcypromine derivative LSD1 inhibitors (OG86, NCD38, T-3775440, GSK-LSD1) inhibit the interaction with the SNAG domain proteins GFI1B and GFI1.26-28 Of note, NCD38 also slightly reduced the interaction between LSD1 and RUNX1.26 Upon OG86 treatment in THP1 cells, LSD1, RCOR1, and GFI1 are released from chromatin, suggesting that GFI1 requires the CoREST complex for stable chromatin binding, as has been reported for SNAI1 (another SNAG-domain protein).27 In contrast, HEL cells treated with NCD38 showed no change in the amount of GFI1B binding, suggesting that GFI1B stably interacts with chromatin without the CoREST complex.26 Additional studies are therefore needed to validate the stability of GFI1B and GFI1 on chromatin without the CoREST complex. In summary, LSD1 has a scaffolding function in addition to its demethylase activity, and LSD1-inhibitors can target both these activities making them ideal to study GFI1B function.

TARGETS AND PATHWAYS EXPLAINING PHENOTYPES IN GFI1B-RELATED BLEEDING AND PLATELET DISORDERS.

Patients with inherited dominant-negative GFI1B variants often suffer from a bleeding disorder with macrothrombocytopenia, a reduction in α- and δ-granule numbers, platelet CD34 expression, and high numbers of dysmorphic megakaryocytes in the bone marrow. The multiple defects suggest that GFI1B is involved in many processes during megakaryopoiesis. Insight into downstream GFI1B pathways could further our understanding of platelet formation and provide new therapeutic targets for (inherited) thrombocytopenia.

GFI1B targets identified in cell lines andGfi1b- null mice Only a few direct GFI1B targets have been identified in megakaryopoiesis so far. These includeRGS18 ,29 FERMT3, and TLN1.30 Interestingly, inherited FERMT3 variants cause defective platelet aggregation resulting in a bleeding diathesis.31 Rgs18 is a GTPase activating protein (GAP) that binds activated G-proteins and stimulate their GTPase activity, thereby terminating G-protein signaling. GATA1, a known interaction partner of GFI1B, is reported to repress RGS18 in erythroid cells.29 It would be interesting to study whether GATA1 and GFI1B repress RGS18 together in erythropoiesis and megakaryopoiesis. FERMT3 and TLN1 encode for Kindlin3 and Talin1, respectively. Kindlin3 and Talin1 are cytoskeletal proteins that bind cytoplasmic tails of integrins, particularly the 3β subunit (CD61) of the αIIbβ3 integrin complex (CD41/CD61), which is the fibrinogen/fibronectin receptor and crucial for platelet aggregation. These interactions lead to activation of the integrin molecule, thereby greatly increasing their affinity for ligands. Furthermore, Kindlin3 and Talin1 stimulate megakaryocyte differentiation likely by remodeling the cytoskeleton. Interestingly, preliminary results from Singh et al. showed that Rgs18 interacts with Kindlin3 and Talin1 in megakaryocytes, which suggests the existence of a cytoskeletal associated signaling network downstream of GFI1B which may synergistically drive megakaryopoiesis.30 These studies are in line with work of Beauchemin et al. showing that Gfi1b-null cells have a poor response (cell spreading)

128 GENERAL DISCUSSION

to integrin acti vati on. For instance integrin3 β is upregulated leading to more αIIbβ3 (CD41/CD61) complex on the membrane. Surprisingly, Gfi 1b-null megakaryocytes were unresponsive to fi brinogen and fi bronecti n, suggesti ng that internal signaling is disturbed. In additi on, PAK4 which regulates acti n cytoskeleton and microtubule expression is strongly increased in Gfi 1b-null cells. Inhibiti on of type II PAKs (e.g. PAK 4) completely rescued the responsiveness of Gfi 1b-null megakaryocytes to integrin acti vati on, but not their ability to form proplatelets. The disturbed proplatelet formati on in Gfi 1b-null megakaryocytes is at least parti ally due to a of lack α-tubulin. Because of this the cells are incapable to polymerize β-tubulin into microtubules.32

Aff ected pathways in GFI1B-Q287* iPSC-derived megakaryocyti c cells To identi fy GFI1B regulated pathways crucial in megakaryopoiesis, we generated induced pluripotent stem cell (iPSC) lines from an individual with the dominant-negati ve GFI1B-Q287* variant and a healthy volunteer. These cells were diff erenti ated towards megakaryocytes and their proteomes were compared. In GFI1B-Q287* iPSC-derived megakaryocyti c cells we observed a down-regulati on of IFN-γ signaling proteins compared to control cells. IFN-γ and its downstream eff ector STAT1 sti mulate megakaryocyte diff erenti ati on (polyploidizati on) and platelet producti33, on, 34 so it would be interesti ng to further validate if GFI1B regulates IFN-γ signaling pathways. Furthermore, GFI1B-Q287* iPSC-derived megakaryocyti c cells revealed signifi cantly increased protein levels of the enti re minichromosome complex (MCM2-7), which is required for DNA replicati on and cell cycle progression. Several studies including our own (Chapter 2) have shown that MCM proteins are down-regulated upon polyploidizati on 5 and further megakaryocyte diff erenti ati 35,on. 36 Thus, failure of down-modulati on of DNA-replicati on associated genes as a consequence of GFI1B-Q287* might contribute to the lack of polyploidizati on in the GFI1B-Q287* iPSC-derived megakaryocyti c cells. Furthermore, the transcripti on factor MEIS1 showed consistent expression in GFI1BQ287* iPSC-derived megakaryocyti c cells, while it was never detected in control iPSC-derived cells. MEIS1 is a key player in megakaryocyte diff erenti ati on and forced MEIS1 expression in CD34+ cells results in larger and more colonies in CFU-MK assays.37 The increased MEIS1 expression might therefore contribute to the increased proliferati on observed for GFI1B-Q287* iPSC-derived megakaryocyti c cells. MEIS1 was earlier indenti fi ed as a GFI1B target gene inmurine erythrocyti c cells, but specifi cally not in murine megakaryocyti c cells.38 Therefore, it would be interesti ng to investi gate whether MEIS1 is a GFI1B target in human cells. To validate these candidate genes and identi fy more GFI1B target genes in iPSC-derived megakaryocytes, our research group plans to perform ChIP sequencing of GFI1B, CoREST complex components, and histone modifi cati ons. Finally, rescue experiments may be performed to determine whether deregulati on of these genes by GFI1B-Q287* can explain the increased proliferati on and disturbed diff erenti ati on of iPSC-derived megakaryocytes.

Aff ected pathways in GFI1B-Q287* primary platelets With platelets representi ng the fi nal stage of megakaryopoiesis, we generated proteome profi les of primary platelets from control and GFI1B-Q287* individuals. In line with the reported α-granule

129 CHAPTER 5

deficiency,1 α-granule proteins such as VWF, THBS1, and PF4, showed markedly reduced levels in GFI1B-Q287* platelets. However, from our data in Chapter 2 it was not possible to conclude whether this is caused by a defect in generation of these proteins, the formation of α-granules, or trafficking of the α-granules to proplatelets. Megakaryocytes of GFI1B-Q287* patients contained a few poorly developed α-granules,1 and expression of proteins involved in formation of α-granules was unchanged or even increased in the platelets of GFI1B-Q287* patients. As described above, Gfi1b-null cells have defective microtubule formation and proteins associated with the gene ontology term cytoskeleton were underrepresented in platelets of GFI1B-Q287* patients. This could be supportive for the theory of affected α-granule trafficking causing reduced α-granule numbers in platelets of GFI1B-Q287* patients. In addition to decreased α-granule proteins, many other proteins were deregulated. Gene ontology terms associated with down-regulated proteins in GFI1BQ287* platelets were related to platelet functions, including wound healing, adhesion, cytoskeleton, and vesicle secretion. Proteins elevated in GFI1B-Q287* platelets were particularly enriched for gene ontology terms on more basic cell processes, such as mitochondrial function, metabolic function, ubiquitination, and RNA processing. These gene ontology terms already suggest that the GFI1B-Q287* megakaryocytes were not developed well when generating these platelets. This was confirmed by comparing protein profiles of healthy maturing megakaryocytes with GFI1B-Q287* patient derived platelets. Around 80% of down-regulated proteins in GFI1B-Q287* platelets showed a clear pattern of up-regulation in differentiating megakaryocytes, whereas the proteins that showed up-regulation in GFI1B-Q287* platelets were generally down- modulated during megakaryocyte differentiation (~60%). As platelets represent the terminal stage of megakaryocyte maturation, our proteomic data show that the GFI1B-Q287* platelets resemble poorly differentiated megakaryocytes.

