BIOLOGICAL INVESTIGATIONS IN THE GENUS PLATANTHERA (ORCHIDACEAE): CONSERVATION ISSUES IN PLATANTHERA LEUCOPHAEA AND EVOLUTIONARY DIVERSIFICATION IN SECTION LIMNORCHIS
DISSERTATION
Presented in Partial Fulfillment of the Requirements for
the Degree Doctor of Philosophy in the Graduate
School of The Ohio State University
By
Lisa Ellen Wallace, MA.
* * * * *
The Ohio State University 2002
Dissertation Committee: Approved by Dr. Daniel Crawford, Co-adviser ______Co-adviser Dr. Andrea Wolfe, Co-adviser
Dr. Kent Holsinger ______Co-adviser
Department of Evolution, Ecology, and Organismal Biology
i
UMI Number: 3081974
______UMI Microform 3081974 Copyright 2003 by ProQuest Information and Learning Company. All rights reserved. This microform edition is protected against unauthorized copying under Title 17, United States Code. ______
ProQuest Information and Learning Company 300 North Zeeb Road PO Box 1346 Ann Arbor, MI 48106-1346 ABSTRACT
Orchidaceae boasts incredible floral and habit diversity, and many species are
quite rare due to natural causes or human activities. In this dissertation, the diversity and
rarity of orchids are investigated in studies on species in the genus Platanthera, a
primarily temperate group with centers of diversity in North America and eastern Asia.
Population genetic structure and the potential for inbreeding depression are examined in
Platanthera leucophaea, a threatened species found in wet prairie fragments in the
Midwestern US. Populations harbor little allozyme variability (AP = 1.18; PP = 12%; HO
= 0.008), but higher levels of diversity were found at RAPD loci (PP = 45%; HNei =
0.159). Both data sets suggested populations are quite differentiated (allozyme FST =
0.75; RAPD ΦST = 0.21), which may indicate little interpopulational gene flow and the
potential for inbreeding within populations. In a subsequent study, the potential for
inbreeding depression was determined in populations of differing size and genetic
structure. The results of these studies indicated that inbreeding depression could be strong
as a result of geitonogamous pollination. However, because this species has mechanisms
to promote outcrossing, it is expected that biparental inbreeding would more likely lead
to inbreeding depression, especially in small populations.
In the latter set of studies, taxonomic relationships within Platanthera section
Limnorchis are examined, with special emphasis on the evolutionary origin and
placement of the polyploid species Platanthera huronensis within the section.
ii Taxonomic classification in Limnorchis is difficult due to intraspecific morphological variability and the purported appearance of interspecific hybrids. Molecular markers correlate with morphological markers and suggest the presence of at least two primary lineages corresponding to green or white flower color. Subtle changes in floral morphology are hypothesized to be important mechanisms of speciation as is divergence of isolated populations allopatrically separated from other conspecific populations. In this analysis, it was also found that P. huronensis is most closely related to both P.
dilatata and P. aquilonis, the progenitors suggested by morphological characteristics.
Parental genotypes are not strictly additive in the polyploid, but there is evidence of
bidirectional evolution of nuclear rDNA towards each of the parental species, with most
individuals showing greater similarity to P. dilatata. Molecular data from ISSR and
RAPD data also support an allopolyploid origin of P. huronensis from P. aquilonis and
P. dilatata, but again, the patterns observed in the polyploid were not strictly additive of
parental genotypes. Extant polyploid lineages are thought to have diverged substantially
since the initial formation of polyploid lineages. A survey of chloroplast RFLP patterns
indicated that P. aquilonis was the maternal parent for eastern samples of P. huronensis,
whereas, P. dilatata was the most likely maternal parent of western samples of P.
huronensis. The strong geographic differences found in RFLP patterns were mirrored by
banding patterns at ISSR and RAPD loci as well as morphological differences. Eastern
populations of P. huronensis may represent an evolutionarily unique entity worthy of
iii taxonomic recognition, but further studies are needed to better understand the relationship
between eastern and western populations of P. huronensis because similar levels of divergence were observed in P. aquilonis and P. dilatata.
Although polyploid species often show increased or novel diversity relative to their diploid progenitors, this result was not found in P. huronensis. Instead, populations of P. huronensis are similar to populations of P. dilatata in the level of diversity, and populations of both of these species are on average significantly more diverse than populations of P. aquilonis. However, at the species level, P. aquilonis is more diverse
than either of the other two species. It is hypothesized that differences in breeding
system are largely responsible for these patterns. Platanthera aquilonis is capable of
self-fertilization while P. dilatata and P. huronensis are thought to be primarily
outcrossing. Thus, gene flow within and between populations of P. aquilonis is expected
to be limited, which would result in the patterns observed in this study, highly differentiated populations and relatively low levels of intrapopulation variation.
iv
Dedicated to my family
v ACKNOWLEDGMENTS
I would like to thank my co-advisers, Dan Crawford and Andrea Wolfe, and committee member, Kent Holsinger for giving me the freedom to develop my own research program and offering guidance and assistance when I needed it.
I thank Mark Wallace for many entertaining road trips, navigating, help in locating and collecting specimens, and artistic contributions to this dissertation.
I thank Shannon Datwyler and TJ Jones for providing help in conducting field studies, and John Freudenstein for collecting plant material from Alaska. Additionally,
Jennifer Windus, Phyllis Higman, Michael Penskar, Kyle Stockwell, and personnel at the
Ohio Division of Wildlife aided in locating and collecting samples of Platanthera leucophaea. I am grateful to Charles Sheviak for sharing his knowledge of orchids and location information with me in the early stages of this project.
I also wish to thank past and present members of the plant systematics and ecology labs at Ohio State, especially Theresa Culley, Shannon Datwyler, Mingjuan
Huang, Andrew Lutz, Chris Randle, and Sarena Selbo for thoughtful discussions.
Additionally, the expertise of Shannon Datwyler, Kay Havens, and Nancy Cowden provided a great aid to the development of laboratory protocols.
I thank Amber, Cleo, Shannon Datwyler, Sarena Selbo, Chris Randle, Jeff
Morawetz, Shawn Krosnick, Mark Mort, Sibyl Bucheli, and TJ Jones for friendship, humor, and encouragement during my time at Ohio State.
vi This research was supported by grants from the American Orchid Society, The
Ohio Chapter of The Nature Conservancy, Ohio Department of Natural Resources, and
The Beatley Herbarium Award.
vii VITA
May 16, 1972 ………………………….Born- Nassawadox, Virginia
1994 …………………………………...B.S. Biology, College of William and Mary
1997 ……...... M.A. Biology, College of William and Mary
1997-2001 ………………………….... Graduate Teaching Associate, The Ohio State University
2002-present ………………………..... Presidential Fellow, The Ohio State University
PUBLICATIONS
1. Wallace, L. E. 2002. Examining the effects of fragmentation on genetic variation in Platanthera leucophaea (Orchidaceae): inferences from allozyme and random amplified polymorphic DNA markers. Plant Species Biology 17: 37-49.
2. Culley, T. M., L. E. Wallace, K. M. Gengler-Nowak, and D. J. Crawford. 2002. A comparison of two methods of calculating GST, a genetic measure of population differentiation. American Journal of Botany 89: 460-465.
3. Wallace, L.E. and M.A. Case. 2000. Contrasting allozyme diversity between northern and southern populations of Cypripedium parviflorum (Orchidaceae): implications for Pleistocene refugia and taxonomic boundaries. Systematic Botany 25: 281-296.
4. Case, M.A., H.T. Mlodozeniec, L.E. Wallace, and T.W. Weldy. 1998. Conservation genetics and taxonomic status of the rare Kentucky Lady’s Slipper: Cypripedium kentuckiense (Orchidaceae). American Journal of Botany 85:1779-1786.
5. Weldy, T.W., H.T. Mlodozeniec, L.E. Wallace, and M.A. Case. 1996. The current status of Cypripedium kentuckiense (Orchidaceae), including a morphological analysis of a newly discovered population in Eastern Virginia. Sida 17: 423-435.
viii FIELDS OF STUDY
Major Field: Evolution, Ecology, and Organismal Biology
ix TABLE OF CONTENTS
Page
Dedication ……………………………………………………………….……………... v
Acknowledgments ……………………………………………………..……………….. vi
Vita …………………………………………………………………….……………... viii
List of Tables ………………………………………………………….………………. xiii
List of Figures ……………………………………………………….……………….. xviii
Chapters:
1. Introduction ……………………………………………………………………… 1
2. Examining the effects of fragmentation on genetic variation in Platanthera leucophaea (Orchidaceae): inferences from allozyme and random amplified polymorphic DNA markers ……………………………………………………… 9
2.1 Introduction ……………………………………………………………… 9 2.2 Materials and Methods …………………………………………………. 12 2.2.1 Allozyme analysis ……………………………………………… 12 2.2.2 Allozyme data analysis ....……………………………………… 13 2.2.3 RAPD analysis …………………………………………………. 14 2.2.4 RAPD data analysis ……………………………………………. 15 2.3 Results ………………………………………………………………….. 17 2.3.1 Variation at allozyme loci ……………………………………… 17 2.3.2 Variation at RAPD loci ………………………………………… 18 2.4 Discussion …………………………………………………………....… 20 2.4.1 Allozyme variation within and among populations ………….… 20 2.4.2 RAPD variation within and among populations ……………….. 23 2.4.3 Conclusions …………………………………………………….. 29
3. The cost of inbreeding in Platanthera leucophaea (Orchidaceae) …………….. 38
3.1 Introduction …………………………………………………………….. 38 3.2 Materials and Methods …………………………………………………. 41
x 3.2.1 Study species …………………………………………………… 41 3.2.2. Experimental design and statistical analysis …………………… 43 3.3 Results ………………………………………………………………….. 47 3.4 Discussion ……………………………………………………………… 50 3.4.1 Reproductive output ………………………………………….… 50 3.4.2 Magnitude of inbreeding depression …………………………… 51 3.4.3 Variability in the expression of inbreeding depression ………… 53 3.4.4 Is inbreeding depression a significant threat to populations of Platanthera leucophaea? ………………………………………. 55 3.4.5 Conservation implications ……………………………………... 57
4. Phylogenetic patterns in Platanthera section Limnorchis (Orchidaceae) based on the internal transcribed spacer (ITS) of nuclear ribosomal DNA ……. 63
4.1 Introduction …………………………………………………………….. 63 4.2 Materials and Methods………………………………………………….. 68 4.3 Results ………………………………………………………………….. 70 4.4 Discussion ……………………………………………………………… 73 4.4.1 Phylogenetic relationships among diploid species ………….…. 73 4.4.2 Where does Platanthera huronensis fit in? ……………………. 77
5. The origin and placement of Platanthera huronensis within section Limnorchis (Orchidaceae): evidence of amphiploidy and multiple origins ……. 97
5.1 Introduction …………………………………………………………….. 97 5.2 Materials and Methods ………………………………………………... 102 5.2.1 ISSR and RAPD markers ……………………………………... 102 5.2.2 RFLP’s of the chloroplast genome …………………………… 105 5.3 Results ……………………………………………………………….... 107 5.3.1 Variation at ISSR and RAPD loci …………………………….. 107 5.3.2 Variation in chloroplast RFLP patterns ………………………. 110 5.4 Discussion …………………………………………………………….. 112 5.4.1 Progenitors of Platanthera huronensis ……………………….. 112 5.4.2 Eastern vs. western Platanthera huronensis ………………….. 113 5.4.3 Number of independent origins of Platanthera huronensis ….. 115 5.4.4 Patterns of molecular variation in Platanthera huronensis …... 118 5.4.5. Taxonomic considerations ……………………………………. 121 5.4.5.1 Platanthera huronensis ………………………………. 121 5.4.5.2 Platanthera dilatata ………………………………….. 124
xi 6. Morphological variation in three widely distributed species of Platanthera section Limnorchis: P. aquilonis, P. dilatata, and P. huronensis (Orchidaceae) …………………………………………………………………. 140
6.1 Introduction …………………………………………………………… 140 6.2 Materials and Methods ………………………………………………... 142 6.3 Results ………………………………………………………………… 144 6.4 Discussion …………………………………………………………….. 147 6.4.1 Intermediacy of Platanthera huronensis ……………………... 147 6.4.2 Intraspecific variation in Platanthera dilatata ……………….. 149 6.4.3 Geographical variation in morphology ……………………….. 151
7. A comparison of variation at inter-simple sequence repeat (ISSR) loci in the polyploid, Platanthera huronensis, and its diploid progenitors, P. aquilonis and P. dilatata …………………………………………………… 161
7.1 Introduction …………………………………………………………… 161 7.2 Materials and Methods ………………………………………………... 164 7.2.1 Data analysis ………………………………………………….. 166 7.3 Results ………………………………………………………………… 170 7.4 Discussion …………………………………………………………….. 174 7.4.1 Genetic variation in the Platanthera aquilonis, P. dilatata, and P. huronensis ………………………………………………174 7.4.2 Comparisons to other species …………………………………. 183 7.4.3 Genetic patterns in areas of sympatry ………………………… 185
Bibliography ………………………………………………………………………….. 205
Appendix Matrix of bands present in each of the 22 chloroplast haplotypes (A-V). Bands 1-26: digestion of trnT-F with MseI; bands 27-29: digestion of trnT-F with BstNI; bands 30-35: digestion of rpl16 with EcoRV. + indicates the presence of a band, - indicates the absence of a band ...…………………………………………………… 231
xii LIST OF TABLES
Table Page
2.1 Genetic variation estimated from 12 allozyme loci for Ohio populations. For each population, the mean number of individuals surveyed (N) over all loci, percent polymorphic loci at a 95% criterion (%P), the number of alleles per locus (A), observed heterozygosity (Ho), expected heterozygosity (He), and the inbreeding coefficient (FIS) are reported. Estimates for each measure are also reported as population means and for the species ………………………………………………………...... 31
2.2 Wright’s F-statistics (Wright 1978) calculated at seven polymorphic allozyme loci for Ohio populations. FIS, inbreeding coefficient due to non-random mating; FIT, reduction in heterozygosity due to inbreeding within populations and genetic drift among populations; FST, degree of differentiation among populations ...………………………………………… 32
2.3 Measures of genetic variation at 58 RAPD loci for populations from Michigan and Ohio. For each population, the number of individuals sampled (N), percent of polymorphic loci at a 95% criterion (%P), Nei's (1973) gene diversity (H), and Shannon's index of gene diversity (S) are reported ……………………………………………………………………… 33
3.1 Performance of selfed, outcrossed, and open-pollinated flowers in the large population of Platanthera leucophaea in 1998 and 2000. Mean values (± 1 SE) are reported for relative seed mass and proportion of viable seeds in a subsample of seeds. Sample sizes are given as N. The effect of treatment was tested with an ANOVA (** P < 0.01; ***P < 0.001). Significant differences among treatments were tested with Bonferroni tests and are indicated by unlike symbols following mean values ………...… 58
3.2 Performance of selfed, outcrossed, and open-pollinated flowers in the small population in 1999 and 2000. Mean values (± 1 SE) are reported for relative seed mass and proportion of viable seeds in a subsample of seeds. Sample sizes are given as N. The effect of treatment was tested with a Kruskal-Wallis test. No significant differences were found for either variable or either year …………………………………………………………..……… 59
xiii 3.3 Magnitude of inbreeding depression observed in seed set, relative seed mass, and percentage of viable seeds in the large and small populations during 1998, 1999, and 2000 …………………………………………………. 60
4.1 Comparison of two major taxonomic classifications of Platanthera section Limnorchis by Ames (1910) and Rydberg (1901) and the nomenclature used in this study. Note that Ames referred to all species currently considered to be Platanthera under the genus Habenaria while Rydberg considered the species of Limnorchis to constitute an entirely distinct genus from Habenaria or Platanthera. Two recent additions to Limnorchis are Platanthera aquilonis (Sheviak 1999) and Platanthera zothecina (Welsh et al. 1987). Platanthera aquilonis is used in reference to the species previously considered to be Habenaria hyperborea. The specific epithet hyperborea is now used only in reference to tetraploid plants similar to H. dilatata var. media from Iceland. Plants referable to P. zothecina were previously included under the specific epithet sparsiflora, but these entities differ in several features of the leaf, lip, and spur. Platanthera huronensis is most similar to Ames’ Habenaria dilatata var. media…………. 83
4.2 Names and locations of taxa sampled for this study. Individuals included in the phylogenetic analyses are indicated by an asterisk following the sample name. Voucher numbers for specimens from herbaria are indicated after sample names. AQ-9, HU-1, HU-4, SP-2 from RM; HU-3 from WIN; HU-5, LM-1 from MICH ………………………………………….....………. 86
4.3 Additive sites found in Platanthera huronensis …………………………….... 88
5.1 Names, locations, sample sizes (N), and chloroplast haplotypes observed in populations of Platanthera aquilonis, P. dilatata vars. dilatata, albiflora, and leucostachys, P. huronensis, P. sparsiflora, and P. stricta included in this study ……………………………………………………………….……. 127
xiv 5.2 Primer sequence, annealing temperature, and number of loci scored for primers used in this study Superscripts following the primer sequence for RAPD primers are names assigned by Operon Technologies …...….……129
5.3 Number of loci scored for each primer for each taxon. The total number of loci present for each taxon is reported followed by the number of monomorphic loci in parentheses. DIL = Platanthera dilatata (all varieties); HUR = P. huronensis; AQL = P. aquilonis var. aquilonis; SPR = P. sparsiflora; STC = P. stricta. N= number of individuals surveyed. ^^Data unavailable ………………………………………………………..… 130
5.4 Relative frequencies of diagnostic bands found in Platanthera dilatata and P. aquilonis. DIL = P. dilatata; HUR = P. huronensis; AQL = P. aquilonis; SPR = P. sparsiflora; STC = P. stricta. ^^ Data unavailable ………………………………………………………..... 131
5.5 Relative frequencies of diagnostic bands found in Platanthera sparsiflora and P. stricta. SPR = P. sparsiflora; STC = P. stricta; DIL = P. dilatata; HUR = P. huronensis; AQL = P. aquilonis ……………………………….... 132
5.6 Comparison of mean genetic distances within and between species based on bands that were shared between individuals at ISSR and RAPD loci. All values reported between species have been corrected to account for relative differences found within a species …………………………………. 133
6.1 Mean (± 1 SD) of 15 quantitative morphological characters (in mm) measured on Platanthera aquilonis (AQL), P. huronensis (HUR), P. dilatata var. dilatata (DIL), P. dilatata var. albiflora (ALB), and P. dilatata var. leucostachys (LEU). Three qualitative features are also reported for each of the species. Populations of P. aquilonis, P. huronensis, and P. dilatata var. dilatata were divided into eastern (E) and western (W) groups for comparison of morphology across the ranges of these species. T-tests were used to compare mean differences between eastern and western populations for P. aquilonis and P. huronensis. Dunn’s multiple comparisons tests were used to compare mean differences within P. dilatata. A significant difference (P < 0.05) for a trait within a taxon is indicated by unlike letters. Sample sizes (N) are indicated for each grouping …………………………………………………………...…... 155
xv 7.1 Population names, locations, sample sizes (N), and estimates of genetic diversity based on ISSR bands. Populations occurring sympatrically with another species of Platanthera are indicated by asterisks. NB: total number of bands observed in a population; %P: percentage of polymorphic loci – 95% criterion; HG: Nei’s genetic diversity based on allele frequencies; HP: Nei’s genetic diversity based on phenotypic frequencies. Mean (± 1 SD) population and species level estimates of diversity are also reported. Significant differences in NB, %P, and HP among the three species are indicated by unlike letters superscripted after mean population level estimates of these three variables (P < 0.05; nonparametric Dunn’s multiple comparisons tests) …………………………………………………. 191
7.2 Spearman’s rank correlations between five measures of genetic diversity: the number of bands per population (NB), percentage of polymorphic loci (%P), Nei’s gene diversity based on allele frequencies (HG), and Nei’s gene diversity based on phenotypic frequencies (HP). All correlations are significant at P < 0.001 …………………………….………. 193
7.3 Results from an analysis of molecular variance performed on each of the species, Platanthera dilatata, P. huronensis, and P. aquilonis. Population differentiation (Φst) is represented by the combined percentage of variation occurring among groups and among populations ……………………..…….. 194
7.4 Mean genetic distances within and between populations of Platanthera aquilonis, P. dilatata, and P. huronensis ……………………………….…... 195
7.5 Mean estimates of Nei’s H calculated from phenotypic frequencies based on 10 replications of 5, 15, 30, 50, or n-1 (n = the total number of loci for a species) loci used in the calculation of HP. Population names follow those in Table 7.1. Estimates found to differ from one another within a population are indicated by superscripted unlike letters (P < 0.05; nonparametric Nemenyi’s tests) ……………………………...….. 196
xvi 7.6 Comparison of genetic diversity estimated from ISSR, AFLP, and RAPD data in the literature. Reported are estimates for percent of polymorphic loci (%P), gene diversity (H), and population differentiation (Structure). Subscript “p” refers to a population level estimate; subscript “sp” refers to a species level estimate. For RAPD studies, mean estimates of diversity for various life history traits are from a recent review by Nybom and Bartish (2000) …………………………………………….……. 197
xvii LIST OF FIGURES
Figure Page
2.1 Locations of populations of Platanthera leucophaea from Michigan (MI1-MI3), and Ohio (OH1-OH7) included in the present study. Populations indicated by a single dot are within 12 km of one another ...... 34
2.2 Three measures of genetic variation at random amplified polymorphic DNA (RAPD) loci, percent of polymorphic loci (P), Shannon's index of gene diversity (S), and Nei's index of gene diversity (H; Nei 1973) compared against population size estimated as a harmonic mean of the number of plants observed over multiple years of census. (a) r2 = 0.119; p > 0.10; (b) r2 = 0.027; p > 0.10; (c) r2 = 0.017; p > 0.10 …..…. 35
2.3 The relationship between geographic distance and genetic distance estimated from random amplified polymorphic DNA (RAPD) bands and based on coancestry (Reynolds et al. 1983) for all pairwise comparisons between populations. A Mantel test was used to test the correlation between geographic and genetic distance (r2 = 0.467; p > 0.05) ……………………………………………………...……. 36
2.4 Neighbor-joining tree of surveyed populations based on coancestry distances calculated from allozyme allele frequencies (a) and coancestry distances (Reynolds et al. 1983) from RAPD band frequencies (b). Population names follow those in Figure 2.1 …………………………...……… 37
3.1 Proportion of capsules recovered relative to the total number chosen for experimental manipulation, and percentage of capsules setting seed for flowers that were self-pollinated, outcross-pollinated, or open-pollinated in the large population in 1998, 1999, and 2000. A significant association exists between mode of pollination and seed set for all years (G test of 2 independence, χ 0.05 [2] = 5.91) …………………………………………………. 61
3.2 Proportion of capsules recovered relative to the total number chosen for experimental manipulation, and percentage of capsules setting seed for flowers that were self-pollinated, outcross-pollinated, or open-pollinated in the small population in 1999 and 2000. Mode of pollination and seed 2 set are independent in both years (G test of independence, χ 0.05 [2] = 5.91) ...… 62 xviii 4.1 The hybrid theory proposed by Schrenk (1978) to account for morphological variants in Platanthera section Limnorchis. Species names reflect the current taxonomy of the group …………………………….... 89
4.2 Platanthera dilatata: (A) habit and (B) close-up of a flower …...……………... 90
4.3 Nucleotide differences in ITS1, 5.8S rDNA, and ITS2 of the nuclear genome in four accessions of Platanthera stricta. Sample names follow those in Table 4.2. – indicates a gap character ………………………………………..… 91
4.4 Nucleotide differences in ITS1, 5.8S rDNA, and ITS2 of the nuclear genome in accessions of Platanthera dilatata vars. dilatata (DI), albiflora (AL), and leucostachys (LU). Sample names follow those in Table 4.2. – indicates a gap character; ? indicates an unknown character …………………..…………..…... 92
4.5 Nucleotide differences in ITS1, 5.8S rDNA, and ITS2 of the nuclear genome in accessions of Platanthera aquilonis. Sample names follow those in Table 4.2. – indicates a gap character; ? indicates an unknown character .……. 93
4.6 Nucleotide differences in Platanthera aquilonis, P. dilatata, and P. huronensis. When standard IUPAC ambiguity codes are used they indicate the presence of two nucleotides in a sample of P. huronensis or at the species level in the case of P. aquilonis and P. dilatata. Sample names for P. huronensis samples follow those in Table 4.2. – indicates a gap character .………………...……… 94
4.7 Strict consensus tree of four most parsimonious trees (length = 315 steps; CI = 0.803; RI = 0.840) from the data set of diploid species. Bootstrap values (> 50%) and decay indices are indicated above branches with bootstrap values listed first. Branch lengths are indicated below branches. Taxon names follow those in Table 4.2.…………………………………………..………...… 95
4.8 Strict consensus tree of 447 most parsimonious trees (length = 460 steps; CI = 0.698; RI = 0.758) found when all samples of P. huronensis are included in the analysis. Bootstrap values (> 50%) and decay indices are indicated above branches with bootstrap values listed first. Branch lengths are indicated below branches. Taxon names follow those in Table 4.2 …………. 96
xix 5.1 Variation in flowers of section Limnorchis. A: Flower of Platanthera dilatata; B-C: Columns of P. aquilonis and P. huronensis. p = anther sac containing a pollinarium; s = stigma; v = viscidium. Illustrations by Mark Wallace ………………………………………………………………..... 134
5.2 Plot of the first two axes from a principal coordinates analysis of individuals of P. dilatata, P. huronensis, P. aquilonis, P. sparsiflora, and P. stricta based on ISSR and RAPD banding patterns. Black dots within the P. aquilonis group indicate P. huronensis individuals. The first two axes explain 20.55% of the total variation observed ……………...... 135
5.3 Plot of the first two axes from a principal coordinates analysis depicting the relationship between individuals of Platanthera huronensis and the three varieties of P. dilatata: dilatata, albiflora, and leucostachys based on ISSR and RAPD banding patterns. The first two axes explain 20.80% of the total variation observed ……………………………………………….... 136
5.4 Plot of the first two axes from a principal coordinates analysis depicting the relationship between individuals of Platanthera huronensis and P. aquilonis based on ISSR and RAPD banding patterns. The first two axes explain 29.10% of the total variation observed ……………………...... 137
5.5 Unrooted phylogram depicting relationships among populations based on a neighbor-joining analysis of mean genetic distances between populations based on ISSR and RAPD bands shared between individuals. Population labels follow those in Table 5.1. Eastern populations of Platanthera dilatata, P. huronensis, and P. aquilonis are indicated by thickened lines ...... 138
5.6 Unrooted phylogram of chloroplast haplotypes based on a neighbor-joining analysis of inter-haplotype distances modified from the similarity coefficient of Nei and Li (1979). The species containing each type follow the pattern i.d. (ALB = P. dilatata var. albiflora; DIL = P. dilatata var. dilatata; LEU = P. dilatata var. leucostachys; HUR = P. huronensis; AQL = P. aquilonis; SPR = P. sparsiflora; STC = P. stricta). The presence of a ca. 50 bp deletion in rpl16, a restriction site in rpl16, and a ca. 200 bp deletion in trnT-F are indicated. All other distinctions between RFLP patterns are due to mutational differences in trnT-F revealed by digestion with MseI. Haplotypes found in each population are listed in Table 5.1 …………………. 139
xx 6.1 Geographic locations of 61 populations sampled for morphometric analyses. N = 20 populations of Platanthera huronensis; N = 10 populations of Platanthera aquilonis; N = 31 populations of Platanthera dilatata ………………………………………………………………………... 158
6.2 Plot of the first three axes from a principal components analysis of populations based on 15 morphological characters. The first three axes explain 78.8% of the variation and are weighted most strongly by lateral sepal length, lateral petal length, and lip length (axis 1); anther apical:basal width, dorsal sepal width, and lateral sepal width (axis 2); and lip maximum:minimum width, lip:spur length, and lip minimum width (axis 3) ………………………………………………………………..... 159
6.3 Plot of populations of white flowered individuals of Platanthera dilatata vars. dilatata, albiflora, and leucostachys on the first three axes produced from a principal components analysis based on 15 morphological characters. The first three axes explain 77.6% of the variation and are weighted most strongly by the lengths of the upper and lateral sepals and lip (axis 1); widths of the lip and lateral sepal (axis 2); and dorsal sepal width and anther widths (axis 3) ……………………………………………………….… 160
7.1 Unrooted strict consensus phylogram of populations of Platanthera aquilonis, P. dilatata, and P. huronensis based on a neighbor-joining analysis of 96 ISSR loci. Population names follow those in Table 1. Bootstrap support values >50% based on 100 replications are reported above branches .……..… 200
7.2 Unrooted phylograms based on neighbor-joining analyses of ISSR banding patterns of individuals in each of the four sets of sympatric populations. A: Platanthera dilatata (pop. K) and P. huronensis (pop. V); B: P. dilatata (pop. H) and P. huronensis (pop. R); C: P. aquilonis (pop. G) and P. dilatata (pop. N); D: P. aquilonis (pops. A and B) and P. dilatata (pop. J). Individuals are identified by a number and the first letter of the species to which they belong. A = P. aquilonis; D = P. dilatata; H = P. huronensis ……….… 201
7.3 Number of loci used to calculate phenotypic diversity compared against the variance in estimates of diversity across loci for populations of Platanthera aquilonis, P. dilatata, and P. huronensis …….……………….…. 204
xxi
CHAPTER 1
INTRODUCTION
Orchidaceae comprises one of the largest families of flowering plants. More than
19,000 species of orchids have been described, but there may be twice as many species awaiting discovery in unexplored tropical habitats (Dressler 1993). This family exhibits incredible natural diversity in floral form, pollination syndrome, and habit. Orchid flowers are unique and sophisticated, and their extraordinary diversity is attributed to a number of factors (Dodson and Gillespie 1967; Dressler 1993). First, the flowers of most orchids are specialized for a single species of pollinator or more frequently for a single group of pollinators with similar morphological features. Thus, individuals with slightly different floral traits are easily isolated from other individuals simply by the behavior of pollinators. Second, long distance dispersal of windborne seeds may facilitate allopatric speciation. The packaging of pollen grains into a pollinium, capable of fertilizing all ovules in a single ovary, and the potentially large number of seeds that can result from a single pollination event facilitate the colonization of new populations from dispersal of a single seed. Third, the epiphytic habit in many tropical species allows unused niches to be occupied by orchids, thereby providing an additional means of isolation through partitioning of the habitat. The rarity of many species greatly adds to the diversity of the family. This natural diversity within and among orchid species has often confused
1 taxonomists and resulted in great difficulty circumscribing natural groups with the
explanation that the family is still actively evolving (e.g., Garay 1972).
The focus of the studies included in this dissertation is within the genus
Platanthera L. C. Richard. Platanthera is a model system for studying evolutionary and
ecological mechanisms important for speciation in orchids because the species show
variability in distribution, abundance, floral form, and reproductive biology. Platanthera
is a moderately sized genus of orchids [ca. 85 species according to Hapeman and Inoue
(1997)] in subfamily Orchidinae and tribe Orchideae. In 1753, Linnaeus described
Orchis and included present day Platanthera species and all other terrestrial orchids with
fleshy tubers, leafy stems, and a terminal inflorescence of flowers with spurs. More than
50 years later, Willdenow removed some species from Orchis and classified them in the
genus Habenaria based on differences in the structure of the column. Shortly thereafter,
Richard removed from Habenaria a group of orchids with pollinia whose caudicles are
adnate to the column (Luer 1975). These species were placed in a new genus, which
Richard called Platanthera, meaning broad anther. Platanthera would not be widely
recognized until Luer used it in his monumental work Orchids of the United States and
Canada in 1975.
Present day Platanthera are identified by a broad anther, elongate root-tuberoids
or lacking tuberoids altogether, and a stigma without processes and an enlarged receptive
surface. Some species contain small stigmatic processes and thus, a precise suite of
morphological characters that would unite all species of Platanthera is lacking.
Nevertheless, most taxonomists recognize the distinctiveness of Platanthera within the tribe Orchideae based on DNA sequence data (Bateman et al. 1997, Pridgeon et al. 1997,
2 Hapeman and Inoue 1997). The base chromosome number in Platanthera is 2n=42, but at least two taxa exhibit higher ploidal levels. Platanthera huronensis (Nuttall) Lindl. is tetraploid (4n = 84; Sheviak and Bracht 1998) while Platanthera obtusata (Banks ex
Pursh) Lindl. may be triploid in some populations (2n = 63; in Tanaka and Kamemoto
1984). All members of Platanthera are terrestrial and photosynthetic. Species are found in a variety of habitats, including meadows, temperate and boreal forests, bogs, fens, marshes, and prairies. Species are distributed primarily in temperate areas of North
America, Asia, Europe, North Africa, and Borneo, but the greatest centers of diversity are in North America and eastern Asia (Luer 1975).
Platanthera displays incredible diversity in floral form and pollination syndrome.
All species have inflorescences which may be sparsely or densely flowered. The flowers have a single fertile anther with two pollinaria on either side of the column. Viscidia, at the base of pollinaria, are located just above the opening to the spur. The viscidia of
Platanthera species attach to the proboscis or eyes of pollinators, which include beetles, butterflies, hawkmoths, noctuid moths, pyralid moths, bumblebees, flies, and mosquitoes
(Hapeman and Inoue 1997). Some species are also capable of self-fertilization. The nectar spur, opposite the lip, varies greatly in length and shape. For example, in
Platanthera stricta Lindl., the spur is short (ca. 2 mm) and saccate. By contrast, the spur in Platanthera praeclara Sheviak and Bowles is more than 40 mm long and filiform.
Catling and Catling (1991) suggested that the number of pollinator species varies inversely with spur length in Platanthera, and longer spurred species show greater specialization in how they are pollinated. Lip shape varies from entire to deeply fringed and may also influence pollinator behavior. Flower colors in the genus include yellow,
3 orange, purple, white, and green, although most species have white or green flowers.
Some species produce a strong floral scent while fragrance is entirely lacking in other species.
A recent molecular phylogenetic analysis of the genus suggests the presence of five recognizable sections in Platanthera: Blephariglottis, Lacera, Limnorchis,
Platanthera, and Tulotis (Hapeman and Inoue 1997). In this analysis the monophyly of all sections except Platanthera is strongly supported, but relationships among the sections are not well resolved. This finding may be indicative of a rapid radiation early in the evolution of the genus (Hapeman and Inoue 1997), but additional data would provide a more robust test of this hypothesis. Section Tulotis, the basal group in the genus, is represented by a few species in eastern Asia. The flowers of these species are generally small and the lips have tubercles, a feature that is lacking in all other members of Platanthera. Like section Tulotis, sections Platanthera and Limnorchis exhibit white, green, or yellow flowers. Section Platanthera encompasses the greatest number of species and exhibits great morphological variability in flower size. The species of section
Limnorchis also exhibit a great deal of morphological variability that is compounded by an abundance of interspecific hybrids. Sections Blephariglottis and Lacera are morphologically similar in that the species have large, colorful, and extremely showy flowers. These two groups differ somewhat in the degree of fringing on the lips.