Comparing the GFI1B deficient models The generated proteomes of primary platelets, iPSC-derived megakaryocytic cells, and normal megakaryopoiesis are of great value as they more closely represent what is happening in human (patho)physiology compared to the cell line and mice studies reported before. The proteins Talin1, Kindlin3, and Rgs18 encoded by the earlier identified GFI1B target genes were detected in iPSC-derived megakaryocytic cells and primary platelets. None of the three proteins were differentially expressed in iPSC-derived megakaryocytes, and only Talin1 and Rgs18 protein levels were significantly different between control and GFI1B-Q287* platelets. Since GFI1B is a repressive transcription factor, one would expect direct target genes to be up-regulated in GFI1B-Q287* platelets. In contrast, Talin1 and Rgs18 expression was down-regulated. Furthermore, PAK4 was up-regulated and α-tubulin down-regulated in Gfi1b deficient mouse megakaryocytes. However, PAK4 was not detected and α-tubulin not consistently differentially expressed in iPSC-derived megakaryocytic cells, normal megakaryocytes, or primary platelets. In summary the different GFI1B deficient models do not always correlate with what is found in GFI1B-Q287* cells and platelets. This could be explained by the differences in cell type or species, but possibly also because the dominant negative GFI1B mutation not only inhibits GFI1B function when it sequesters the CoREST complex but also other transcription factors relying on this complex.

130 GENERAL DISCUSSION

CHALLENGES IN CLASSIFICATION OF NEW VARIANTS IN INHERITED BLEEDING AND PLATELET DISORDERS.

Due to high-throughput next generati on sequencing approaches many new gene variants have been identi fi ed in inherited bleeding and platelet disorders. Standards and guidelines for the classifi cati on of new gene variants have been published by the American College of Medical Geneti cs (ACMG) and Genomics and the Associati on for Molecular Pathology (AMP),39 and similar recommendati ons have been made by EuroGentest and the European Society of Human Geneti cs.40 The classifi cati ons are based on evidence such as variant allele frequency in a control populati on, co-occurrence with a known pathogenic variant in another gene, in-silico predicti ons on the eff ect of the variant on nucleoti de and amino acid level, segregati on of the variant with disease, and functi onal studies. The functi onal studies produce strong evidence for either ‘benign’ or ‘pathogenic’ classifi cati on, and are crucial in the interpretati on of variants in small families. Therefore it is very important that the functi onal studies are carefully validated and reproducible in showing a damaging eff ect on the gene or gene product, and preferably model a phenotype of the pati ent. In Chapters 2 and 3 we developed assays to investi gate the damaging eff ect of variants on GFI1B functi on. Luciferase reporter assays show whether the biochemical GFI1B functi on of inducing gene repression is aff ected by using exogenous promoters. A more physiological model was also developed where this same functi on is tested on endogenous GFI1B target promoters. Furthermore we designed an expansion competi ti on assay using the megakaryoblasti c cell line MEG-01, which shows the biological 5 GFI1B functi on of inhibiti ng cell expansion. Introducti on of the dominant-negati ve GFI1B-Q287* variant sti mulates MEG-01 expansion, and therefore models the increased megakaryocyte expansion observed in bone marrow of GFI1B-Q287* aff ected individuals. To further validate the expansion assay, we tried to identi fy the underlying process (apoptosis or proliferati on) that could explain why MEG-01 cells with exogenous GFI1B are overgrown by non-transduced cells, and the opposite occurs with cells expressing GFI1B-Q287*. However, we could not detect clear diff erences in apoptosis or the amount of cells in S-phase. Recently, we also performed the same expansion assay in another megakaryoblasti c cell line called CMK. We observed that the CMK cells expressing exogenous GFI1B were much faster overgrown than MEG-01 cells with exogenous GFI1B. However, the GFI1B-Q287* transduced CMK cells behaved more like empty vector transduced cells, and did not overgrow the non-transduced cells as was observed in MEG-01 (Figure 5A). Since the eff ect of exogenous GFI1B is faster and more pronounced in CMK, we hypothesized that these cells are overgrown because they undergo apoptosis. By staining the CMK cells with Annexin-V, we indeed observed a signifi cant higher percentage of apoptoti c cells in the exogenous GFI1B culture. The increased percentage of apoptoti c cells was not observed when introducing the pathogenic GFI1B-Q287* variant, or the variants of unknown signifi cance GFI1B-H181Y and GFI1B- R184P (Figure 5B). Apoptoti c assays in CMK cells could also be used to investi gate the biological functi on of GFI1B in a broader context. The advantage for CMK cells being that the phenotype is faster presented, however the dominant-negati ve eff ect of GFI1B-Q287* is not visible.

131 CHAPTER 5

For future functional test development, it would be desired to invest in models that show affected proplatelet formation or α-granule formation/trafficking because these phenotypes directly cause the bleeding diathesis in GFI1B mutated individuals. The increased megakaryocyte expansion observed in bone marrow of GFI1B-Q287* individuals and modeled in MEG-01 cells, is further upstream in the process of plateletFigure development. 5

A


     

  

      

   !      
#"

B


    

    

   

 !

         

         Figure 5. GFI1B induces apoptosis in CMK cells. (A) Expansion competition cultures of CMK cells retrovirally transduced with empty vector (EV), GFI1B-flag wild type, or GFI1B-Q287*-flag. Fold change of GFP% to GFP% at day 5 (first GFP measurement) is presented on the y-axis. Results show mean ± standard error of the mean (n=3). (B) Percentage of Annexin V positive CMK cells 6 days after retroviral transduction with EV, GFI1B-flag, GFI1B-H181Y- flag, GFI1B-R184P-flag or GFI1B-Q287*vectors. Results show mean ± standard deviation (n=3). Two-tailed paired t-tests were performed to determine statistical significance.P * <0.05 All constructs are in GFI1B-p37 isoform context.

132 GENERAL DISCUSSION

COLLABORATION OF GFI1B, GATA1, RUNX1 AND FLI1 EXPLAINING THE OVERLAP IN PHENOTYPES.

Inherited variants in transcripti on factors GFI1B, GATA1, RUNX1, and FLI1 cause bleeding and platelet disorders with thrombocytopenia and granule defects. For variants in GFI1B, GATA1, and RUNX1 a reducti on of α-granules has been described, in contrast to FLI1 where the α-granules arefused. Other overlapping phenotypes are platelet CD34 expression for RUNX1 and GFI1B variants, platelet MYH10 expression for RUNX1 and FLI1 variants, and enlarged platelets with hyperproliferati on of megakaryocytes for GFI1B and GATA1 variants. This overlap in phenotypes could be explained by the fact that the factors regulate each other’s expression and interact to regulate transcripti on (RUNX1 interacts with GATA1 and FLI1,41, 42 GFI1B interacts with GATA1,43, 44 and chromati n interacti on studies have shown many common targets for GATA1, RUNX1 and FLI1).45 To identi fy GFI1B, GATA1, RUNX1, and FLI1 co-regulated pathways underlying common phenotypes, our research group plans to compare proteome profi les of platelets from pati ents with inherited variants in these transcripti on factors. However, it would maybe be more informati ve to use megakaryocyti c cells in which also chromati n binding, histone marks, and transcriptomics can be assessed, such as pati ent derived iPSC cells or by CRISPR-Cas9 mediated introducti on of the variants in healthy iPSC lines to have a similar geneti c background. We already studied one overlapping phenotype of GATA1 (V205M, G208S, R216Q, D218G, D218N) and GFI1B (Q287*, L308P) variants: the increased megakaryocyte numbers in the bone marrow 5 of these pati ents. Since GFI1B and GATA1 repress the anti -apoptoti c protein Bcl-XL together,44 we were wondering if disturbed apoptosis is underlying the increased megakaryocyte numbers in these pati ents. We studied GFI1B and GATA1 induced apoptosis in the acute megakaryoblasti c leukemia cell line CMK. Of note, CMK cells have a GATA1 mutati on preventi ng full length GATA1 expression, resulti ng in sole expression of the naturally occurring shorter isoform GATA1s (lacks the N-terminal transacti vati on domain, amino acids 1-83). Earlier we showed that GFI1B induced apoptosis, and that this eff ect was lost for GFI1B-Q287* (Figure 5B). Overexpression of GATA1 in CMK cells resulted in an increased percentage of apoptoti c cells, like what was observed for GFI1B. However, in contrast to GFI1B, pathogenic variants in GATA1 (V205M, R216Q, and D218G) sti ll induced apoptosis like wild type GATA1. This could suggest that increased megakaryocyte numbers in the bone marrow of pati ents with inherited GATA1 variants are not caused by disturbed apoptosis, in contrast to GFI1B-Q287*. The percentage of apoptoti c cells in the CMK culture expressing exogenous GATA1s was decreased compared to the culture expressing exogenous GATA1, indicati ng that the N-terminal transacti vati on domain is crucial for apoptoti c functi on of GATA1 (Figure 6). These results are in line with an earlier report showing that the region between amino acids 54-110, which is parti ally lacking in GATA1s, is required to dampen cell growth.46

133 CHAPTER 5

Figure 6


    

  

 

   


 

 

             

Figure 6. The N-terminal transactivation domain of GATA1 is crucial for its pro-apoptotic function in CMK cells. Percentage of Annexin V positive CMK cells 6 days after retroviral transduction with empty vector (EV), HA-GATA1, HA-GATA1s, HA-GATA1-V205M, HA-GATA1-R216Q, and HA-GATA1-D218G vectors. Results show mean ± standard deviation (n=3). Two-tailed paired t-tests were performed to determine statistical significance.P * <0.05

FUNCTIONAL CHARACTERIZATION OF THE RS621940 LOCUS ~8 KB DOWNSTREAM OF GFI1B.