Members of section Lacera have deeply fringed lips.
Platanthera leucophaea, the subject of the first two chapters, is typical of the species in section Lacera. This species is one of the showiest species of Platanthera and also one of the rarest native orchids in the United States. Known as the Eastern prairie
4 fringed orchid, P. leucophaea is extremely attractive with large creamy white flowers and
strongly fringed lips. Although this species once grew abundantly in the wet prairies east
of the Mississippi River, today it is known from approximately 75 populations in the
United States and Canada (USFWS, 2000). Populations have been reduced in size and
lost due to fire suppression, invasion of competing species, and conversion of habitat for
agricultural use. Consequently, P. leucophaea was listed as a threatened species under the Endangered Species Act in 1989.
Preservation of populations of P. leucophaea in their native habitats will require continual management, which is contingent upon an understanding of environmental threats and vulnerable life cycle stages. Generally, though, not all individuals or
populations of a species can be preserved, and conservationists must identify areas which
harbor diversity and then prioritize units of greatest conservation value according to their
evolutionary or ecological significance. Species with higher levels of genetic variation
presumably are better prepared to survive stochastic events and changes in environmental
conditions compared to species with little genetic variation. Thus, the most diverse
populations are generally highest on the list for preservation. Assessment of biological
diversity in both genotypic and phenotypic characters provides a clearer indication of the
evolutionary potential of populations in a species. Molecular markers are widely used to
estimate how much genotypic variation a species holds and how that variation is
partitioned within and among populations. In the first of two studies on P. leucophaea,
the extent and structure of genetic variation in populations from Ohio and Michigan are
estimated using allozyme and random amplified polymorphic DNA (RAPD) markers. It
is expected that because populations are widely spaced, gene exchange between them is
5 limited. One potential consequence of limited gene flow is inbreeding, which can
cascade into genetic homogeneity, reduced competitive ability, and reduced resistance to
parasites. The genetic data did suggest the potential for erosion of genetic variation in some populations and furthermore that inbreeding might be prevalent in some populations. In a follow-up study the potential for inbreeding depression is examined in two populations that differ in size and genetic structure. Given that P. leucophaea has multiple features to promote outcrossing, including complex flowers suited to pollination by hawkmoths, nectar production, and temporal constraints on effective deposition of pollinia between flowers, inbreeding depression is expected to be severe such that an outcrossing breeding system is favored by natural selection. Nevertheless, inbreeding depression could still result from matings between closely related individuals (i.e., biparental inbreeding). Experimental hand-pollinations of flowers were carried out over successive years to reveal possible temporal differences that environmental or genotypic factors might have on reproductive ability. Seed production and seed viability were used to estimate inbreeding depression and to evaluate how significant the threat of inbreeding might be for P. leucophaea. The results of this study and the characterization of population genetic structure are discussed in the context of recommendations for the continued conservation of P. leucophaea.
In contrast to the showiness of P. leucophaea and other members of section
Lacera, the taxa of section Limnorchis are much less conspicuous, but much more taxonomically complex as a result of intraspecific morphological variation and apparent interspecific hybridization (Schrenk 1978). This complexity is the focus of the latter four chapters. One primary problem with the taxonomy of this group has been the identity of
6 Platanthera hyperborea, which is considered a highly polymorphic umbrella species by some authors (e.g., Ames 1910; Case 1987). In an effort to re-examine evolutionary relationships in this section, DNA sequence data are used in a phylogenetic analysis of species in this group. A primary focus in this and the succeeding studies is on the identity of the polyploid species Platanthera huronensis (Nuttall) Lindl., and the relationship of this species to diploid species in the section.
In contrast to most animals, one of the most important mechanisms by which new plant species arise is polyploidization (see Soltis and Soltis 1993, 2000; Ramsey and
Schemske 1998; Otto and Whitton 2000 for current reviews on the subject). Otto and
Whitton (2000) suggest polyploidy may be the “single most common mechanism of sympatric speciation in plants”. As many as 50% of angiosperm species and 95% of pteridophyte lineages are believed to have a polyploid history if plants with a base chromosome number of 13 are considered polyploids (Grant 1981). Polyploidy, in a very general sense, is the incorporation of three or more genomes in an individual. Stebbins
(1950) distinguished three types of polyploids: autopolyploids arise from chromosome doubling within one species; allopolyploids arise through interspecific hybridization and chromosome doubling; segmental allopolyploids arise from parents with partially divergent genomes such that some chromosome regions are homologous (containing nearly identical copies) between parents while other regions are homeologous (containing divergent copies).
The evolutionary origin of polyploid and hybrid individuals can often be traced to diploid progenitor(s). Neutral heritable genetic markers offer the best hope of inferring the evolutionary history of an organism because they are expected to be passed from
7 parent to offspring unaltered by the forces of evolution. The hypothesis that P.
huronensis is an allopolyploid derivative of Platanthera aquilonis Sheviak and
Platanthera dilatata (Pursh) Lindley ex Beck, based on morphological features (Catling
and Catling 1997; Sheviak 1999), is evaluated using inter-simple sequence repeat (ISSR)
and RAPD markers as well as restriction fragment polymorphisms of the chloroplast
genome. Assuming the chloroplast genome is passed to offspring exclusively in seeds,
the maternal genome should be identifiable in P. huronensis, and thus the number of
independent polyploid lineages can be estimated. Morphological variability is also re- examined in P. huronensis and its putative parental species across a wider geographic
range than has previously been studied. Lastly, the utility of ISSR markers in estimating
population genetic structure is explored. Compared to other molecular markers, such as
allozymes and RAPDs, studies of ISSR variation in natural populations are rare. Some studies have compared variation using ISSRs to variation estimated from allozymes (e.g.,
Ge and Sun 1999; Culley and Wolfe 2001), but very few studies have compared variation at ISSR loci among closely related species. In the final study, ISSR variation is compared across species and ploidal levels and in the context of progenitor-derivative relationships among P. aquilonis, P. dilatata, and P. huronensis.
8
CHAPTER 2
EXAMINING THE EFFECTS OF FRAGMENTATION ON GENETIC VARIATION
IN PLATANTHERA LEUCOPHAEA (ORCHIDACEAE): INFERENCES FROM
ALLOZYME AND RANDOM AMPLIFIED POLYMORPHIC DNA MARKERS1
1From L Wallace, “Examining the effects of fragmentation on genetic variation in Platanthera leucophaea (Orchidaceae): Inferences from allozyme and random amplified polymorphic DNA markers", Plant Species Biology (2002) Vol 17(1): 37-49, reproduced with permission from Blackwell Publishing Asia. http://www.blackwell-science.com/psb
2.1 INTRODUCTION
Successful management and preservation of populations of rare, threatened, or
endangered species depend on a complete understanding of the species, including levels and structure of genetic variation. Knowledge of population genetic structure provides an historical perspective of evolutionary changes that characterize a species and allows us to predict how populations will respond to future events of natural and artificial origin
(Berry 1971; Lande and Barrowclough 1987; Vrijenhoek 1987; Huenneke 1991). When used in conjunction with other information about a species’ ecological requirements, studies of population genetic structure provide effective foci for conservation and management by defining evolutionarily significant units (Ryder 1986).
9 Although environmental, demographic, and genetic stochasticity can each cause
decreases in reproduction and survival (Schemske et al. 1994), random fluctuations in
habitat are considered to be more important than factors related to demographic or
genetic stochasticity (Boyce 1992; Menges 1992; Holsinger and Vitt 1997).
Nevertheless, with loss of genetic variation, populations become less able to deal with
changes in their environment and may be affected more severely by genetic drift
(Huenneke 1991; Ellstrand and Elam 1993; Milligan et al. 1994) via an increase in
inbreeding depression, a reduction in resistance to pathogens, and loss of ecologically important alleles that code for traits affecting survival and reproduction (reviewed in
Booy et al. 2000; Loew 2000).
Rare plants often occur in disjunct or fragmented populations. By effectively
preventing inter-population gene flow, fragmentation increases differentiation among
populations and may increase the risk of extinction. Even when selective pressures are
weak, small populations can experience divergence in alleles for fitness traits through
genetic drift. Consequently, any attempt to re-connect populations or establish new
populations by supplementing them with seed or plants from elsewhere might result in
outbreeding depression (Price and Waser 1979; Templeton 1986; Waser 1993; Reinartz
1995; Fischer and Matthies 1997). Therefore, it is important to understand the degree of
divergence among populations and in particular, the extent to which those differences
will affect survival and reproduction in variable habitats.
Platanthera leucophaea (Nuttall) Lindl., the Eastern prairie fringed orchid, is a
long-lived, perennial, outcrossing species pollinated by nocturnal hawkmoths
(Sphingidae; Bowles 1983; Cuthrell 1994). Like many other temperate orchid species, P.
10 leucophaea experiences dramatic fluctuations in the number of flowering individuals from year to year, due in part to its preference for habitats that are prone to disturbance
by flooding and burning. Abundant mycorrhizae, high water levels, and burning promote
flowering in some populations (USFWS 1999) while no known ecological correlates
explain the fluctuations observed in other populations (J. Windus, pers. comm.).
Platanthera leucophaea purportedly originated from Platanthera praeclara
Sheviak and Bowles in tallgrass prairies occurring within the drainage basin of the
Missouri River (Sheviak and Bowles 1986). Greater specialization of its pollination syndrome presumably allowed P. leucophaea to colonize the newly formed prairie peninsula after the close of the Wisconsinan glacial period. Populations were once contiguous and abundant in prairies and wetlands east of the Mississippi River, but they have declined more than 70% from original county records due to conversion of suitable habitat into agricultural land, invasion of exotic species such as purple loosestrife
(Lythrum salicaria L.) and reed canary grass (Phalaris arundinacea L.), and over- collecting (USFWS 1999). Consequently, P. leucophaea was listed as a federally threatened species in 1989, and presently, it is known from approximately 75 populations in the United States (Illinois, Iowa, Maine, Michigan, Ohio, Virginia, Wisconsin;
USFWS 1999), and Canada (Ontario; Brownell 1984). The populations in Ohio and
Michigan are on the eastern edge of the present range of the species and are effectively isolated from western populations in Illinois, Iowa, and Wisconsin.
Given the fragmented distribution and variability in population size, genetic differentiation is expected to be high among populations of P. leucophaea due to low levels of gene flow and substantial genetic drift. Previous estimates of genetic diversity
11 based on allozymes have indicated low levels of variability in eastern populations. For example, Cowden (1993) examined five populations of P. leucophaea in Illinois,
Michigan, and Ohio (including three populations re-examined in this study) using 12 loci and found moderate mean population levels of genetic variability in the number of alleles per locus (1.34), percent polymorphic loci (28%), and observed heterozygosity (0.053; in all cases observed heterozygosity was lower than expected heterozygosity). To compare previous estimates of genetic variation in a larger sample of populations, both allozyme and RAPD (random amplified polymorphic DNA) markers were used to quantify variation in this study. RAPD's were chosen because of their wide use in studies of genetic variation in natural populations of rare species (e.g., Maguire and Sedgley 1997;
Martín et al. 1997, 1999; Palacios and González-Candelas 1997; Cardoso et al. 1998;
Allnutt et al. 1999; Gillies et al. 1999; Prathepha and Baimai 1999; Lowe et al. 2000;
Tansley and Brown 2000) and relative ease of generating data. The objectives of this study include: 1) determination of relative levels of genetic variation among eastern populations at allozyme and RAPD loci, 2) assessment of the potential consequences of fragmentation and reductions in the number of reproducing plants on genetic variation,
and 3) determination of units appropriate for conservation and management.
2.2 MATERIALS and METHODS
2.2.1 Allozyme analysis
Leaf tissue from seven extant populations in Ohio (Fig. 2.1) was collected for
allozyme electrophoresis. A representative number of individuals was sampled in each of
these populations with the attempt to get every individual in populations of fewer than 20
12 flowering plants. Tissue was collected in the field and stored on water ice for 1-4 days
after which it was frozen at –80° C until being ground for electrophoresis. The leaves
were ground in Gottlieb’s extraction buffer as outlined in Soltis et al. (1983) no more
than two weeks before electrophoresis.
Twelve percent starch gels were used in conjunction with three buffer systems,
which enabled the resolution of 10 enzymes and 14 putative loci. Aspartate
aminotransferase (AAT; EC 2.6.1.1), catalase (CAT; EC 1.11.1.6) and leucine aminopeptidase (LAP; EC 3.4.11.-) were resolved on a lithium borate system at pH 8.3
(#7 in Soltis et al. 1983). However, LAP was discontinued due to inconsistent staining.
Isocitrate dehydrogenase (IDH; EC 1.1.1.42), malate dehydrogenase (MDH; EC
1.1.1.37), 6-phosphogluconate dehydrogenase (PGD; EC 1.1.1.44), and shikimate
dehydrogenase (SKD; EC 1.1.1.25) were resolved on a histidine system at a pH of 7.0
(#1 in Soltis et al. 1983). Malic enzyme (ME; EC 1.1.1.40), phosphoglucomutase (PGM;
EC 2.7.5.1), and triosephosphate isomerase (TPI; EC 5.3.1.1) were also resolved on a
histidine system (#1 in Soltis et al. 1983) with the pH increased to 7.5. Staining
schedules followed those outlined in Soltis et al. (1983) with the use of agarose overlays
on IDH, MDH, PGD, SKD, ME, PGM, and TPI. For AAT, CAT, and LAP, staining
baths were used. Proteins suspected of having similar mobilities were verified by
running individuals from different populations side by side on the same gel.
2.2.2 Allozyme data analysis
Allele frequencies were calculated for each population (available upon request).
The number of alleles per locus (A), percent polymorphic loci at a 95% criterion (%P),
observed and expected heterozygosities (Ho and He, respectively), and the inbreeding
13 coefficient (FIS) were calculated using GDA vers. 1.0 (Lewis and Zaykin, 2001) for each
population and the species. Population substructure was estimated with Wright's (1978)
F-statistics, FIS, FIT, and FST, according to the method outlined in Weir (1996). These statistics represent reductions in heterozygosity expected under random mating in individuals relative to subpopulations (FIS), or the total variation in the species (FIT), and the amount of variation distributed among populations (FST). Confidence intervals (95%)
for F-statistics were estimated by bootstrapping over loci with 1000 replicates. Lastly,
genetic distances between populations were calculated using the coancestry distance in
GDA (Lewis and Zaykin 2001) and a neighbor-joining tree was constructed.
2.2.3 RAPD Analysis
Leaf tissue was sampled from 192 individuals in 10 populations from Michigan
and Ohio (Fig. 2.1). In populations of fewer than 20 flowering plants, attempts were made to sample all individuals. Total genomic DNA was extracted using the CTAB method (Doyle and Doyle 1987), and RAPD markers were generated by polymerase chain reaction (PCR) in all samples. Primers previously known to provide variable and repeatable banding patterns in Illinois populations of P. leucophaea (K. Havens, pers. com.) were employed to assess variation among individuals from populations included in this study. Seven 10-mer primers were subsequently chosen (OPA-03, OPA-04, OPA-
09, OPB-01, OPB-08, OPB-18, and OPC-11; Operon Technologies, Alameda, CA,
USA), and every individual was surveyed for each primer. Each 25 µl reaction contained ca. 5 ng template DNA, 1X PCR buffer (20mM Tris-HCl and 50 mM KCl; Invitrogen,
Carlsbad, CA, USA), 200 µM of each dNTP (Invitrogen), 2.3 mM MgCl2 (2.0 mM
MgCl2 for primers OPA-03 and OPA-04), 5 pmoles of primer, and 0.5 units of Taq DNA 14 polymerase (Invitrogen). A negative control, including all ingredients except template
DNA, was included with each set of reactions to detect contamination. All reactions were amplified using the following conditions: 1 cycle of 94°C for 2 mins.; 45 cycles of
94°C for 1 min., 36°C for 1 min., and 72°C for 2 mins.; 1 cycle of 72°C for 2 mins.; soak indefinitely at 4°C. The total product was run out on 1.2% TAE agarose gels, which were stained with ethidium bromide. Bands were visualized by UV light, and the images were captured digitally. Duplicate reactions and gels were run for all primers and all individuals. Non-replicated bands were eliminated from analyses. Bands of similar molecular weight and migration distance across individuals were assumed to be homologous (Rieseberg 1996; Adams and Rieseberg 1998). Homology assessments were made across gels based on a standard individual amplified and run on each gel and a 1KB
DNA ladder (Invitrogen). Bands were coded as present or absent.
2.2.4 RAPD data analysis
Monomorphic loci and private alleles (unique to a single population) were excluded from the data set. Due to the dominant nature of RAPD markers, allele frequencies must be determined under the assumptions that only two alleles exist at a locus and that populations are in Hardy-Weinberg equilibrium unless estimates of inbreeding are available from other data. In this study, allele frequencies were determined under three conditions: (1) assuming variable levels of inbreeding in populations (i.e., FIS values from allozyme data were used for Ohio populations and FIS was set at 1.0 for Michigan populations); (2) assuming complete inbreeding in all populations (i.e., FIS = 1.0); and (3) assuming random mating in all populations (i.e., FIS =
0). From these allele frequencies, three measures of genetic variation, percent of
15 polymorphic loci at a 95% criterion (%P), Nei's (1973) gene diversity (H), and Shannon's
index of gene diversity based on band frequency (S; Lewontin 1972), were calculated for all populations using POPGENE (Yeh et al.1999).
Estimates of population differentiation (GST) were calculated under the three
described assumptions of population equilibrium or disequilibrium using POPGENE
(Yeh et al. 1999). Diversity was also partitioned using Shannon’s index of gene diversity
where the portion of variation within populations is HPOP/HSP and the portion among
populations is (HSP - HPOP) / HSP (Lewontin 1972). Additionally, an analysis of
molecular variance (AMOVA) using squared Euclidean distances was carried out in
ARELQUIN (Schneider et al. 2000). AMOVA uses genetic distances among individuals
to partition the total variance into covariance components according to intra-individual,
inter-individual, and inter-population differences (Excoffier et al. 1992). The resulting
variance components are used to estimate variation within and among populations (ΦST).
Estimates of population differentiation were carried out on the entire set of populations
and on the Ohio populations alone such that direct comparisons could be made to estimates resulting from allozyme data.
The genetic distance measure of Reynold's et al. (1983) based on coancestry was calculated for all pairwise population comparisons using TFPGA (Miller 1997). The relationship between genetic distance and geographic distance was explored using a
Mantel test (Sokal and Rohlf 1995). Significance of the Mantel statistic was determined using 9000 permutations in NTSYS (Rohlf 1997). Geographic patterns were further explored using the NEIGHBOR algorithm in PHYLIP vers. 3.5c (Felsenstein 1993) and
Reynold's et al. (1983) genetic distance.
16 Linear regressions were used to assess the relationship between the number of
flowering plants and amount of genetic variation within populations. Population sizes
were estimated from the harmonic mean number of flowering plants determined from
census data over multiple years. Because of the variability in the number of flowering
plants from year to year, estimates of population size based on harmonic means may be
better indicators of effective population size in P. leucophaea (Frankham 1995a). The
percent of polymorphic loci, gene diversity (Nei 1973), and Shannon’s index of gene diversity (Lewontin 1972) were each tested against population size. Population sizes were log transformed before analysis and analyses were carried out in SPSS, vers. 10.
2.3 RESULTS
2.3.1 Variation at allozyme loci
A single locus was observed for CAT, IDH, ME, PGD, PGM, and SKD while TPI had two loci, and AAT and MDH each had three loci. However, only two loci were consistently resolvable for the latter two enzymes. Data from 12 loci are included in this study. All populations are monomorphic at IDH, MDH-1, ME, PGD, and SKD. For
AAT-1, AAT-2, MDH-2, PGM, TPI-1, and TPI-2, two alleles were found, and CAT
contained three alleles.
Very little genetic variation was found in any population. The number of alleles
per locus ranges from 1.08 in OH1 and OH5 to 1.33 in OH3 (Table 2.1). Three private
alleles were found in two populations, but only one occurs in a moderately high frequency (0.565) in OH7. Likewise, the percentage of polymorphic loci in populations is also low, ranging from approximately 8% to 25%. Ignoring population boundaries, the
17 frequency of polymorphic loci in the species is 25%. Only two populations, OH2 and
OH4, have heterozygosity values that meet expected values under Hardy-Weinberg equilibrium. Furthermore, three of the seven populations exhibit negligible heterozygosity (Table 2.1), and fixation indices (FIS) are high in five populations.
Populations OH2 and OH4 have very low, negative fixation indices, indicative of an excess of heterozygotes.
Consistent with a general lack of variation at allozyme loci, estimates of population differentiation are also quite high. The mean FST for polymorphic loci is 0.75
(95% CI 0.028-0.890; Table 2.2). This value is largely due to the effect of two loci,
PGM-1 and CAT-1, which exhibit fixed allelic differences among populations.
Generally, the neighbor-joining tree does not indicate geographic structuring among the populations (Fig. 2.4). For example, the branches leading to populations OH2, OH5, and
OH7 are long and indicate extensive genetic differences in these populations relative to
others in Ohio.
2.3.2 Variation at RAPD loci
From the seven primers used, 64 bands were scored. Six bands were excluded
from the analyses because they were either monomorphic (1) or found in a single
individual (5). Very similar estimates of diversity were found regardless of the value of
2 FIS. Pairwise population estimates of GST are highly correlated (r = 0.861; p < 0.00)
when FIS is set at 0 (i.e., random mating) or varied according to estimates from allozyme
data. Furthermore, other estimates of gene diversity (i.e., %P, H, S) are also similar when
FIS varies. Values for each of these measures do not change at all when FIS is set at allozyme estimates compared to when FIS is set at 1.0 for all populations. When FST is
18 compared to estimates derived from FIS = 0, the values differ by 0.03 or less. Given the
similarity in estimates, only values derived from setting FIS at values generated from
allozyme data are reported here.
Locus polymorphism within populations ranges from 36% in MI1, MI3, and OH1
to 57% in OH5 (Table 2.3). Although estimates of gene diversity based on Nei’s (1973)
expected heterozygosity are generally lower than estimates based on Shannon’s index of
2 diversity (Lewontin 1972), the two measures are significantly correlated (r Spearman = 0.98;
p < 0.000). Population MI3 has the lowest level of diversity for both measures (H =
0.118; S = 0.181) while population OH2 has the highest level of diversity (H = 0.202; S =
0.307; Table 2.3).
Estimates of FST are comparable across various methods of analysis and indicate
moderate levels of population differentiation in P. leucophaea. These estimates are 0.21 in an AMOVA, 0.26 from GST, and 0.30 from Shannon's index of diversity. Considering
Ohio populations alone, estimates of population differentiation are 0.20 from an
AMOVA, 0.24 from GST, and 0.26 from Shannon’s index of gene diversity.
Populations included in this study range in size (i.e., harmonic mean size) from ca. 15 plants (OH1) to more than 1800 plants (OH5). Populations of greater than 50 plants are considered large (USFWS 1999). Population OH5 is exceptionally large as most populations of this species maintain fewer than 100 flowering plants in any given year (USFWS 1999). Although the three populations from Michigan have fewer polymorphic loci, estimates of gene diversity are comparable to populations in Ohio. No population is genetically depauperate. While there is a slight trend for larger populations to harbor higher levels of polymorphic loci (Fig. 2.2), this trend is not significant (r2 =
19 0.119; p > 0.10). Furthermore, gene diversity measured as H or S is not correlated with population size. Rather, estimates are very similar in populations of all sizes.
Although there is substantial genetic structure among the populations studied here, a consistent geographic pattern is not apparent. For example, the Mantel test revealed a non-significant correlation (r2 = 0.467; p > 0.05) between geographic and
genetic distances (Fig. 2.3). Furthermore, little structure is apparent in the neighbor-
joining trees based on allozyme or RAPD loci (Fig. 2.4). Populations OH1, OH2, and
OH3 are less than 8 km apart, yet they are not as closely related as one might expect
under conditions of inter-population gene flow via pollen and seeds.
2.4 DISCUSSION
2.4.1 Allozyme variation within and among populations
Platanthera leucophaea has low diversity at allozyme loci. Generally,
populations contain few alleles per locus (mean A = 1.18) or polymorphic loci (mean %P
= 11.90), and low levels of heterozygosity (mean HO = 0.008; Table 2.1). These
estimates are also low compared to those previously reported for P. leucophaea or closely
related Platanthera species. For example, Cowden (1993) studied five populations of P.
leucophaea and found an average of 28% polymorphic loci and 1.34 alleles per locus.
Generally, her estimates of heterozygosity are higher than estimates reported here,
ranging from 0.013 in a population from Illinois to 0.102 in a population from Michigan
(MI1 in this study). Notably, however, she reported lower observed heterozygosity than
expected heterozygosity for every population sampled. Cowden (1993) also surveyed
other more common species of Platanthera, including Platanthera blephariglottis
20 (Willd.) Lindl. and Platanthera ciliaris (L.) Lindl., and found similar mean levels of polymorphic loci (22% and 31%, respectively) and heterozygosity (0.050 and 0.082, respectively) in populations.
Features of its life history heavily influence the structure of genetic variation in a species; long-lived, outcrossing species are expected to be more variable than annual or selfing species (Hamrick and Godt 1989). Among many outcrossing Orchidaceous taxa, relatively low levels of differentiation have been reported (GST = 0.16; Case 2001). In contrast to these findings, moderately high levels of FST have been reported for several
Platanthera species (Cowden 1993). Most of the variation at allozyme loci found in
Ohio populations of P. leucophaea occurs among populations rather than within them
(FST = 0.754; Table 2.2). Given the physical distance separating most populations of P.
leucophaea, it is not surprising that they are strongly differentiated. Apparently this
degree of divergence is due to the fixation of different alleles at CAT-1 and PGM-1 in
populations. The estimate of FST drops to 0.04 when these loci are eliminated. Notably,
Cowden (1993) also found populations fixed or nearly fixed for alternate alleles at five of
12 loci, which accounts for her estimate of FST at 0.574.
The lack of allozyme variability, fixation of alleles, and genetic disjunction of
populations of P. leucophaea could be causes or consequences of its present rarity.
Although allozymes frequently do not exhibit high levels of intraspecific variability,
especially in rare species (e.g., Soltis et al. 1992; Crawford et al. 1994; Sun 1997;
Esselman et al. 2000; reviewed in Hamrick and Godt 1989; Gitzendanner and Soltis
2000), other factors must also be considered as explanations for the apparent lack of
diversity. For example, the fixation of different alleles in populations could be the result
21 of origination from divergent source populations, differential selective pressures, and/or genetic drift. Considering the results of this study and the overall low levels of allozyme variation observed in other Platanthera species, perhaps P. leucophaea historically lacks allozyme diversity. If P. leucophaea is a derivative species of the Western prairie fringed orchid, Platanthera praeclara, as suggested by Sheviak and Bowles (1986), it may be similar to other derivative species in having only a subset of variation found in its parent species, P. praeclara (e.g., Ranker and Schnabel 1986; Cheng et al. 2000; Cronberg
2000).
It is widely believed that P. leucophaea speciated from P. praeclara by adapting to a different suite of pollinators (Sheviak and Bowles 1986). Platanthera leucophaea places pollinia on the proboscis of moths, and this is thought to be a more efficient means of pollination than placing pollinia on the eyes of pollinators, the method employed by P. praeclara. Furthermore, after the close of the Wisconsinan glaciation, P. leucophaea probably rapidly colonized the prairie peninsula around the Great Lakes and invaded an ecologically diverse landscape. Thus, the lack of allelic variation at most loci and fixation of alleles in several populations is consistent with founder events by a small number of individuals and variable source populations. Although it is expected that gene flow was extensive shortly after colonization, recent fragmentation of its habitat and isolation of populations may have increased the allelic differences seen among populations today. Unfortunately, however, this hypothesis remains untested because there are no published studies comparing allozyme diversity in P. leucophaea and P. praeclara.
22 Population differentiation may also result from inbreeding (Hartl and Clark 1997), and it appears to have played a role in P. leucophaea as evidenced by variation in estimates of FIS among populations. Two populations, OH2 and OH4, show no evidence of inbreeding while the other five populations are very highly inbred (FIS = 0.743-1.0;
Table 2.1). The degree of inbreeding does not appear to be correlated with population size, and it is not known how much inbreeding naturally occurs in populations. Although this species is self-compatible (L. Wallace, unpubl. data), a pollinator is required for seed set, and P. leucophaea has mechanisms to reduce inbreeding such as use of specific insect pollinators and rotation of a pollinium on a pollinator before contact with a recipient stigma. Despite these mechanisms to promote outcrossing, geitonogamous or bi-parental inbreeding can still occur. Several flowers on an inflorescence are receptive at the same time, and hawkmoth pollinators visit consecutive flowers on an inflorescence and return to plants previously visited (L Wallace, pers. obs.). Furthermore, the potential for inbreeding may be heightened in smaller populations where genets are infrequent and widely spaced (e.g., Barrett and Kohn 1991; Jennersten and Nilsson 1993; Ågren 1996;
Kunin 1997). Further studies are needed to evaluate the potential for and consequences of inbreeding in populations of P. leucophaea.
2.4.2 RAPD variation within and among populations
In species where little allozyme variation has been found, PCR-based DNA markers often reveal equal or higher levels of genetic variability (e.g., Qamaruz-Zaman et al. 1998; Wolfe et al. 1998; Esselman et al. 2000). Greater diversity in DNA markers such as RAPD’s is attributed to the fact that many loci are amplified, providing a genome-wide survey (Williams et al. 1990). In contrast to allozyme loci, non-coding
23 regions, such as those that may be amplified with random primers, are unlikely to be
under heavy selective constraints. Mutations can accumulate and spread throughout a
population rather quickly. The eastern populations of P. leucophaea included in this
study exhibit greater variation at RAPD loci than previously found at allozyme loci.
Variation is most apparent in different band frequencies among populations, and every individual exhibited a unique multi-locus RAPD phenotype.
Polymorphism at RAPD loci was substantially greater than polymorphism at allozyme loci for all populations. For example, population OH5 only exhibits 8.33%
polymorphic loci for allozymes, but had the highest estimate of polymorphism at RAPD loci (56.90%). Even the lowest estimate based on RAPD’s (36.21% in populations MI1,
MI3, and OH1; Table 2.3) is higher than the highest estimate from allozymes (25%;
Table 2.1). Additionally, estimates of gene diversity are generally high as measured by
Nei’s expected heterozygosity (mean H = 0.159) or Shannon’s index (mean S = 0.245).
These estimates do show consistency in the relative levels of diversity for the populations sampled. For example, population OH2 has the highest estimate of H and S (0.202 and
0.307, respectively) while population MI3 has the lowest estimate (0.118 and 0.181, respectively). In comparison to estimates of diversity based on RAPD’s in other species,
P. leucophaea has lower heterozygosity (H = 0.159) than long-lived perennial species
(0.242), regionally distributed species (0.222), early-mid successional species (0.166-
0.195), species with a mixed mating system (0.219), or species with wind-dispersed seeds
(0.261; Nybom and Bartish 2000). [Comparisons to the summary presented by Nybom and Bartish (2000) should be interpreted cautiously, though, because several mean estimates of diversity are based on fewer than five studies.] Most populations of P.
24 leucophaea surveyed in this study exhibit less gene diversity than those in Illinois as
well. Havens and Buerkle (1999) estimated gene diversity to be 0.215 in six populations,
but they also reported values less than 0.15 for two populations.
Estimates of genetic variation based on the gene diversity measure of Nei (1973)
or Shannon’s information index (Lewontin 1972) measure different components of
RAPD diversity and therefore are not directly comparable. Shannon’s index of diversity
may be higher than Nei’s (1973) gene diversity because it tends to emphasize any
diversity that is present (Bussell 1999). Additionally, comparisons across studies can be
problematic because there is little consistency in the method used to calculate S across
loci. In comparison to other studies where S was calculated as it was in this study, the estimate for P. leucophaea (0.245) is similar to estimates for other outcrossing species, including Erodium paularense Fern. Gonz. and Izco (0.180; Martín et al. 1997) and
Swietenia macrophylla King (0.36; Gillies et al. 1999). In contrast to these values,
Bussell (1999) found very low levels of phenotypic diversity (S = 0.043) in Isotoma petraea F. Muell, an inbred species, while Yeh et al. (1995) reported very high levels of
diversity (S = 0.651) in Populus tremuloides Michx., a highly asexually reproducing
species.
There is a slight tendency for smaller populations to harbor fewer polymorphic
loci and lower diversity as measured by S, but the trend is not significant (Fig. 2.2).
These data suggest that the harmonic mean population size is not a reliable predictor of
RAPD variation. However, the harmonic mean population sizes used in this study may be somewhat misleading because data are not available for all populations over all years of census. Estimation of true effective size in orchid populations is extremely difficult
25 because populations of many temperate orchid species cycle through stages of dormancy
and activity (i.e., reproductive and vegetative plants). Furthermore, biotic and ecological
factors that control dormancy are not well understood. For example, flowering of P.
leucophaea is positively correlated with growing season rainfall in populations in tall-
grass prairies in Illinois (Bowles et al. 1992), but ecological correlates have not been
found to explain the simultaneous flowering of hundreds of plants in populations in sedge
meadows in Ohio (Windus and Cochrane 1997). Given a historical occurrence in
graminoid habitats, population dynamics of P. leucophaea are undoubtedly affected by
periodic disturbances such as fire and succession (USFWS 1999). Studies directed at
examining dormancy patterns in this and other temperate orchid species are much needed
and would aid in understanding how genetic variation is partitioned and maintained in populations.
The extreme contrast in levels of genetic diversity as measured by allozymes and
RAPD’s was surprising. The discrepancy in levels and structuring of genetic diversity in these data sets, undoubtedly, is the result of recent and historical genetic and ecological factors. Previously, others have suggested that chaotic fluctuations in the number of reproducing individuals may actually protect rare species from extinction by reducing the
impact of stochastic events. This can be achieved by maintaining variation unevenly at
multiple stages of the life cycle (Rosenzweig and Lomolino 1997). For example, seed
banks may preserve genetic variation and buffer populations when there are few
aboveground plants (Epling et al. 1960; del Castillo 1994; Tansley and Brown 2000).
Additionally, some populations exhibit an increase in heterozygosity over successive life-
history stages (reviewed in Ennos 1989; Mitton 1989). A long-lived seed bank probably
26 does not contribute substantially to preserving genetic variation in P. leucophaea because
the seeds do not remain viable for long periods of time in the soil (Stoutamire 1996).
However, dormant plants could be an important genetic resource. Long-lived species with overlapping generation times should retain higher levels of genetic diversity for any given period of time, especially if individuals repeatedly contribute to future generations
(Hedrick 1992; Nunney and Elam 1994). If levels of variation can differ among life history stages in other species, it is possible that genetic diversity at RAPD loci is
preserved in dormant plants in P. leucophaea. In particular, during periods of extensive flowering, characteristic of P. leucophaea, the variation would be exposed and recombined in the production of an abundance of seeds. If even a limited number of seedlings survive to reproduce, relatively high levels of variation could be maintained.