GFI1B is not only pathologically involved in inherited bleeding and platelet disorders, but also in hematological malignancies. For example GFI1B expression is often increased in peripheral blood cells from leukemia and MPN patients.47, 48 Also, reduced GFI1B expression and function was associated with leukemia development and a worse prognosis for myelodysplastic syndrome (MDS) and acute myeloid leukemia (AML) patients.49, 50 This highlights the importance of balanced GFI1B expression, which is normally mediated by multiple epigenetic regulators such as GFI1B , GATA1, and TAL1 binding theGFI1B promoter and downstream regulatory elements. Up until now, three elements located 12.5 kb, 16 kb and 17.5 kb downstream of GFI1B have been identified that likely regulateGFI1B expression. In chapter 4 we investigated whether the clonal hematopoiesis and MPN predisposing G-allele of rs621940, located ~8 kb downstream of GFI1B, affects GFI1B expression and auto-repression. The rs621940 locus binds many hematopoietic transcription factors in the leukemia cell line K562 including ERG1, GATA1/2 and TAL1, and is enriched for the enhancer associated histone mark H3K4me1 (ENCODE consortium). In addition, we observed clear GFI1B enrichment at the rs621940 locus in MEG-01 cells. Luciferase reporter assays suggest a repressive effect of the rs621940 encompassing element on the GFI1B promoter. However, the two rs621940-alleles did not affect GFI1B promoter activity differently in these assays. In addition, deletion of this region in K562 cells caused no consistent difference in GFI1B expression nor auto-repression. Finally, GFI1B expression from the two rs621940-alleles was not consistently different in mononuclear cells of healthy individuals. In conclusion, our studies find no evidence that rs621940 affectsGFI1B expression nor auto-repression.

134 GENERAL DISCUSSION

The fact that many transcripti on factors bind the rs621940 locus suggests that this region is involved in gene regulati on. Furthermore, we identi fi ed 24 proteins that bind diff erenti ally to the two rs621940-alleles in MEG01 cells, suggesti ng a functi onal consequence of the polymorphism rs621940. Possibly GFI1B is regulated by the rs621940 element in cell types we did not investi gate, or the element regulates expression of another gene.

CONCLUSION

Several GFI1B variants have been identi fi ed in individuals with inherited bleeding and platelet disorders. Heterozygous GFI1B variants leading to a truncati on of the DNA binding domain are most frequent and truly pathogenic. Work in this thesis showed that the truncati ng variant GFI1B-Q287* inhibits wild type GFI1B in a dominant-negati ve manner by sequestering the CoREST complex. The proteome studies on iPSC derived megakaryocytes and primary platelets from control and GFI1B-Q287* individuals, identi fi ed many deregulated pathways and are valuable data sets for future studies into molecular pathways driving megakaryopoiesis and platelet formati on. Furthermore, we developed assays that show whether new variants have a damaging eff ect on the biochemical and biological functi on of GFI1B. The functi onal assays contributed to the classifi cati on of Q89fs, C168F, H181Y, and R184P as variants of unknown signifi cance. These variants aff ect GFI1B functi on through protein truncati on or disrupti on of zinc fi nger 1, but are not necessarily suffi cient to cause bleedings on their own. Finally, we identi fi ed 5 the rs621940 locus ~8 kb downstream of GFI1B as a putati ve regulatory DNA element. However, in our studies we did not fi nd evidence showing that this region regulatesGFI1B expression. Further research is required to identi fy the functi onal consequence of the clonal hematopoiesis and MPN predisposing polymorphism rs621940.

135 CHAPTER 5

REFERENCES

1. Monteferrario D, Bolar NA, Marneth AE, et al. A dominant-negative GFI1B mutation in the gray platelet syndrome. N Engl J Med. 2014;370(3):245-253. 2. Stevenson WS, Morel-Kopp MC, Chen Q, et al. GFI1B mutation causes a bleeding disorder with abnormal platelet function. J Thromb Haemost. 2013;11(11):2039-2047. 3. Marneth AE, van Heerde WL, Hebeda KM, et al. Platelet CD34 expression and alpha/delta-granule abnormalities in GFI1B- and RUNX1-related familial bleeding disorders. Blood. 2017;129(12):1733-1736. 4. Kitamura K, Okuno Y, Yoshida K, et al. Functional characterization of a novel GFI1B mutation causing congenital macrothrombocytopenia. J Thromb Haemost. 2016;14(7):1462-1469. 5. Uchiyama Y, Ogawa Y, Kunishima S, et al. A novel GFI1B mutation at the first zinc finger domain causes congenital macrothrombocytopenia. British journal of haematology. 2017; 6. Ferreira CR, Chen D, Abraham SM, et al. Combined alpha-delta platelet storage pool deficiency is associated with mutations in GFI1B. Molecular genetics and metabolism. 2017;120(3):288-294. 7. Rabbolini DJ, Morel-Kopp MC, Chen Q, et al. Thrombocytopenia and CD34 expression is decoupled from alpha- granule deficiency with mutation of the first growth factor-independent 1B zinc finger.J Thromb Haemost. 2017;15(11):2245-2258. 8. Schulze H, Schlagenhauf A, Manukjan G, et al. Recessive grey platelet-like syndrome with unaffected erythropoiesis in the absence of the Splice Isoform GFI1B-p37. Haematologica. 2017;102(9):102(109):e375-e378. 9. Laurent B, Randrianarison-Huetz V, Frisan E, et al. A short Gfi-1B isoform controls erythroid differentiation by recruiting the LSD1-CoREST complex through the dimethylation of its SNAG domain. Journal of cell science. 2012;125(Pt 4):993-1002. 10. Saleque S, Kim J, Rooke HM, Orkin SH. Epigenetic regulation of hematopoietic differentiation by Gfi-1 and Gfi- 1b is mediated by the cofactors CoREST and LSD1. Mol Cell. 2007;27(4):562-572. 11. Maiques-Diaz A, Somervaille TC. LSD1: biologic roles and therapeutic targeting. Epigenomics. 2016;8(8):1103- 1116. 12. Kelly RD, Cowley SM. The physiological roles of histone deacetylase (HDAC) 1 and 2: complex co-stars with multiple leading parts. Biochem Soc Trans. 2013;41(3):741-749. 13. Magliulo D, Bernardi R, Messina S. Lysine-Specific Demethylase 1A as a Promising Target in Acute Myeloid Leukemia. Front Oncol. 2018;8(255. 14. Lin Y, Wu Y, Li J, et al. The SNAG domain of Snail1 functions as a molecular hook for recruiting lysine-specific demethylase 1. EMBO J. 2010;29(11):1803-1816. 15. Barrios AP, Gomez AV, Saez JE, et al. Differential properties of transcriptional complexes formed bythe CoREST family. Mol Cell Biol. 2014;34(14):2760-2770. 16. Rivero S, Ceballos-Chavez M, Bhattacharya SS, Reyes JC. HMG20A is required for SNAI1-mediated epithelial to mesenchymal transition. Oncogene. 2015;34(41):5264-5276. 17. Lan F, Collins RE, De Cegli R, et al. Recognition of unmethylated histone H3 lysine 4 links BHC80 to LSD1- mediated gene repression. Nature. 2007;448(7154):718-722. 18. Shi YJ, Matson C, Lan F, Iwase S, Baba T, Shi Y. Regulation of LSD1 histone demethylase activity by its associated factors. Molecular cell. 2005;19(6):857-864. 19. Upadhyay G, Chowdhury AH, Vaidyanathan B, Kim D, Saleque S. Antagonistic actions of Rcor proteins regulate LSD1 activity and cellular differentiation. Proc Natl Acad Sci U S A. 2014;111(22):8071-8076. 20. Esteghamat F, van Dijk TB, Braun H, et al. The DNA binding factor Hmg20b is a repressor of erythroid differentiation. Haematologica. 2011;96(9):1252-1260.