Consequently, the effects of fragmentation and small effective population size may take longer to impact populations negatively due to preservation of rare alleles and unique genetic combinations at various life-history stages. Even though the levels and structure of genetic variation within and among populations may fluctuate from year to year, equilibrium could be maintained through rare exchange of migrants between populations and storage of variation in dormant plants, and less frequently in seeds. Additionally, metapopulation dynamics may also be involved in maintaining spatial structure and genetic variation in populations where disturbance (e.g., flooding in wetland habitats) is common (Bowles 1983; Case and Case 1990).
Estimates of population differentiation based on RAPD's are not as great as the estimates from allozymes. Still, the effects of fragmentation and isolation are apparent at
RAPD loci. The estimates of ΦST from AMOVA or GST, or population differentiation
27 based on Shannon’s index indicate that the majority of variation at RAPD loci is
maintained within populations (> 70%). Populations from Ohio and Michigan are
slightly less differentiated than populations from Illinois (ΦST = 0.39; Havens and
Buerkle 1999). Birchenko (2001) examined genetic variation in Platanthera integrilabia
(Correll) Luer, another threatened species, using ISSR (inter-simple sequence repeat)
markers, and found levels of differentiation similar to P. leucophaea, estimating ΦST at
0.21. Populations of P. leucophaea are as differentiated as populations in other species with an outcrossing or mixed mating system (ΦST = 0.28-0.27; Nybom and Bartish 2000).
Moderate levels of differentiation may be an indication of low levels of inter-
population gene flow and genetic drift. The lack of correspondence between genetic and
geographic distances for both allozyme and RAPD markers (Fig. 2.4) suggests either that
gene flow is restricted or it occurs at long and short distances. Despite adaptations to
long distance dispersal, including wind-dispersed, dust-like seeds, pollen packaged into
pollinia that readily attaches to pollinators, and the utilization of pollinators capable of
traveling long distances between populations (Linhart and Mendenhall 1977), it is
doubtful that gene flow happens frequently between populations. Orchid seeds typically
travel 5-10 km (Rasmussen 1995), and most extant populations of P. leucophaea are
more than 10 km apart without suitable habitats between them.
Genetic differentiation among populations of P. leucophaea may have resulted
from genetic drift associated with fragmentation and isolation. Such a hypothesis is
consistent with the predictions of Hutchinson and Templeton (1999) who suggested that
recent fragmentation followed by isolation produces a pattern of low correlation between
geographic and genetic distances and large scatter among plotted points of these two 28 independent measures. The plot of pairwise genetic and geographic distances of
populations from Michigan and Ohio (Fig. 2.3) shows that exact pattern. Furthermore,
some population pairs that are physically close are more genetically distinct than more
distant populations. For example, populations OH1 and OH2 are less than 1 km apart, but do not cluster together in either of the trees based on allozymes or RAPD’s (Fig. 2.4).
2.4.3 Conclusions
For rare species, one of the most important goals of studies of genetic variation is to identify how many unique genotypes are present and how they are distributed within and among populations (Qamaruz-Zaman et al. 1998). Dominant DNA markers such as
RAPD’s, ISSR’s, and AFLP’s can meet this goal in addition to providing estimates of total diversity.
Units appropriate for conservation and management should be established on the basis of their evolutionary potential. Evolutionary success of a species will be
maximized when populations from a wide geographic range are capable of both
ecological and genetic exchangeability rather than being genetically distinct (Crandall et
al. 2000). Importantly, the degree of genetic distinction among populations must be
evaluated in the context of a species' evolutionary history. The fact that every individual
could be identified by a unique multilocus RAPD phenotype suggests that this species does harbor high levels of diversity. Furthermore, if variation at RAPD loci is interpreted as an indication of genetic potential of a species, these data indicate that eastern populations of P. leucophaea have genetic potential to persist and sustain future evolutionary change.
29 The similarity of many RAPD loci among individuals across wide geographic
distances suggests that maintaining any of the populations surveyed could preserve
variation in P. leucophaea. In contrast, multiple populations should be maintained if the
goal is to preserve the majority of allozyme variation found in P. leucophaea. Because the greatest threat to P. leucophaea in Ohio and Michigan is the loss of individuals from populations due to successional changes, invasion of exotic species, and habitat destruction, it is recommended that conservationists strive to maintain populations of adequate sizes (e.g., more than 20 plants) that are capable of sustaining natural reproduction. Although a correlation between levels of genetic variation and population
size was not apparent in this study, negative consequences of small population size,
including loss of genetic polymorphism (Karron 1987; Raijmann et al. 1994), inability to
attract pollinators (Jennersten and Nilsson 1993; Ågren 1996; Kearns and Inouye 1997),
and increased inbreeding depression (Ellstrand and Elam 1993) have been demonstrated
in other species. Consequently, additional demographic and genetic studies should
become regular components of management to monitor future changes in populations of
P. leucophaea.
30
Population N A %P Ho He FIS
OH1 13.00 1.08 8.33 0.000 0.123 1.000
OH2 24.00 1.17 8.33 0.021 0.019 -0.078
OH3 11.50 1.33 25.00 0.007 0.087 0.918
OH4 14.17 1.17 16.67 0.025 0.024 -0.043
OH5 38.33 1.08 8.33 0.000 0.012 1.000
OH6 25.00 1.25 8.33 0.007 0.025 0.743
OH7 21.92 1.17 8.33 0.000 0.050 1.000
MEAN 21.13 1.18 11.90 0.008 0.033 0.746
Species 147.92 1.67 25.00 0.007 0.103 0.929
Table 2.1. Genetic variation estimated from 12 allozyme loci for Ohio populations. For each population, the mean number of individuals surveyed (N) over all loci, percent polymorphic loci at a 95% criterion (%P), the number of alleles per locus (A), observed heterozygosity (Ho), expected heterozygosity (He), and the inbreeding coefficient (FIS) are reported. Estimates for each measure are also reported as population means and for the species.
31
Locus FIS FIT FST
CAT-1 1.000 1.00 0.785
AAT-1 1.000 1.00 0.038
AAT-2 1.000 1.00 0.051
MDH-2 -0.033 -0.006 0.026
PGM-1 -0.091 0.939 0.944
TPI-1 1.000 1.000 -0.001
TPI-2 -0.037 -0.005 0.031
Overall 0.745 0.937 0.754
95% CI 0.112-1.000 0.420-1.000 0.028-0.890
Table 2.2. Wright’s F-statistics (Wright 1978) calculated at seven polymorphic allozyme loci for Ohio populations. FIS, inbreeding coefficient due to non-random mating; FIT, reduction in heterozygosity due to inbreeding within populations and genetic drift among populations; FST, degree of differentiation among populations.
32
Population N %P H S
MI1 21 36.21 0.136 0.209
MI2 6 41.38 0.155 0.231
MI3 10 36.21 0.118 0.181
OH1 13 36.21 0.122 0.194
OH2 24 51.72 0.202 0.307
OH3 17 50.00 0.166 0.254
OH4 13 41.38 0.164 0.247
OH5 40 56.90 0.185 0.291
OH6 25 51.72 0.157 0.248
OH7 23 48.27 0.186 0.285
MEAN 19.2 45.00 0.159 0.245
Species 192 62.10 0.220 0.349
Table 2.3. Measures of genetic variation at 58 RAPD loci for populations from Michigan and Ohio. For each population, the number of individuals sampled (N), percent of polymorphic loci at a 95% criterion (%P), Nei's (1973) gene diversity (H), and Shannon's index of gene diversity (S) are reported.
33
MI2 MI3
MI1
OH5, OH6
OH1, OH2, OH3 OH7 OH4 330 km
Figure 2.1. Locations of populations of Platanthera leucophaea from Michigan (MI1- MI3), and Ohio (OH1-OH7) included in the present study. Populations indicated by a single dot are within 12 km of one another.
34
0.6 P
0.5 S
H (a) 0.4
0.3 (b)
0.2 (c)
Index of genetic variation 0.1
0
0 0.5 1.0 1.5 2.0 2.5 3.0 3.5
Log mean population size
Figure 2.2. Three measures of genetic variation at random amplified polymorphic DNA (RAPD) loci, percent of polymorphic loci (P), Shannon's index of gene diversity (S), and Nei's index of gene diversity (H; Nei 1973) compared against population size estimated as a harmonic mean of the number of plants observed over multiple years of census. (a) r2 = 0.119; p > 0.10; (b) r2 = 0.027; p > 0.10; (c) r2 = 0.017; p > 0.10.
35
0.60
0.45
0.30
Genetic Distance
0.15
0.00 0 125 250 375 500
Geographic Distance (km)
Figure 2.3. The relationship between geographic distance and genetic distance estimated from random amplified polymorphic DNA (RAPD) bands and based on coancestry (Reynolds et al. 1983) for all pairwise comparisons between populations. A Mantel test was used to test the correlation between geographic and genetic distance (r2 = 0.467; p > 0.05).
36
OH7 (a) OH5
OH2
OH3
OH1
OH4
OH6 0.1
(b) OH1
OH4
OH2
OH3
OH5 OH7
MI1
MI2
OH6
MI3 0.1
Figure 2.4. Neighbor-joining tree of surveyed populations based on coancestry distances calculated from allozyme allele frequencies (a) and coancestry distances (Reynolds et al. 1983) from RAPD band frequencies (b). Population names follow those in Figure 2.1.
37
CHAPTER 3
THE COST OF INBREEDING IN PLATANTHERA LEUCOPHAEA
(ORCHIDACEAE)1
1 From Wallace, L.E. 2003. The cost of inbreeding in Platanthera leucophaea (Orchidaceae)”, American Journal of Botany (in press). Reproduced with permission from The American Journal of Botany, Botanical Society of America.
3.1 INTRODUCTION
In the midst of an extinction epidemic, habitat destruction and fragmentation are
among the most significant threats to loss of biodiversity (Young et al. 1996). Many
previously widespread species are now represented by few, isolated populations. The
survival and evolution of fragmented populations depends on their evolutionary histories
and the magnitude of future impacts. Thus, it is important to understand how habitat
fragmentation impacts demographic and genetic processes in threatened species in order to maximize viability and growth within populations.
In naturally outcrossing species, a significant threat to population extinction is
inbreeding, which can reduce individual fitness and produce genetically homogenous
populations (Mills and Smouse 1994; Frankham 1995b; Amos and Balmford 2001). For
naturally outcrossing species, the magnitude of inbreeding depression is a likely predictor
of persistence in populations that are small or have little access to interpopulational gene
flow (Barrett and Kohn 1991; Lesica 1993; Newman and Pilson 1997; Amos and
Balmford 2001). Inbreeding depression can result not only from self-fertilization but 38 from mating between genetically similar individuals (i.e., biparental inbreeding). Thus, in flowering plants, any self-compatible species is potentially at risk of inbreeding depression.
The negative consequences associated with inbreeding result from increased homozygosity within inbred individuals, which comes about by the action of overdominance (Wright 1977) or partial dominance (Charlesworth and Charlesworth
1987). According to the overdominance hypothesis, heterozygous individuals are always more fit, and thus, it is reduced heterozygosity that results in loss of fitness.
Alternatively, according to the partial dominance hypothesis, increased expression of and selection against recessive deleterious alleles during inbreeding cause a loss of fitness.
Regardless of the genetic mechanism at work, inbreeding can increase the risk of extinction if increased homozygosity reduces reproductive output in naturally outcrossed populations.
The magnitude of inbreeding depression experienced by a species should be strongly influenced by the demographic and mating history of individual populations.
Classical models of inbreeding depression predicted that a population with a history of bottlenecks and isolation would not be severely affected by repeated inbreeding because deleterious alleles in the homozygous condition are purged through repeated exposure to natural selection (Lande and Schemske 1985; Charlesworth and Charlesworth 1987;
Barrett and Charlesworth 1991). In contrast, a population that once was large or experienced gene flow may be more likely to suffer greater losses initially should inbreeding become common. More recent theoretical work suggests, however, that purging may not be an effective or consistent force in reducing inbreeding depression in
39 populations (reviewed in Byers and Waller 1999). The extent to which purging can reduce inbreeding depression will depend on a complex interaction of factors, including genetic effects such as dominance and epistasis, breeding system, population size, and the strength of natural selection acting on exposed alleles (Byers and Waller 1999). Once outcrossing is replaced by inbreeding as the predominant means of reproduction, populations may be on a path to extinction if individuals are unable to withstand the consequences of inbreeding depression.
In this study, the potential for inbreeding depression is examined in Platanthera leucophaea (Nuttall) Lindl. (Orchidaceae), the Eastern prairie white fringed orchid. This species was once frequently found in prairies and wetlands east of the Mississippi River, but loss of habitat, invasion of exotic species (e.g., Lythrum salicaria L. and Phalaris arundinacea L.), and over-collecting have caused significant population declines
(USFWS 2001). Presently, P. leucophaea is a federally listed threatened species known from 59 populations in the United States (Illinois, Iowa, Maine, Michigan, Ohio,
Virginia, and Wisconsin) and 12 populations in Ontario, Canada (USFWS 2001). Only six of the populations in the United States are considered highly viable. Because the majority of populations are critically small (i.e., fewer than 20 flowering plants) and fragmented, successful reproduction may be severely compromised in many of them. For example, small effective population sizes and isolation suggest that inbreeding may be common in many populations of P. leucophaea. Furthermore, estimates of the inbreeding coefficient, FIS, based on allozyme variation, indicate variable levels of inbreeding within populations (Cowden 1993; Wallace 2002). For example, Wallace
(2002) found significant heterozygote deficiency in five of seven populations surveyed
40 (FIS = 0.74-1) but an excess of heterozygous individuals in two other populations (FIS = -
0.043, -0.078). High FIS estimates were observed across four of the seven polymorphic
loci analyzed, supporting the idea that inbreeding, not a Wahlund effect, is a more likely cause for the excessive homozygosity observed in populations. Although high FIS values can also result from genetic drift in small populations, a correlation between population size and diversity, which might be expected if drift causes fixation of alleles, was not found in P. leucophaea (Wallace 2002). Additionally, several other rare orchid species also show variable levels of inbreeding that are independent of population size (e.g.,
Wong and Sun 1999; Alexandersson and Agren 2000). Thus, the indirect interpretation of high levels of inbreeding based on FIS values seems appropriate, and suggests that non- random mating has played a significant role in shaping population genetic structure in P. leucophaea. Given this variability in population genetic structure, the severity of inbreeding depression might also vary across populations. The goals of this study are to determine if inbreeding depression exists in P. leucophaea and to evaluate the extent to which the magnitude of inbreeding depression can vary with population size, genetic structure, and time.
3.2 MATERIALS AND METHODS
3.2.1 Study species
Platanthera leucophaea is a perennial species pollinated by nocturnal hawkmoths in the family Sphingidae (Robertson 1893; Bowles 1983; Cuthrell 1994). Flowering plants produce 10-30 creamy white flowers that open sequentially from the bottom to the top over a period of 1-2 wk. The flowers produce an abundance of nectar in a long spur at
41 the back of the flower as well as a strong, sweet fragrance at dusk. Upon visiting a flower, a hawkmoth projects its proboscis down into the spur to drink the nectar. As the proboscis is withdrawn from the spur, it brushes against an anther sac and picks up a pollinarium (composed of a pollinium, stipe, and viscidium). The pollinium subsequently rotates about the viscidium to a point where it can contact the stigma of another flower.
Darwin (1877) believed this bending mechanism promoted outcrossing. A single pollinium is probably sufficient to fertilize the thousands of ovules in an ovary, but whole pollinaria are rarely deposited on single flowers (Neiland and Wilcock 1995). Rather, as pollinia are rubbed against the stigma, massulae (groups of pollen grains) are removed and stick to the stigma. Consequently, many flowers probably receive pollen from multiple donors because hawkmoths regularly visit multiple flowers on an inflorescence and are frequently found carrying multiple pollinaria (Cuthrell 1994).
Several days after pollination, the external flower withers and the seeds develop within the ovary. The dust-like seeds and are dispersed in the autumn by the wind when the capsule dehisces. The seeds contain only an embryo and a testa (seed coat). Seed germination is greatly aided by the presence of a mycorrhizal symbiont, and seedling survival is entirely dependent on the association (Stoutamire 1996; Zettler et al. 2001;
Bowles et al. 2002). Germinated seeds remain parasitic on the mycorrhizae for some time before producing leaves. Additionally, roots of plants must be infected each spring before shoots re-emerge. Despite the orchid’s reliance on them, mycorrhizae are probably not species-specific or limiting because multiple species have been isolated from P. leucophaea (Curtis 1939; Zettler et al. 2001). There is some evidence that seed germination is inhibited by light, but may be induced by high water levels (Stoutamire
42 1996; USFWS 2001). Under natural field conditions, seeds become infected during late
spring or early summer, coinciding with the time when above-ground shoots re-emerge
(USFWS 2001; L. Wallace, unpubl. data). The species probably does not maintain a large seed bank, relying instead on production of an over-abundance of seeds from each flower each year (Stoutamire 1996).
3.2.2 Experimental design and statistical analysis
The potential for inbreeding depression was examined in two populations that differ in size, genetic structure, and community structure. The first population, (hereafter referred to as the large population) near Lake Erie in northern Ohio (Sandusky County), is currently one of the largest known populations of this species. In 1996, more than
5600 flowering plants were observed in this population, but yearly censuses have shown many fewer flowering plants recently (J. Windus, pers. comm.). The closest known population is approximately 2 km away. The large population occurs in an early successional lake plain prairie, and is affected by fluctuating lake levels and heavy invasion of exotic species, including Lythrum salicaria and Phalaris arundinacea
(USFWS 2001). Despite its large size, suitable habitat for this population is not abundant
(USFWS 2001). This large population contains very little allozyme variability
(percentage of polymorphic loci = 8.33; HO = 0), and estimates of inbreeding are high
(FIS = 1.0; Wallace 2002).
The second population (hereafter referred to as the small population) used in this
study occurs in a late successional wet sedge meadow in north-central Ohio (Holmes
County). It is typical of the size of many other extant populations in Ohio and Michigan
where suitable habitat is limited (USFWS 2001). This population has had fewer than 50
43 flowering plants for the last 15 yr (J. Windus, pers. comm.), but is within 10 km of two
other P. leucophaea populations. While it also has low levels of polymorphic loci
(8.33%), observed heterozygosity is slightly higher (HO = 0.021), and estimates of
inbreeding are quite low (FIS = -0.078; Wallace 2002).
Experiments were carried out over 3 yr in the large population (1998-2000) and 2
yr in the small population (1999-2000) to evaluate the effect that different environmental
conditions or genotype may have on the severity of inbreeding depression. In each
population, plants were selected on the basis of having several unopened buds and/or
fresh unpollinated flowers. Flowers were determined to be unpollinated by the presence
of two pollinaria and the absence of visible massulae on the stigma. Every attempt was
made to choose plants that were at the same stage of flowering. Unpollinated flowers and
unopened buds were covered with net bags until they could be pollinated by hand. Of the plants that were suitable candidates, a sample was chosen for experimental manipulation
(all flowering plants were used in the small population). Sample sizes were 34 plants in
1998, 50 plants in 1999, and 51 plants in 2000 in the large population. In the small
population, sample sizes were 19 plants in 1999 and nine plants in 2000.
To control for genetic and maternal effects, each plant was treated as a block. On
each plant, three flowers were chosen for one of the three pollination treatments: hand
self pollination, hand outcross pollination, or open pollination. Hand pollinations
involved removing a single pollinarium from a flower with a metal dissecting needle and
rubbing it on the stigma of a recipient flower. Before pollination, self-pollinaria were
removed from flowers. Flowers that were selfed received pollen from their own anther
(i.e., true selfing), while flowers that were outcrossed received pollen from an individual
44 at least 2 m away. This species is not known to be clonal, but individual plants often grow in close proximity to one another. Thus, by choosing plants at this distance, the chances of effecting biparental inbreeding were reduced. Hand-pollinated flowers were covered by net bags until capsules matured. Additionally, in the large population in
1998, 21 flowers on a separate set of 21 plants were chosen as a test for autogamous pollination. The buds of these flowers were placed in net pollination bags and left bagged for the duration of flowering. Bagged flowers were periodically checked during the time between treatment and collection of capsules. In mid-September, mature, unopened capsules were collected and taken back to the laboratory where they were stored in desiccant at 4°C until further examination.
Reproductive success, and thus the potential for inbreeding depression, was estimated at the earliest possible stage in this species- at the level of seed set and seed viability. The proportion of capsules setting seed was determined for each treatment.
Fruits were assumed to have set seed if viable seeds were found in a capsule. Each capsule and its seeds were weighed, and seed mass relative to total fruit mass was calculated. All of the seeds from a capsule were mixed and a subsample was taken for assessment of seed viability. Seeds were soaked at room temperature in a 5% bleach solution for 1.5 h, after which they were rinsed in distilled water, put into petri dishes with a 1% solution of triphenyltetrazolium chloride (TTC), and left in the dark at room temperature for at least 24 h. After treatment, seeds were rinsed onto filter paper and dried at room temperature until they could be easily removed from the paper onto a microscope slide. A minimum of 100 seeds (mean = 307) was examined per capsule at
100X under a light microscope to assess viability. A seed was considered viable if it
45 contained a large, plump reddish-brown embryo, while a seed was judged inviable if it
did not contain an embryo or contained a shriveled, uncolored embryo. (The TTC
staining schedule worked inconsistently for seeds collected during 2000. Therefore, viability of seeds collected in 2000 was based primarily on the size and quality of the
embryo.) These categories were easy to distinguish for the majority of seeds, but for the
few ambiguous cases, the seeds were not included in the final count. The proportion of
viable embryos in the subsample was subsequently determined.
Differences in the frequency of seed set among the three treatment groups were tested using a G test of independence (Sokal and Rohlf 1995) for each year of the experiment in each population. Differences in relative seed mass and percent seed
viability among treatments were analyzed using a randomized complete block design and
analysis of variance (ANOVA) in the large population for each year. Where necessary,
data were arcsine transformed to meet the assumptions of ANOVA. Treatment was
considered a fixed effect, and each plant was considered a block and treated as a random
effect. Analyses were performed using the univariate analysis of general linear models in
SPSS (version10 1999) with the type IV sum of squares, as recommended for missing
data within blocks. No block is missing data for more than one treatment. In the large
population in 1998, seven data points are missing (two each in the self and outcross-
pollinated treatments and three in the open-pollinated treatment); in 2000, three data
points are missing for the outcross-pollinated treatment. When significant differences
were found, Bonferroni tests were used to discern where the differences existed (Sokal
and Rohlf 1995). Due to small sample sizes in the small population, data for each year
were analyzed with a non-parametric Kruskal-Wallis test (Zar 1996) performed in SPSS.
46 Two data points are missing from the self and outcross-pollinated treatments for the small population in 1998. There are no missing data for the 2000 data set.
Pearson’s correlation (Sokal and Rohlf 1995) between total seed mass and seed viability was also calculated for each site and each year using SPSS. Lastly, the magnitude of inbreeding depression (δ) was calculated for each site and each year according to the following formula: δ = (poutcross – pself)/poutcross, where pi represents the
variable measured for each mode of pollination (Holsinger 1988). According to this
equation, estimates of inbreeding depression range from –1 to 1. Negative values result
when selfed progeny are more fit than outcrossed progeny. A value of 0.5 is a threshold
value over which an outcrossing mating system should be favored.
3.3 RESULTS
Due to environmental factors, only a small fraction of pollinated capsules
survived to maturity (Fig. 3.1). In the large population during 1998, intact capsules were
retrieved from 29 of the 34 plants originally manipulated. Drought conditions prevented
the formation of most capsules during 1999; of the 50 plants initially pollinated, only
nine produced capsules. Consequently, the data for this year have not been analyzed.
During 2000, capsules were recovered from 33 of the 51 pollinated plants. In the small
population, capsules were recovered from eight of the 19 plants pollinated in 1999 and
from every pollinated plant (N = 9) in 2000.
In the large population, the majority of capsules that were recovered set seed (Fig.
3.1). Seed set for all three treatments in the large population was greater than 50% in
1998 and 2000. In all three years of study, self-pollinated flowers exhibited lower seed 47 set compared with hand-outcrossed or open-pollinated flowers. Open-pollinated flowers consistently exhibited the highest levels of seed set. Tests of independence indicated a
significant association between mode of pollination and level of seed set in the large
population for each study year (G = 7.04 for 1998; G = 13.50 for 1999; G = 7.77 for
2000).
Of the 21 buds that were bagged in 1998 in the large population, 15 were
recovered at the end of the growing season, but none produced viable seeds. This result
confirms previous observations that P. leucophaea requires a vector for pollination.
However, it does not preclude the possibility of facilitated selfing in this species.
In the large population, the mode of pollination had a significant effect on seed
mass and seed viability for both years (Table 3.1). However, the trends differed among
years. In 1998, open-pollinated capsules were similar to hand-outcrossed capsules, but
both had significantly higher seed mass and seed viability than hand-selfed capsules. In fact, there is more than a two-fold difference in percent seed viability between open- pollinated (77%) or outcrossed (62%) capsules compared to selfed capsules (16%). In contrast to these findings, during the 2000 season, hand-pollinated capsules were relatively similar to one another in relative seed mass, but all three treatments differed significantly in the proportion of viable seeds per capsule. Seed viability was lower in both open-pollinated (59%) and hand-outcrossed (39%) capsules in 2000 compared to
1998, but it was slightly higher in the self-pollinated (23%) capsules in 2000.
Nevertheless, seeds resulting from self-pollination still exhibit lower overall levels of viability than seeds resulting from outcross or open pollination.
48 In the small population, seed set was also greater than 50% in all treatments in both years of study (Fig. 3.2). However, mode of pollination and seed set were not significantly associated in this population in either year (G = 1.02 for 1999; G = 3.29 for
2000). In both years, hand-outcrossed and self-pollinated flowers had similar levels of seed set, which were lower than open-pollinated flowers in 1999, but higher than open- pollinated flowers in 2000.
In the small population, the mode of pollination did not result in significant differences in seed mass or seed viability in either 1999 or 2000 (Table 3.2). In both years, outcross-pollinated seeds did show at least 10% greater viability compared to self- pollinated seeds. Open-pollinated capsules exhibited lower seed mass and viability than outcross-pollinated capsules, which may reflect limited pollinator activity in the small population.
The reduction in seed set, seed mass, and seed viability for self-pollinated capsules relative to outcross-pollinated capsules suggests that this species does experience a loss of reproductive success as a result of inbreeding. However, these data also suggest that the magnitude of inbreeding depression can differ substantially among populations and environmental conditions. A high correlation between seed mass and proportion of viable seeds in a capsule in the large population in both 1998 (r = 0.74; P <
0.001) and 2000 (r = 0.71; P < 0.001) and in the small population in 2000 (r = 0.66; P <
0.001), but very little inbreeding depression was found in seed mass or seed set in either of these populations. In contrast, rather high levels were found for seed viability in the large population in both years and in the small population in 1999. Estimates of δ, measured for seed set or relative seed mass, are less than 0.30 in both populations in any
49 year (Table 3.3). In contrast, estimates of δ, based on seed viability, range from 0.74
(1998) to 0.41 (2000) in the large population and from 0.49 (1999) to 0.17 (2000) in the
small population.
3.4 DISCUSSION
3.4.1 Reproductive output
Low levels of fruit set (< 50%), common among epiphytic (e.g., Oncidium
variegatum; Ackerman and Montero Oliver 1985) and terrestrial orchid species (e.g.,
Ophrys insectifera [Darwin 1877]; Cypripedium calceolus [Nilsson 1979; Kull 1998];
Dactylorhiza lapponica [Neiland and Wilcock 1995], are usually attributed to a lack of
pollinators and/or limited resources (e.g., Zimmerman and Aide 1989; Snow and
Whigham 1989; Ackerman and Montalvo 1990; Primack and Stacy 1998). Although the high levels of seed set (>50%; Fig. 3.1) observed in P. leucophaea may seem anomalous, pollinators were frequently seen visiting flowers in the large population. High levels of seed set have previously been noted in this population as well (J. Windus, pers. comm.).
Successful seed production may have been aided by experimenter presence that reduced herbivory by insects and otherwise protected plants. Additionally, size and proximity to other populations may have acted to increase pollinator visitation rates in the populations included in this study. Nevertheless, because natural fruit set has been low (<50%) in other populations of P. leucophaea (Cuthrell, 1994; J. Windus, pers. comm.), isolation and small size may still be a strong deterrent to reproduction (Washitani 1996; Steffan-
Dewenter and Tscharntke 1999).
Frequent pollinator visitation in the large population also resulted in high levels of seed viability. However, open pollination was not expected to lead to increased levels of
50 seed viability relative to outcross pollination performed by the experimenter. This
difference may reflect disparity in how the flowers were pollinated, especially in the
method of application and the amount of pollen applied to stigmas. Hand pollinations
involved rubbing a single pollinium on the stigma of a recipient flower. The amount of
pollen likely was not a limiting factor in the hand-pollinated treatment because a single
pollinium contains more pollen than is needed to fertilize all of the ovules in an ovary
(Neiland and Wilcock 1995; Light and MacConaill 1998). Many orchids have high
pollen:ovule ratios, and the ratio in Platanthera chlorantha (Custer) Rchb., a morphologically similar species to P. leucophaea, is 24:1 (Neiland and Wilcock 1995).
Perhaps, though, the large pollen load of an entire pollinium had a negative effect on seed production in hand-pollinated flowers. In most species with sectile pollinia, including P. leucophaea, massulae, rather than whole pollinia are deposited on stigmas (Neiland and
Wilcock 1995). Thus, the placement of a pollinium on the stigma may have led to pollen tube overcrowding in the style, thereby inhibiting access to all ovules in the ovary
(Cruden 1976; Neiland and Wilcock 1995). In contrast, the placement of multiple massulae over several days by hawkmoths is probably less likely to lead to pollen overcrowding and may promote higher seed viability and multiple siring of seeds within a single ovary.
3.4.2 Magnitude of inbreeding depression
Orchids are widely known for their floral specialization and use of animal pollinators. Only 5-20% of species are capable of autogamous pollination (Catling
1990), but most species are self-compatible with pre-pollination barriers to self- fertilization (van der Pijl and Dodson 1966). As in many other outcrossing angiosperm
51 species, though, inbreeding depression may also promote outcrossing in orchids by acting as a post-pollination barrier to self-fertilization. Pollination syndromes in orchids have been widely studied, but very there are few reports on the cost of inbreeding in orchids.
When inbreeding depression has been studied in orchids, it is typically estimated from
reproductive output (e.g., fruit set and seed viability) of the maternal plant, rather than
survivability or reproductive success of the offspring. The results indicate a variety of
responses to inbreeding in orchids. Species that are capable of self-fertilization via
autogamy or facilitated selfing show little evidence of inbreeding depression (e.g.,
Peakall and James 1989; Ortiz-Barney and Ackerman 1999; Alexandersson and Agren
2000), while outcrossing species exhibit varying degrees of inbreeding depression (e.g.,
Nilsson 1983; Johnson 1994; Peakall and Beattie 1996; Vallius 2000; Borba et al. 2001;
Luyt and Johnson 2001; Meléndez-Ackerman and Ackerman 2001). Results from this
study, as well as previous work by Bowles et al. (2002), suggest P. leucophaea also
experiences moderately high levels of early acting inbreeding depression.
Inbreeding depression was not severe at the level of seed set or seed mass (Table
3.3), a pattern that was consistent in both populations. These variables are probably less
accurate measures of reproductive success than seed viability, though. Capsules were
considered to have set seed if any viable seeds were present. Even though seed mass and
proportion of viable seeds are significantly correlated, seed mass, like seed set, does not
take into account those seeds that lack embryos. The difference in mass between a seed
with an embryo and one without an embryo is miniscule and certainly undetectable with
most balances. Thus, even in a bulk measure of seeds with and without embryos, it is
probably difficult to distinguish an overall difference. The quality of seeds (e.g., embryo
52 presence or germination) is expected to more accurately reflect differences in
reproductive success, and P. leucophaea does show inbreeding depression for seed
viability in both populations (Table 3.3). In general, estimates of δ for P. leucophaea are
more similar to mean estimates of inbreeding depression for outcrossing angiosperm
species (δ = 0.49) than for selfing species (δ = 0.22; Husband and Schemske 1996).
Furthermore, the estimates of inbreeding depression in P. leucophaea are concordant with the floral biology, suggesting that outcrossing is the predominant means of reproduction. Nevertheless, the frequent presence of viable seeds in self-pollinated capsules (in some instances, the number of viable seeds was quite high) suggests that self fertilization may be tolerated in some populations.
3.4.3 Variability in the expression of inbreeding depression
The strength of inbreeding depression is likely to vary across populations, owing
to their unique evolutionary and demographic histories. While isolated populations of P. leucophaea may experience increased levels of inbreeding through geitonogamy or biparental inbreeding, the results of this study do not suggest that early acting inbreeding depression will be more severe in smaller populations relative to larger populations. On the contrary, the population, in which inbreeding is thought to be frequent, experienced higher levels of inbreeding depression as a result of self-fertilization. These data provide little evidence to support the classical view that repeated inbreeding reduces inbreeding depression in this population. Consequently, low levels of genetic heterozygosity combined with inbreeding depression suggest that this population, despite its current size, may be more vulnerable to extinction than other populations with more stable population histories. Although the large population is the largest known in Ohio presently, before 53 1992, fewer than 50 flowering plants had been observed (J. Windus, pers. comm.). Thus,
it is likely that the large population experienced a bottleneck or a recent influx of migrants from other populations. In contrast, the small population may have been historically small, experiencing relatively minor fluctuations in the number of reproductive individuals from year to year. Perhaps, it has reached an equilibrium level of inbreeding and is less likely to be affected by inbreeding depression in the future.
Results from this study as well as studies of population genetic structure (Wallace 2002) indicate that size (i.e., number of flowering individuals) alone is not an adequate predictor of population viability in P. leucophaea.
Temporal differences in the magnitude of inbreeding depression have been reported in other species (e.g., reviewed in Charlesworth and Charlesworth 1987; reviewed in Husband and Schemske 1996; reviewed in Byers and Waller 1999), and may be attributed to purging of deleterious alleles through repeated inbreeding (i.e., when δ decreases with increased inbreeding), the effect of differing environmental conditions on survival and reproductive success, or genetic variation among the individuals chosen for the experiment. Although purging of deleterious alleles may occur in populations of P. leucophaea with repeated inbreeding, it is impossible for such an effect to be seen during the 3 yr duration of this study because individual plants can grow for more than 3 yr before their first flowering (Bowles 1983). Additionally, seeds used to estimate inbreeding depression were not placed back into the population and therefore are not contributing to future generations. Thus, it would seem that some effect of the habitat and/or genetic make-up of the individuals used in the study accounts for the different levels of inbreeding depression seen across years.
54 An increase in inbreeding depression as a result of stress, which has been found in some other species (Dudash 1990; Eckert and Barrett 1994; but see Johnston 1992;
Groom and Preuninger 2000), was not readily apparent in this study. Although the effect of environmental stress was not directly tested in this study, rainfall levels varied across the 3 yr of study in the large population. In 1999 and 2000, this population experienced extremely dry conditions, which resulted in death of above-ground shoots before fruit set in 1999. The majority of open-pollinated and outcross-pollinated flowers produced seed in 2000, but the proportion of viable seeds for these treatments was lower in 2000 than in
1998. In contrast, the proportion of viable seeds increased among the self-pollinated flowers in the large population, but the difference was only 7% (Table 3.1). While this finding suggests that inbreeding depression was not as severe in 2000 compared to 1998, it is noteworthy that self-pollinated flowers still produced significantly fewer viable seeds than outcross or open-pollinated flowers in both years of experimentation. In contrast, environmental conditions in the small population appeared more consistent over the two years of this study, but many fewer plants were seen flowering in 2000. Thus, reasons for the differences in inbreeding depression seen across years and populations are not easily explained, and reflect the complex interaction of multiple environmental and biological factors on the expression of inbreeding depression.
3.4.4 Is inbreeding depression a significant threat to populations of Platanthera leucophaea?
Allozyme data strongly suggest inbreeding in many populations of P. leucophaea, irrespective of population size (Wallace 2002). Additionally, the results of this study indicate a negative consequence of inbreeding at the level of seed development. The
55 relative importance of inbreeding via geitonogamy or matings between genetically similar individuals is not so clear, however. Studies on other orchids suggest biparental inbreeding is more likely than geitonogamy to lead to inbreeding depression. For example, Johnson and Nilsson (1999) predicted that geitonogamy will occur in P. chlorantha only after a pollinator visits nine flowers. Geitonogamy was infrequent due to the short time a pollinator spent on each inflorescence and the length of time it takes for a pollinarium to bend into the correct position to contact a stigma (80 s). Furthermore, they suggested that deposition of massulae, rather than entire pollinia, promoted high levels of pollen carryover. Because of the strong resemblance to P. chlorantha in flower structure and pollination syndrome (i.e., both are nocturnally pollinated by moths), geitonogamy probably occurs infrequently in P. leucophaea as well. Pollen carryover could result in
biparental inbreeding, though, if individuals within populations are genetically similar.
Even though inbreeding depression was observed at the level of seed production
and seed development, the great abundance of seeds that can be produced in a single
orchid ovary may compensate for reductions in seed viability in inbred flowers.
Measures of inbreeding depression based on seed set or embryo viability, unfortunately,
then, may say little about the long-term survival of inbred and outcrossed offspring. A
few studies have demonstrated inbreeding depression at the level of seed germination.
Bowles et al. (2002) reported a significant and positive correlation between proportion of
viable seeds per capsule and seed germination for P. leucophaea, and suggested that
inbreeding depression may have a cascading effect starting with fruit set and following
through to later life stages. Unfortunately, the difficulty in germinating orchid seeds and
growing seedlings severely hinders examination of inbreeding depression at later life
56 stages in orchids, and I am unaware of any orchid studies where offspring fitness has been considered beyond the level of seed germination.
3.4.5 Conservation implications
Management plans for rare, endangered, or threatened species designed with information from multiple sources, including population genetic structure, ecological requirements, and reproductive biology offer the best hope of protecting these species.
While much more is known about the life history of P. leucophaea than many other rare species, there are still many aspects of its life cycle that are not clear. The persistence of this species is dependent upon successful recruitment within populations. Given the small sizes and fragmented distribution of populations of P. leucophaea, seedling recruitment is likely to be severely limited by multiple factors, including pollinator service and suitable microsites for seed germination (Calvo 1993). The results of this study clearly suggest that early acting inbreeding depression exists in P. leucophaea, and may be an additional threat to long-term survival of populations. Long-term studies that can identify critical life stages in seedling recruitment, which will also be the most difficult to study because they are the stages spent underground, will be invaluable for future conservation of P. leucophaea. This information will be particularly important if the creation of new populations or supplementation of existing populations become primary objectives in the conservation of this species. At this time, a cautious management plan would be one that strives to stimulate growth and stability within extant populations by promoting outcrossing within populations, increasing population sizes, and maximizing genetic variability.
57
Relative seed mass Proportion of viable seeds
Treatment N Mean ± SE F N Mean ± SE F
1998
Self 27 0.15 ± 0.013a 9.44*** 27 0.16 ± 0.030a 41.36***
Outcross 27 0.17 ± 0.015b 27 0.62 ± 0.060b
Open 26 0.19 ± 0.016b 26 0.77 ± 0.051b
2000
Self 33 0.16 ± 0.014a 5.45** 33 0.23 ± 0.056a 22.27***
Outcross 30 0.15 ± 0.013a 30 0.39 ± 0.058b
Open 33 0.20 ± 0.012b 33 0.59 ± 0.056c
Table 3.1. Performance of selfed, outcrossed, and open-pollinated flowers in the large population of Platanthera leucophaea in 1998 and 2000. Mean values (± 1 SE) are reported for relative seed mass and proportion of viable seeds in a subsample of seeds. Sample sizes are given as N. The effect of treatment was tested with an ANOVA (** P < 0.01; ***P < 0.001). Significant differences among treatments were tested with Bonferroni tests and are indicated by unlike symbols following mean values.
58
Relative seed mass Proportion of viable seeds
Treatment N Mean ± SE Η N Mean ± SE Η
1999
Self 6 0.14 ± 0.030 0.34 6 0.31 ± 0.111 0.56
Outcross 6 0.17 ± 0.055 6 0.46 ± 0.186
Open 8 0.13 ± 0.013 8 0.41 ± 0.121
2000
Self 9 0.27 ± 0.093 2.56 9 0.46 ± 0.097 3.65
Outcross 9 0.18 ± 0.032 9 0.55 ± 0.114
Open 9 0.13 ± 0.030 9 0.27 ± 0.119
Table 3.2. Performance of selfed, outcrossed, and open-pollinated flowers in the small population in 1999 and 2000. Mean values (± 1 SE) are reported for relative seed mass and proportion of viable seeds in a subsample of seeds. Sample sizes are given as N. The effect of treatment was tested with a Kruskal-Wallis test (H). No significant differences were found for either variable or either year.
59
Population, year Seed set Relative seed mass Proportion of viable seeds
Large, 1998 0.21 0.12 0.74
Large, 2000 0.26 -0.05 0.42
Small, 1999 0 0.17 0.49
Small, 2000 0 -0.50 0.17
Table 3.3. Magnitude of inbreeding depression observed in seed set, relative seed mass, and proportion of viable seeds in the large and small populations during 1998, 1999, and 2000.
60
200
180 Seed set
160 Capsules recovered
140 120 100 Percent 80 60 40 20 0
Self Self Self Self Open Open Open Outcross Outcross Outcross 1998 1999 2000
Figure 3.1. Proportion of capsules recovered relative to the total number chosen for experimental manipulation, and proportion of capsules setting seed for flowers that were self-pollinated, outcross-pollinated, or open-pollinated in the large population in 1998, 1999, and 2000. A significant association exists between mode of pollination and seed set 2 for all years (G test of independence, χ 0.05 [2] = 5.91).
61
200 180 Seed set 160 Capsules recovered 140 120 100 80 Percent 60 40 20 0
Self Self Self Open Open Outcross Outcross
1999 2000
Figure 3.2. Proportion of capsules recovered relative to the total number chosen for experimental manipulation, and proportion of capsules setting seed for flowers that were self-pollinated, outcross-pollinated, or open-pollinated in the small population in 1999 and 2000. Mode of pollination and seed set are independent in both years (G test of 2 independence, χ 0.05 [2] = 5.91).
62
CHAPTER 4
PHYLOGENETIC PATTERNS IN PLATANTHERA SECTION LIMNORCHIS
(ORCHIDACEAE) BASED ON THE INTERNAL TRANSCRIBED SPACER (ITS) OF
NUCLEAR RIBOSOMAL DNA
4.1 INTRODUCTION
Platanthera section Limnorchis (Orchidaceae) has bewildered taxonomists for
more than a century because species’ boundaries are easily blurred by intraspecific
morphological variability and putative interspecific hybridization (Kraenzlin 1893;
Rydberg 1901; Ames 1910; Luer 1975; Schrenk 1978; Sheviak 1999). Numerous
taxonomic treatments have been published, but there is still little consensus on the number of species or defining characters for species. For example, Rydberg (1901)
created a new genus for the complex, Limnorchis, and recognized 24 species. By
contrast, Kraenzlin (1893) treated all of the morphological variants in one polymorphic
species. Still, others have taken an intermediate interpretation by recognizing only a
limited number of species (e.g., Ames 1910) and using intraspecific designations to deal
with morphological variants (e.g., Correll 1950; Luer 1975). The most comprehensive
treatments of the section by Rydberg in 1901 and Ames in 1910 are contrasted in Table
4.1. The generic placement used by both of these authors is now considered to be
incorrect. Recent molecular phylogenies have demonstrated that the species of
63 Limnorchis constitute a monophyletic subgrouping within Platanthera (Hapeman and
Inoue 1997). To pull Limnorchis species out as a distinct genus would lead to paraphyly
of Platanthera. Molecular phylogenetic studies have also demonstrated strong
differences between Habenaria, now considered largely tropical, and Platanthera, of tropical and temperate distribution (Pridgeon et al. 1997). The currently accepted generic name, Platanthera, will be used throughout this dissertation.
Since the early 20th century, there have been only a few improvements to the
taxonomy of section Limnorchis. Schrenk (1978) suggested a hybrid theory (Fig. 4.1) to
deal with variants that do not fit into the boundaries of otherwise recognizable species.
Hapeman and Inoue (1997) elucidated the monophyly of section Limnorchis within
Platanthera using DNA sequence data from nuclear ribosomal DNA. Catling and
Catling (1989, 1997) and Sheviak (1999) have made significant strides in circumscribing
the identity of Platanthera huronensis (Nutt.) Lindl., a polyploid species, from other
entities still under the umbrella of Platanthera hyperborea (L.) Lindl. In the remainder
of this dissertation I hope to add to our systematic understanding of section Limnorchis.
Section Limnorchis, a primarily North American group, is largely boreal and
montane. It reaches its greatest complexity in the western cordillera, but several species
also occur in the East and the Southwest. Some authors have suggested that some eastern
Asian species of Platanthera may also be a part of section Limnorchis, but Hapeman and
Inoue (1997) did not find strong molecular evidence of a relationship between any of the
Asian species they examined and the species of section Limnorchis. Nevertheless, Inoue
(1983), working in Japan, suggests that some species of section Limnorchis do have
64 extended ranges that reach the Aleutian Islands and Japan. Thus, it is not clear whether
section Limnorchis truly occurs in Asia or if the Asian plants have been misidentified.
The species of section Limnorchis are all terrestrial, photosynthetic, and primarily found in mesic habitats. Most of the species are not endemic to a single type of habitat, but some species do have restricted distributions. Populations of the more common species are found in roadside ditches, forests, mountain meadows, fens, bogs, and along stream banks. The species may be characterized as mid-successional, and population turnover is probably frequent in disturbed sites. Additionally, although all of the species are perennial, individual plants are probably not long-lived (Reddoch and Reddoch
1997).
Section Limnorchis is characterized by plants with leafy stems and elongate spikes of white to green flowers (Fig. 4.2) which are generally similar, yet display a great deal of variability (Table 4.1). Plants may be sparsely to densely flowered, depending on the species and to some extent, environmental conditions. All of the species flower during June, July, and August. Some of the species bloom for more than 50 days (Boland
1993), a strategy that may maximize reproductive success when pollinator visitation is low. After pollination, the flowers remain on the developing ovary, although petals and sepals tend to curl up preventing access to the stigma. Individually, the flowers are small
(1-2 cm wide) and rather inconspicuous, but large racemes of 50 or more flowers can be quite striking. The flowers are subtended by photosynthetic floral bracts. Flower structure is typical of orchids, and these species also have a spur that extends outward just below the lip. The length of the spur typically corresponds to proboscis length of the primary pollinator. Most of the species produce nectar in their spur, but not all of them
65 are fragrant. In several species, the lateral petals are situated inside the dorsal sepal,
forming a hood-like structure over the column, while the lateral sepals extend outward
(Fig. 4.2). The lip is rhombic to linear in shape while the spur is globose to cylindrical, slender to stout, and shorter or longer than the lip. The stigma, situated immediately
above the spur, is rounded in P. aquilonis or pointed, to some degree, in most other
species. On either side of the stigma lie two anther sacs, each holding a single
pollinarium. Viscidia at the bases of pollinaria are situated in such a way that they contact the eyes or proboscis of a pollinator as it probes the spur. Most species are
thought to be primarily outcrossing, but geitonogamy is possible. Various moths,
butterflies, bees, flies, and beetles are attracted to the species that are fragrant and
produce nectar (Kipping 1971; Catling and Catling 1989; Patt et al. 1989; Boland 1993).
Platanthera aquilonis Sheviak (previously known as Platanthera hyperborea) is both
allogamous and autogamous (Gray 1862a; Reddoch and Reddoch 1997; Sheviak 1999).
Self-fertilization is effected when massulae (i.e., clumps of pollen grains within a
pollinium) fall out of the anther sac and down onto the flat, wide stigma (Gray 1862a;
Reddoch and Reddoch 1997; Sheviak 1999). None of the species is believed to be
specialized for a single species of pollinator, but flowers may be similar enough that
some pollinators are shared between species when they come into contact, thereby
increasing the likelihood of interspecific hybridization in this group. Alternatively, subtle
shifts in floral structure or resulting pollinator behavior (e.g., where pollinia are placed on
the pollinator, the length of the nectar spur) may be adequate to isolate species (Inoue
1983; Hapeman and Inoue 1997). Although numerous interspecific hybrids have been
66 named, the genetic nature of these hybrids or compatibility of pure parental forms has not been examined experimentally.
In this study, evolutionary relationships among the taxa in section Limnorchis are explored using sequence data from the internal transcribed spacer (ITS) region of 18S-
26S nuclear ribosomal DNA. ITS sequences have been used widely to infer phylogenetic relationships among angiosperm taxa, and in some cases this region exhibits enough polymorphism to be useful at low taxonomic levels (reviewed in Soltis and Soltis 1998).
Although nuclear rDNA occurs in multiple copies, loci are expected to become homogenized as a result of concerted evolution (Zimmer et al. 1980; Hillis et al. 1991) due to gene conversion (Hillis et al. 1991) and/or unequal crossing-over (Arnheim 1983).
In hybrid individuals, however, multiple copies of nuclear rDNA may be retained if hybridization occurred relatively recently, nuclear rDNA repeats are at different loci in parental genomes and interlocus gene conversion does not happen in the hybrid, or if the hybrid is asexual (Baldwin et al. 1995). Thus, nuclear rDNA sequences can also be helpful for elucidating cases of reticulate evolution. Because hybridization is thought to be extremely common in section Limnorchis, ITS sequence data may be particularly helpful for indicating instances of reticulation in this group. Platanthera huronensis is polyploid (4N = 84; Sheviak and Bracht 1998) whose hypothesized origin is hybridization between Platanthera dilatata, a white-flowered species (2N = 42), and
Platanthera aquilonis, a green-flowered species (2N = 42), followed by the retention of both genomes (Catling and Catling 1997, Sheviak 1999). Comparison of nuclear rDNA sequences from multiple samples of P. huronensis to those of its purported parents will be used to test the hypothetical origin of the polyploid. Additionally, these data will
67 provide a better understanding of the molecular evolution of nuclear rDNA sequences in
P. aquilonis, P. dilatata, P. huronensis, and closely related species and the utility of
nuclear rDNA sequences as phylogenetic markers at lower taxonomic levels in
Platanthera.
4.2 MATERIALS AND METHODS
A total of 55 samples from section Limnorchis and four outgroup taxa, all species of Platanthera, was included in this study (Table 4.2). This sampling scheme includes eight of the described taxa of section Limnorchis as well as representatives from various geographic regions for seven of the taxa. Sequences for two of the outgroup taxa,
Platanthera praeclara and P. chlorantha, were taken directly from GenBank (Table 4.2).
Voucher specimens from populations sampled by the author are deposited at OS. Several
accessions were taken from specimens in other herbaria (Table 4.2). Total genomic DNA
was extracted from fresh or silica dried leaves using a modification of the CTAB method
(Doyle and Doyle 1987). The entire region between 18S rDNA and 26S rDNA was
amplified using primers N-nc18S10 (5’AGGAGAAGTCGTAACAAG3’) and C26A
(5’GTTTCTTTTCCTCCGCT3’; Wen and Zimmer 1996). Amplifications were done in
25 µL reactions containing the following ingredients: 1X PCR buffer (20 mM Tris-HCl
and 50 mM KCl; Invitrogen, Carlsbad, California, USA), 200 µM of each dNTP
(Invitrogen), 5 mM MgCl2, 0.4 µM of each primer, 0.5 units of Taq DNA polymerase
(Invitrogen), 2.5 µL DMSO, and 1.0 µL template DNA. The thermocycler program used to amplify the region is 1 cycle of 94° C for 3 min, 50° C for 1 min, 72° C for 1 min; 30 cycles of 94° C for 1 min, 50° C for 1 min, 72° C for 45 s; 1 cycle of 72° C for 5 min; 68 indefinite soak at 4° C. Amplification products were verified on 1% TAE agarose gels
and subsequently cleaned by precipitating them with an equal volume of PEG:NaCl
(20%:2.5M). Cleaned products were sequenced directly using the ABI Prism Dye
Terminator Cycle Sequencing Ready Reaction Kit with AmpiTaq DNA Polymerase (PE
Biosystems, Foster City, California, USA) under the following conditions: 25 cycles of
96° C for 30 s, 50° C for 15 s, 60° C for 4 min; indefinite soak at 4° C. Unincorporated dye terminators were removed by ethanol precipitation according to the manufacturer’s instructions. Sequences were run on an ABI Prism 3100 Genetic Analyzer (PE
Biosystems). All sequences were checked and corrected manually where needed. Single stranded sequences were compared and used to assemble a consensus sequence using
Sequencher 3.1.1 (GeneCodes Corp., Ann Arbor, MI, USA).
All sequences were aligned globally using Clustal X (Thompson et al. 1994; available free from the authors at http://newfish.mbl.edu/course/software/clustalX/) and manually adjusted using Se-Al v. 1.0a1, a sequence alignment editor (Rambaut; available free from the author at http://evolve.zoo.ox.ac.uk/software/se-al/main.html). Taxa with identical sequences were combined and run as a single accession. Additionally, samples of P. aquilonis, P. dilatata, and P. stricta which differed from other conspecific samples only at autapomorphic characters, and therefore did not provide any additional resolution of relationships, were pruned from the analyzed data set. The autapomorphic characters in the excluded taxa are all single nucleotide changes (Figs. 4.3-4.5). The exclusion of these nearly similar sequences resulted in 40 samples that were analyzed phylogenetically. Parsimony informative gaps were coded according to the methods described in Simmons and Ochoterena (2000). To evaluate the effect that hybrid
69 individuals (i.e., P. huronensis) have on tree topology, separate analyses were performed excluding and including all sequences of P. huronensis. Both analyses were performed in the same manner using parsimony in PAUP* 4.0b (Swofford 1999). All characters were included in the searches. For each data set (i.e., including or excluding P. huronensis) a heuristic search was implemented with a random addition sequence of 100 replications, and TBR branch swapping with two trees held at each step. Branches of maximum length of 0 were collapsed. Branch support was evaluated using a strict consensus bootstrap analysis in PAUP* with 100 bootstrap replicates. Additionally, decay analyses (Bremer 1988) were run on the strict consensus tree using TreeRot v.2
(Sorenson 1999). The analysis was performed using 100 replicate heuristic searches with
random addition of taxa and TBR branch swapping.
4.3 RESULTS
Amplification of the 18S-26S rDNA region produced a single band of ca. 800 base pairs in length in all individuals. Sequence data alone provided 714 scored characters, including several gaps necessary for alignment. Of these characters, 97 are parsimony informative. The coding of gaps revealed an additional 32 characters, 15 of which were coded as complex gaps. Only 22 gaps were found to be parsimony informative. Polymorphism was found in all species for which multiple accessions were examined. In P. stricta, 21 (3%) site differences were found (Fig. 4.3), 56 (8%) differences were identified in P. dilatata (Fig. 4.4), and 26 (4%) differences were found in P. aquilonis (Fig. 4.5). Substantially more intraspecific polymorphism was observed in P. huronensis, with some samples being similar to P. aquilonis and others (most)
70 similar to P. dilatata (Fig. 4.8). A total of 27 sites were clearly divergent between P. dilatata and P. aquilonis. At each of these sites, all but two of the P. huronensis samples contained the nucleotide found in P. dilatata (Fig. 4.6). The remaining two individuals contained the nucleotide characteristic of P. aquilonis. At some of these sites, two bases were detected in P. huronensis (Table 4.3). Evidence of multiple divergent copies of rDNA was found at other sites in P. huronensis as well, but in many cases, one of the nucleotides was not found in any of the accessions of P. dilatata or P. aquilonis (data not included). There was very little evidence of recombination between parental genomes in
P. huronensis, but there were some sites for which the nucleotide(s) found in a polyploid sample were not observed in any samples of the other species.
The analysis of nucleotide characters alone and excluding P. huronensis resulted in 20 most parsimonious trees (length = 242 steps; CI = 0.855; RI = 0.885), while the inclusion of gaps improved resolution within the tree and produced four most parsimonious trees (length = 315 steps; CI = 0.803; RI = 0.840). Hereafter, discussion of the results is based only on the trees produced with the inclusion of gap characters. The major groupings depicted in the strict consensus tree (Fig. 4.7) were consistent in all four most parsimonious trees. The only differences among the trees occurred in the placement of AL-1 within the white- flowered clade and in resolution of the relationships among
AQ-3, AQ-4, and AQ-6.
In this analysis, Platanthera chlorantha (Custer) Reichenb., a European species, comes out as sister to section Limnorchis followed by Platanthera orbiculata (Pursh)
Lindl., and lastly, the pair of Platanthera praeclara Sheviak and Bowles and Platanthera leucophaea (Nuttall) Lindl (Fig 4.7). Section Limnorchis is strongly supported (bootstrap
71 = 100; decay index = 21) as a monophyletic group with respect to other species of
Platanthera (Fig. 4.7). All of the white-flowered taxa of P. dilatata are grouped together with strong support for this clade (bootstrap = 100; decay index = 7), but there is little match between the groupings based on sequence data and morphological traits. Although the two accessions of var. leucostachys (LU-1 and LU-5) form a distinct group within the
P. dilatata clade, each of these samples is more similar to a sample of var. dilatata from the eastern United States. Notably, the relationships and indeed, most of the intraspecific relationships among samples of P. dilatata depicted in the strict consensus tree are not supported by bootstrap or decay analyses. This finding is largely the result of a lack of informative polymorphic sites within this species.
Individuals of P. aquilonis, P. limosa, and P. sparsiflora, all green-flowered taxa, form a clade that is sister to the clade containing P. dilatata and the other green-flowered species, P. stricta. Although P. stricta appears to be more closely related to P. dilatata
than to the other green-flowered species, this relationship is not supported by bootstrap or
decay indices. Within the green-flowered clade, the two accessions of P. sparsiflora are
quite different. The sample from Utah, SP-2, is much more similar to P. aquilonis and P.
limosa than to SP-1 from Oregon. Furthermore, the relationship between P. sparsiflora,
as represented by SP-1, and the rest of this group is only weakly supported in bootstrap
and decay analyses.
The analysis in which P. huronensis samples were included resulted in 453 most
parsimonious trees (length = 460 steps; CI = 0.698; RI = 0.758). The general topological
relationships among diploids and support for these relationships did not change after
addition of the polyploid species with the exception that some resolution within the P.
72 dilatata clade is lost (Fig. 4.8). This is due to the strong similarity between most of the
samples of P. huronensis and P. dilatata (Table 4.3, Figs. 4.5, 4.8). Two accessions of the polyploid, HU-7 and HU-9, cluster with individuals of P. aquilonis. Within the P. dilatata-P. huronensis clade, there is some structure among the samples of the polyploid.
That is, samples of the polyploid are distributed across three groups: group one includes only polyploid individuals while the other two groups include samples of P. huronensis and P. dilatata. None of these primary groups is supported, but specific relationships between HU-3 and HU-4 as well as HU-12 and HU-15 are supported. In some cases, intraspecific samples group according to geographical proximity, but this is not a consistent finding.
4.4 DISCUSSION
4.4.1 Phylogenetic relationships among diploid species
The results of this study clearly indicate that section Limnorchis is a monophyletic
group with regard to the other species of Platanthera that were examined. This finding
corroborates previous hypotheses of the distinctiveness of this group suggested by
morphological similarity and molecular phylogenetic analyses of the genus (Hapeman and Inoue 1997). The biogeographic history of Platanthera is not well understood, but
Bateman et al. (1997) suggested the genus radiated rapidly in western North
America/eastern Asia based on the vast diversity of species in these areas. This
hypothesis can also be extended to account for diversity and taxonomic complexity of
section Limnorchis in western North America. Section Limnorchis is quite distinct from
other Platanthera species sampled as indicated by a long branch connecting the section to
73 these other species (Fig. 4.7). No species from the sister group to section Limnorchis as
suggested by Hapeman and Inoue (1997) were sampled, and therefore it is not clear how
rapidly Limnorchis might have diverged within Platanthera.
Within section Limnorchis, there appears to have been an early split between green-flowered and white-flowered taxa. The apparent similarity of P. stricta to P.
dilatata may indicate the presence of multiple green-flowered lineages, but this
relationship could also be artifact since there is no bootstrap or Bremer support for the
relationship between P. stricta and P. dilatata. Thus, nuclear rDNA may simply lack
sufficient order polymorphism to resolve the exact placement of P. stricta in the section.
Although sampling of green-flowered variants is not extensive, the evolutionary
relationships depicted by the phylogeny are quite interesting and somewhat unexpected.
The flowers of P. limosa and P. sparsiflora have very long spurs, a condition thought to
lead to fewer, highly specific pollinators (Catling and Catling1991). Greater floral
specialization in angiosperms and orchids, in particular, is expected to be an evolutionary
improvement over reliance on a generalist suite of pollinators (Van der Pijl and Dodson
1966; Wyatt 1983). Indeed, previous analyses have suggested that longer spurs are more
derived conditions in Platanthera as well (Hapeman and Inoue 1997). Thus, it is surprising that both of the longer-spurred species appear to have diverged earlier in the
evolution of the section than did P. aquilonis. The autogamous nature of P. aquilonis,
though, may in part account for this apparent anomaly because self-fertilization is also
considered a derived means of reproduction in angiosperms (Wyatt 1983; Holsinger
2000). The evolution of pollination syndromes resulting in greater specificity of
pollinators might have occurred in isolated populations whereby natural selection by
74 pollinators shaped the flowers and/or genetic drift randomly caused changes in floral form. Because orchid populations are commonly small and isolated, it is expected that genetic drift was a primary driving force. The specificity of the relationship between flower and pollinator might have come about afterwards. Alternatively, if ancestral taxa regularly occurred together in populations, increased specificity between plant and pollinator (i.e., divergence) as well as autogamous pollination might have evolved in response to the presence of closely related congeneric individuals. Whatever the mechanism, the evolution of morphological variability provides a means of partitioning pollinators. It is hypothesized that the ancestor of the extant forms was a relatively unspecialized green-flowered Platanthera orchid which was pollinated by a generalist suite of pollinators. Perhaps, it was something morphologically similar to P. stricta, which has a very short spur (< 2mm) and is pollinated by a variety of short-tongued insects (Patt et al. 1989). Hapeman and Inoue (1997) suggested that the ancestors of section Limnorchis likely had green flowers, which lends support to the hypothesis that the more specialized extant green-flowered forms were derived from a green generalist species. Additional molecular data should provide a better understanding of the relationship between P. stricta and the other green-flowered taxa in the section.
Neighbor-joining analyses based on ISSR and RAPD data indicate a closer relationship of P. stricta to P. aquilonis and P. sparsiflora than to P. dilatata (L. Wallace, unpubl. data).
If green is the basal flower color in the section, then white flower color characteristic of P. dilatata must be a more recently derived condition. Intraspecific variants with white flowers have been considered to be very closely related yet
75 morphologically distinguishable (Luer 1975). The extensive morphological diversity that
is apparent in P. dilatata, however, is not matched by diversity at the molecular level, at
least in nuclear rDNA copies. A similar lack of molecular diversity has also been
reported in other orchid groups which exhibit a lot of morphological diversity (e.g.,
Soliva et al. 2001). This finding in P. dilatata is consistent with the suggestion that the three morphologically recognizable varieties represent plastic phenotypes of a single variable species, especially since the morphological variation exhibited by P. dilatata is
clearly continuous across the three varieties (L. Wallace, unpubl. data). Alternatively, the
three floral varieties may be distinct lineages that have radiated rapidly from a common
ancestor relatively recently, in which case the time since divergence may not have been
long enough for extensive molecular differences to accumulate at loci. Additionally,
occasional gene flow across varietal boundaries could maintain a continuum of
morphological variability.
Because the nominate variety, dilatata, is widely distributed and overlaps extensively with each of the other varieties, it is expected to be the progenitor of the more
restricted forms, albiflora and leucostachys. Spur morphology likely reflects the types of
insects capable of pollinating these taxa, and therefore may be a primary means of
reproductive isolation among the varieties of P. dilatata as suggested for Aquilegia
(Hodges and Arnold 1995). If the varieties do occur in sympatry and are reproductively
isolated in these areas, then they would be considered separate lineages rather than
merely phenotypes of a highly variable species. This is an interesting system, which
warrants further taxonomic study with molecular markers that exhibit intraspecific
polymorphism.
76 4.4.2 Where does Platanthera huronensis fit in?
The taxonomic status of P. huronensis has been debatable for a number of
reasons, including the loss of Thomas Nuttall’s type specimen and the inability of many
authors to distinguish P. huronensis from P. aquilonis or P. dilatata in some populations
(e.g., Case 1987). Only recently P. huronensis regained recognition at the specific level
as a result of definitive proof of its ploidal level and distinct morphology (Catling and
Catling 1997; Sheviak and Bracht 1998; Sheviak 1999; L. Wallace, unpubl. data). The
morphological features exhibited by P. huronensis appear to be intermediate to or a
mosaic of those found in P. aquilonis and P. dilatata. Thus, P. huronensis is
hypothesized to be an allopolyploid derivative of P. aquilonis and P. dilatata (Catling
and Catling 1997). The results of this study also suggest a close relationship between P.
huronensis, P. dilatata, and P. aquilonis. This finding corroborates other studies, based
on ISSR, RAPD, and chloroplast RFLP markers, in which the genetic composition of P.
huronensis has been found to be most similar to P. aquilonis and P. dilatata (L. Wallace,
unpubl. data). Additionally, some samples of P. huronensis do show additivity of
parental types at sites where P. aquilonis and P. dilatata are clearly divergent (Table 4.3).
Thus, the data from this and other studies collectively support a hybrid origin of P.
huronensis. The patterns of genetic variability observed in P. huronensis are quite
complex, rivaling morphological complexity within the section, and suggesting that P.
huronensis is not a recently derived taxon.
Despite the similarity of P. huronensis samples in gross morphological features, they are not all alike at the molecular level. Intraspecific variation was observed in this species in the form of novel rDNA types and differential similarity of polyploids to one
77 parent or the other. The existence of novel types may reflect limited sampling of parental taxa or genomic changes within P. huronensis that have occurred after polyploidization.
Chase et al. (2002) also found novel types in Dactylorhiza polyploids and suggested that these may have originated from a parental species that was not sampled. Multiple data sources corroborate the notion that P. huronensis is most closely related to P. aquilonis and P. dilatata. Intraspecific polymorphism was not as great in either of the parental species as it was in P. huronensis, even in samples from very different regions in North
America. The samples of P. huronensis examined in this study could have originated from parental lineages that were not sampled or are extinct. Even though all areas where the parental species occur in North America are not represented, it is expected that sampling of parental types was sufficiently widespread that unique variants would have been apparent in the individuals that were included, given the continuous distributions of
P. aquilonis, P. dilatata, and P. huronensis across the northern United States and Canada.
There is no a priori reason to suspect that there are regions where populations of P. aquilonis or P. dilatata occur, are isolated from other conspecific populations, and therefore would have divergent rDNA types. Further sampling is needed, though, to confirm this point.
The novel types observed in P. huronensis may also have resulted from genomic reorganization of parental types shortly after polyploid formation. The clarity of sequence data for most samples of P. huronensis suggests that evolution has been in the direction of one parent or the other and may have been swift since the initial formation of polyploid lineages. Interestingly, individuals of P. huronensis from populations in western North America have a similar chloroplast haplotype, as determined by RFLP
78 analysis, which is identical to a pattern found in a single individual of P. dilatata in a sympatric population and very similar to other haplotypes identified in P. dilatata.
Although the mechanisms of evolutionary change (e.g., genome loss, concerted evolution) are not clear, it is apparent that extant lineages of P. huronensis have diverged from closely related species at nuclear and plastid loci.
Intra-individual polymorphism of rDNA copies was not commonly seen in the samples of P. huronensis, which suggests either that copies from the parental genomes became homogenized through concerted evolution or some copies have been lost since the initial formation of polyploid lineages represented by extant populations. Interlocus concerted evolution among nuclear rDNA copies has been reported in polyploids of the
Festuca-Lolium complex (Gaut et al. 2000), Gossypium (Wendel et al. 1995), Microseris
(Roelofs et al. 1997), Nicotiana (Volkov et al. 1999), Paeonia (Sang et al. 1995), and
Saxifraga (Brochmann et al. 1996), whereas multiple divergent copies of nuclear rDNA are retained in polyploids of Brassica (Waters and Schaal 1995), Coprosma (Wichman et al. 2002), Hedera (Vargas et al. 1999), Silene (Popp and Oxelman 2001), and Triticum
(Zhang et al. 2002). Homogenization of multiple copies of a gene depends on temporal and genetic factors. For example, the tempo of concerted evolution in Paeonia polyploids is more strongly affected by the location of rDNA loci on chromosomes rather than the number of copies of the gene (Zhang and Sang 1999). Additionally, if loci are at or near telomeres, they are more likely to become homogenized, a result found in both
Gossypium (Hanson et al. 1996) and Paeonia (Zhang and Sang 1999). By contrast,
Brassica polyploids maintain parental polymorphisms in rDNA and several repeats of this gene family map to non-telomeric locations on chromosomes (Maluszynska and
79 Heslop-Harrison 1993). These are interesting findings, but without knowledge of the number of rDNA copies in P. huronensis, the role of concerted evolution in homogenizing inter-genomic rDNA copies cannot be distinguished from the possibility
that some copies have just been lost.
The apparent bidirectional evolution in P. huronensis suggested by these data is
one of the most surprising results of this study. Fourteen samples of P. huronensis have
sequences that are most consistent with sequences observed in P. dilatata at sites where
the putative parental species are divergent (Figs. 4.6, 4.8). The other two polyploid individuals have sequences that match those found in P. aquilonis (HU-7 and HU-9).