136 GENERAL DISCUSSION

21. Niwa H, Umehara T. Structural insight into inhibitors of fl avin adenine dinucleoti de-dependent lysine demethylases. Epigeneti cs. 2017;12(5):340-352. 22. Schmidt DM, McCaff erty DG. trans-2-Phenylcyclopropylamine is a mechanism-based inacti vator of the histone demethylase LSD1. Biochemistry. 2007;46(14):4408-4416. 23. Yang M, Culhane JC, Szewczuk LM, et al. Structural basis for the inhibiti on of the LSD1 histone demethylase by the anti depressant trans-2-phenylcyclopropylamine. Biochemistry. 2007;46(27):8058-8065. 24. Mohammad HP, Smitheman KN, Kamat CD, et al. A DNA Hypomethylati on Signature Predicts Anti tumor Acti vity of LSD1 Inhibitors in SCLC. Cancer Cell. 2015;28(1):57-69. 25. Schenk T, Chen WC, Gollner S, et al. Inhibiti on of the LSD1 (KDM1A) demethylase reacti vates the all-trans- reti noic acid diff erenti ati on pathway in acute myeloid leukemia. Nature medicine. 2012;18(4):605- 611. 26. Yamamoto R, Kawahara M, Ito S, et al. Selecti ve dissociati on between LSD1 and GFI1B by a LSD1 inhibitor NCD38 induces the acti vati on of ERG super-enhancer in erythroleukemia cells. Oncotarget. 2018;9(30):21007-21021. 27. Maiques-Diaz A, Spencer GJ, Lynch JT, et al. Enhancer Acti vati on by Pharmacologic Displacement of LSD1 from GFI1 Induces Diff erenti ati on in Acute Myeloid Leukemia. Cell reports. 2018;22(13):3641-3659. 28. Ishikawa Y, Gamo K, Yabuki M, et al. A Novel LSD1 Inhibitor T-3775440 Disrupts GFI1B-Containing Complex Leading to Transdiff erenti ati on and Impaired Growth of AML Cells. Molecular cancer therapeuti cs. 2017;16(2):273-284. 29. Sengupta A, Upadhyay G, Sen S, Saleque S. Reciprocal regulati on of alternati ve lineages by Rgs18 and its transcripti onal repressor Gfi 1b. Journal of cell science. 2016;129(1):145-154. 30. Singh D, Upadhyay G, Sengupta A, et al. Cooperati ve Sti mulati on of Megakaryocyti c Diff erenti ati on by Gfi1b Gene Targets Kindlin3 and Talin1. PLoS One. 2016;11(10):e0164506. 5 31. Kuijpers TW, van de Vijver E, Weterman MA, et al. LAD-1/variant syndrome is caused by mutati ons in FERMT3. Blood. 2009;113(19):4740-4746. 32. Beauchemin H, Shooshtarizadeh P, Vadnais C, Vassen L, Pastore YD, Moroy T. Gfi 1b controls integrin signaling- dependent cytoskeleton dynamics and organizati on in megakaryocytes. Haematologica. 2017;102(3):484-497. 33. Duek A, Lundberg P, Shimizu T, et al. Loss of Stat1 decreases megakaryopoiesis and favors erythropoiesis in a JAK2-V617F-driven mouse model of MPNs. Blood. 2014;123(25):3943-3950. 34. Huang Z, Richmond TD, Muntean AG, Barber DL, Weiss MJ, Crispino JD. STAT1 promotes megakaryopoiesis downstream of GATA-1 in mice. J Clin Invest. 2007;117(12):3890-3899. 35. Haldar S, Roy A, Banerjee S. Diff erenti al regulati on of MCM7 and its intronic miRNA cluster miR-106b-25 during megakaryopoiesis induced polyploidy. RNA biology. 2014;11(9):1137-1147. 36. Raslova H, Kauff mann A, Sekkai D, et al. Interrelati on between polyploidizati on and megakaryocyte diff erenti ati on: a gene profi ling approach. Blood. 2007;109(8):3225-3234. 37. Zeddies S, Jansen SB, di Summa F, et al. MEIS1 regulates early erythroid and megakaryocyti c cell fate. Haematologica. 2014;99(10):1555-1564. 38. Chowdhury AH, Ramroop JR, Upadhyay G, Sengupta A, Andrzejczyk A, Saleque S. Diff erenti al transcripti onal regulati on of meis1 by Gfi 1b and its co-factors LSD1 and CoREST. PLoS One. 2013;8(1):e53666. 39. Richards S, Aziz N, Bale S, et al. Standards and guidelines for the interpretati on of sequence variants: a joint consensus recommendati on of the American College of Medical Geneti cs and Genomics and the Associati on for Molecular Pathology. Genet Med. 2015;17(5):405-424. 40. Matt hijs G, Dierking A, Schmidtke J. New EuroGentest/ESHG guidelines and a new clinical uti lity gene card format for NGS-based testi ng. European journal of human geneti cs : EJHG. 2016;24(1):1.

137 CHAPTER 5

41. Huang H, Yu M, Akie TE, et al. Differentiation-dependent interactions between RUNX-1 and FLI-1 during megakaryocyte development. Molecular and cellular biology. 2009;29(15):4103-4115. 42. Elagib KE, Racke FK, Mogass M, Khetawat R, Delehanty LL, Goldfarb AN. RUNX1 and GATA-1 coexpression and cooperation in megakaryocytic differentiation. Blood. 2003;101(11):4333-4341. 43. Huang DY, Kuo YY, Chang ZF. GATA-1 mediates auto-regulation of Gfi-1B transcription in K562 cells. Nucleic Acids Res. 2005;33(16):5331-5342. 44. Kuo YY, Chang ZF. GATA-1 and Gfi-1B interplay to regulate Bcl-xL transcription. Mol Cell Biol. 2007;27(12):4261- 4272. 45. Tijssen MR, Cvejic A, Joshi A, et al. Genome-wide analysis of simultaneous GATA1/2, RUNX1, FLI1, and SCL binding in megakaryocytes identifies hematopoietic regulators. Dev Cell. 2011;20(5):597-609. 46. Kuhl C, Atzberger A, Iborra F, Nieswandt B, Porcher C, Vyas P. GATA1-mediated megakaryocyte differentiation and growth control can be uncoupled and mapped to different domains in GATA1. Mol Cell Biol. 2005;25(19):8592- 8606. 47. Vassen L, Khandanpour C, Ebeling P, et al. Growth factor independent 1b (Gfi1b) and a new splice variant of Gfi1b are highly expressed in patients with acute and chronic leukemia. Int J Hematol. 2009;89(4):422-430. 48. Elmaagacli AH, Koldehoff M, Zakrzewski JL, Steckel NK, Ottinger H, Beelen DW. Growth factor-independent 1B gene (GFI1B) is overexpressed in erythropoietic and megakaryocytic malignancies and increases their proliferation rate. Br J Haematol. 2007;136(2):212-219. 49. Thivakaran A, Botezatu L, Hones JM, et al. Gfi1b: a key player in the genesis and maintenance of acute myeloid leukemia and myelodysplastic syndrome. Haematologica. 2018;103(4):614-625. 50. Anguita E, Gupta R, Olariu V, et al. A somatic mutation of GFI1B identified in leukemia alters cell fate via a SPI1 (PU.1) centered genetic regulatory network. Dev Biol. 2016;411(2):277-286.