Both of these individuals (HU-7 and HU-9) have a chloroplast haplotype most similar to
P. dilatata, though, suggesting that P. dilatata was the maternal parent of the lineages (L.
Wallace, unpubl. data). Most of the western samples of P. huronensis within the P. dilatata clade have a chloroplast haplotype that is identical to the haplotype found in HU-
7 and HU-9. This is an indication of concordance between the evolutionary direction of nuclear and plastid genomes in these individuals. By contrast, all samples of P. huronensis from the eastern United States and Canada exhibit a chloroplast haplotype identical to one found in P. aquilonis from the same region. Note, though, that all of these individuals are more similar to P. dilatata in the nuclear rDNA phylogeny (Fig.
4.8). Thus, P. huronensis lineages have apparently evolved in the direction of the maternal progenitor in some instances and in the direction of the paternal progenitor in other cases. Interestingly, no examples were found in which P. aquilonis appears to have been the maternal progenitor and rDNA has evolved in the direction of P. aquilonis. The
divergent patterns between nuclear and chloroplast genomes may seem anomalous, but
80 similar patterns have been documented in other polyploid species as well. For example,
Wendel et al. (1995) found that in four of the six Gossypium polyploid species they
studied, rDNA copies became homogenized to the paternal sequence; only two of the
polyploid species are more similar to the maternal progenitor in sequence composition,
despite the finding that all polyploid lineages were derived from crosses between a
maternal A genome and a paternal D genome.
Numerous hypotheses may explain the appearance of bidirectional evolution in P.
huronensis. The reason nuclear rDNA should evolve in the direction of P. dilatata more
frequently than toward P. aquilonis is not readily apparent, given the data at hand.
However, the asymmetry of this evolutionary pattern suggests that it may be a directed process since geographically disparate lineages of P. huronensis show similar patterns of
rDNA evolution when they are otherwise distinct at RAPD and ISSR loci (L. Wallace,
unpubl. data). Perhaps, nuclear rDNA types of P. dilatata are at a selective advantage in
cytoplasmic environment of most P. huronensis lineages. Alternatively, individuals in
which the chloroplast haplotype and rDNA type do not match may exhibit the remnants
of historical introgression between diploid and polyploid species. Numerous authors
have suggested frequent hybridization between species whenever they come into contact
(e.g., Schrenk, 1978), and it would be worthwhile to determine the true nature of
interspecific hybridization in areas of contact. These data revealed several interesting
genetic patterns in P. huronensis. Examination of additional samples with additional
markers may parallel these findings or elucidate additional evolutionary patterns in this
group. Critical areas that need to be sampled include the mid-western United States and
81 Canada, which bridges eastern and western populations, as well as the southwestern
United States, where many other species in section Limnorchis occur.
In summary, the mechanisms of evolutionary diversification in section
Limnorchis are numerous. Subtle differences in pollination syndromes associated with spur length, floral fragrances, and viscidia may be the primary means by which new species originate in section Limnorchis. Hybridization and polyploidization have been important in the origin of P. huronensis, but given our current understanding of the group, this does not appear to be a common mechanism of speciation since few other polyploid taxa have been documented and most hybrids are found only in areas of contact between parental species. This does not, however, eliminate the possibility that hybridization could be an indirect mechanism of diversification. For it could act to mix up genetic combinations. If these recombinant individuals dispersed to new areas, they could continue to diverge in isolation to the point of being morphologically distinct from their progenitors. Studies on other species, especially the rarer forms, of section
Limnorchis may indeed implicate hybridization in the origin of species and may also reveal other explanations for the morphological complexity in this group.
82 Ames classification Rydberg classification This study Distinguishing features Geographic range
Habenaria dilatata Limnorchis dilatata, L. Platanthera dilatata White flowers, dilated Greenland, subarctic fragrans, L. borealis, L. var. dilatata & P. lip, filiform spur nearly America, graminifolia, L. dilatata dilatata var. equal to the lip in length Newfoundland, linearifolia, L. leptoceratitis, albiflora northern US and L. gracilis, L. Canada, AK convallariaefolia Habenaria dilatata Limnorchis media Platanthera Greenish-white flowers, Within the range of H. var. media huronensis dilated lip, spur equal in dilatata length to lip Habenaria dilatata Limnorchis leucostachys, L. Platanthera dilatata White flowers, dilated WA, OR, ID, CA, var. leucostachys leucostachys var. robusta, L. var. leucostachys lips, spur longer than lip NV, UT, AZ, British thurberi, L. leptoceratitis Columbia Habenaria hyperborea Limnorchis hyperborea, L. Platanthera “Excessively variable” Greenland, subarctic media, L. huronensis, L. aquilonis Green flowers, lip not America,
83 brachypetala, L. viridiflora, dilated, spur equal to or Newfoundland, L. major slightly shorter than lip northern US and Canada, AK Cont.
Table 4.1. Comparison of two major taxonomic classifications of Platanthera section Limnorchis by Ames (1910) and Rydberg (1901) and the nomenclature used in this study. Note that Ames referred to all species currently considered to be Platanthera under the genus Habenaria while Rydberg considered the species of Limnorchis to constitute an entirely distinct genus from Habenaria or Platanthera. Two recent additions to Limnorchis are Platanthera aquilonis (Sheviak 1999) and Platanthera zothecina (Welsh et al. 1987). Platanthera aquilonis is used in reference to the species previously considered to be Habenaria hyperborea. The specific epithet hyperborea is now used only in reference to tetraploid plants similar to H. dilatata var. media from Iceland. Plants referable to P. zothecina were previously included under the specific epithet sparsiflora, but these entities differ in several features of the leaf, lip, and spur. Platanthera huronensis is most similar to Ames’ Habenaria dilatata var. media.
Table 4.1 (continued)
Ames classification Rydberg classification This study Distinguishing features Geographic range
Habenaria Limnorchis purpurascens Green flowers with CO, NM hyperborea var. reddish lips, dilated lip, purpurascens short, saccate spur Habenaria Limnorchis behringiana Large, greenish flowers, Asia, Attu Island behringiana filiform spur two times longer than lip Habenaria saccata Limnorchis stricta, L. Platanthera stricta Green flowers, lax Pacific Northwest, brachypetala, L. gracilis, L. inflorescence, short, Rocky Mountains laxiflora saccate spur Habenaria Limnorchis sparsiflora, L. Platanthera Large green flowers, CO, UT, NV, NM, AZ, 84 sparsiflora ensifolia sparsiflora beak of stigma broadly OR, CA triangular, slender spur, lax inflorescence Habenaria Limnorchis brevifolia Large, green flowers, NM, Mexico brevifolia spur much longer than lip, stout stems flower near ground, nearly leafless Habenaria limosa Limnorchis arizonica Platanthera limosa Large, green flowers, NM, AZ, Mexico spur much longer than lip, leaves elongated Habenaria Resembles H. Mexico richardii sparsiflora Cont.
Table 4.1 (continued)
Ames classification Rydberg classification This study Distinguishing features Geographic range
Habenaria Resembles H. brevifolia Mexico ghiesbreghtiana but with longer leaves Habenaria Green flowers, linear lip Mexico nubigena Habenaria Similar to H. limosa but Mexico volcanica lip is lanceolate, elongated filiform spur
85
Sample Geographic origin Sample Geographic origin
P. aquilonis P. huronensis
AQ-1 Maine HU-1* (Frohne 49293) Alaska
AQ-2 Michigan HU-2* Alaska
AQ-3* Montana HU-3* (Churchill) Canada
AQ-4* New York HU-4* (Hartman 2128) Colorado
AQ-5 New York HU-5* (Hill 29551) Michigan
AQ-6* Ontario HU-6* Michigan
AQ-7 Ontario HU-7* Montana
AQ-8 Vermont HU-8* Montana
AQ-9 (Hartman 52341) Wyoming HU-9* Montana
HU-10* New York
P. dilatata var. albiflora HU-11* Wyoming
AL-1* Montana HU-12* Wyoming
AL-2 Montana HU-13* Wyoming
AL-3* Wyoming HU-14* Wyoming
AL-4 Wyoming HU-15* Wyoming
AL-5* Wyoming HU-16* Wyoming
AL-6 Wyoming
Cont.
Table 4.2. Names and locations of taxa sampled for this study. Individuals included in the phylogenetic analyses are indicated by an asterisk following the sample name. Voucher numbers for specimens from herbaria are indicated after sample names. AQ-9, HU-1, HU-4, SP-2 from RM; HU-3 from WIN; HU-5, LM-1 from MICH.
86
Table 4.2 (continued)
Sample Geographic origin Sample Geographic origin
P. dilatata var. dilatata P. limosa
DI-1 Alaska LM-1* (Daniel 1597) Arizona
DI-2 Maine
DI-3* Montana P. sparsiflora
DI-4 Montana SP-1* Oregon
DI-5* New York SP-2* (Franklin 7284) Utah
DI-6 New York
DI-7* Ontario P. stricta
DI-8 Ontario ST-1 Montana
DI-9* Vermont ST-2* Montana
DI-10* Wyoming ST-3* Montana
DI-11* Wyoming ST-4 Montana
DI-12* Wyoming
P. chlorantha* Z94117 & Z94118
P. dilatata var. leucostachys P. leucophaea* Ohio
LU-1* Montana P. orbiculata* Montana
LU-2 Montana P. praeclara* AF301445
LU-3 Oregon
LU-4 Oregon
LU-5* Oregon
87
Accession Site States in State in State in
P. huronensis P. dilatata P. aquilonis
HU-7 153 C/T C T
HU-8 96 C/T T C
HU-8 198 A/G A or G A
HU-8 208 C/T C or T C
HU-8 213 C/T C or T T
HU-11 96 C/T T C
HU-11 208 C/T C or T C
HU-11 213 C/T C or T T
HU-11 592 A/G A G
HU-12 96 C/T T C
HU-12 175 C/G C G
HU-12 208 C/T C or T C
HU-13 50 A/C A or C or G A
HU-15 208 C/T C or T C
HU-15 592 A/G A G
HU-16 213 C/T C or T T
Table 4.3. Additive sites found in Platanthera huronensis.
88 Platanthera dilatata
Platanthera Platanthera xestesii xlassenii
Platanthera Platanthera xmedia Platanthera stricta sparsiflora (Platanthera ? huronensis)
Platanthera ? xcorrellii
Platanthera aquilonis
Figure 4.1. The hybrid theory proposed by Schrenk (1978) to account for morphological variants in Platanthera section Limnorchis. Species names reflect the current taxonomy of the group.
89
(A)
(B)
Figure 4.2. Platanthera dilatata: (A) habit and (B) close-up of a flower. Illustrations by Mark Wallace.
90 Position 25556666666677777 157770446799900011 237172346264006804801 ST-1 CGCAG-GGTACAAGGGGG-GC ST-2 NNC-A---CACAAA-CGACCT ST-3 CGCAGAG-CACAAGGGGGCGC ST-4 C---GAGGTM---GGG-GCGC
Figure 4.3. Nucleotide differences in ITS1, 5.8S rDNA, and ITS2 of the nuclear genome in four accessions of Platanthera stricta. Sample names follow those in Table 4.2. – indicates a gap character
91 Position 12224566666666666666666666666777777777 1112223334445690119313445555666777788899999000001111 34671275893492480288359945263678134025967801236034890134 DI-1 GAACAAAATGACGTTCAGGCTACTACACATTCCGAATAGC-AGA-TGGTGC-GCGA DI-2 GAAC-AAATGACGTTCAGGCCACTACACAT-CCGAATAG--AGA-T--TG--GCGA DI-3 GACCAAAATGACGTTC-GACCACCACACATTCAG-ATAGC-AGA-TGGTGC-GCGA DI-4 GAACAAAATGACGTTCAGACCACTACACATTCCGAATAGC-AGA-TGGTGC-GCGA DI-5 GAACAAAATGACGTTCAGGTCACT???????????????????????????????? DI-6 GAACAAAATGACGTTCAAGCCASTACACATTCCGAATAGC-AGA-TGGTGC-GCGA DI-7 GAACAAAATGACGTTCAGGYCACT-C-CAT--C-A------AA--T--T---G-GA DI-8 GAACAAAATGACGTTTAGGCCACTAC--ATT-CGA-TAG--AGA-T--TGCC--GA DI-9 GAACAAAATGACGTTCAGGCCACTACACATTCCG--TAGC-AGA-TGGTGC-GCGA DI-10 GAACAAAATGACGTTC-GACCACCAC-C-TTCCG--TAG--AGA-T--TG--GCGA DI-11 GAACAAAATGACGTTCAGGCCACCAC-CATTCCG--T-G--AA--T--TG--GCGA DI-12 GACCAAAATGACGTTCCGGCCACCACACATTCCG--TAG--AGA-T-GTG--GCGA
92 AL-1 GAACAAAATGACGTTCAGACCACTACACATTCCGAATAGC-AGA-TGGTGC-GCGA AL-2 GAACAAAATGACGTTCAGRCCACTACACATTCCGAATAG--AGA-TGGTGC-GCGA AL-3 GACCAA-TTGCCGTTCAGACCACCACACATTCNG-ATAGC-AGA-TGGTGC-GCGA AL-4 GAA-AAAATGACGTTCAGACCWCC--A-ATTCCGAATAG--AGA-W--TGC---GA AL-5 GACCAAAATGCCGTTC-GACCACCACACATTCC-AA-AG--AGA-TG-GT--GCGA AL-6 -AA--AAA------CAGACCACCACACA-TCCGAATAGC-AGA-TGGTGC-GCGA LU-1 GAACAAAATGACGTTCAGGTYACTACACATTCCGAATAGC-AGA-TGGTGC-GCGA LU-2 GAACATAATGACGTTCAGACCACTACACATTCCGAATAGC-AGA-T-GTGC-GCAT LU-3 G--C-AAATGACGTTCAGGCCACTACACATTCCGAATAGC-AGA-TCNTGC-GCGA LU-4 GAACAAA-TGACGTTCAGGCYACTACACATTCCGARTAGCGAGA-TG????????? LU-5 GAA-AAAATGACGTTCGGGCCACTACACATTCCGA-TAGC-AGGATGGTGC-GCGA
Figure 4.4. Nucleotide differences in ITS1, 5.8S rDNA, and ITS2 of the nuclear genome in accessions of Platanthera dilatata vars. dilatata (DI), albiflora (AL), and leucostachys (LU). Sample names follow those in Table 4.2. – indicates a gap character; ? is an unknown character
Position 46666666666677777 15667773455778999900111 26900470876278026015608013 AQ-1 ????A--GGG--T----GAG--C-CG AQ-2 C-C-ACGGGGGATCAT-GAGGGCG-G AQ-3 CACAACGGGGGATCATCGAGGGCGCG AQ-4 CAC-ACGGGGGATCATCGAGGGCGCG AQ-5 -ACAACGGGNGATCATCGAG--CGCG AQ-6 CACAACGGGGG--C-T-A-----GC- AQ-7 CACA-CGGAGGATCAT-GAGGGCGCG AQ-8 CACAACGGGGGATCATCGAGGGCGCG AQ-9 CACAACGGGGGATCATCGAGGGCGCG
Figure 4.5. Nucleotide differences in ITS1, 5.8S rDNA, and ITS2 of the nuclear genome in accessions of Platanthera aquilonis. Sample names follow those in Table 4.2. – indicates a gap character; ? indicates an unknown character
93
Position 111112222222234556 145566789225790111124796092 027918086343585123577416127 HU-1 TTTCATATTACCCGAAATATCGGTGA- HU-2 TTTCATATTACCCGAAACATCGGTGAT HU-3 TTTC-TATTACCCGAAACATCGGTGA- HU-4 TTTCGTATTACCCGAAACATCGGTGA- HU-5 TTTCATATTACCCGAAACAGCGGTGA- HU-6 -WTCATATTACCCGAAACATCGGTGA- HU-7 -CGAGCGCCGTYGAGTTT-C-ATCGGG HU-8 TTTCATATYACCCRAAAYATCGGTGA- HU-9 ACGAGCGTCGTCGAGTTT-C-ATCGGG HU-10 TTTCATATTACCCGAAACATCGGTGA- HU-11 TTTCATATYACCCGAAAYATCGGTGR- HU-12 TT-CATATYACCSGAAACWTCGGTGA- HU-13 TTTCATATTACCCGAAACATCGGTGA- HU-14 TTTCATATTACCCGAAATATCGGTGA- HU-15 TTTCATATTMCCCGAAATRTCGSTGR- HU-16 TTTCATATTACCCGAAAYATCGGTGA- All dilatata TTTCATATTACCCRAAAYATCGGTGA- All aquilonis ACGAGCGCCGTTGAGTTT-C-ATCTGG
Figure 4.6. Nucleotide differences in Platanthera aquilonis, P. dilatata, and P. huronensis. When standard IUPAC ambiguity codes are used they indicate the presence of two nucleotides in a sample of P. huronensis or at the species level in the case of P. aquilonis and P. dilatata. Sample names for P. huronensis samples follow those in Table 4.2. – indicates a gap character
94
P. praeclara 7 P. leucophaea 0 P. orbiculata 58 P. chlorantha 30
ST-2 100/10 10 Green 100/21 13 ST-3 flowered 37 0
AL-1 0 LU-5 3 4 78/ 3 1 DI-9 14 1 100/7 1 LU-1 10 65/1 1 1 DI-5 0 AL-3 2 White DI-3 3 1 flowered 100/21 AL-5 30 1 6 51/ 1 DI-10 3 2 DI-12 3 3 2 DI-7 10 3 64/1 0 DI-11
23 SP-1 54/1 LM-1 5 3 100/7 SP-2 10 3 92/2 Green AQ-4 2 1 flowered 89/3 AQ-3 4 0
AQ-6 9
Figure 4.7. Strict consensus tree of four most parsimonious trees (length = 315 steps; CI = 0.803; RI = 0.840) from the data set of diploid species. Bootstrap values (> 50%) and decay indices are indicated above branches with bootstrap values listed first. Branch lengths are indicated below branches. Taxon names follow those in Table 4.2.
95
P. praeclara 7 P. leucophaea 0 59 P. orbiculata P. chlorantha 31 100/10 10 ST-2 13 ST-3 0 AL-1 1 100/23 HU-10 1 37 HU-4 88/5 3 4 2 2 HU-3 HU-5 3 4 2 7 HU-13 79/3 3 HU-6 13 HU-1 4 DI-7 13 7 HU-11 100/ 7 HU-14 10 11 HU-8 4 21 9 HU-16 LU-1 3 DI-5 1 HU-12 100/21 51/1 19 18 HU-15 29 11 HU-2 8 1 4 LU-5 1 DI-9 2 AL-3 DI-3 4 1 AL-5 1 6 DI-10 3 2 3 3 DI-12 2 DI-11 3 23 SP-1 51/1 LM-1 5 3 98/7 SP-2 10 3 77/2 HU-9 2 20 85/3 AQ-4 2 1 80/1 AQ-3 0 2 HU-7 85/3 7 5 AQ-6 5
Figure 4.8. Strict consensus tree of 453 most parsimonious trees (length = 460 steps; CI = 0.698; RI = 0.758) found when all samples of P. huronensis are included in the analysis. Bootstrap values (> 50%) and decay indices are indicated above branches with bootstrap values listed first. Branch lengths are indicated below branches. Taxon names follow those in Table 4.2.
96
CHAPTER 5
THE ORIGIN AND PLACEMENT OF PLATANTHERA HURONESIS WITHIN
SECTION LIMNORCHIS (ORCHIDACEAE): EVIDENCE OF AMPHIPLOIDY AND
MULTIPLE ORIGINS
5.1. INTRODUCTION
Polyploidy, once thought to be an evolutionary dead-end (Stebbins 1950) or
evolutionary noise (Wagner 1970), is now recognized to play a creative role in the evolution of many groups of organisms (reviewed in Soltis and Soltis 1993; 2000;
Ramsey and Schemske 1998; Otto and Whitton 2000). Polyploidy is particularly common among plants; as many as 50% of angiosperm species and 95% of pteridophyte lineages are believed to have a polyploid history if plants with a base chromosome number of 13 are considered polyploids (Grant 1981). Otto and Whitton (2000) estimate the rate at which new species arise via polyploidy to be 2-4% in angiosperms and 7% in ferns, suggesting that it may be the “single most common mechanism of sympatric speciation in plants”.
Polyploidy, in a very general sense, is the incorporation of three or more nuclear genomes in an individual. Stebbins (1950) distinguished three types of polyploids:
autopolyploids arise from chromosome doubling within one species; allopolyploids arise
through interspecific hybridization and chromosome doubling; segmental allopolyploids
97
arise from parents with partially divergent genomes such that some chromosome regions
are homologous (containing nearly identical copies) between parental genomes while
other regions are homeologous (containing divergent copies). Generally, allopolyploids
and autopolyploids can be distinguished by chromosome pairing behavior at meiosis.
Allopolyploids exhibit bivalents at meiosis and disomic inheritance whereas
autopolyploids exhibit multivalent formation and polysomic inheritance.
Additivity or exaggeration of parental traits is expected in polyploids, and is also
often used in the initial identification of polyploidy in a species. For example, increased
DNA content of polyploids can translate into increases in cell size (Stebbins 1971),
stomatal cell size (reviewed in Levin 1983; Masterson 1994), and pollen size (Otto and
Whitton 2000) relative to diploid counterparts. Frequently, polyploids also exhibit novel
features, presumably resulting from inter-genomic interactions, changes in genome
structure, and subsequent effects of natural selection and genetic drift on the phenotype
(Levin 1983; Soltis and Soltis 1993; Leitch and Bennett 1997; Wendel 2000). Some of
the phenotypic novelties that have been observed in polyploids include slower
development (von Well and Fossey 1998), larger seeds (Villar et al. 1998), evolution of a perennial habit (reviewed in Levin 1983), increased production of secondary compounds
(reviewed in Levin 1983), alteration of floral traits that cause shifts in interactions with pollinators and parasites (Taylor and Smith 1979; Thompson et al. 1997), delayed flowering (reviewed in Levin 1983), and shifts in mating system, including the evolution of asexual reproduction, self-fertilization, and breakdown of genetic self-incompatibility systems (reviewed in Levin 1983; Stebbins 1950; Wedderburn and Richards 1992).
98
Additionally, increased molecular variability is also characteristic of some polyploids
(reviewed in Soltis and Soltis 1993).
The formation of a stable polyploid lineage is a complex process involving
multiple steps. Tracing the evolutionary origin of a polyploid species can be a difficult task even in recently evolved polyploid species due to the propensity for multiple origins of polyploid lineages (Soltis and Soltis 1993) and rapid genome evolution during the early stages of polyploid formation and stabilization (Wendel 2000). Multiple independent sources of data, including morphology, cytology, and surveys of molecular markers from multiple genomes (i.e., nuclear, chloroplast, and mitochondrial), offer the best hope for elucidating historical patterns of polyploid formation and colonization. In this study, the evolution and taxonomic status of Platanthera huronensis (Nuttall) Lindl.
(Orchidaceae), a purported allopolyploid, is investigated using molecular markers.
Platanthera huronensis is a member of section Limnorchis, one of five subgroups in the genus Platanthera. This section is one of the most taxonomically perplexing groups within the genus Platanthera. Much of the taxonomic ambiguity arises from intraspecific morphological variability, but interspecific hybridization adds an additional level of complexity in areas where species occur sympatrically (Luer 1975; Schrenk
1978; Sheviak 1999). The section is characterized by perennial species with inconspicuous green or white flowers that occasionally display hints of yellow or red on the lip. Individually, the flowers are small (1-2 cm wide), but inflorescences of 50 or more flowers can be quite striking. Most of the species are believed to produce nectar in a spur, but not all of them are fragrant. Both outcrossing and autogamous species are found in the section (Kipping 1971; Patt et al. 1989; Boland 1993; Reddoch and Reddoch
99
1997; Sheviak 1999). Many of the outcrossing species are not specialized for a single
pollinator, and instead attract various moths, butterflies, bees, and flies (Kipping 1971;
Catling and Catling 1989; Patt et al. 1989; Boland 1993). It is expected that generalist
pollinator syndromes and overlapping phenologies increase the likelihood of interspecific hybridization. Collectively, section Limnorchis is represented broadly throughout much of North America, reaching the Arctic Circle to the north, Mexico to the south, the eastern coast of North America, and as far west as the Aleutian Islands. Most of the species are restricted to western North America, but several species also occur in northeastern North America. The species occupy mesic sites, including disturbed places such as roadside ditches and more stable places such as fens, bogs, and woodlands.
Platanthera huronensis is tetraploid (4n = 84; Sheviak and Bracht 1998) whereas most other species in the section are diploid (2n = 42; Tanaka and Kamemoto 1984).
Several authors have suggested that P. huronensis might be derived through hybridization of a diploid white-flowered species, Platanthera dilatata (Pursh) Lindley ex Beck, and a
diploid green-flowered species, Platanthera aquilonis Sheviak [previously called
Platanthera hyperborea (Linnaeus) Lindl.] (Catling and Catling 1997; Sheviak 1999).
The floral features of these diploid species appear to be combined in P. huronensis.
Furthermore, P. huronensis is frequently found in intermediate habitats or at the edges of populations of the purported parental species. Historically, flower color and lip shape have been used to distinguish these three species, but these characters are quite variable in P. huronensis (Case 1987; Sheviak 1999; L. Wallace, unpubl. data). Platanthera huronensis typically has greenish-white flowers in contrast to the pure white flowers of
P. dilatata and the greenish-yellow flowers of P. aquilonis. The lip of P. dilatata has a
100
strong basal dilation while the lips of P. huronensis and P. aquilonis vary from having little or no dilation to having very strong dilations. Individual floral parts in P. huronensis are generally larger than in P. aquilonis, but smaller than in P. dilatata
(Catling and Catling 1997; L. Wallace, unpubl. data). When flower color and lip shape are ambiguous, P. huronensis can still be distinguished from P. aquilonis by features of the column. The stigma of P. huronensis is pointed and rises up between divergent anther sacs, a condition that strongly resembles the column of P. dilatata (Fig. 5.1). In
contrast, the stigma of P. aquilonis is rounded, and the anther sacs meet above the stigma
(Fig. 5.1). The shape of the viscidium, the sticky pad at the base of a pollinarium, also
differs among the three species. It is oblong in P. dilatata, oval in P. huronensis, and
orbicular in P. aquilonis (Sheviak 1999; L. Wallace, unpubl. data). These species also
differ in whether they produce floral scents. Platanthera dilatata and P. huronensis are fragrant, whereas P. aquilonis is not known to be fragrant. The differences in floral features reflect different pollination syndromes. Platanthera dilatata is outcrossing and pollinated by moths and butterflies (Gray 1862b; Kipping 1971; Boland 1993).
Platanthera aquilonis is facultatively autogamous (Gray 1862a, 1862b; Catling 1983,
1990; Sheviak 1999; Catling and Catling 1991; Reddoch and Reddoch1997), but may be pollinated by mosquitoes or other small flies in some parts of its range (Luer 1975).
Platanthera huronensis is most commonly outcrossing and pollinated by moths, bees, and flies (Catling and Catling 1989), but some populations of this species may also be autogamous (Reddoch and Reddoch 1997).
The geographic distribution of P. huronensis is thought to be contiguous with that of its purported parents. These are the only species in the section that occur in eastern
101
and western North America. Their range extends throughout much of Canada and the
northern United States in the east, to the western coast of Canada and the United States,
as far north as Alaska and the Arctic Circle, and into the southwestern United States. The distribution of populations of P. huronensis may not be continuous throughout Canada
(Sheviak 1999), but herbarium records suggest that the species is found continuously throughout the northern United States.
Morphological intermediacy and geographic distribution suggest the most likely progenitors of P. huronensis are indeed P. dilatata and P. aquilonis. However, variation in morphological features used to distinguish species in this group, overlap in the types of pollinators attracted to the species, and great potential for interspecific hybridization in areas of sympatry suggest that alternative origins of P. huronensis are also possible
(Sheviak 1999). Thus, the primary purpose of this study is to evaluate the taxonomic position and evolutionary origin of P. huronensis within section Limnorchis.
Specifically, molecular data are used to document intraspecific variation and to elucidate patterns of gene flow and dispersal.
5.2 MATERIALS and METHODS
5.2.1 ISSR and RAPD markers
To test the robustness of the hypothetical origin of P. huronensis from P. dilatata and P. aquilonis, the genetic make-up of 251 individuals of P. huronensis and six putative parental taxa was assessed using inter-simple sequence repeat (ISSR) and random amplified polymorphic DNA (RAPD) markers. Putative parental taxa included
P. dilatata vars. dilatata, albiflora, and leucostachys, P. aquilonis, Platanthera
102
sparsiflora (S. Watson) Schlechter, and Platanthera stricta Lindl.. The latter two species are green-flowered and are frequently found in sympatry with P. dilatata, P. huronensis,
or P. aquilonis in western North America. Platanthera sparsiflora is readily distinguished from P. dilatata, P. huronensis, or P. aquilonis by its long linear spur and lip, whereas P. stricta can be easily identified by its short, saccate spur.
Leaves from five individuals per population were sampled except in populations containing fewer than five plants (Table 5.1). Voucher specimens are deposited at OS.
This sampling scheme was designed to detect variation across wide geographic distances.
A more detailed study of population genetic structure in P. huronensis will be reported elsewhere (L. Wallace, unpubl. data). Leaf samples were kept on ice in the field and stored at –80°C until DNA was extracted. Total genomic DNA was extracted using a modification of the CTAB method (Doyle and Doyle 1987). Nine accessions representing the five species were initially surveyed for variation with 22 ISSR (inter- simple sequence repeat) primers and 62 RAPD (random amplified polymorphic DNA) primers. Six ISSR primers and four RAPD primers were chosen for the larger survey because they produced repeatable patterns of variation as well as bands that initially appeared to be diagnostic for a species. Primer sequences, optimal annealing temperatures, and the number of loci scored are listed in Table 5.2. For ISSR primers, each 25 µL reaction contained 1X PCR buffer (20 mM Tris-HCl and 50 mM KCl;
Invitrogen), 200 µM of each dNTP (Invitrogen), 1 mM MgCl2, 0.4 µM primer (0.8 µM
for ISSR-1), 0.5 units of Taq DNA polymerase (Invitrogen), and 0.3 µL template DNA.
ISSR reactions were subjected to the following thermocycler program: 94°C for 2.5 min.
(1 cycle); 94°C for 40 sec., 45°C -48°C (depending on the primer; Table 5.2) for 45 sec., 103
72°C for 1.5 min. (35 cycles); 94°C for 45 sec., 45°C - 48°C (depending on the primer;
Table 5.2) for 45 sec., 72°C for 7 min. (1 cycle); soak indefinitely at 4°C. For RAPD
primers, each 25 µL reaction contained 1X PCR buffer (20 mM Tris-HCl and 50 mM
KCl; Invitrogen), 200 µM of each dNTP (Invitrogen), 2 mM MgCl2, 5 pmoles of primer,
0.5 units of Taq DNA polymerase (Invitrogen), and 0.4 µL template DNA. RAPD
reactions were amplified according to the following program: 94°C for 2 min. (1 cycle);
94°C for 1 min., 36°C for 1 min., 72°C for 2 min. (35 cycles); 72°C for 7 min. (1 cycle);
soak indefinitely at 4°C. Template DNA was not quantified upon extraction but was
tested in dilutions to determine the amount that would give consistent results. A negative
control, including all ingredients except template DNA, was included with each set of
reactions to detect contamination. The total product was separated on 1.2% TAE agarose gels, stained with ethidium bromide, and visualized with UV light. Images of gels were captured digitally for later analysis. Duplicate reactions and gels were run for all primers and individuals. Non-replicated bands were eliminated from the data set. Band homology was based on similarity of molecular weight and occasionally band intensity.
A 1 kb-plus DNA ladder (Invitrogen) was run on each gel as a size standard.
Additionally, because of the large number of individuals that was surveyed across the five species, bands suspected of being similar in size were compared by re-amplifying individuals and running them side-by-side on a gel. Bands were scored as present (1) or absent (0).
Band frequency was determined for each species as the number of individuals containing a band relative to the number of individuals surveyed. (Note: Data for the varieties of P. dilatata were pooled because examination of the data did not provide 104
strong evidence of a relationship between P. huronensis and one specific variety of P. dilatata; see RESULTS below). The data set was examined for the presence of high- frequency bands that might be diagnostic in one or more species. However, the paucity of monomorphic bands and the fact that most bands occurred in fewer than 50% of the surveyed individuals precluded direct assessment of additivity of species-specific (i.e., monomorphic) bands in the polyploid. Thus, bands that were present in at least 50% of individuals of a species were considered species-typical, and their presence and frequency were compared across species. The data matrix was also examined for fixed genotypes within or between populations. The matrix of bands was subjected to multivariate analyses using principal coordinates analysis (PCoA) in NTSYS-pc (Rohlf
1998) based on a distance matrix derived from the similarity coefficient of Nei and Li
(1979). Intraspecific and interspecific genetic distances were estimated from the mean number of pairwise differences in bands within and between populations and species using ARLEQUIN (Schneider et al. 2000). Interspecific distances were corrected to account for relative differences found within species. Relationships among populations were also evaluated in a neighbor-joining (NJ) analysis performed using the NEIGHBOR algorithm in PHYLIP (Felsenstein 1993) and based on genetic distances between populations as determined in ARLEQUIN.
5.2.2 RFLP’s of the chloroplast genome
Restriction fragment length polymorphisms were also used to elucidate patterns of dispersal and maternal parentage in P. huronensis. The chloroplast genome is assumed to be passed to offspring maternally as has been demonstrated for other orchids (Chang et al. 2000). Two non-coding regions of the chloroplast genome, the rpl16 intron and trnT-
105
F intergenic region, were amplified by PCR and cut with four restriction enzymes. The rpl16 intron was amplified using primers F71 (Jordan et al. 1996) and R622 (Les et al.
2002). The trnT-F intergenic region was amplified using primers “a” and “f” from
Taberlet et al. (1991). Each 25 µL reaction contained 1X PCR buffer (20 mM Tris-HCl
and 50 mM KCl; Invitrogen), 200 µM of each dNTP (Invitrogen), 3 mM MgCl2, 0.24 µM of each primer for rpl16 (0.4 µM of each primer for trnT-F), 0.5 units of Taq DNA polymerase (Invitrogen), and 1.0 µL template DNA. Amplified products were amplified under the following conditions: 94°C for 5 min. (1 cycle); 94°C for 1 min., 53°C for 1 min., 72°C for 2 mins. (35 cycles); a final extension at 72°C for 5 mins. (1 cycle).
Products were verified on 1% TAE agarose gels and subsequently cleaned by precipitating them with an equal volume of PEG:NaCl (20%:2.5M). Four µl of the cleaned product were digested with two units of restriction enzyme for 24 hours according to the manufacturer’s instructions. The rpl16 intron was digested with EcoRV
(Invitrogen) while trnT-F was digested with BstNI, DraI, and MseI (New England
BioLabs, Beverly, MA). Separate reactions were set up for each restriction enzyme.