138 GENERAL DISCUSSION

5

139

6 English summary CHAPTER 6

142 ENGLISH SUMMARY

When a blood vessel is damaged due to injury or surgery a process called haemostasis prevents signifi cant blood loss. Blood platelets, or thrombocytes, have a central role in this process by forming a plug that stops the bleeding. Platelets are derived from large cells that reside in the bone marrow, called megakaryocytes. During megakaryocyte development, or megakaryopoiesis, early megakaryoblasts undergo endomitosis to become polyploid. This is followed by cytoplasmic maturati on, during which the demarcati on membrane system and α/δ-granules are formed. The δ-granules contain small molecules such as calcium, magnesium and adenine nucleoti des (ATP, ADP) that sti mulate platelet aggregati on. The α-granules store the proteins needed for coagulati on and haemostasis. Mature megakaryocytes generate multi ple, long branching extensions called proplatelets (containing the granules) that elongate into the sinusoidal blood vessels of the bone marrow. Finally, the blood fl ow will mediate the release of platelets into the blood stream. The above described formati on of platelets is defecti ve in inherited platelet disorders with thrombocytopenia and/or thrombopathy resulti ng in a bleeding diathesis. Over 60 genes have been found mutated in various types of inherited platelet disorders. However, there are sti ll many pati ents that do not receive a molecular diagnosis. In this thesis we investi gated molecular mechanisms and downstream pathways of the transcripti on factor GFI1B, which is one of the mutated proteins in inherited platelet disorders. Identi fi cati on of molecular pathways relevant for megakaryopoiesis and platelet formati on could expand the panel of possibly mutated genes and thereby improve the molecular diagnosis success rate of inherited platelet disorders. In additi on, insight in molecular mechanisms and pathways can contribute to targeted drug development for thrombocytopenia or thrombopathy, and help to understand and hopefully prevent drug-induced thrombocytopenia. GFI1B is crucial for emergence and maintenance of hematopoieti c stem cells, erythropoiesis, megakaryopoiesis, and platelet formati on. Loss of Gfi 1b in adult mice blocks terminal megakaryocyte diff erenti ati on, and inheritedGFI1B variants can cause a bleeding diathesis with macro-thrombocytopenia 6 and multi ple platelet and megakaryocyte defects. The phenotypes diff er between the type of GFI1B variants. The most severe phenotypes are found in pati ents with truncati ng variants resulti ng in loss of the full-length GFI1B isoform (p37), the phenotypes caused by dominant-negati ve truncati ng variants are milder, and pati ents with missense variants someti mes do not even have a bleeding diathesis. Therefore, it is not clear if the reported missense variants are causati ve for all phenotypes. In additi on, the molecular mechanism of dominant-negati ve truncati ng and missense variants are unknown. GFI1B is a repressive transcripti on factor with an N-terminal SNAG domain that recruits the CoREST complex via LSD1. The C-terminus contains six zinc fi ngers of which 3-5 are essenti al for DNA binding. In chapter 2 we investi gated the molecular properti es of the heterozygous bleeding-associated GFI1B-Q287* variant. This dominant-negati ve variant has lost its DNA-binding functi on, but can sti ll interact with the LSD1 containing CoREST complex. The interacti on with LSD1 is crucial for both wild type GFI1B and the pathogenic functi on of GFI1B-Q287*. Together with the fact that disrupti on of the GFI1B- LSD1 interacti on using a small molecule induces GFI1B-Q287* like phenotypes, this strongly suggests that dominant-negati ve truncati ng variants like GFI1B-Q287* inhibit wild type GFI1B by sequestering the CoREST complex. In additi on, we used GFI1B-Q287* to identi fy GFI1B regulated pathways crucial

143 CHAPTER 6

for megakaryopoiesis and platelet function. To study megakaryopoiesis, we generated induced pluripotent stem cell (iPSC) lines from a healthy donor and GFI1B-Q287* patient, and differentiated them towards megakaryocytes. By comparing the proteome of healthy and GFI1B-Q287* iPSC- derived megakaryocytic cells we found that proteins involved in cell division and proteins involved in interferon signaling were deregulated. To identify pathways involved in platelet production and function we generated proteome profiles of primary platelets from healthy and GFI1B-Q287* individuals. GFI1B-Q287* platelets showed reduced expression of proteins implicated in platelet function such as α-granule and cytoskeleton proteins, and elevated expression of proteins normally downregulated during megakaryocyte differentiation. These findings contribute to our knowledge on GFI1B function in both normal megakaryopoiesis and inherited platelet disorders. In chapter 3 we performed a molecular and clinicopathological characterization of eight GFI1B variants previously identified in cases with unexplained bleeding and/or platelet defects. All variants are located in non-DNA binding domains: the intermediary domain (D23N, Q89fs, G139S), zinc finger 1 (C168F, H181Y, R184P), the loop between zinc finger 1 and 2 (R190W), or zinc finger 2 (G198S). We developed a cell expansion assay to show the effect of variants on GFI1B function. This assay together with the clinicopathological characterization classified Q89fs, C168F, H181Y, and R184P as variants of unknown significance (VUS). They affect GFI1B function through protein truncation or disruption of zinc finger 1, but are not necessarily sufficient to cause bleedings on their own. Still, their identification and documentation will help to distinguish pathological from non-pathological GFI1B variants and increase our understanding of GFI1B functional domains. In addition to inherited platelet disorders, GFI1B also has a pathological role in myeloid malignancies. For example, GFI1B expression levels are often upregulated in peripheral blood cells from patients with leukemia and myeloproliferative neoplasms (MPN). Also, reduced GFI1B expression and function was associated with leukemia development and a worse prognosis for myelodysplastic syndrome (MDS) and acute myeloid leukemia (AML) patients. This highlights the importance of balanced GFI1B expression, which is normally mediated by multiple epigenetic regulators such as GFI1B, GATA1, and TAL1 binding the GFI1B promoter and downstream regulatory elements. Up until now, three elements located 12.5 kb, 16 kb and 17.5 kb downstream of GFI1B have been identified that could regulate GFI1B expression. In chapter 4 we investigated whether the clonal hematopoiesis and the MPN-associated polymorphism rs621940, located ~8 kb downstream of GFI1B, affects GFI1B expression. Studies from the ENCODE consortium showed that many epigenetic regulators bind the rs621940 locus inK562 cells, including GATA1 and TAL1. In addition, we observed clear GFI1B binding to the rs621940 locus in MEG-01 cells. Pull-down experiments using DNA-sequences with either rs621940-allele followed by protein identification using mass spectrometry detected 24 differentially bound proteins in MEG- 01 cells, but GFI1B was not among these. Luciferase reporter assays using the GFI1B promoter and a GFI1B downstream region encompassing rs621940, suggest that the rs621940 locus inhibits the GFI1B promoter. This effect was stronger for the C-allele than the G-allele. However, there was no significant difference in GFI1B auto-repression or GATA1-mediated stimulation between the rs621940

144 ENGLISH SUMMARY

C- and G-allele. Also, deleti on of a 1.6 kb fragment encompassing rs621940 in K562 cells did not alter GFI1B expression or GFI1B auto-repression. Absolute GFI1B expression did not diff er between the rs621940[CC] and rs621940[CG] samples in primary peripheral blood mononuclear cells from healthy donors. Finally, the eff ect of rs621940 on allelic GFI1B expression in mononuclear cells was analyzed. Also, targeted deep RNA sequencing did not detect consistent diff erences between rs621940 alleles on allelic GFI1B expression. These studies fi nd no evidence that rs621940 aff ects GFI1B expression or GFI1B auto-repression. This calls into questi on whether the G-allele of rs621940 predisposes for myeloid transformati on through alteredGFI1B expression. In summary, we showed that inherited GFI1B variants with disturbed DNA binding inhibit wild type GFI1B by sequestering the CoREST complex. Our proteome studies on iPSC derived megakaryocytes and primary platelets from control and GFI1B mutated individuals, identi fi ed many deregulated pathways and are valuable data sets for future studies specifying GFI1B regulated pathways. Furthermore, our studies showed that GFI1B zinc fi nger 1 missense variants disturb GFI1B functi on, but do not necessarily cause bleedings on their own. Publicati on of these variants contributes to improved molecular diagnosis of pati ents with inherited platelet disorders. Finally, we identi fi ed the rs621940 locus as a possible regulatory DNA element, but further studies are required to identi fy the functi onal consequence of rs621940. Possibly GFI1B is regulated by the rs621940 element in cell types we did not investi gate, or the element regulates expression of another gene.

6

145

7 Nederlandse samenvatti ng CHAPTER 7

148 NEDERLANDSE SAMENVATTING

Wanneer een bloedvat beschadigd is door een verwonding of operati e zal hemostase voorkomen dat er te veel bloed verloren gaat. Bloedplaatjes, of trombocyten, hebben een centrale rol in dit proces door een prop te vormen die de bloeding stopt. Bloedplaatjes worden gevormd vanuit grote voorlopercellen in het beenmerg, genaamd megakaryocyten. Tijdens de ontwikkeling van megakaryocyten, of megakaryopoiese, ondergaan onrijpe megakaryoblasten endomitose waardoor ze polyploïd worden. Dit wordt gevolgd door rijping van het cytoplasma waarbij het demarcati e membraan systeem en α- en δ-granulen gevormd worden. De δ-granulen bevatt en moleculen zoals calcium, magnesium en adenine nucleoti den (ADP, ATP) die bloedplaatjes aggregati e sti muleren. De α-granulen bevatt eneiwitt belangrijk voor bloedstolling en hemostase. Uiteindelijk zullen rijpe megakaryocyten meerdere lange vertakte uitstulpingen genaamd proplaatjes door de wand van kleine bloedvaten in het beenmerg steken. De proplaatjes bevatt en de bovengenoemde granules. Door de kracht van de bloedstroming worden de uiteindelijke bloedplaatjes afgescheiden van de proplaatjes uitstulpingen. Het hierboven beschreven proces van bloedplaatjesvorming is verstoord in pati ënten met erfelijke bloedplaatjes aandoeningen, wat resulteert in een verhoogde bloedingsneiging met te weinig bloedplaatjes (trombocytopenie) en/of slecht functi onerende bloedplaatjes (trombopathie). Meer dan 60 genen zijn gemuteerd gevonden bij verschillende erfelijke vormen van bloedplaatjesaandoeningen. Echter, er zijn nog steeds veel pati ënten waarbij de onderliggende mutati e niet gevonden wordt. In dit proefschrift hebben we onderzoek gedaan naar de moleculaire eigenschappen van de transcripti efactor GFI1B, welke één van de gemuteerde eiwitt en is in erfelijke bloedplaatjes aandoeningen. Identi fi cati e van moleculaire paden relevant voor megakaryopoiese en bloedplaatjesvorming kan de groep van mogelijk gemuteerde genen vergroten en daarmee de moleculair-geneti sche diagnose verbeteren bij erfelijke bloedplaatjesaandoeningen. Verder zal inzicht in de moleculaire mechanismen en paden bijdragen aan het identi fi ceren van doelen voor gerichte therapie-ontwikkeling voor trombocytopenie/ trombopathie. Daarnaast kan dit ook van belang zijn bij het begrijpen en misschien voorkomen van medicati e-geïnduceerde trombocytopenie. Het GFI1B eiwit is cruciaal voor het ontstaan en behouden van hematopoieti sche stamcellen, erytropoiese, megakaryopoiese, en bloedplaatjesvorming. Verlies van Gfi 1b in volwassen muizen blokkeert de terminale diff erenti ati e van megakaryocyten, en erfelijke GFI1B varianten kunnen 7 resulteren in een verhoogde bloedingsneiging met trombocytopenie, en meerdere bloedplaatjes- en megakaryocyt-afwijkingen. De ernst van de bloedingsneiging hangt af van het type mutati e. De meest ernsti gste bloedingsneigingen worden gevonden bij pati ënten waarbij de grootste isovorm van GFI1B (genoemd p37) niet meer tot expressie komt. De fenotypen van dominant-negati eve varianten die niet in staat zijn DNA te binden zijn iets milder, en pati ënten met missense varianten buiten het DNA-bindend domein hebben soms niet eens een duidelijk verhoogde bloedingsneiging. Voor de gerapporteerde missense varianten is het dan ook niet alti jd duidelijk of zij verantwoordelijk zijn voor alle fenotypen. Daarnaast is nog onbekend hoe gemuteerd GFI1B de megakaryocyt- en plaatjesontwikkeling verstoort. GFI1B is een represserende transcripti efactor met een N-terminaal SNAG domein welke het CoREST eiwitcomplex rekruteert via het LSD1 eiwit. De C-terminus van GFI1B bevat zes zink vingers waarvan zink vinger 3-5 essenti eel zijn voor DNA binding. In hoofdstuk 2 hebben we het moleculaire

149 CHAPTER 7

mechanisme van de heterozygote GFI1B-Q287* variant onderzocht. Deze dominant-negatieve variant heeft zijn DNA-bindende functie verloren, maar kan nog steeds een interactie aangaan met LSD1 en de rest van het CoREST complex. Ons onderzoek toont aan dat het wegvangen van LSD1 door mutant GFI1B-Q287* een belangrijke rol speelt bij de pathogenese. Daarnaast induceert chemische verstoring van de GFI1B-LSD1 interactie in primaire megakaryoblasten fenotypen welke ook gevonden zijn in GFI1B-Q287* muteerde megakaryocyten. Samen laten deze experimenten zien dat dominant-negatieve truncerende varianten zoals GFI1B-Q287*, wild type GFI1B remmen door het CoREST complex weg te vangen. Verder hebben we GFI1B-Q287* gebruikt om GFI1B gereguleerde biologische paden te identificeren die belangrijk zijn voor megakaryopoiese en bloedplaatjesfunctie. Om megakaryopoiese te bestuderen hebben we geïnduceerde pluripotente stamcel (iPSC) lijnen gemaakt van een gezonde donor en een GFI1B-Q287* patiënt, en deze in de megakaryocytaire richting gedifferentieerd. Door de volledige eiwit expressieprofielen (proteoom) van gezonde en GFI1B-Q287* megakaryocyten te vergelijken, hebben we gevonden dat eiwitten met een rol in celdeling en interferon signalering gedereguleerd waren. Om paden te identificeren die belangrijk zijn voor bloedplaatjesproductie en -functie hebben we een proteoom gegenereerd van bloedplaatjes afkomstig van gezonde controles en een GFI1B-Q287* patiënt. GFI1B-Q287* bloedplaatjes lieten een verlaagde expressie zien van eiwitten belangrijk voor bloedplaatjesfunctie zoals α-granulen and cytoskeleteiwitten, en een verhoogde expressie van eiwitten die normaal laag zijn in rijpe megakaryocyten. Deze bevindingen dragen bij aan onze kennis over GFI1B functie in normale megakaryopoiese en erfelijke bloedplaatjes aandoeningen. In hoofdstuk 3 hebben we een moleculaire en clinicopathologische karakterisatie gedaan van acht GFI1B varianten die eerder gevonden zijn in casussen met onverklaarbare bloedingen en/of bloedplaatjes defecten. Alle varianten bevinden zich in niet-DNA bindende domeinen: het intermediaire domein (D23N, Q89fs, G139S), zink vinger 1 (C168F, H181Y, R184P), de lus tussen zink vinger 1 en 2 (R190W), of in zink vinger 2 (G198S). Wij hebben een assay ontwikkeld die het effect van varianten op GFI1B functie kan laten zien. De resultaten van deze functionele test heeft samen met de clinicopathologische karakterisatie, varianten Q89fs, C168F, H181Y, en R184P geclassificeerd als “variants of unknown significance” (varianten met onbekende significantie, VUS). Deze varianten beïnvloeden GFI1B functie door een truncatie of verstoring van zink vinger 1, maar zijn op zichzelf niet per se voldoende om een verhoogde bloedingsneiging te veroorzaken. De karakterisering van deze varianten zal bijdragen aan een verbeterde pathologische classificatie van GFI1B varianten (zeker wanneer ze vaker gevonden worden) en onze kennis vergroten over de functionele GFI1B domeinen. Naast erfelijke bloedplaatjesaandoeningen heeft GFI1B ook een pathologische functie in myeloide maligniteiten. Zo is GFI1B expressie vaak verhoogd in bloedcellen van patiënten met leukemie en myeloproliferatieve neoplasmen (MPN). Daarnaast is verlaagde GFI1B expressie en/ of functie geassocieerd met leukemie ontwikkeling en een slechte prognose voor patiënten met myelodysplastich syndroom (MDS) en acute myeloide leukemie (AML). Dit benadrukt dat een goed gereguleerde GFI1B expressie cruciaal is. Normaal gesproken wordt dit gerealiseerd door binding van verschillende regulatoren zoals GFI1B, GATA1 en TAL1 aan de GFI1B promoter en verder weg liggende regulatoire DNA elementen. Tot nu toe zijn drie regio’s 12.5 kb, 16 kb en 17.5 kb stroomafwaarts van