Digested products of EcoRV were separated on 1.2% agarose TBE gels; the products of
BstNI and DraI were separated on 2% agarose TBE gels, and the products of MseI were separated on 2% NuSieve agarose (BioWhittaker Molecular Applications, Rockland,
ME) TBE gels. A 1 kb-plus DNA ladder (Invitrogen) was run on each gel as a size standard. Gels were stained with ethidium bromide and visualized under UV light.
Individuals suspected of having similar banding patterns were re-digested and run side- by-side on a gel. Bands of similar mobility on a gel were assumed to be homologous and to have a restriction site in common. The number of distinct chloroplast haplotypes was 106
determined and bands were coded as present or absent. A NJ analysis of inter-haplotypic
differences modified from the similarity coefficient of Nei and Li (1979) was used to examine patterns of relationship among haplotypes. The distance matrix was generated in NTSYS-pc (Rohlf 1998), and the NJ tree was constructed using the NEIGHBOR algorithm in PHYLIP (Felsenstein 1993).
5.3 RESULTS
5.3.1 Variation at ISSR and RAPD loci
From the six ISSR primers and four RAPD primers used, a total of 305 bands were scored among all surveyed individuals. No data are available for primer RAPD-2 in individuals of P. sparsiflora despite repeated attempts at amplification. The ISSR
primers yielded nearly twice as many bands overall (202) and a greater mean number of
usable bands per primer (mean = 33.67 bands) compared to RAPD primers (mean =
25.75 bands; Table 5.2). Nevertheless, both types of primers provided species-typical
bands. Neither data set alone reveals the clarity of relationships among species that the
whole data set reveals (results not included). Most bands are polymorphic and present in
fewer than 50% of the individuals surveyed. When all bands or just ISSR bands are
considered, every individual is identifiable by a unique multilocus phenotype. However, if only RAPD bands are considered, four phenotypes are common between two or more
individuals. Common RAPD phenotypes are not shared between populations, though.
Twenty-seven of the 305 total bands occur in all five species, but these bands are
not in equal frequencies among species. The total number of scorable loci ranged from
54 in P. sparsiflora to 238 in P. dilatata (Table 5.3). Monomorphic bands (i.e., in every
107
individual of a species) also occur in all of the species, but most of these are not unique to a single species. Platanthera sparsiflora contains the most monomorphic bands with 10,
followed by P. aquilonis with eight, P. huronensis and P. stricta each with seven, and P.
dilatata with three (Table 5.3). All five species also contain a number of unique bands,
including 41 in P. dilatata, 26 in P. stricta, 14 in P. huronensis, and four each in P.
aquilonis and P. sparsiflora. Most of the unique bands found in P. dilatata, P.
huronensis, and P. aquilonis, however, were not present in more than 10% of the
individuals surveyed for each of these species. Only three of the unique bands found in
P. huronensis occur in more than three individuals. The frequencies of unique bands in
P. sparsiflora and P. stricta are much higher because many fewer individuals of these
species were sampled.
Individuals of P. huronensis do not exhibit strictly additive banding patterns, but
22 bands that occur in high frequency (i.e., in > 50% of the individuals) in this species are
also found in high frequency in either P. dilatata or P. aquilonis and are absent or in low frequency in P. sparsiflora and P. stricta (Table 5.4). Twelve of the 22 high-frequency bands are “dilatata”-specific while the other 10 are “aquilonis”-specific. Four high- frequency bands in P. dilatata and/or P. aquilonis, which might be expected in a hybrid derivative of these species, are absent or infrequent in P. huronensis.
Platanthera huronensis shows little genetic affinity for either P. sparsiflora or P. stricta. For example, 19 bands occur in intermediate or high frequency (> 50% occurrence) in P. sparsiflora or P. stricta, but are absent or in very low frequency (< 1% occurrence) in P. huronensis (Table 5.5). Additionally, no bands are shared exclusively between P. huronensis and P. stricta, and only two are shared exclusively between P.
108
huronensis and P. sparsiflora. Both of these bands are found in only two polyploid
samples, though.
A multivariate analysis indicates a clear separation of the five species as well as
geographic structuring in some of the species. The PCoA (Fig. 5.2) reveals a strong
disparity between eastern and western samples of P. huronensis, with all of the eastern
samples (and two western samples) showing a greater affinity to P. aquilonis than to
other P. huronensis. Platanthera huronensis from western North America is, for the
most part, a cohesive group that is distinct from all of the diploid species on both axes.
The separation of P. huronensis from other species is due to the combinations of bands
present in the individuals rather than the presence of unique bands. The pattern of
relatedness between P. huronensis and the varieties of P. dilatata does not indicate a link
between P. huronensis and any one of the varieties, although eastern populations seem to
bridge western P. huronensis and var. dilatata (Fig. 5.3). The varieties albiflora and
leucostachys are virtually indistinguishable, but noticeably distinct from var. dilatata on
the second axis. Comparison of P. huronensis with P. aquilonis likewise reveals a strong
similarity of all eastern samples and three western samples of P. huronensis with P.
aquilonis (Fig. 5.4). However, no geographic pattern of relationship is suggested
between western P. huronensis and P. aquilonis. Rather, P. aquilonis displays greater
intraspecific variability than western P. huronensis.
The greatest degree of divergence was found in P. dilatata, while individuals within the population of P. sparsiflora were the least divergent (Table 5.6). Mean genetic distance between species ranges from a high of 40.180 between P. huronensis and P. stricta to a low of 16.910 between P. huronensis and P. aquilonis. Notably, P.
109
huronensis is nearly equally divergent with P. dilatata as it is with P. aquilonis. The difference between P. huronensis and P. dilatata is 16.668. The NJ tree based on inter- population genetic distances depicts a similar pattern of relationships among the species as that revealed for individuals in the PCoA, although the relationship between P. dilatata var. dilatata and P. huronensis is more clearly outlined (Fig. 5.5). Additionally,
P. dilatata and P. aquilonis show a moderate amount of geographic structure as eastern and western populations of each species are more similar within these areas than between them. Interestingly, all samples of P. huronensis cluster within the green-flowered group, which includes P. aquilonis, P. sparsiflora, and P. stricta. Platanthera dilatata var. dilatata is sister to the green-flowered cluster. Populations of P. dilatata vars. albiflora and leucostachys form the outermost clusters in the tree.
5.3.2 Variation in chloroplast RFLP patterns
Variation in chloroplast RFLP patterns was found within species and within populations. Multiple patterns were found in 15 populations (Table 5.1), but there was no evidence of interspecific introgression (i.e., shared chloroplast haplotypes) in sympatric populations. Three RFLP patterns are distinguishable based on the rpl16
intron, including one size difference and one restriction site difference (Fig. 5.6). The
most common size of the rpl16 intron amplified is ca. 0.85 kb. One individual from
population HU13 contains a slightly smaller fragment (ca. 0.8 kb), and direct sequencing of the product revealed this individual to be strongly divergent from all other individuals
surveyed. One restriction site in the rpl16 intron was found in all samples of P. aquilonis
and P. stricta, in all eastern samples and two western samples of P. huronensis, and in
two samples of P. sparsiflora (cp types N-U; Fig. 5.6; Table 5.1). Cutting at this site
110
yields two bands of ca. 0.25 kb and ca. 0.6 kb. This restriction site was not found in the
majority of western P. huronensis or any of the P. dilatata samples.
Fragments of two different sizes were also found for the trnT-F region. Most individuals contain a fragment of ca. 2.2 kb; a smaller fragment (ca.1.7 kb) was found only in P. dilatata vars. dilatata and albiflora (cp types K-M; Table 5.1). No restriction sites in trnT-F were recognized by DraI. One site, recognized by BstNI, is shared by all individuals, but two different patterns were found, which correspond to the size difference in trnT-F. Digestion with MseI indicated a great deal of variation in trnT-F, resulting in 21 RFLP patterns. However, because many small bands (i.e., < 0.1 kb) and were not resolvable, the variation reported may be an underestimate of the true extent of variation in this region of the chloroplast genome. Resolvable fragments ranged in size
from ca. 0.1 kb to ca. 0.7 kb.
Digestion of both regions allowed the resolution of 22 chloroplast haplotypes.
Thirteen distinct types were found in P. dilatata, but there is little correspondence
between haplotype and varietal status or geographic origin. All of the eastern samples of
P. dilatata have an identical haplotype (C; Fig. 5.6), which is shared with population DI1 from Alaska as well as individuals referable to vars. albiflora and leucostachys from the western U.S. (Table 5.1). A single haplotype was found in P. stricta, while two haplotypes were identified in P. sparsiflora, distinct only in rpl16. The six eastern samples of P. huronensis have an identical haplotype, which they share with two individuals of P. aquilonis from population AQ4. The majority of western P. huronensis
samples have the same haplotype, and this is shared by a single P. dilatata var. albiflora
individual from population AL5. Only three individuals of western P. huronensis have
111
different haplotypes. One of these haplotypes (V) is unique to an individual in population HU13, while the other two haplotypes are identical to haplotypes found in P. aquilonis (N in population HU14 and S in population HU16; Table 5.1).
Neighbor-joining analysis indicates a greater similarity of the chloroplast haplotype characteristic of most western samples of P. huronensis (cp type B) with haplotypes of P. dilatata (Fig. 5.6). The difference in the primary haplotype of P. huronensis and haplotypes observed in P. dilatata is due to a single band (Appendix).
This primary haplotype of P. huronensis differs from haplotypes in P. aquilonis both by the restriction site in rpl16 and several bands in the profile of trnT-F digestion with MseI.
The two primary groups in the tree are distinguished by the presence of the restriction site in rpl16, found in P. aquilonis, P. stricta, and some P. sparsiflora individuals.
Subsequently, within these groups, RFLP patterns are determined by the restriction sites that were detectable with digestion of the trnT-F region with MseI. Although P. sparsiflora and P. stricta have the rpl16 restriction site, the RFLP patterns observed in these species differ from those found in P. huronensis and P. aquilonis by restriction sites in the trnT-F region. Similar to the patterns found with ISSR and RAPD markers, eastern
P. huronensis has a chloroplast RFLP pattern that matches that found in P. aquilonis.
5.4 DISCUSSION
5.4.1 Progenitors of Platanthera huronensis
Distinguishing between an allopolyploid or autopolyploid origin can be difficult, especially if a polyploid taxon has originated multiple times or the initial polyploid event occurred many generations ago. Because allopolyploidy involves interspecific
112
hybridization, the resulting alloploid should exhibit, to some degree, a combination of characters observable in the progenitor species. Allozymes, and more recently, PCR- based molecular markers and restriction site data have been used to demonstrate biochemical additivity and ultimately parentage of homoploid (e.g., Rieseberg 1991;
Rieseberg et al. 1993; Smith et al. 1996; Padgett et al. 1998; Wolfe et al. 1998a, 1998b) and polyploid hybrid species (e.g., Wendel 1989; Soltis et al. 1995; Arft and Ranker
1998; Cook et al. 1998; Hedrén et al. 2000, 2001; Baumel et al. 2001). The ISSR and
RAPD data presented here, while not showing complete additivity in all individuals suspected of being amphiploids, do suggest P. huronensis is of hybrid origin as well.
Among the species examined, P. huronensis is most similar to P. dilatata and P. aquilonis at ISSR and RAPD loci (Table 5.6), in accordance with predictions based on morphological intermediacy (Catling and Catling 1997; Sheviak 1999). Platanthera huronensis exhibits a combination of 22 high-frequency bands found in P. dilatata and P. aquilonis (Table 5.4), and has few unique bands occurring in high-frequency. Likewise, the data provide little evidence of a primary or secondary relationship between P. huronensis and either P. sparsiflora or P. stricta since several distinctive morphological and genetic markers observed in these species are absent in P. huronensis. Both P. sparsiflora and P. stricta have a number of high-frequency ISSR and RAPD bands that are not found in P. huronensis (Table 5.5) and unique chloroplast RFLP patterns which are not closely related to haplotypes observed in P. huronensis (Fig. 5.6).
5.4.2 Eastern vs. western Platanthera huronensis
The patterns of variation observed in P. huronensis from various geographic regions reflect ancient processes related to the formation of neopolyploids as well as
113
more recent events. The most common mechanisms of tetraploid formation are the union
of diploid gametes or a triploid bridge (reviewed in deWet 1980; Ramsey and Schemske
1998). A bridge results from the production of a triploid individual from a diploid
gamete and a haploid gamete and the subsequent fertilization of a triploid gamete by a
haploid gamete. In an allotetraploid organism formed in one step via the union of diploid
gametes, it is expected that parental traits will be equally represented in the tetraploid offspring. However, the genetic make-up of an allotetraploid produced via a triploid bridge will strongly depend on the contribution of each species at each step. It is only when one of the species provides the haploid gamete in both the first and second steps that the parental species can be expected to be equally represented in the resulting raw allotretraploid. If one species provides both the diploid gamete in the first step and the haploid gamete in the second step, then markers of this species should be represented in a proportion of 3:1 relative to markers of the other species in a newly created allotetraploid.
The strong distinction between eastern and western samples of P. huronensis is one of the more interesting results of this study because it hints at different evolutionary processes in these populations, which may be related to different mechanisms of origin of polyploids that are morphologically similar. The strong similarity between eastern P. huronensis and P. aquilonis could be indicative of an autopolyploid origin from P. aquilonis. The capacity for self-fertilization in P. aquilonis should certainly increase the chance that two conspecific diploid gametes would unite. Alternatively, eastern P. huronensis could have resulted from allopolyploidy via unreduced gametes or a triploid bridge. The greater representation of P. aquilonis makers in eastern P. huronensis, then, could have resulted from secondary gene exchange with this species or could be related
114
to the way in which the allotetraploid was initially created. If P. aquilonis provided the
diploid gamete in the first step and the haploid gamete in the second step, then P.
huronensis should be more genetically similar to this species. Similar processes may also
explain the origin of P. huronensis in other areas and the similarity between P. huronensis and P. dilatata in chloroplast RFLP patterns in western populations.
Unfortunately, these molecular data provide little in the way of distinguishing among the various mechanisms of polyploid formation in P. huronensis, but results from other
studies point to a primary allopolyploid origin of P. huronensis. For example, Sheviak
and Bracht (1998) found bivalent chromosome formation in chromosome squashes of P.
huronensis individuals, which is generally indicative of allopolyploidy rather than
autopolyploidy.
5.4.3 Number of independent origins of Platanthera huronensis
The common presence of fixed genotypes or genetic markers in widely separated
populations strongly suggests a common ancestry of them and can be indicative of a
progenitor-derivative relationship between taxa. Furthermore, matching genetic markers
within polyploid populations to markers in populations of the parental species provides
evidence of parentage and adds to interpretation of the number of times a polyploid
species has originated. Most studies on polyploid species have found evidence of
multiple origins within and among populations (reviewed in Soltis and Soltis 1993). In
most of the cases in which a single origin has been suggested, the polyploid species is
endemic or otherwise restricted in its distribution. For example, a single origin is
estimated in the apomictic species Dactylorhiza insularis in the western Mediterranean
region of Europe (Bullini et al. 2001), in Saxifraga svalbardensis, a narrow Arctic
115
endemic allopolyploid species (Brochmann et al. 1998), and in the narrow endemic
Draba ladina (Widmer and Baltisberger 1999).
To occupy its current distribution, which is quite extensive, P. huronensis could
have independently evolved multiple times in disjunct areas with limited dispersal of
seeds or this species could have evolved relatively few times with widespread dispersal
of seeds. If the latter hypothesis is correct, P. huronensis is expected to be an old taxon.
These hypotheses are not necessarily mutually exclusive, though, because extant
populations of P. huronensis may be derived from very old polyploid lineages in some
areas and recently derived polyploid lineages in other areas, especially given the
geographical history of areas where this species presently occurs. The distinctness of
eastern and western P. huronensis samples strongly suggests different evolutionary
origins and reciprocal maternal parentage. Chloroplast haplotypes suggest that P.
aquilonis has been the maternal parent in eastern samples while both P. aquilonis and P. dilatata may have served as the maternal parent of western samples.
Determining the actual number of times a polyploid species originated is more tenuous, but a count of the number of unique multilocus genotypes is often used to estimate independent origins (reviewed in Soltis and Soltis 1993). Identification of a unique phenotype in every individual sampled, then, would suggest at least 79 independent origins of P. huronensis from P. aquilonis and P. dilatata. Simply ascribing a unique origin for every unique phenotype, may grossly overestimate the number of times a species has evolved de novo because multiple phenotypes can also arise in a population as a result of segregation of bands that were heterozygous in the neopolyploids (e.g., Soltis and Soltis 1993). Additionally, gene flow between polyploids
116
or between diploids and polyploids, as well as mutations and genomic changes in later
generations could make it seem as if polyploid organisms have originated independently
even if there has only been a single origin within or among populations. The time since
formation of a neopolyploid is an important consideration in estimating the number of
independent origins in a polyploid taxon. In the absence of such information for P.
huronensis, a more conservative estimate of the number of independent origins is five,
based on variation in the chloroplast genome. A single origin is recognized for the
eastern samples, while four independent origins are suspected in the western samples.
Although this may seem like an underestimate of the number of separate origins for such
a widespread species, ISSR and RAPD markers did not provide clear geographic
structure among western populations of P. huronensis to suggest independent origins of
these populations. Likely, the number of independent origins of P. huronensis will be
revised upward with additional population sampling.
Assuming P. huronensis has originated de novo infrequently, secondary dispersal
of polyploid genotypes must also be invoked to account for the current distribution of this
species. The unique RFLP pattern that is shared by populations of P. huronensis in
Alaska and the lower Rocky Mountains certainly suggests these individuals descended
from a common ancestor. On the contrary, the eastern populations appear to have been
derived from P. dilatata and/or P. aquilonis in the northeastern United States or adjacent
Canada. The sharing of multiple molecular markers among very distant populations within P. huronensis, P. dilatata, and P. aquilonis is a strong indication that long distance dispersal is an important mechanism by which new populations are founded. The similar
chloroplast haplotypes observed in eastern and western populations could result from
117
long distance seed dispersal since dispersal over very long distances is theoretically
possible in orchids because their dust-like seeds travel well in wind currents. However,
Rasmussen (1995) suggests that in most orchid species, seeds probably only travel 5-10 km in wind currents. Thus, seed dispersal in P. dilatata, P. huronensis, and P. aquilonis
may occur in a stepping stone fashion (Kimura and Weiss 1964) in which dispersal is localized among neighboring populations, yet distant populations still remain connected via localized gene flow across a wide range of populations. Future studies aimed at investigating gene exchange by seeds and pollen will undoubtedly provide interesting results that will more thoroughly explain the role that long distance seed dispersal plays in diversification of these species and orchid species in general. Infrequent colonization of small founder populations through long distance dispersal of seeds and subsequent evolution within these populations has been suggested as an important mechanism of diversification of the Orchidaceae (Rasmussen 1995). With regard to P. huronensis, sampling of populations between Alaska and the lower Rocky Mountains and in the northeastern and mid-western United States and Canada will be critical for exploring phylogeographic patterns in P. huronensis, P. aquilonis, and P. dilatata.
5.4.4 Patterns of molecular variation in Platanthera huronensis
Complete additivity of bands found in parental species was not observed consistently in individuals of P. huronensis. Although most of the bands found in the polyploid were also found in P. dilatata and/or P. aquilonis, 12 (5%) are unique to this species. Three of these unique bands occur in more than 20% of the samples and across several populations. Likewise, all ISSR or RAPD fragments of the parental species were not necessarily found in P. huronensis, and four of these occur frequently (i.e., > 50%) in
118
one or both of the parental species. Wendel (2000) suggested that even newly formed
polyploids should not necessarily exhibit additivity relative to their progenitors because
of the rapid genome changes that can accompany the formation of a polyploid and the
many different gametic combinations that can result from independent assortment and
inter-genomic exchange in first generation polyploids. Recent studies demonstrating the
presence of non-Mendelian variation in synthetically produced Brassica alloploids (Song
et al. 1995) support this view.
Incomplete additivity observed in P. huronensis, the recently derived alloploids
Tragopogon mirus and Tragopogon miscellus (Cook et al. 1998), and older alloploids in
the Dactylorhiza incarnate-maculata complex (Hedrén et al. 2001) may have several
explanations. First, extant polyploid lineages may have originated from parental
lineages that are now extinct. Many populations of P. huronensis and its diploid
progenitors are probably short-lived because they frequently occur in disturbed sites, such
as roadside ditches. Rapid turnover of populations and individuals within populations
(Reddoch and Reddoch 1997) in combination with infrequent formation of neopolyploids
could result in polyploid genotypes for which no progenitor genotype can be identified
even with unlimited sampling of individuals and molecular markers. Alternatively, novel
variation may simply be attributed to populations of the parental species that were not
sampled. The ISSR and RAPD markers indicated greater similarity among individuals
within populations than between individuals from different populations. Additionally, it
appears that most of the variation within populations is represented by the five
individuals per population included in this study since a larger survey of individuals revealed similar patterns of within-population diversity (L. Wallace, unpubl. data).
119
Population sampling does not, however, include all of the areas where these species are
found in the United States and Canada. Consequently, the low-frequency ISSR and
RAPD bands as well as the primary chloroplast haplotype found in western P. huronensis
may exist in some other unsampled populations of P. dilatata and P. aquilonis. Source
populations could even exist in very distant places from the locations of sampled
populations if seeds are occasionally dispersed over long distances. A third hypothesis
for the presence of unique variation observed in P. huronensis is that genomic evolution
may have occurred rapidly after formation of neopolyploids, resulting in the addition or
loss of ISSR and RAPD priming sites in the polyploid. Genomic reorganization, a complex and potentially non-random process, may involve intra-genomic and inter- genomic chromosomal rearrangements, gene silencing, and concerted evolution
(reviewed in Wendel 2000). Additional data are needed to evaluate the role that genomic reorganization has played in P. huronensis.
The potential for intraspecific chloroplast variation is likely to be greater in long- lived perennial species, species with a wide geographic distribution, and species capable of long distance gene flow. To some degree, these are all features common to the species of section Limnorchis. Still, the extent of intraspecific and interspecific chloroplast variation observed among individuals of P. dilatata, P. huronensis, and P. aquilonis using only a small portion of the chloroplast genome is a significant finding if one considers that for many plant species the chloroplast genome evolves very slowly and intraspecific variation is minimal or difficult to locate. In fact, minimal divergence in the chloroplast genome has been detected in many other orchid genera (e.g., Bullini et al.
2001; Soliva et al. 2001). Yet, in some other species of plants, intraspecific chloroplast
120
variation is extensive enough to provide a means of tracing patterns of gene flow within populations and among geographic regions (reviewed in Soltis et al. 1997).
Despite the overall high levels of variation observed in apparently closely related species, the lack of extensive intraspecific chloroplast variation in western samples of P. huronensis was surprising. In another polyploid orchid, Dactylorhiza insularis, individuals from disparate geographic regions and with distinct multilocus allozyme genotypes have an identical chloroplast haplotype (Bullini et al. 2001). This finding is expected, though, because this species reproduces apomictically and little chloroplast variation was observed in its diploid progenitor species. Western populations of P. huronensis may be genetically uniform because they originated from a common neopolyploid, but it is also possible that intraspecific variation exists in P. huronensis and was not detected. Bands less than 100 bp resulting from digestion of trnT-F with MseI were not resolvable on agarose gels, but more variability may be found within trnT-F if these bands could be resolved or if the exact sequence of this region is examined across populations.
5.4.5 Taxonomic Considerations
5.4.5.1 Platanthera huronensis. The taxonomic status of P. huronensis has been repeatedly debated over the last century. It has been recognized at the specific level
(Lindley 1840; Rydberg 1901; Catling and Catling 1989, 1997; Reddoch and Reddoch
1987; Sheviak 1999), varietal level (Fernald 1950; Luer 1975), synonymous with P. aquilonis (Ames 1910; Correll 1950; Gleason and Cronquist 1991), or merely mentioned in passing in discussions of the potential for hybrid formation in the complex (e.g.,
Morris and Eames 1929; Case 1987). In recent works, P. huronensis has been treated
121
more frequently at the specific level, perhaps because it is now recognized to be a
polyploid. At least two authors have provided detailed descriptions of morphological
features which distinguish it from P. aquilonis (Catling and Catling 1997; Sheviak 1999).
Molecular data from this study also support its recognition at the specific level.
Platanthera huronensis comprises a morphologically recognizable entity that appears to
be reproductively isolated from closely related species. Furthermore, unique patterns of
ISSR and RAPD loci as well as chloroplast RFLP patterns distinguish this species from
other green flowered taxa in section Limnorchis, including P. aquilonis, P. sparsiflora,
and P. stricta in some parts of its range.
Although the distinctness of P. huronensis within section Limnorchis is apparent, several other taxonomic issues related to the identity of P. huronensis remain unresolved.
First, the strong disparity between eastern and western populations of P. huronensis is
interesting, and may indicate the presence of unique evolutionary lineages within P. huronensis, which may or may not warrant taxonomic recognition. It is noteworthy that samples of P. huronensis collected for this study also show differences in the sizes of plants and flowers from eastern and western populations, but not in qualitative features, such as column structure (L. Wallace, unpubl. data). Similar morphological differences were seen in P. dilatata and P. aquilonis, but intraspecific genetic variation was not as extensive as interspecific variation in these species. Variable environmental factors associated with different habitats could also produce the morphological differences observed. Sampling of P. huronensis was not sufficient in this study to fully address geographic patterns of polyploidization and dispersal in this species because of its widespread distribution throughout much of Canada and the northern United States.
122
Thus, any hypothesis that eastern and western samples might represent distinct taxa within or comparable to P. huronensis is tentative at this point. If P. huronensis from eastern and western areas prove to be independent lineages and consistent morphological differences can be identified between them, then it may be valid to recognize them as distinct.
Second, the relationship of Platanthera xmedia (Rydb.) Luer to P. huronensis must also be considered. Luer (1975) used P. xmedia in reference to hybrids of P. dilatata and P. aquilonis. However, it is not clear how P. xmedia might differ from P. huronensis since P. huronensis is also regarded as intermediate to P. dilatata and P. aquilonis. Luer (1975) recognized both P. huronensis (as a variety of P. aquilonis) and
P. xmedia, but reserved the latter name for individuals that were difficult to identify and
“putative hybrids about mid-way between the varieties of the species P. aquilonis and P. dilatata.” Luer (1975) did not suggest a hybrid origin for P. huronensis. Thus, P. xmedia may be appropriately applied to homoploid hybrids that may occur in areas where
P. dilatata and P. aquilonis come into contact, but no studies have yet demonstrated unequivocally that interspecific hybridization at the diploid level occurs naturally between any of the species in section Limnorchis.
Lastly, evolutionary relationships among P. huronensis and related species are further confused by the presence of two other tetraploid species, Platanthera hyperborea
(L.) Lindl., in Iceland (Sheviak 1999) and Platanthera hyperborea var. viridiflora
(Cham.) Kitamura in Japan (Inoue 1983). According to Sheviak (1999), P. hyperborea is very similar to P. huronensis in several morphological features, but there is a noticeable difference in the sizes of plants between the two species and in some relatively minor
123
qualitative features of the flowers. In describing P. hyperborea var. viridiflora, Inoue
(1983) suggested that the tetraploid plants in Japan are more robust and with more linear
lips than those in North America and Iceland, yet it is not clear whether his comparison was to Icelandic plants referable to P. hyperborea or North American plants referable to
P. huronensis. Polyploidy is not common in Platanthera, and it is therefore possible that these entities represent geographic races of a large and variable P. huronensis.
Alternatively, these taxa may represent wholly different polyploid lineages that have evolved from entirely different progenitors. This provides yet another interesting twist to the systematics of section Limnorchis, and additional comparative studies of Icelandic and Japanese plants with P. huronensis should help to resolve the taxonomic complexities that continue to plague this group.
5.4.5.2 Platanthera dilatata. The three varieties of P. dilatata (dilatata, albiflora, and leucostachys) are distinguished by their geographical distributions and spur lengths
(Luer 1975). The varieties also show some divergence in viscidium shape (Sheviak
1999; L. Wallace, unpubl. data), which corresponds rather strongly to differences in
flower size and is likely related to the Lepidopteran species that pollinate them. All three
varieties occur in western North America and have continuous, and in some areas
overlapping, distributions; only var. dilatata also occurs in eastern North American as
well. In var. dilatata, the spur is approximately equal to the length of the lip, in var.
albiflora, the spur is one quarter to one half as short as the lip, and in var. leucostachys,
the spur is approximately twice as long as the lip. While var. leucostachys is easily
distinguished by spur length, vars. albiflora and dilatata seem to intergrade into one
another when spur length is used to discriminate them (L. Wallace, unpubl. data). Given
124
the recognizable morphological differences among the varieties, they might be expected
to exhibit divergence in molecular markers as well. These taxa are not strongly divergent
at nuclear rDNA loci (L. Wallace, unpubl. data), but the ISSR and RAPD data are more
informative with regard to the patterns of relatedness in P. dilatata. Indeed, the patterns revealed by these markers are quite striking. That is, vars. albiflora and leucostachys, the
two most morphologically divergent taxa, are genetically more similar to one another
than to var. dilatata (Fig. 5.3). In the NJ tree, populations of the three varieties represent
distinct clusters, and within each of the varieties, populations cluster according to
geographic proximity. Populations LU3 and AL3, which fall within the var. dilatata cluster, may indicate the introduction of markers from var. dilatata into these populations via hybridization or seed dispersal. A large population of var. dilatata was located within a few km of population AL3, but this population was not included in this study.
The widespread distribution of var. dilatata, which encompasses that of both of the other two varieties, suggests the radiation of these taxa from the nominate variety.
Given the differences in spur length and viscidium shape, selection by pollinators may have been a driving force for intraspecific diversification (Luer 1975). Evidence of a progenitor-derivative relationship can often be deduced from molecular markers, provided there has not been substantial divergence between taxa. No directional pattern of divergence was found in this study, however. Populations of vars. albiflora and leucostachys fall outside the cluster of var. dilatata populations in the NJ tree (Fig. 5.5).
Additionally, although similar chloroplast haplotypes were observed among the varieties, other populations of vars. albiflora and leucostachys (e.g., AL1, AL2, AL5, and LU3) have unique chloroplast patterns, which were never observed in var. dilatata (Table 5.1).
125
These results not only corroborate morphological distinctions, they also suggest a more
interesting and complex pattern of diversification within P. dilatata. Morphological and molecular markers do suggest some degree of distinctness among these three varieties of
P. dilatata, which supports the continued recognition of these taxa at the varietal rank. A search for additional markers may indicate that these taxa are actually quite distinct. It is expected that differences in flower structure (e.g, spur length) among the three varieties
provides some degree of reproductive isolation among them. Additionally, the reproductive mechanisms of var. albiflora are not known. Future studies that examine the extent and mechanism of reproductive isolation among the varieties should be particularly helpful.
126
Population Location N Haplotype
Platanthera aquilonis AQ1 Bruce, Ontario, Canada 1 N AQ2 Bruce, Ontario, Canada 2 N AQ3 Aroostook Co., ME 5 N AQ4 Aroostook Co., ME 5 P,Q AQ5 Aroostook Co., ME 5 Q AQ6 Marquette Co., MI 5 R AQ7 Flathead Co., MT 5 S AQ8 Flathead Co., MT 5 R AQ9 Park Co., MT 2 S AQ10 Essex Co., NY 5 R AQ11 Herkimer Co., NY 3 N AQ12 Caledonia Co., VT 5 N,O
Platanthera dilatata var. albiflora AL1 Beaverhead Co., MT 5 E,H AL2 Ravalli Co., MT 5 J AL3 Fremont Co., WY 5 H, K AL4 Teton Co., WY 5 H,M AL5 Teton Co., WY 5 B,C,L AL6 Teton Co., WY 4 C,H,K
Platanthera dilatata var. dilatata DI1 Fairbanks North Star, AK 5 C DI2 Bruce, Ontario, Canada 5 C DI3 Aroostook Co., ME 5 C DI4 Park Co., MT 5 C,I,L DI5 Ravalli Co., MT 5 F,H DI6 Herkimer Co., NY 5 C DI7 Caledonia Co., VT 5 C DI8 Sublette Co., WY 5 H,K DI9 Sublette Co., WY 5 K Cont.
Table 5.1. Names, locations, sample sizes (N), and chloroplast haplotypes observed in populations of Platanthera aquilonis, P. dilatata vars. dilatata, albiflora, and leucostachys, P. huronensis, P. sparsiflora, and P. stricta included in this study.
127
Table 5.1 (continued)
Population Location N Haplotype
Platanthera dilatata var. leucostachys LU1 Flathead Co., MT 5 D,H LU2 Missoula Co., MT 5 H LU3 Ravalli Co., MT 5 A LU4 Klamath Co., OR 5 C LU5 Wallowa Co., OR 5 H
Platanthera huronensis HU1 Fairbanks North Star, AK 5 B HU2 Alger Co., MI 3 P HU3 Carbon Co., MT 5 B HU4 Carbon Co., MT 5 B HU5 Carbon Co., MT 5 B HU6 Park Co., MT 3 B HU7 Herkimer Co., NY 1 P HU8 Wallowa Co., OR 5 B HU9 Door Co., WI 2 P HU10 Fremont Co., WY 5 B HU11 Fremont Co., WY 5 B HU12 Park Co., WY 5 B HU13 Park Co., WY 5 B,V HU14 Sublette Co., WY 5 B,N HU15 Teton Co., WY 5 B HU16 Teton Co., WY 5 B,S HU17 Teton Co., WY 5 B HU18 Teton Co., WY 5 B
Platanthera sparsiflora SP1 Linn Co., OR 5 G,U
Platanthera stricta SC1 Beaverhead Co., MT 5 T SC2 Gallatin Co., MT 5 T SC3 Granite Co., MT 5 T SC4 Ravalli Co., MT 5 T
128
Primer name Primer sequence 5’ to 3’ Annealing # Loci scored temperature ISSR primers
ISSR-1 (TC)6RG 46°C 34
ISSR-2 (TC)6RC 45°C 29
ISSR-3 (CA)7YG 47°C 26
ISSR-4 (AC)7RG 47°C 40
ISSR-5 (CTC)7RC 45°C 36
ISSR-6 (CT)8RG 48°C 37 Total 202 Mean/primer 33.67 RAPD primers RAPD-1 AGGCCAACAG BE-19 36°C 32 RAPD-2 CACACTCCAG C-16 36°C 14 RAPD-3 TGGCGCAGTG X-03 36°C 19 RAPD-4 ACGGGAGCAA X-13 36°C 38 Total 103 Mean/primer 25.75
Table 5.2. Primer sequence, annealing temperature, and number of loci scored for primers used in this study. Superscripts following the primer sequence for RAPD primers are names assigned by Operon Technologies.