150 NEDERLANDSE SAMENVATTING

GFI1B gevonden die waarschijnlijk GFI1B expressie reguleren. In hoofdstuk 4 hebben we onderzocht of het single nucleoti de DNA polymorfi sme rs621940, welke 8 kb stroomafwaarts van GFI1B ligt en geassocieerd is met klonale hematopoiese en MPN, GFI1B expressie beïnvloedt. Studies van het ENCODE consorti um in K562 cellen (erytroleukemie cellijn van een chronisch myeloide leukemie (CML) pati ënt) hebben aangetoond dat veel regulatoire eiwitt en zoals GATA1 en TAL1 rondom rs621940 aan DNA binden. Daarnaast tonen wij in hoofdstuk 4 een duidelijke GFI1B binding aan rondom rs621940 in MEG-01 cellen (megakaryocyt leukemie cellijn van een CML pati ënt). Vervolgens hebben we in MEG-01 cellen 24 additi onele eiwitt en geïdenti fi ceerd die binden rondom rs621940 en voorkeur hebben voor één van de twee allelen. GFI1B zat echter niet bij deze diff erenti eel bindende eiwitt en. Luciferase reporters assays die het eff ect laten zien van de rs621940 regio opGFI1B promoter acti viteit, suggereren dat de rs621940 regio de GFI1B promoter remt. Dit eff ect was sterker voor het C-allel dan het G-allel. Echter, er was geen signifi cant verschil in GFI1B repressie of GATA1 sti mulati e van de GFI1B promoter tussen het rs621940 C- en G-allel. Ook resulteerde deleti e van een 1.6 kb fragment rond het rs621940 locus niet in een consistent eff ect op GFI1B expressie of GFI1B auto-repressie in K562 cellen. In primaire perifere mononucleaire bloedcellen van gezonde donoren verschilde GFI1B expressie niet tussen de rs621940[CC] and rs621940[CG] monsters. Daarnaast was er in de rs621940[CG] monsters geen consistent verschil in allel-specifi eke GFI1B expressie gedetecteerd tussen het C- en G-allel. Onze experimenten hebben geen bewijs geleverd dat rs621940 GFI1B expressie of GFI1B auto-repressie beïnvloedt. Deze data trekken de theorie dat het G-allel van rs621940 predisponeert voor myeloide transformati e doorGFI1B expressie te veranderen in twijfel. Concluderend kan gesteld worden dat de in dit proefschrift beschreven hoofdstukken bijdragen aan een beter begrip van de functi e van normaal en gemuteerd GFI1B bij de ontwikkeling van megakaryocyten en bloedplaatjes.

7

151

8 Curriculum Vitae List of publicati ons RIMLS portf olio CHAPTER 8

154 CURRICULUM VITAE

CURRICULUM VITAE

Rinske van Oorschot werd geboren op 9 januari 1991 te ‘s-Hertogenbosch, maar groeide op in Zaltbommel. In 2009 haalde ze daar het VWO-diploma (profi el Natuur & Gezondheid) aan scholengemeenschap Cambium. Hierna is ze begonnen met de bachelor Moleculaire Levenswetenschappen aan de Radboud universiteit in Nijmegen. Deze werd afgerond in 2012 met een onderzoeksstage over reumatoïde artriti s bij dr. Joyce van Beers en prof. dr. Ger Pruijn op de afdeling Biomoleculaire Chemie, Radboud Insti tute for Molecular Life Sciences (RIMLS). Gedurende haar master Moleculaire Levenswetenschappen heeft ze ti jdens haar eerste masterstage onderzoek gedaan naar TET2 en IDH1/2 mutati es in acute myeloide leukemie bij dr. Leonie Kroeze en prof. dr. Joop Jansen van het Laboratorium Hematologie, Radboudumc. Dit werd gevolgd door een tweede masterstage over de functi e van blaaskanker risicopolymorfi smen op de afdeling Experimentele Urologie, RIMLS onder begeleiding van dr. Alexandra Dudek en dr. Gerald Verhaegh. Na afronding van haar master in 2014 is Rinske teruggekeerd naar het Laboratorium Hematologie van het Radboudumc voor haar promoti eonderzoek. Hier heeft ze onder begeleiding van dr. Bert van der Reijden en prof. dr. Joop Jansen onderzoek gedaan naar het moleculaire mechanisme van GFI1B mutati es in erfelijke bloedplaatjes aandoeningen en het eff ect van het polymorfi sme rs621940 op GFI1B expressie. De resultaten staan beschreven in dit proefschrift , zijn gepubliceerd in internati onale ti jdschrift en, en gepresenteerd op verschillende nati onale en internati onale congressen, waaronder het congres van de “American Society of Hematology (ASH)” in 2016. Gedurende haar promoti eonderzoek heeft zij het PhD programma van het RIMLS gevolgd, en hiervoor cursussen als “Management voor promovendi”, “Scienti fi c Writi ng”, “Loopbaan oriëntati e voor promovendi”, en “Solliciteren en Netwerken” afgerond.

8

155 LIST OF PUBLICATIONS

LIST OF PUBLICATIONS

1. R. van Oorschot, A.E. Marneth, S.M. Bergevoet, M.G.J.M. van Bergen, K. Peerlinck, C.E. Lentaigne, C.M. Millar, S.K. Westbury, R. Favier, W.N. Erber, E. Turro, J.H. Jansen, W.H. Ouwehand, H.L. McKinney, NIHR BioResource (collaborative group), K. Downes, K. Freson, B.A. van der Reijden. Inherited missense variants that affect GFI1B function do not necessarily cause bleeding diatheses. Haematologica. 2019 Jun;104(6):e260-e264

2. R. van Oorschot, M. Hansen, J.M. Koornneef, A.E. Marneth, S.M. Bergevoet, M.G.J.M. van Bergen, F. P.J. van Alphen, C. van der Zwaan, J.H.A. Martens, M. Vermeulen, P.W.T.C. Jansen, M.P.A. Baltissen, B.A.P. Laros-van Gorkom, H. Janssen, J.H. Jansen, M. von Lindern, A.B. Meijer, E. van den Akker, B.A. van der Reijden. Molecular mechanisms of bleeding disorder-associated GFI1B-Q287* mutation and its affected pathways in megakaryocytes and platelets. Haematologica. 2019 Jan 17. Epub ahead of print.

3. R. van Oorschot, M.G.J.M van Bergen, B.A. van der Reijden. Erfelijke bloedingneigingen met granule-defecten veroorzaakt door transcriptiefactormutaties. Nederlands Tijdschrift voor Hematologie 2019;16:113-21

4. R. van Oorschot, S.M. Bergevoet, A.O. de Graaf, E.L.R.T.M. Tönnissen, K. Neveling, P.W.T.C. Jansen, M.P.A. Baltissen, M. Vermeulen, A. Mandoli, J.H.A. Martens, J.H. Jansen, B.A. van der Reijden. Functional characterization of the clonal hematopoiesis and myeloproliferative neoplasm associated polymorphism rs621940 located downstream of GFI1B. To be submitted

156 RIMLS PORTFOLIO

RIMLS PORTFOLIO

Name PhD student: R. van Oorschot PhD period: 01-09-2014 unti l 31-08-2018 Department: Laboratory Medicine, LH Promotor(s): Prof.dr. J.H. Jansen Graduate school: Radboud Insti tute for Co-promotor(s): Dr. B.A. van der Reijden Molecular Life Sciences

TRAINING ACTIVITIES Year(s) ECTS a) Courses & Workshops - Introducti on day Radboudumc 2014 0.5 - RIMLS introducti on course 2014 2 - RIMLS PhD retreat #, #, #, * 2014-2018 3 - Technical fora 2014-2016 0.5 - Scienti fi c intergrity 2016 1 - Management for promovendi 2016 2 - Scienti fi c writi ng 2016-2017 3 - Loopbaanmanagement voor promovendi 2017 1 - Solliciteren en Netwerken 2018 1 b) Seminars & Lectures - Radboud research rounds 2014-2017 0.6 - Seminars 2014-2016 0.6 - BD horizon tour 2017 0.2 - Epigeneti cs and transcripti on regulati on meeti ngs 2017 0.2 c) (Inter)nati onal Symposia & Congresses - Radboud new fronti ers (4x) 2014-2017 4 - Oncology science day 2014 0.25 - Dutch Hematology congress 2015 0.5 - Dutch Hematology congress* 2016 0.75 - Dutch Hematology congress * 2017 0.75 - Dutch Hematology congress * 2018 0.75 - European Hematology Associati on (EHA) congress 2015 0.75 - Masterclass Molecular aspects of haematological disorders 2015 0.5 - Masterclass Molecular aspects of haematological disorders* 2016 0.75 - Masterclass Molecular aspects of haematological disorders* 2018 0.75 - American society of hematology (ASH) congress* 2016 1.5 - Confererence clonal disorders of haematopoiesis: journey towards the future 2017 0.25 d) Other - Journal club 2014-2016 1

TEACHING ACTIVITIES Year(s) ECTS e) Lecturing - 8 f) Other - Shared supervision honours student Nelleke Brouwer 2015 1 - Supervision bachelor (WO) student Marjan Poelhuis 2015-2016 1 - Supervision master student Feija Verstegen 2017 2 - Supervision bachelor (HBO) student Rüveyda Akmese 2017-2018 2