129
Primer DIL HUR AQL SPR STC N=99 N=79 N=48 N=5 N=20 ISSR-1 27 (0) 31 (0) 20 (0) 6 (0) 16 (0) ISSR-2 22 (0) 16 (1) 6 (1) 2 (1) 12 (0) ISSR-3 21 (0) 17 (1) 16 (0) 5 (0) 16 (1) ISSR-4 32 (0) 28 (0) 23 (0) 11 (1) 20 (3) ISSR-5 28 (0) 24 (1) 18 (1) 7 (3) 24 (0) ISSR-6 28 (0) 23 (0) 17 (1) 3 (3) 18 (0) RAPD-1 28 (1) 20 (1) 16 (1) 8 (1) 19 (0) RAPD-2 9 (1) 10 (1) 9 (1) ^^ 5 (0) RAPD-3 16 (1) 10 (1) 6 (2) 1 (1) 6 (0) RAPD-4 27 (0) 22 (1) 20 (1) 11 (0) 22 (3) Total 238 (3) 201 (7) 151 (8) 54 (10) 158 (7)
Table 5.3. Number of loci scored for each primer for each taxon. The total number of loci present for each taxon is reported followed by the number of monomorphic loci in parentheses. DIL = Platanthera dilatata (all varieties); HUR = P. huronensis; AQL = P. aquilonis var. aquilonis; SPR = P. sparsiflora; STC = P. stricta. N= number of individuals surveyed. ^^Data unavailable.
130
Band DIL AQL HUR SPR STC ISSR-1J 0.04 0.71 0.87 __ __ ISSR-1W 0.20 0.56 0.56 __ 0.05 ISSR-2I 0.17 __ 0.53 __ __ ISSR-2M 0.71 __ 0.66 __ __ ISSR-2P 0.90 0.04 0.56 __ __ ISSR-2R 0.43 __ 0.54 __ __ ISSR-3F 0.68 0.04 0.81 __ __ ISSR-3J 0.08 0.92 0.99 __ __ ISSR-4S 0.36 0.04 0.86 __ 0.15 ISSR-5L 0.93 __ 0.77 __ 0.20 ISSR-5M 0.02 1.0 0.21 __ 0.10 ISSR-5N 0.14 0.02 0.80 __ __ ISSR-5T 0.36 0.02 0.63 __ __ ISSR-5Y 0.58 0.02 0.85 __ 0.05 ISSR-5AE 0.62 0.08 0.48 __ __ RAPD-1C 0.14 0.77 0.75 __ 0.10 RAPD-1G __ 0.52 0.35 __ 0.05 RAPD-1L 0.24 0.06 0.58 __ 0.10 RAPD-1T 0.17 1.0 0.95 __ 0.05 RAPD-2A __ 0.56 0.14 ^^ __ RAPD-2C __ 0.62 0.11 ^^ __ RAPD-4O __ 0.67 0.37 __ __
Table 5.4. Relative frequencies of species-typical bands found in Platanthera dilatata and P. aquilonis. DIL = P. dilatata; HUR = P. huronensis; AQL = P. aquilonis; SPR = P. sparsiflora; STC = P. stricta. ^^ Data unavailable.
131
Band SPR STC DIL HUR AQL ISSR-2D __ 0.75 0.09 0.02 __ ISSR-2H __ 0.80 0.06 0.05 __ ISSR-2K* __ 0.95 ______ISSR-3V __ 0.85 __ 0.04 0.10 ISSR-4M* 0.60 ______ISSR-4Q* 0.80 0.70 0.06 __ __ ISSR-5J __ 0.65 ______ISSR-5R __ 0.95 0.08 0.02 0.04 ISSR-5AD __ 0.50 ______ISSR-5J* 1.0 ______ISSR-6V __ 0.50 0.07 __ __ ISSR-6X __ 0.60 0.10 0.02 __ ISSR-6B* 1.0 __ __ 0.02 __ RAPD-3H __ 0.95 0.02 __ __ RAPD-4A __ 1.0 0.01 __ __ RAPD-4B __ 1.0 ______RAPD-4F __ 1.0 ______RAPD-4Q 0.60 __ 0.01 __ __ RAPD-4D* 0.60 ______
Table 5.5. Relative frequencies of species-typical bands found in Platanthera sparsiflora and P. stricta. SPR = P. sparsiflora; STC = P. stricta; DIL = P. dilatata; HUR = P. huronensis; AQL = P. aquilonis.
132
P. huronensis P. dilatata P. aquilonis P. sparsiflora P. stricta P. huronensis 44.002 P. dilatata 16.668 58.077 P. aquilonis 16.910 21.879 42.115 P. sparsiflora 32.166 23.695 26.401 21.200 P. stricta 40.180 28.069 35.266 28.163 46.397
Table 5.6. Comparison of mean genetic distances within and between species based on bands that were shared between individuals at ISSR and RAPD loci. All values reported between species have been corrected to account for relative differences found within a species.
133
(A)
(C) (B)
p
v
s
Figure 5.1. Variation in flowers of section Limnorchis. A: Flower of Platanthera dilatata; B-C: Columns of P. aquilonis and P. huronensis. p = anther sac containing a pollinarium; s = stigma; v = viscidium. Illustrations by Mark Wallace.
134
P. stricta P. aquilonis
P. sparsiflora PCO Axis 2
P. dilatata P. huronensis
PCO Axis 1
Figure 5.2. Plot of the first two axes from a principal coordinates analysis of individuals of P. dilatata, P. huronensis, P. aquilonis, P. sparsiflora, and P. stricta based on ISSR and RAPD banding patterns. Black dots within the P. aquilonis group indicate P. huronensis individuals. The first two axes explain 20.55% of the total variation observed.
135
P. huronensis
P. dilatata var. dilatata
P. dilatata var. albiflora
P. dilatata var. leucostachys PCO Axis 2
PCO Axis 1
Figure 5.3. Plot of the first two axes from a principal coordinates analysis depicting the relationship between individuals of Platanthera huronensis and the three varieties of P. dilatata: dilatata, albiflora, and leucostachys based on ISSR and RAPD banding patterns. The first two axes explain 20.80% of the total variation observed.
136
Eastern P. huronensis
Western P. huronensis
P. aquilonis PCO Axis 2
PCO Axis 1
Figure 5.4. Plot of the first two axes from a principal coordinates analysis depicting the relationship between individuals of Platanthera huronensis and P. aquilonis based on ISSR and RAPD banding patterns. The first two axes explain 29.10% of the total variation observed.
137
AL1 AL2 AL4 AL5 AL6 LU1 LU3 LU5 LU4 LU2 DI5 DI4 DI8 AL3 DI9 DI1 DI2 DI3 DI6 DI7 SP1 SC4 SC1 SC2 SC3 HU1 HU11 HU12 HU8 HU16 HU13 HU15 HU17 HU18 HU10 HU3 HU4 HU5 HU1 HU6 AQ8 AQ5 AQ4 HU7 HU2 AQ10 AQ6 AQ7 AQ9 1 AQ12 AQ3 AQ11 HU9 AQ2 AQ1
Figure 5.5. Unrooted phylogram depicting relationships among populations based on a neighbor-joining analysis of mean genetic distances between populations based on ISSR and RAPD bands shared between individuals. Population labels follow those in Table 5.1. Eastern populations of Platanthera dilatata, P. huronensis, and P. aquilonis are indicated by thickened lines.
138
A – LEU
B – ALB; HUR
C – ALB; DIL; LEU
D – LEU
E – ALB
F – DIL G – SPR
H – ALB; DIL; LEU
I – DIL
J – ALB K – ALB; DIL
L – ALB; DIL
trnT-F deletion M – ALB
N – AQL; HUR
O – AQL
P – AQL; HUR
Q – AQL
rpl16-EcoRV R – AQL restriction site S – AQL; HUR 0.1
T – STC
U – SPR
V – HUR
Figure 5.6. Unrooted phylogram of chloroplast haplotypes based on a neighbor-joining analysis of inter-haplotype distances modified from the similarity coefficient of Nei and Li (1979). The species containing each type follow the pattern i.d. (ALB = P. dilatata var. albiflora; DIL = P. dilatata var. dilatata; LEU = P. dilatata var. leucostachys; HUR = P. huronensis; AQL = P. aquilonis; SPR = P. sparsiflora; STC = P. stricta). The presence of a ca. 50 bp deletion in rpl16, a restriction site in rpl16, and a ca. 200 bp deletion in trnT-F are indicated. All other distinctions between RFLP patterns are due to mutational differences in trnT-F revealed by digestion with MseI. Haplotypes found in each population are listed in Table 5.1.
139
CHAPTER 6
MORPHOLOGICAL VARITAION IN THREE WIDELY DISTRIBUTED SPECIES OF
PLATANTHERA SECTION LIMNORCHIS: P. AQUILONIS, P. DILATATA, AND P.
HURONENSIS (ORCHIDACEAE)
6.1 INTRODUCTION
Taxonomic classification of Platanthera section Limnorchis has been a point of contention among orchidologists for more than a century. An inability to classify species due to extensive intraspecific morphological variation and the apparent presence of interspecific hybrids has resulted in there being little agreement on the number of species or defining characters for them (e.g., Rydberg 1901; Ames 1910; Schrenk 1978; Sheviak
1999). Despite numerous anecdotal accounts of intraspecific morphological variation, surprisingly few studies, have actually measured intraspecific variation in floral and vegetative characters or demonstrated that individuals of intermediate morphology are true hybrids. The studies that have documented morphological variation have only examined species at small regional scales. Catling and Catling (1997) provided the first detailed comparison of morphological features in three of the most widely distributed species in the complex: Platanthera huronensis (Nutt.) Lindley, Platanthera aquilonis
Sheviak, and Platanthera dilatata (Pursh) Lindley ex Beck, but their assessment was limited to populations in the Canadian Rocky Mountains. In this study, morphological
140
variation is re-examined in populations of P. aquilonis, P. dilatata, and P. huronensis from several geographic regions in the United States and Canada.
Several interspecific hybrids occur in section Limnorchis (Schrenk 1978), but P. huronensis stands out among them because it has become a stable species through polyploidization (4n = 84; Sheviak and Bracht 1998). Platanthera huronensis appears to be an allopolyploid derivative of P. dilatata and P. aquilonis based on morphological
(Catling and Catling 1997; Sheviak 1999) as well as molecular markers (L. Wallace, unpubl. data). Platanthera huronensis has green or greenish-white flowers similar to those of P. aquilonis, but is fragrant and has a column that is more similar to that seen in
P. dilatata. These three species overlap in range and are widely distributed from the
Atlantic coast to the Pacific coast of the United States and Canada. Populations are concentrated most heavily above 40° N latitude. Morphologically similar plants also occur in eastern Asia, and thus the ranges of these species may be even broader than current descriptions indicate. Although there may be some habitat partitioning among the species, they frequently occur together with P. huronensis in intermediate areas or at edges of populations of P. aquilonis or P. dilatata (Catling and Catling 1997; Sheviak
1999). In the northeast, P. aquilonis commonly occurs in boreal forests, whereas P. dilatata and P. huronensis occupy wet marshes, bogs, and fens.
Geographic differences in morphological traits among these species have certainly been noted and named by many taxonomists, but associations between morphological and genetic variation have not been adequately studied. Recent studies by
Wallace (unpubl. data) suggest that many species in section Limnorchis may be as genetically diverse as they are morphologically diverse. For example, substantial
141
differences in the genetic make-up of P. huronensis from eastern and western North
America can be seen in chloroplast, inter-simple sequence repeat (ISSR), and random
amplified polymorphic DNA (RAPD) markers. All three types of markers indicated a
strong similarity of P. huronensis in eastern populations to P. aquilonis while western samples of the polyploid are more similar to P. dilatata. Collectively, these results suggest P. huronensis includes multiple independently derived lineages. Multiple origins of polyploid taxa are repeatedly documented in plants (reviewed in Soltis and Soltis
1993), but the importance of morphological or genetic differences which may characterize polyploid individuals in different populations is not always apparent. This study will follow on previous studies which documented substantial differences in molecular markers between eastern and western populations of P. huronensis. The specific goal is to examine the extent to which eastern and western populations differ in quantitative and qualitative features of floral morphology. Populations of the putative parental species have also been included for comparison to patterns observed in P. huronensis. Additionally, all three varieties of P. dilatata [vars. dilatata, albiflora
Chamisso, and leucostachys (Lindl.) Luer] have been included in the analysis to document intervarietal morphological variation and to test the current taxonomy of white flowered taxa in section Limnorchis.
6.2 MATERIALS AND METHODS
Morphological diversity was assessed on individuals in a total of 61 populations, including 20 populations of P. huronensis, 10 populations of P. aquilonis, and 31 populations of P. dilatata from Alaska, Idaho, Maine, Michigan, Montana, New York,
142
Oregon, Vermont, Wisconsin, Wyoming, and the Bruce Peninsula of Ontario, Canada
(Fig. 6.1). Floral morphological measurements were taken on up to five individuals per
population. Individuals were initially assigned to a species in the field based on flower
color, and column shape. Flowers were chosen from the middle of the inflorescence to
minimize potential placement effects on floral morphology. Field-collected flowers were
preserved in FAA (45% EtOH, 45% water, 5% glacial acetic acid, and 5% formalin) and morphological measurements were taken on preserved flowers. Voucher specimens for most populations visited by the author are deposited at OS. Preserved flowers from all populations remain with the author.
Four qualitative characters (flower color, lip outline shape, viscidium shape, and stigma shape) primarily differentiated the three species. An additional fifteen quantitative features were assessed on one flower from each plant included in the survey.
The floral characters that were measured include minimum and maximum lip width, lip length from the attached to the spur to the tip, spur length from the opening to the tip, width of the anther at the apex and base (i.e., where the viscidia are held), dorsal sepal length and width at the widest point, lateral sepal length and width at the widest point, lateral petal length and width at the widest point, the ratio of maximum lip width to minimum lip width, the ratio of lip length to spur length, and the ratio of anther apical width to anther basal width.
For statistical analysis populations of P. aquilonis, P. dilatata, and P. huronensis were divided into eastern (east of the Mississippi River) and western (west of the
Mississippi River) groups for comparison of morphology across the ranges of these
species. Differences in the quantitative traits and ratios between eastern and western
143
populations of P. aquilonis and P. huronensis were examined with non-parametric Mann-
Whitney U-tests (Zar 1996), and Kruskal-Wallis non-parametric tests were used to detect differences among the varieties of P. dilatata. Statistical tests were performed using
SPSS, vers. 10. Dunn’s multiple comparisons tests (Zar 1996) were subsequently used to determine where the significant differences existed in P. dilatata. Multivariate principal components analyses (PCA) were also used to explore relationships among all morphological variables. These analyses were based on mean population values for each trait. Average taxonomic distances were determined from the population mean values and used in the PCA carried out in NTSYS-pc, vers. 2.02h (Rohlf 1998).
6.3 RESULTS
Substantial intraspecific and interspecific morphological variability was apparent
in quantitative characters, but the qualitative characters used to assign plants to a species
were remarkably constant even across wide geographic regions. Flowers of P. aquilonis
sampled from western populations were generally larger than those from eastern
populations (Table 6.1), but samples from the two geographic regions tended to have
similarly shaped lips that only occasionally displayed minor basal dilation. The flowers
were light green in color, but occasionally took on a yellowish-green hue. Floral
fragrance was not detected in any of the eastern or western samples of P. aquilonis. The
stigma of P. aquilonis is broad, curved, and recessed rather than protruding up between
the anther sacs. Viscidia are orbicular in shape, and pollinia were frequently found falling out of their sacs and down onto the stigma, a mechanism of self-pollination.
144
However, flowers of this species were not typically closed to potential pollinators,
suggesting that outcrossing can also occur.
The varieties of P. dilatata are all similar in having white flowers with strongly
dilated lips and a pointed stigma. The three varieties differ, however, in flower size, spur
length, and viscidium shape (Table 6.1). The var. leucostachys generally had larger
flowers than either of the other two varieties. The spur is nearly twice as long as the lip
in var. leucostachys (mean lip:spur length = 0.70 ± 0.173) , substantially shorter than the
lip in var. albiflora (mean = 1.47 ± 0.246), and approximately the same length as the lip
in var. dilatata (mean = 1.01 ± 0.119 for eastern populations; mean = 1.11 ± 0.146 for
western populations). Although some differences were detected between eastern and
western samples of P. dilatata var. dilatata, fewer of these differences were significant
compared to the differences observed in P. aquilonis or P. huronensis. Western samples of P. dilatata var. dilatata did have smaller flowers with shorter lips and spurs, more strongly dilated lips, and wider anther apices than eastern samples (Table 6.1).
Interestingly, flower size, excluding spur length, was very similar between eastern var. dilatata and var. leucostachys. The viscidia of varieties dilatata and leucostachys are square-oblong, but differ in size with var. dilatata having shorter viscidia. The viscidia of var. albiflora are oblong to lanceolate in shape and generally smaller than those of the other two varieties. Different floral fragrances were also detected among the varieties, but were not consistent within a variety (pers. observation). A clove-like scent was characteristic of eastern populations of var. dilatata while western populations of this variety exhibited a much sweeter fragrance. A clove-like scent was also apparent in some populations of var. leucostachys.
145
Consistent with previous observations, P. huronensis has features that appear
intermediate to P. aquilonis and P. dilatata var. dilatata. The flowers of this species are green in color, but often appear whitish. A mild, sweet scent was detected in only one eastern population while various scents were found in western populations ranging from very sweet to musty. The stigma shape of P. huronensis is similar to that of P. dilatata in
that it is pointed and protrudes upward between the anther sacs. However, in this species,
the stigma is not as pointed as it is in P. dilatata. The oval viscidia of P. huronensis are
distinct from the orbicular viscidia observed in P. aquilonis and the oblong viscidia found
in P. dilatata, and could represent an intermediate form. As in var. dilatata, eastern and
western populations of P. huronensis are distinct in the sizes of their flowers. Eastern
populations tended to have flowers with shorter lips, sepals, and petals, but similarly
sized spurs. Additionally, the separation between anther sacs tends to be more
pronounced in eastern populations. Lip shape, a character often used to distinguish P.
huronensis from P. aquilonis (Luer, 1975; Sheviak, 1999), was found to be extremely
variable within and among populations of P. huronensis. Some individuals displayed
strongly dilated lips similar to those of P. dilatata, while other individuals exhibited lips
with little or no dilation. Lip width measured at the widest point, an indication of the
degree of basal dilation, is greatest in western samples, and this finding was also found
for western samples of P. dilatata var. dilatata. (Table 6.1).
Intraspecific variability and overlap in the sizes of individual floral structures
suggests that qualitative characters, such as flower color and shape of the stigmatic
surface, may prove more useful for distinguishing these taxa. However, the sizes of
floral structures may also be helpful for distinguishing these taxa, if multiple characters
146
are considered together. The PCA plot reveals not only taxonomic distinctions, but
geographic disparities in P. dilatata var. dilatata, P. huronensis, and P. aquilonis as well
(Fig. 6.2). Populations of P. huronensis are as distinct as any of the other species
included in this survey, clustering most closely with P. dilatata, but intergrading into P.
aquilonis. The first three axes explain 78.8% of the variation. The characters with the highest loadings on these three axes include lateral sepal length, petal length, and lip
length (axis 1); apical:basal anther width, dorsal sepal width, and lateral sepal width (axis
2); and maximum:minimum lip width, lip:spur length, and minimum lip width (axis 3).
Although there is some separation of the three varieties of P. dilatata, they form a
continuum along the first axis (Fig. 6.3) with vars. albiflora and leucostachys at opposite
ends of the first axis. The var. dilatata is the most variable as populations of smaller
flowered individuals cluster closer to the group of var. albiflora and populations of larger
flowered individuals are more morphologically similar to var. leucostachys. The var. albiflora is distinct from the other two varieties on the third axis, which is explained most strongly by variation in the width of the dorsal sepal and apical and basal widths between the anther sacs. Surprisingly, spur length, a primary character used to distinguish the three varieties of P. dilatata and which was found to be significantly different among the varieties in this study, is not particularly important in the patterns depicted by multivariate analyses of morphological variation (Fig. 6.3).
6.4 DISCUSSION 6.4.1 Intermediacy of Platanthera huronensis
After more than a century of confusion over the existence and classification of P.
huronensis, it was not until 1997 that Catling and Catling (1997) provided the first
147
detailed study of the morphological intermediacy of P. huronensis. In western
populations, P. huronensis is easily distinguished from its putative parental species by
flower color, the shape and width of the base of the lip, and the relative width of the
anther sacs (Catling and Catling 1997). Likewise, in this study, P. huronensis is
morphologically distinct in individual qualitative features and in multivariate analyses of
the quantitative characters. Platanthera huronensis is consistently recognizable in the field, and the flowers of this species are intermediate in size to those of P. aquilonis and
P. dilatata var. dilatata. Flower color is useful for distinguishing P. dilatata, but was
found to break down in distinguishing the green-flowered species. Individuals with
strongly dilated lips are easily referable to P. huronensis, but not all plants of this species
exhibit widely dilated lips. When additional characters are needed, the shape of the
stigmatic surface, width of the anther sacs, and shape of viscidia can be consistently and
reliably used to delineate P. huronensis from P. aquilonis. As early as 1862, Gray noted
differences in the shapes of viscidia between P. dilatata and P. aquilonis, and more
recently, Sheviak (1999) discussed again the utility of viscidium shape as a reliable
diagnostic character in this group. Furthermore, both Catling and Catling (1997) and
Sheviak (1999) recognized differences in column structure and stigmatic shape and used
them to distinguish herbarium specimens of P. dilatata, P. huronensis, and P. aquilonis.
Thus, if several traits are considered together, P. aquilonis, P. dilatata, and P. huronensis
can be readily distinguished in most populations, and future taxonomic treatments should
reflect these differences.
The mean values for sizes of floral traits are comparable to regional assessments
made for P. dilatata in Newfoundland (Boland 1993), P. aquilonis, and P. huronensis in
148
Ottawa (Reddoch and Reddoch 1997), and P. aquilonis, P. dilatata, and P. huronensis in the Canadian Rocky Mountains (Catling and Catling1997). Generally, the values reported here are more similar to the lower end of the ranges established by these other authors. Nevertheless, the differences discerned from anecdotal descriptions by various other authors corroborate the morphological differences reported in this study.
6.4.2 Intraspecific variation in Platanthera dilatata
Platanthera dilatata is perhaps the most morphologically variable species in section Limnorchis. Unlike geographical variants discussed in other species of section
Limnorchis, most authors agree that at least two variants of P. dilatata are consistently
recognizable in the field. Luer (1975) recognized the morphological diversity of this
species by designating three varieties. Spur length in relation to lip length is the primary
means of distinguishing the varieties, but viscidium shape also differs among them. The
var. leucostachys is the most distinctive because it has a spur that can be more than two
times longer than the lip (Table 6.1). In contrast, vars. albiflora and dilatata have spurs that are shorter than or nearly equal in length to the lip, respectively. The smaller size of the spur in var. albiflora is not indicative of the size of other floral features since the
flowers of this variety tend to be similar or slightly larger than the flowers of the
nominate variety. In contrast, there is an increase in size of floral structures in var.
leucostachys. For example, the viscidium of this taxon is longer than in either of the
other varieties. Presumably, these features have been shaped by natural selection to
match the morphology of pollinators that service them. Large noctuid moths (Kipping
1971) and swallowtail butterflies (pers. observation) are confirmed pollinators of var. leucostachys, and a skipper and several noctuid moths are confirmed pollinators of var.
149
dilatata (Boland 1993). Although pollinators have not specifically been documented in populations of var. albiflora, pollination by Lepidopterous insects is expected based on similarity to the other two varieties. It is believed that in all three varieties pollinia attach to the proboscis of an insect as it probes the spur for nectar.
In some areas of western Canada and the United States, the three varieties have overlapping distributions. The nominate variety is the only one that also occurs in the east. Based on these distributions and the great amount of morphological diversity in var. dilatata, especially in the western United States (Luer 1975), it is hypothesized that vars. albiflora and leucostachys are derived from var. dilatata. These varieties may have evolved through long distance dispersal of seeds followed by divergence in allopatry due primarily to pollinator-mediated selection. It is expected that selection could drive the evolution of reproductive traits rather quickly because they are directly tied to individual fitness. Subsequently, a new variant population could also spread through long distance seed dispersal. The capacity for long-distance dispersal has been suggested by some authors as a means of facilitating the rapid evolution of new orchid taxa (e.g., Dodson and Gillespie 1967; Dressler 1993). If the nominate variety is the progenitor of the other two varieties, the derivative taxa are expected to have subsets of variation in the progenitor. DNA sequence data from nuclear rDNA revealed very little variation among the varieties and no clear pattern of evolution. RAPD and ISSR markers were more informative in that they revealed molecular differences that also corresponded to morphological differences, but these data were also inconclusive in indicating the direction of evolution in P. dilatata (L. Wallace, unpubl. data). These markers did, however, suggest vars. albiflora and leucostachys are more closely related to one another
150
than either is to var. dilatata. This result could be interpreted as an indication of derivation from similar genotypes within var. dilatata or that all three varieties evolved independently from a similar ancestral species. Given the genetic variability found within P. dilatata, which seems to correlate with morphological variation, the continued recognition of three varieties within P. dilatata (Luer 1975) is recommended. With additional insight into the evolutionary origin and placement within section Limnorchis, the taxonomy of P. dilatata may need to be revised. In future studies, it will be helpful to determine the extent to which the varieties are reproductively isolated and the basis of the morphological variation.
6.4.3 Geographical variation in morphology
Modern classifications seek to reflect morphological variants which also have distinct evolutionary histories. Correlative studies are often used to assess the importance of morphological variability to the fitness of individuals as well as the relationship between morphological and molecular variation. Frequently, though, variation in morphological and molecular markers is not strongly correlated due to differential selection acting on the two types of traits, interspecific hybridization, or other factors. In this and related studies (L. Wallace, unpubl. data), extensive morphological and molecular variation in species of section Limnorchis has been documented. Generally, there is good agreement between the patterns suggested by morphological variation and those suggested by molecular markers, despite the small sample sizes of western P. aquilonis and eastern P. huronensis in the morphological analysis. The similarity in patterns exhibited by different types of characters suggests that morphological and molecular loci are evolving in similar directions. A surprising finding was the extent of
151
geographical structure in each of these species given their nearly continuous distribution
across the northern United States and Canada. Although eastern and western populations
of P. aquilonis, P. dilatata, and P. huronensis were not particularly distinct in qualitative features (e.g., column structure or viscidium shape), significant differences were noted in the sizes and shapes of floral structures. Within broad limits, the sizes of floral structures are more likely to be phenotypically plastic than are structures directly involved in transferring and receiving pollen (e.g., pollinaria shape or shape of the stigmatic surface).
Additionally, there may be more variation in genes which control traits not under strong selective pressure as a result of random mutation. Thus, the morphological variability
that was observed in this study could be due to phenotypic plasticity corresponding to
environmental conditions or it could be genetically based and under selection by different
suites of pollinators in different populations.
Phenotypic variation in vegetative characters is expected among plants in
populations living in different environmental conditions, but floral features are expected
to be more stable because they are involved in reproduction and ultimately lifetime
fitness. Floral features that attract pollinators influence the rate and effectiveness of
visitation by pollinators and are expected to increase male and female reproductive
success (Campbell et al. 1991). Thus, floral structure in a population should be molded
by the primary pollinator servicing the population (Stebbins 1970). When conspecific
populations are visited by different pollinators in different areas of the species’ range, the
potential exists for divergence in floral traits corresponding to the traits of local
pollinators, driven by natural selection. Such a phenomenon has been suggested for
several orchids, including many Platanthera species. Inoue (1983) discussed the
152
possibility of pollination ecotypes in the Platanthera mandarinorum complex to explain
morphological diversity and the difficulty of recognizing taxa. Various noctuid and
geometrid moths with overlapping proboscis lengths are known pollinators in populations
of P. mandarinorum in Japan, and the specific length of the proboscis of the primary
pollinator in a given population correlates strongly with differences in spur position and
length. Additionally, Robertson and Wyatt (1990) suggested the presence of pollination
ecotypes in Platanthera ciliaris in the southeastern United States. Spur length as well as
the size of other floral features differ between populations in the coastal plain and
mountains, and these floral differences correspond to variation in proboscis length of
butterfly pollinators in each of these regions. Although detailed studies of the pollination
of all of the Platanthera species studied here have not been done, P. dilatata and P. huronensis do not appear to be specific to a single pollinator species. Catling and Catling
(1989) reported pollination by bumblebees, noctuid moths, nymphs, and brush-footed butterflies in a single population of P. huronensis in the southern Rocky Mountains.
Several species of noctuid moths and skippers pollinate the flowers of P. dilatata, but bumblebees and other butterflies are also known to visit flowers (Boland 1993). In
Platanthera stricta, a related species in section Limnorchis, primary pollinators include several anthophilous flies, bumblebees, and geometrid moths, but various other beetles, moths, bees, and flies also reportedly visit flowers (Patt et al. 1989). As suggested by
Patt et al. (1989) for P. stricta, the ability to be pollinated by a variety of insects enables species to reproduce successfully in a wide range of habitats and under conditions of limited pollinator availability. This suggestion can be extended to other species of section Limnorchis that have generalist pollination syndromes as well. In P. aquilonis, P.
153
dilatata, and P. huronensis, it seems possible that the primary pollinators in a population
could differ across different microhabitats. Thus, the morphological differences reported
for the species of section Limnorchis may have been shaped by directional selection from
pollinators. Selection on floral traits may happen rather quickly in populations, and thus,
is possible even in short-lived populations. For example, Maad (2000) found significant
changes in floral morphology within a three-year period in a population of Platanthera
bifolia pollinated by a single hawkmoth species.
The presence of differential selection in populations serviced by different
pollinators is only one hypothesis that could explain the morphological differences
observed in these species. Additional studies that can address the genetic basis of
morphological variation and the relationship between floral morphology and pollinator morphology and behavior should be helpful for refining the taxonomic identities of these three widely distributed species. It is surprising that little variation was observed in spur length in eastern and western populations of the three species. Spur length is strongly correlated with proboscis length in other spurred flowers and several other species of
Platanthera (Nilsson 1988) and is expected to be under strong selection. It is not clear why there should be strong morphological differences in other floral features that appear to be less involved in the transfer of pollen if the direction of selection differs among populations. Regardless of the reason for the morphological variation, it would seem best at the present time to consider populations within each species part of single geographically variable taxa.
154
E AQL W AQL E HUR W HUR E DIL W DIL ALB LEU (N=33) (N=11) (N=15) (N=92) (N=30) (N=25) (N=30) (N=37) Lip max width 1.61 ± 1.68 ± 1.87 ± 2.08 ± 2.07 ± 2.42 ± 1.98 ± 2.21 ± 0.278 0.275 0.255 0.407 0.420ab 0.476b 0.301a 0.438ab Lip min width 1.01 ± 1.21 ± 1.09 ± 1.22 ± 1.07 ± 1.09 ± 0.98 ± 1.03 ± 0.258a 0.262b 0.210a 0.202b 0.215 0.245 0.202 0.270 Lip length 3.18 ± 4.35 ± 4.19 ± 5.21 ± 5.20 ± 4.18 ± 4.46 ± 5.94 ± 0.588a 0.342b 0.926a 0.764b 0.890ab 0.924ac 0.551c 1.112b Spur length 3.38 ± 3.55 ± 4.01 ± 4.26 ± 5.15 ± 4.40 ± 3.11 ± 8.79 ± 0.663 0.476 0.645 0.723 0.708a 0.913a 0.569c 1.794b Cont.
155 Table 6.1. Mean (± 1 SD) of 15 quantitative morphological characters (in mm) measured on Platanthera aquilonis (AQL), P. huronensis (HUR), P. dilatata var. dilatata (DIL), P. dilatata var. albiflora (ALB), and P. dilatata var. leucostachys (LEU). Three qualitative features are also reported for each of the species. Populations of P. aquilonis, P. huronensis, and P. dilatata var. dilatata were divided into eastern (E) and western (W) groups for comparison of morphology across the ranges of these species. T- tests were used to compare mean differences between eastern and western populations for P. aquilonis and P. huronensis. Dunn’s multiple comparisons tests were used to compare mean differences within P. dilatata. A significant difference (P < 0.05) for a trait within a taxon is indicated by unlike letters. Sample sizes (N) are indicated for each grouping.
Table 6.1 (continued)
E AQL W AQL E HUR W HUR E DIL W DIL ALB LEU (N=33) (N=11) (N=15) (N=92) (N=30) (N=25) (N=30) (N=37) Dorsal sepal 3.09 ± 3.75 ± 3.63 ± 4.45 ± 4.41 ± 4.01 ± 3.84 ± 5.07 ± length 0.467a 0.285b 0.768a 0.674b 0.783a 0.542ab 0.459b 0.927c Dorsal sepal 2.11 ± 1.20 ± 2.57 ± 1.58 ± 2.50 ± 1.92 ± 1.36 ± 1.68 ± width 0.440a 0.136b 0.475a 0.532b 0.472a 0.716b 0.249c 0.622bc Lateral sepal 3.30 ± 4.23 ± 3.77 ± 5.16 ± 5.12 ± 4.53 ± 4.35 ± 5.97 ± length 0.481a 0.375b 0.925a 0.857b 1.035a 0.612ac 0.605c 1.220b Lateral sepal 1.77 ± 1.35 ± 1.90 ± 1.94 ± 2.27 ± 2.28 ± 1.80 ± 2.15 ± width 0.394a 0.368b 0.266 0.671 0.411a 0.498a 0.418b 0.731ab 156 Lateral petal 2.37 ± 3.31 ± 3.28 ± 4.26 ± 4.34 ± 3.69 ± 3.43 ± 5.08 ± length 0.463a 0.381b 1.172a 0.863b 0.961ab 0.741bc 0.614c 1.240a Lateral petal 1.29 ± 1.92 ± 1.793 ± 2.45 ± 2.24 ± 2.63 ± 2.35 ± 2.67 ± width 0.354a 0.390b 0.479a 0.626b 0.493a 0.404b 0.426ab 0.621b Anther apical 0.70 ± 1.13 ± 0.68 ± 1.31 ± 0.94 ± 1.16 ± 1.04 ± 1.25 ± width 0.224a 0.162b 0.282a 0.240b 0.189a 0.242b 0.247ab 0.252b Anther basal 1.13 ± 1.17 ± 1.16 ± 1.45 ± 1.11 ± 1.16 ± 1.13 ± 1.20 ± width 0.234 0.174 0.183a 0.259b 0.112 0.136 0.162 0.248 Cont.
Table 6.1 (continued)
E AQL W AQL E HUR W HUR E DIL W DIL ALB LEU (N=33) (N=11) (N=15) (N=92) (N=30) (N=25) (N=30) (N=37) Lip maximum: 1.68 ± 1.44 ± 1.75 ± 1.72 ± 1.95 ± 2.28 ± 2.10 ± 2.27 ± minimum width 0.524a 0.320b 0.299 0.364 0.323 0.466 0.565 0.655 Lip:spur length 0.96 ± 1.24 ± 1.04 ± 1.25 ± 1.01 ± 1.11 ± 1.47 ± 0.70 ± 0.164a 0.140b 0.153a 0.269b 0.119a 0.146a 0.246c 0.173b Anther apical: 0.64 ± 0.97 ± 0.61 ± 0.91 ± 0.85 ± 1.00 ± 0.92 ± 1.05 ± basal width 0.228a 0.131b 0.285a 0.163b 0.144a 0.177b 0.173ab 0.183b Flower color Light green Light green Green Green-white White White White White Viscidium shape Orbicular Orbicular Oval Oval Short Short Oblong- Long
157 oblong oblong lanceolate oblong Stigma shape Rounded Rounded Pointed Pointed Pointed Pointed Pointed Pointed
158
Figure 6.1. Geographic locations of 61 populations sampled for morphometric analyses. N = 20 populations of Platanthera huronensis; N = 10 populations of Platanthera aquilonis; N = 31 populations of Platanthera dilatata.