TOTAL 34.1

157

9 Dankwoord CHAPTER 9

160 DANKWOORD

“Do what you like, and like what you do. “ Dit stond op mijn favoriete T-shirt en de door mijn moeder geschreven kaart voor het behalen van mijn master. In dit laatste hoofdstuk wil ik graag iedereen bedanken die deze periode “leuk” heeft gemaakt. Ten eerste wil ik Bert bedanken voor zijn vertouwen in mij, zeker wanneer ik dit zelf niet meer had. Je moti verende speeches en oneindig enthousiasme zorgden ervoor dat ik alti jd weer vol positi eve energie onze maandevaluati es uitkwam. Tijdens deze gesprekken kon ik in het begin je vele ideeën en theorieën nog alleen maar volgen, maar nu ben ik zo ver dat ik echt mee kan doen en jou af en toe iets kan uitleggen. Jouw enthousiasme was niet alleen wetenschap gerelateerd. Je kon ook alti jd trots vertellen over je eigen/oppas kinderen, klusjes rondom het huis, en vakanti es (inclusief foto’s en google maps om alles te visualiseren). Ook wanneer ik weer eens toe was aan “vitamine sea”, wist je alti jd veel mooie plekken die ik na het surfen kon bezoeken in bijvoorbeeld de Algarve of op Lanzarote. Dit samen heeft ervoor gezorgd dat ik me vertrouwd en veilig voelde op de afdeling, en daar wil ik je heel erg voor bedanken. Joop, heel erg bedankt voor al je input, en je terugkerende vragen naar de (klinische) relevanti e van ons onderzoek. Jouw streven naar effi ciënti e is een belangrijke tegenhanger voor Bert zijn enthousiasme. Daarnaast creëer jij met je humor een informele werksfeer die ik heel pretti g vind. Saskia, zonder jou had ik het allemaal nooit afgekregen. “Je hebt er weer één afgeleverd.”, zoals je zelf al zei. Heel erg bedankt voor het beantwoorden van al mijn vragen, en de vele experimenten die je hebt gedaan. Ik vond het een super fi jne samenwerking, en daarnaast ook erg gezellig buiten het lab bij de vierdaagse feesten, promoti e feestjes, en labuitjes. Anne, het was heel fi jn dat ik op een lopende trein mocht stappen en in het begin even bij jou mocht kijken hoe het allemaal werkt. Daarnaast was het ook alti jd erg gezellig op onze tripjes naar bijvoorbeeld de EHA in Wenen, Sanquin in Amsterdam, en de RIMLS PhD retreats. Heel veel succes verder in Boston. Maaike, toen ik dreigde alleen over te blijven op de AIO kamer kwam jij gelukkig. Ik bewonder jouw doorzetti ngsvermogen en positi eve “can do” instelling heel erg. Je hebt in deze drie jaar al zoveel nieuwe dingen jezelf eigen gemaakt en deze geïmplementeerd in het lab, nu moet je ze alleen nog gaan gebruiken. Bedankt voor de fi jne samenwerking, je moti verende insteek als ik het even niet meer zag zitt en dit laatste jaar, en de vele andere gesprekken. Heel veel succes verder met het afronden van je PhD, huis en “body by Bo”. Florenti en, ik wil jou vooral bedanken voor al onze ti jd buiten het lab. Jij bent wel mijn maatje geworden hier in Nijmegen. Samen hockeyen, naar ASH in San Diego, Down the Rabbit hole, of andere concerten en festi vals. Op het lab was het vaak te gezellig als jij er was. Dus toen je nog alleen op donderdag kwam werken, plande ik deze dag maar niet te vol met experimenten want we moesten natuurlijk ook nog de vele series (Game of Thrones, Lucifer) en de hockey opstelling bespreken. Leonie, van stage begeleider naar collega ging eigenlijk heel natuurlijk. Misschien omdat er een jaartje tussen zat, maar ook zeker omdat jij jezelf nooit boven andere stelt. Ik vond het alti jd erg gezellig 9 om naast je te zitt en, en zal zeker onze trip naar de EHA Wenen nooit vergeten.

161 CHAPTER 9

Thessa en Ruth heel erg bedankt voor jullie hulp en gezelligheid de afgelopen jaren. Samen met Saskia zijn jullie de kern van onze moleculaire onderzoeksgroep en super waardevol. Verder zijn er nog mensen in onze onderzoeksgroep met wie ik maar kort heb samengewerkt. Gorica, ik wil je graag bedanken voor de fijne gesprekken die we hebben gehad. Je was altijd oprecht geïnteresseerd, en ik hoop dat het snel weer beter met je gaat. Saskia L. en Maarten bedankt voor jullie input tijdens de werkbesprekingen. Davide, Niccolo, and Pedro, it has been a long time since you guys have left, but I do want to thank you for the atmosphere you brought to our room in my first year. I hope you are doing well. Charlotte, Francesca, and Saioa, you filled the PhD room again, and made sure that Maaike is not left alone. Thank you for that, and I wish you all good luck with your research. Lieve dames (Marion, Evelyn, Ellen, Laura, Adrian, Patricia, Tamara) en Louis van de moleculaire diagnostiek, bedankt voor al jullie hulp, en de gezelligheid tijdens verjaardagstaartjes en lab-BBQs. Voor Aniek geldt dit natuurlijk ook. Daarnaast vond ik het erg leuk je beter te leren kennen tijdens de congressen in Wenen en San Diego. De rest van het Laboratorium Hematologie wil ik bedanken voor hun hulp en gezelligheid op ons grote lab. Naast mensen van het Laboratorium Hematologie heb ik ook nauw samengewerkt met groepen buiten onze afdeling. Marten, Emile, Marieke, Annemarie en Sander (Sanquin, Amsterdam), bedankt voor jullie hulp en gastvrijheid tijdens de werkbezoeken. Jullie iPSC en megakaryocyten expertise is super waardevol. Joost, Michiel, Marijke, en Pascal (afdeling Moleculaire Biologie, RIMLS) bedankt voor jullie hulp tijdens de mass spec en ChIP experimenten. Kathleen (KU Leuven) bedankt voor al je input tijdens de afronding van ons GFI1B varianten paper. Verder nog mijn vriendinnetjes uit Zaltbommel. Manelja, ik bewonder jouw moed en drive enorm. Jij bent mijn levend voorbeeld van “Do what you like, and like what you do.” Marije, naast mijn familie ken ik jou al het langst. Als kleine meisjes op de gym en zwemclub waren we nog rivalen, maar toen we samen in de brugklas kwamen en elkaar echt leerde kennen werden we al snel vriendinnen. Je bent super lief en oprecht geïnteresseerd in een ander, waardoor het altijd zo fijn kletsen is met jou. Je wilde altijd graag begrijpen waar mijn onderzoek over ging, en hierdoor heb ik mijn lekenpraatje (presentatie aan het begin van de verdediging) al vaak op jou kunnen oefenen. Verder wil ik je bedanken voor alle gezelligheid de afgelopen jaren op onze filmavondjes, wintersport vakantie, en Surfana Festival bezoeken. En tot slot wil ik natuurlijk mijn liefste familie bedanken. Joep en Maaike, mijn broertje en zusje, afwasbuddies, speelkameraatjes en surfmatties. Nu jullie in Eindhoven wonen zien we elkaar niet meer elke dag, maar is het wel super bijzonder en fijn als we met zijn alle thuis in Zaltbommel zijn. Dan kunnen we weer gezellig samen skateboarden, zeilen, surfen, shoppen, romantische komedies kijken en de afwas doen. Lieve Birna, ons hondje, maar eigenlijk bijna een zusje. Ik vond het altijd heel fijn om samen met jou de uiterwaarden in te trekken, en samen te zwemmen en spelen in de Waal. Zo was ik lekker even alleen, maar toch niet echt. Lieve Papa en Mama, bedankt voor het creëren van onze fijne familie, waar we nog allemaal heel graag samen thuis komen om met jullie te kletsen en samen te zeilen.

162 DANKWOORD

9

163

Rinske van Oorschot van Rinske HEMATOLOGICAL DISORDERS HEMATOLOGICAL TRANSCRIPTION FACTOR GFI1B IN GFI1B IN FACTOR TRANSCRIPTION MOLECULAR MECHANISMS OF THE OF THE MECHANISMS MOLECULAR

RIMLS MOLECULAR MECHANISMS OF THE TRANSCRIPTION FACTOR GFI1B IN HEMATOLOGICAL DISORDERS Rinske van Oorschot 2019-09