P. dilatata var. dilatata P. aquilonis P. dilatata var. albiflora P. huronensis P. dilatata var. leucostachys Western populations indicated by darkened symbols
3
s A Axi C P 159 PCA Axis 2 PCA Axis PCA Axis 1
Figure 6.2. Plot of the first three axes from a principal components analysis of populations based on 15 morphological characters. The first three axes explain 78.8% of the variation and are weighted most strongly by lateral sepal length, lateral petal length, and lip length (axis 1); anther apical:basal width, dorsal sepal width, and lateral sepal width (axis 2); and lip maximum:minimum width, lip:spur length, and lip minimum width (axis 3).
var. dilatata var. leucostachys var. albiflora PCA Axis 3 PCA Axis 160
PCA Axis 2 PCA Axis PCA Axis 1
Figure 6.3. Plot of populations of white flowered individuals of Platanthera dilatata vars. dilatata, albiflora, and leucostachys on the first three axes produced from a principal components analysis based on 15 morphological characters. The first three axes explain 77.6% of the variation and are weighted most strongly by the lengths of the upper and lateral sepals and lip (axis 1); widths of the lip and lateral sepal (axis 2); and dorsal sepal width and anther widths (axis 3).
CHAPTER 7
A COMPARISON OF VARIATION AT INTER-SIMPLE SEQUENCE REPEAT
(ISSR) LOCI IN THE POLYPLOID PLATANTHERA HURONENSIS AND ITS
DIPLOID PROGENITORS, P. AQUILONIS AND P. DILATATA (ORCHIDACEAE)
7.1 INTRODUCTION
Polyploidy is a dynamic process and one that plays a major creative role in the evolution of plants (e.g., Levin 1983; Thompson and Lumaret 1992; Soltis and Soltis
1993, 2000; Otto and Whitton 2000). The evolutionary success of polyploidy in plants is thought to be due to shifts in morphology, breeding system, and physiology that enable newly formed polyploids to occupy broader ecological niches than their diploid progenitors (Stebbins 1950; Levin 1983; Soltis and Soltis 1993; 2000; Otto and Whitton
2000). For example, reproductive shifts, including asexual reproduction and the capacity for self-fertilization, may be especially important in the establishment of new polyploid species and could also be an effective reproductive barrier between a neopolyploid and its diploid progenitor(s). Underlying genetic structure also affects the success of newly formed polyploids. Many polyploids harbor more genetic variability than their diploid progenitors, perhaps due to genome rearrangements and recombination between parental genomes (Wendel 2000). Changes at the molecular level have been found to occur very rapidly in polyploids of wheat (Ozkan et al. 2001) and Brassica (Song et al. 1995).
161
Multiple origins from divergent parental genotypes and subsequent gene flow between
polyploids of different origin could also enhance genetic variability in polyploid species
and add an extra level of complexity to the process of polyploidization in plants.
Observable genetic changes that take place in polyploid species range from the
molecular level to the population level. Comparative studies of polyploid taxa and
closely related diploid taxa are likely to be the most informative for evaluating the
ecological and evolutionary significance of polyploidy. In this study, variation at inter-
simple sequence repeat (ISSR) loci is used to estimate genetic diversity and structure in
populations of an allopolyploid, Platanthera huronensis (Nuttall) Lindl. (Orchidaceae),
and its diploid progenitor species, Platanthera aquilonis Sheviak and Platanthera dilatata (Pursh) Lindley ex Beck. ISSR markers are dominant markers that represent regions between simple sequence repeat (SSR) regions that are amplified by the polymerase chain reaction (PCR). They are thought to be inherited in a Mendelian manner (Tsumara et al. 1996; Fang and Roose 1999), and show high levels of diversity in natural and cultivated species of plants (reviewed in Wolfe and Liston 1998).
Consequently, ISSR markers have been useful for systematic studies (e.g., Wolff and
Morgan-Richards 1998; Wolfe and Randle 2001), for documenting cases of interspecific hybridization (e.g., Wolfe et al. 1998a, 1998b), and for describing population genetic structure (e.g., Esselman et al. 1999; Ge and Sun 1999; Camacho and Liston 2001; Culley and Wolfe 2001; Kimball and Crawford 2001; Lutz 2001). Compared to other molecular markers, such as allozymes and random amplified polymorphic DNAs (RAPD), studies of ISSR variation in natural populations are sparse. Although some studies have compared variation using ISSRs to variation estimated from allozymes (e.g., Ge and Sun
162
1999; Culley and Wolfe 2001), very few studies have compared variation at ISSR loci
among closely related species. In this study, ISSR variation is compared across species
and ploidal levels and in the context of progenitor-derivative relationships among P.
aquilonis, P. dilatata, and P. huronensis.
Platanthera huronensis, P. aquilonis, and P. dilatata are included in section
Limnorchis, a taxonomically complex group within the genus Platanthera. Cytological
(Sheviak and Bracht 1998), morphological (Catling and Catling 1997; L. Wallace, unpubl. data), and molecular (L. Wallace, unpubl. data) markers support an allopolyploid origin of P. huronensis with P. aquilonis and P. dilatata as the most likely parental species. Platanthera huronensis is tetraploid (4n = 84) while most other species in the complex, including P. aquilonis and P. dilatata, are diploid (2n = 42).
The members of section Limnorchis are temperate terrestrial species with small
(1-2 cm wide) white or green flowers that may number in the hundreds on larger plants.
Species are morphologically distinguishable by several floral features, which appear to be related to differences in breeding systems and pollination syndromes. Both P. aquilonis and P. huronensis have greenish flowers; P. dilatata has white flowers. Floral features are generally smaller in P. huronensis than they are in P. dilatata, and larger than they are in P. aquilonis (Catling and Catling 1997; L. Wallace, unpubl. data). In both P. huronensis and P. dilatata, the stigma is pointed and rises up between divergent anther sacs. By contrast, the stigma of P. aquilonis is rounded and the anther sacs meet above the stigma. The shape of the viscidium, the sticky pad at the base of a pollinium, also differs among the three species. It is oblong in P. dilatata, oval in P. huronensis, and orbicular in P. aquilonis. These species also differ in whether they produce floral scents.
163
Platanthera dilatata and P. huronensis are fragrant, although they produce different
scents. Platanthera aquilonis is not known to be fragrant. The rounded, flattened stigma
facilitates autogamy in P. aquilonis (Gray 1862a, 1862b; Catling 1983, 1990; Sheviak
1999; Catling and Catling 1991; Reddoch and Reddoch1997), but flowers of this species
are also pollinated by mosquitoes and other small flies (Luer 1975). Platanthera dilatata
is pollinated by moths and butterflies (Gray 1862b; Kipping 1971; Boland 1993).
Platanthera huronensis is pollinated by moths, bees, and flies (Catling and Catling 1989),
but some populations of this species may also be autogamous (Reddoch and Reddoch
1997).
The species occupy mesic sites, including disturbed areas such as roadside ditches
and more pristine habitats such as fens, bogs, and woodlands. Populations of P.
huronensis are distributed in New England and adjacent Canada, across the Great Lakes
area, westward into California, and south to Colorado. The parental species and other
species in Section Limnorchis occupy areas within and beyond the range of P.
huronensis. Platanthera aquilonis extends into the arctic regions of Canada, westward
into Alaska, the Aleutian Islands, and possibly into Northeast Asia and the Southwestern
United States. Likewise, P. dilatata has a widespread distribution, but is not thought to
occur as far north as P. aquilonis.
7.2 MATERIALS AND METHODS
A total of 501 plants was sampled from seven populations of P. aquilonis, 14
populations of P. huronensis, and 10 populations of P. dilatata in eastern and western
North America (Table 7.1). Sample sizes ranged from seven to 20 individuals; in small
164
populations every individual was sampled. Voucher specimens are deposited at OS.
Leaf samples were kept on ice in the field and later stored at –80°C in the lab until DNA
was extracted. Total genomic DNA was extracted using a modification of the CTAB method (Doyle and Doyle 1987). Nine accessions representing the three species were surveyed for variation with 22 ISSR primers, and three primers that showed substantial levels of polymorphism and repeatable banding patterns were subsequently chosen to
assess genetic variation in all populations. The sequences for these primers are 5’
(AC)7RG 3’ for ISSR-1, 5’ (CT)8RG 3’ for ISSR-2; and 5’ (TC)6RG 3’ for ISSR-3.
Each 25 µL reaction contained 1X PCR buffer (20 mM Tris-HCl and 50 mM KCl;
Invitrogen, Carlsbad, CA USA), 200 µM of each dNTP, 1 mM MgCl2, 0.4 µM primer
(0.8 µM for ISSR-3; Sigma-Genosys, Spring, TX USA), 0.5 units of Taq DNA
polymerase (Invitrogen), and 0.3 µL template DNA. Template DNAs were not
quantified after extraction, but samples were tested in dilutions to determine an amount
that would give consistent results. A negative control, including all ingredients except
template DNA, was included with each set of reactions to detect contamination. All
reactions were amplified according to the following thermocycler program: 1 cycle of
94°C for 2.5 min; 35 cycles of 94°C for 40s, 46°C (ISSR-3), 47°C (ISSR-1), or 48°C
(ISSR-2) for 45 s, 72°C for 1.5 min; 1 cycle of 94°C for 45 s, 46°C, 47°C, or 48°C
(depending on the primer) for 45 s, 72°C for 7 min; indefinite soak at 4°C. Amplification
products were separated on 1.2% TAE agarose gels, stained with ethidium bromide, and
visualized with UV light. Images of gels were captured digitally for later analysis.
Duplicate reactions and gels were run for all primers and individuals. Non-replicated
bands were eliminated from the data set. Band homology was based on similarity of 165
molecular weight and occasionally band intensity. A 1 Kb Plus DNA ladder (Invitrogen)
was run on every gel as a size standard. Additionally, because of the large number of
individuals that were surveyed, bands suspected of being homologous were compared by
re-amplifying those individuals and running them side-by-side on a gel. Bands were
scored as present (1) or absent (0).
7.2.1 Data analysis
Because ISSR markers are dominant, heterozygous individuals cannot be
distinguished from individuals with a homozygous dominant genotype. In the absence of
genetic or other information on the breeding system of a species, one must assume that
these loci are bi-allelic and that populations are in Hardy-Weinberg equilibrium in order
to calculate allele frequencies and related measures of genetic diversity. The calculation
of the null allele is determined by the frequency of the absence of a band without regard
to the fact that the absence of band may not be a homologous condition across individuals in a population or species. Recent theoretical and empirical studies have suggested that if a sufficient number of polymorphic dominant loci are assayed, estimates of genetic diversity and heterozygosity based on allele frequencies should be largely concordant with estimates derived from allele frequencies at codominant markers (e.g., Krauss 2000;
Mariette et al. 2002).
Alternatively, phenotypic data from dominant markers can be analyzed strictly on the basis of band presence/absence. Phenotypic analyses reveal much less information about population genetic diversity and structure, but in some cases this method of analysis may be more appropriate because no assumptions are made concerning Hardy-
Weinberg equilibrium, breeding system, or the number of alleles at a locus. Although
166
breeding system has been studied to some degree in each of the three species considered in this study (Gray 1862a, 1862b; Catling and Catling 1989; Boland 1993), population genetic structure has not been examined with codominant markers, and little is known about the factors likely to be important in determining genetic structure in these species.
Thus, the approach taken in this paper is to analyze the ISSR data phenotypically (i.e., based on band presence/absence) and genotypically (i.e., based on allele frequencies).
For the genotypic analysis, allele frequencies and estimates of diversity were determined under the assumption of random mating in populations (i.e., FIS = 0) as well as complete
inbreeding in populations (i.e., FIS = 1). The data were checked for the presence of high
frequency bands according to the recommendation of Lynch and Milligan (1994).
However, no bands occurred so frequently in a species to warrant their exclusion from
the data set.
The total number of bands (NB) and the percentage of polymorphic loci (%P)
using a 95% criterion were determined for each population and each species. For the
phenotypic analysis, genetic diversity in populations and species was estimated from
2 2 Nei’s gene diversity index according to the following formula: HP = 1 – Pi – Qi
(Mariette et al. 2002). This estimate of diversity is based on the frequencies of band presence (Pi) or absence (Qi) in each population. Estimates of HP were calculated for
each locus, and the mean over all loci was used as to estimate diversity in populations
and species. For the genotypic analysis, allele frequencies were determined and
subsequently used to calculate Nei’s gene diversity according to the following formula:
2 2 HG = 1- pi – qi , where pi and qi represent the frequencies of the dominant and null
alleles, respectively. As for HP, diversity was estimated at each locus, and the estimates
167
reported for populations and species are mean values over all loci. Regardless of the
assumption of complete inbreeding or outcrossing, no differences in the estimates of
allele frequencies or HG were found with POPGENE (Yeh et al. 1997). Thus, estimates
of genotypic diversity will be reported from the analysis of allele frequencies calculated under the assumption of Hardy-Weinberg equilibrium and employing a bias correction
(i.e., implemented using a Taylor expansion) suggested by Lynch and Milligan (1994).
These analyses were carried out using TFPGA (Miller 1997).
Significant differences in the total number of bands per population, percentage of polymorphic loci, and the two estimates of Nei’s gene diversity (HG and HP) were
examined among the species using Kruskal-Wallis tests (Sokal and Rohlf 1995). When
overall differences were found, Dunn’s multiple comparisons tests (Zar 1996) were used to distinguish exactly where the differences existed. Additionally, the strength and
significance of relationships between the various measures of genetic diversity were
evaluated with Spearman’s rank correlation (Sokal and Rohlf 1995). Patterns of genetic
structure within each species were explored through an analysis of molecular variance
(AMOVA) performed in ARLEQUIN (Schneider et al. 2000). An AMOVA uses squared
Euclidean distances among individuals to partition the total variance into covariance
components according to intra-individual, inter-individual, and inter-population differences (Excoffier et al. 1992). The resulting variance components are subsequently
used to estimate variation among populations (ΦST).
Genetic distances were calculated between all pairs of populations using the
Manhattan distance measure in the program RAPDDIST (Black 1995). Relationships
among populations and species were explored in a dendrogram generated according to
168
the neighbor-joining (NJ) algorithm implemented in the NEIGHBOR program of
PHYLIP vers. 3.5c (Felsenstein, 1993). Tree support was estimated by bootstrapping in
the following manner: a set of 100 distance matrices was generated in RAPDDIST, a NJ
tree was constructed from each of the distance matrices in NEIGHBOR, and the program
CONSENSE (in PHYLIP) was used to generate a strict consensus tree. Bootstrap values
represent the number of times a group appeared in the 100 separate trees.
A relationship between geographic and genetic distance was evaluated using a
Mantel test of matrix correlation (Sokal and Rohlf 1995) for each of the species.
Geographic distances, measured in km, were log transformed before the analysis. Mantel
tests were carried out using NTSYS-pc (Rohlf 1998), and 9999 permutations of the data
sets were used in testing the significance of each correlation.
Four sets of sympatric populations are included in this survey. Two sets are of P.
dilatata and P. huronensis populations (K and V; H and R) and two sets are of P.
aquilonis and P. dilatata populations (G and N; and A, B, and J). Specific relationships
among individuals in each of these sets were explored in more detail using NJ analyses based on a distance coefficient derived from the similarity coefficient of Nei and Li
(1979). Inter-individual genetic distances were calculated using NTSYS-pc (Rohlf
1998), and NJ dendrograms were constructed with the program NEIGHBOR in PHYLIP
(Felsenstein 1993).
There is considerable debate concerning the number of dominant markers needed to provide robust estimates of genetic diversity within natural populations of plants. To further explore this issue in the three species included in this study, phenotypic diversity,
HP, was re-calculated using 5, 15, 30, 50, or n-1 loci (where n is the total number of loci
169
found in a species) for each population. Mean estimates of HP were calculated for each population from 10 replications of each set of loci used. In each replication, a unique set of loci was randomly chosen from the pool of loci found in each species. Significant differences in diversity estimates, corresponding to the use of different numbers of loci, were examined for each population using Kruskal-Wallis tests, and subsequently Dunn’s multiple comparisons tests when an overall significant result was found (Zar 1996).
7.3 RESULTS
Among the 29 populations surveyed, 95 bands were scored-- 32 from ISSR-1, 30 from ISSR-2, and 33 from ISSR-3. The greatest number of bands was found in P. huronensis (79), but P. dilatata had nearly as many with 73; 60 bands were found in populations of P. aquilonis. Twenty-two bands were exclusive to a single species, but generally occurred in low frequency (Pi < 0.13). Of these bands, 13 occurred in P.
huronensis and the remaining nine were found in P. dilatata. Platanthera aquilonis did
not exhibit any bands that were not also found in one of the other species. Eighteen
multilocus phenotypes are shared by two or more individuals in populations U (one
phenotype shared between two individuals) and Y (one phenotype shared between three individuals) of P. huronensis, population I of P. dilatata (one phenotype shared between
two individuals), and populations A (three phenotypes shared among 10 individuals), B
(three phenotypes shared among 13 individuals), D (two phenotypes shared among four
individuals), E (two haplotypes shared among 10 individuals), F (two phenotypes shared
among four individuals), and G (three phenotypes shared among 13 individuals) of P.
aquilonis. No multilocus phenotypes are shared between populations.
170
Populations of P. huronensis and P. dilatata exhibited similar levels of diversity, which were generally higher than the levels observed in populations of P. aquilonis.
Platanthera huronensis populations have significantly more bands per population than P. aquilonis while P. dilatata populations have a significantly higher incidence of polymorphic loci than populations of P. aquilonis (Table 7.1). Similar patterns were found for the other measures of genetic diversity as well. However, a significant difference was only found for HP between P. dilatata and P. aquilonis. It is notable that standard deviations for all measures of diversity are substantially greater in P. aquilonis compared to the other two species examined. Furthermore, disparity among populations contributes to higher species level diversity found in P. aquilonis compared to P. huronensis and P. dilatata. Estimates of diversity, measured by Nei’s method, are very similar within populations and species, regardless of whether allele frequencies or phenotypic frequencies are considered (Table 7.1). The difference between HP and HG ranged from 0 to 0.0398 across all populations. In 12 of the 31 populations, HP was
greater than HG. This trend was more common in P. dilatata than in either of the other
two species. All measures of diversity show positive and highly significant (P < 0.001) correlations (Table 7.2).
Most of the variation at ISSR loci in P. huronensis occurs within populations
((ΦST = 0.36; Table 7.3). Likewise, in P. dilatata, slightly more than half of the total
variation occurs within populations (ΦST = 0.49), but regional differences account for
more of the variation than the variance among populations (26.9% vs. 21.8%,
respectively; Table 7.3). In contrast, only 30% of the variation resides within populations
of P. aquilonis, and this pattern does not reflect strong regional differences (7% among 171
groups; Table 7.3). The regional differences found in P. dilatata are significant while
those in P. aquilonis are not significant.
Not surprisingly, genetic distances between conspecific populations are higher
than distances between heterospecific populations; this is a trend consistent in all three
species. Mean intraspecific distance is lowest in P. huronensis (0.112), followed by P.
dilatata (0.122) and P. aquilonis (0.139; Table 7.4). Populations of P. huronensis and P.
aquilonis are the least similar (mean distance = 0.198), while greatest interspecific similarity was observed between populations of P. huronensis and P. dilatata (mean distance = 0.169; Table 7.4). In the NJ analysis of populations based on genetic distances, populations of P. aquilonis tend to cluster together, and there is substantial support for this grouping with the exception of population B (Fig. 7.1). Populations of P. dilatata cluster together in two rather distinct groups, which correspond to eastern and western populations. The “eastern” group has moderately high bootstrap support (71%), but the western group, as a whole, is weakly supported. The most interesting pattern occurs in P. huronensis as populations do not represent a cohesive group nor is there a strong geographic pattern to the grouping of populations by molecular markers. For example, population R from Alaska forms the branch external to the large group of P. aquilonis and P. dilatata populations. Mantel tests largely support the patterns suggested by the NJ analysis as the correlation between geographic distance and genetic distance is moderately strong and significant only in P. dilatata (r = 0.77; P = 0.0004).
The NJ analysis of plants in sympatric populations show interesting patterns of relatedness among the individuals. In the two populations in which P. huronensis occurs with P. dilatata (Fig. 7.2a,b), conspecific individuals cluster together, but there is greater
172
variability among individuals of P. huronensis. For example, although individuals 16H
and 18H (Fig. 7.2a) cluster deeply within the P. huronensis group, the branch connecting
these individuals to the rest of the group suggests a substantial amount of divergence in
ISSR banding patterns. Likewise, although the branch lengths between the main P.
huronensis group and the cluster of 1H and 14H (Fig. 7.2a) are shorter than the branches
between P. dilatata and P. huronensis, these individuals are still quite distinct from other
P. huronensis individuals. The pattern in Figure 7.2b suggests that individuals of P. huronensis are more cohesive; branch lengths are shorter and the individuals cluster in
one of two main groups, with the exception of 4H, which is sister to the P. dilatata group.
In the two areas of sympatry in which P. dilatata and P. aquilonis were found,
these species are also quite distinct at ISSR loci. In populations G and N (Fig. 7.2c), P.
aquilonis is depicted as a cohesive group, which is strongly divergent from both of the
clusters containing P. dilatata. Although P. dilatata clusters in two distinct groups in the
tree, the branches within and between these groups are small and noticeably shorter than
branches within the P. aquilonis group. Perhaps the most interesting pattern is revealed
by the clustering patterns represented by individuals of populations A, B, and J (Fig.
7.2d). Not only are the species strongly divergent, the two populations of P. aquilonis
are also quite distinct. The tree indicates that population A (1A-20A) is more similar to
P. dilatata, but P. aquilonis plants in population B were intermixed with P. dilatata
plants of population J. The branch lengths among individuals of population B (21A-40A)
are remarkably small, indicating very little divergence in ISSR banding patterns among
these individuals.
173
The inability to distinguish dominant heterozygous genotypes from dominant homozygous genotypes is a disadvantage of dominant markers in the estimation of population genetic structure. Nonetheless, some authors have suggested that if many polymorphic dominant markers are assessed in a sufficient number of individuals,
reliable estimates of genetic diversity can be obtained (e.g., Mariette et al. 2002). The results of this study indicate that estimates of HP based on 15-30 loci are comparable to
estimates that are based on nearly all of the loci for P. dilatata and P. huronensis (Table
7.5). Although differences in diversity occur among populations within each of these
species, significant differences corresponding to the use of different numbers of loci were found in only two P. huronensis populations (X and W) and only when mean values with five loci are compared to mean values with additional loci. Estimates of HP did not differ
significantly regardless of the number of loci used in any population of P. dilatata, while
significant differences were found in all but one population of P. aquilonis (Table 7.5).
Many of the differences occurred between estimates based on 30 or fewer loci and 50 or more loci. Interlocus variance decreases with the inclusion of additional loci in the estimation of HP for all three species (Fig. 7.3).
7.4 DISCUSSION
7.4.1 Genetic variation in Platanthera aquilonis, P. dilatata, and P. huronensis
Increased, recombined, or novel genetic variation are expected outcomes of successful polyploidization events, and have even been discussed as principal reasons for the successful establishment of newly formed polyploids (e.g., Stebbins 1950).
Furthermore, multiple origins of polyploids and gene flow between populations of
174
separate origin are also expected to heighten variation in polyploid species (Soltis and
Soltis 1993; 2000). These theoretical expectations have been supported in numerous
empirical studies of natural polyploid populations (reviewed in Soltis and Soltis 1993).
The results of this study, however, do not provide compelling evidence to support this finding in P. huronensis. At the species level, P. huronensis is actually the least diverse of the three species examined. At the population level, though, P. huronensis has similar, albeit slightly lower, levels of ISSR variation to populations of P. dilatata, and populations of both of these species have higher levels of diversity compared to populations of P. aquilonis (Table 7.1). Platanthera huronensis populations exhibited higher levels of diversity than populations of the diploid species in only one measure, total number of bands. However, the difference was only significant between P. huronensis and P. aquilonis.
Variability in all of the diversity indices is greatest across populations of P. aquilonis, and this contributes to the high estimates of diversity observed at the species level. Genetic variability across populations of P. aquilonis is likewise reflected in the high estimate of population differentiation for this species (ΦST = 0.49; Table 7.3), which
indicates greater structure among populations than was found for either P. dilatata (ΦST =
0.49) or P. huronensis (ΦST = 0.36). Also, much less of the variation is accounted for by
differences between populations from eastern and western regions in P. aquilonis than in
P. dilatata, and the AMOVA indicates that the variance attributed to differences between
the two groups is not significant in P. aquilonis. These same patterns of differentiation
and diversity can also be seen in the NJ tree of populations (Fig. 7.1). For example,
strong regional differences exist in P. dilatata as eastern populations (I, J, M, and N) are 175
moderately supported as a cohesive group sister to the cluster of P. aquilonis populations.
The western populations of P. dilatata (H, K, L, O, P, and Q) also form a cohesive
cluster, albeit with little overall support, external to the group that contains P. aquilonis
and P. dilatata. Although the two western populations of P. aquilonis (D, E) do cluster together, there is very little support for this relationship. The populations of P.
huronensis cluster distantly from a moderately supported cluster containing only
populations of P. aquilonis and P. dilatata. Although there is reasonably good support for an allopolyploid origin of P. huronensis, other studies also indicated remarkable individuality in the genetic profiles of P. huronensis individuals relative to samples of P.
dilatata or P. aquilonis (L. Wallace, unpubl. data).
When observed variation has been less than expected, evolutionary events that
could influence or be influenced by the origin of the species, the distribution of
populations, and the breeding system have been considered in discussions of genetic
structure in polyploid taxa. For example, Shore (1991) suggested that founder events and
subsequent inbreeding could account for the significantly lower levels of polymorphic
loci and heterozygosity observed in tetraploid populations of Turnera ulmifolia var.
intermedia compared to diploid populations. Likewise, Baumel et al. (2001) invoked genetic bottlenecks at the time of formation, either from a unique origin or multiple origins from genetically similar parental types, to explain the lack of variation observed in Spartina anglica, an allopolyploid species. Although more variation was found in tetraploid populations of Centaurea jacea, the increase in diversity between ploidal levels was not as great as expected, and Hardy and Vekemans (2001) proposed that historical differences in population size, convergence of genetic diversity due to hybridization, and
176
a slow rate of reaching mutation-drift equilibrium could account for this pattern. Many
of the factors discussed in other species could also explain the patterns observed here.
Stochastic processes associated with the colonization history of populations can strongly influence the amount of diversity contained within a species. Populations that are founded by few individuals, subsequently receive few migrants, and remain small should have less genetic diversity than larger, more stable populations. Independent origins of populations and even individuals within populations have been reported for other polyploid species (reviewed in Soltis and Soltis 1993), but may not be particularly common in P. huronensis. Although high levels of genetic variability have been found at
ISSR and RAPD loci in populations of P. huronensis, a survey of chloroplast haplotypes in all of the populations included in this study, and based on variation in the rpl16 intron and the trnT-F intergenic spacer region, revealed an identical haplotype in all but three of the 72 individuals of P. huronensis that were surveyed (L. Wallace, unpubl. data). The most common haplotype found in P. huronensis was shared by only one other sample of
P. dilatata. In contrast, many haplotypes were found among populations of P. aquilonis and P. dilatata, and in many of the populations, multiple haplotypes were present. Two scenarios could account for the lower levels of variation observed in P. huronensis. First, a limited amount of variation is expected in the populations of P. huronensis surveyed in this study if they originated from a common ancestor. Second, P. aquilonis and P. dilatata may be inherently more diverse because they are older taxa, widely distributed, or affected differently by the creative forces of evolution compared to P. huronensis.
Phylogenetic relationships among taxa within section Limnorchis are not clear, but P. aquilonis and P. dilatata are the most morphologically variable species within this group
177
(Luer 1975). This variability seems to be mirrored by variation at the molecular level,
but additional studies of populations in areas not covered by this study are needed to
evaluate the full extent of genetic variability in all of these species.
Extensive reviews of the allozyme literature (e.g., Hamrick and Godt 1989, 1997)
have indicated that geographic range is most strongly correlated with diversity at the
species level and geographic range and breeding system together are strongly correlated
with variation in populations. Population differentiation is expected to be lowest in
species that are widely distributed, outcrossing, and have good dispersal capabilities.
Although estimates of FST are not directly comparable between allozymes and other molecular markers, theoretical expectations regarding how variation is partitioned should still hold if markers follow Mendelian properties and are not rapidly evolving. In a review of other temperate orchid species, Case (2002) found that mean GST, estimated
from allozyme data, was lower than mean estimates of GST in other flowering plant
species. Furthermore, in other studies of Platanthera species, where dominant markers
have been used, moderately low levels of population differentiation have been found.
Platanthera integrilabia and Platanthera leucophaea are animal-pollinated species with
small population sizes and restricted distributions. Population differentiation, estimated
from ΦST, was 0.21 for both species based on ISSR loci in P. integrilabia (Birchenko
2001) and RAPD loci in P. leucophaea (Wallace 2002), although AMOVA indicated
significant differentiation of populations in both studies. Based on the frequency and
widespread distributions of populations of P. aquilonis, P. dilatata, and P. huronensis
throughout much of western North America and the capacity for long-distance seed
dispersal, populations are not expected to be strongly differentiated in any of the species
178
considered here. Although most of the variation does reside within populations of P. dilatata and P. aquilonis (Table 7.3), populations of P. huronensis were still more
strongly differentiated than either P. integrilabia or P. leucophaea. In P. dilatata, a
larger portion of the variation residing outside of populations is due to regional
differences, and this pattern is also apparent in the NJ tree (Fig. 7.1). The pattern of
genetic structure in P. aquilonis is interesting because more than twice as much variation
exists among populations of this species, and regional differences make a minor, non-
significant contribution.
These results would seem to suggest that despite the potential for widespread gene
flow among populations, genetic consequences of inter-population exchange may not be
visible over the long term. Stochastic changes related to the life history of orchids could
also influence the maintenance of genetic variation within and among populations.
Because orchid seeds are dust-like, they are capable of founding new, genetically isolated
populations far from a source population. The capacity for long-distance dispersal has
been suggested by some authors as a means of facilitating the rapid evolution of new taxa
in the family (e.g., Dodson and Gillespie 1967; Dressler 1993). Genetic differentiation
among populations is expected to increase as loci are randomly lost in populations due to
genetic drift. High rates of population turnover can substantially affect estimates of
population differentiation (Slatkin 1977; Wade and McCauley 1988; Whitlock and
McCauley 1990; McCauley et al. 1995) because founder events usually involve few
colonizers and the finite life of individual populations reduces the time over which
subsequent gene flow can counter genetic differences associated with the initial founding
event. Because many populations of P. aquilonis, P. dilatata, and P. huronensis occur in
179
transient habitats, genetic drift is also likely to play a central role in how genetic variation
is created and maintained in these species. That there is variability in estimates of
variation across populations, which does not seem to be correlated with differences in
population size, also suggests a difference in how populations have experienced and
responded to evolutionary changes at the level of individual loci and on the whole
genome. Additionally, individuals within populations tend to be more similar to other
individuals in the same population than to individuals from other populations. This suggests that many of these populations are founded by one or a few individuals, few migrants travel between populations, or natural selection acts within populations to homogenize them. Most ISSR markers, though, are expected to be in non-coding regions and therefore not directly affected by natural selection (Wolfe and Liston 1998).
Differences in breeding system may also aid in explaining the observed differences in levels and structure of genetic variation at the population level. Variation at ISSR loci could be introduced into populations by mutation or migration of seeds and pollen. Gene flow via pollen may be more extensive in P. dilatata and P. huronensis
because these species are primarily outcrossing. Increased gene flow through seeds and
pollen would tend to reduce differentiation among populations while genetic
recombination through sexual reproduction would promote variability within populations.
In contrast, if selfing is common in P. aquilonis populations, this should limit genetic
recombination and pollen-mediated gene flow. Estimates of diversity are much more
variable across populations of P. aquilonis, as indicated by measures of standard deviation. This is an interesting result that may reflect different degrees of outcrossing or
selfing in populations of P. aquilonis.
180
Although all five measures of diversity considered here are strongly correlated, they still do not provide a complete picture of genetic variability in these species. In the
238 individuals of P. huronensis examined, only two multilocus phenotypes are shared between four individuals; in both instances the phenotype was shared between individuals within a population. Likewise, only one multilocus phenotype was shared by two individuals in one P. dilatata population. By contrast, 15 shared phenotypes were found in P. aquilonis, although shared phenotypes were only found within populations.
The presence of individual-specific bands largely distinguishes individuals of P. huronensis and P. dilatata, but these low frequency bands are not expected to contribute substantially to global indices of polymorphic loci (especially reported at a 95% criterion as in this study), or Nei’s gene diversity.
Alternative explanations related to the nature of the ISSR loci in estimating population structure could also help to explain the patterns of genetic differentiation observed in this study. The evolution of ISSR loci occurs as a result of divergence in one or both priming sites, loss of a SSR site, or chromosomal structural rearrangement (Wolfe and Liston 1998). Although ISSR markers are generally believed to conform to
Mendelian inheritance, studies have found some cases in which they display non-
Mendelian characteristics from generation to generation. Tsumara et al. (1996) found 3 of the 77 bands studied departed from Mendelian expectations. Additionally, Fang and
Roose (1999) found that 22.9% of the 223 ISSR fragments they examined in hybrids of
Citrus x Poncirus deviated significantly from Mendelian expectations, and this proportion was similar to the deviations they observed for RFLP and microsatellite markers in the same crosses. Bands that are scored and included in the estimation of ΦST
181
and are not passed between generations or capable of moving between populations (e.g., somatic mutations in non-reproductive organs) should be reflected in increased estimates of differentiation among populations. Additionally, simple sequence repeats, which serve as the priming sites for ISSR markers are known to have a high rate of gaining and losing
repeat units due to DNA slippage (Schlötterer 1998). Extensive variation at ISSR loci has even been found in species not suspected of experiencing high levels of sexual reproduction or outcrossing. For example, extensive variability at ISSR loci was found in
Botrychium pumicola despite the fact that reproduction is primarily asexual by means of gemmae (Camacho and Liston 2001; Table 7.6). As this example illustrates, rapid mutation rates and subsequent gains and losses of ISSR priming sites could also result in increased divergence among populations.
Differences in estimates of phenotypic diversity were not strongly influenced by the number of loci used in the calculation of HP for P. dilatata and P. huronensis (Table
7.5). Significant differences in HP corresponding to differences in the number of loci used
in the calculation were found in only two populations of P. huronensis, and the
differences exist between estimates of HP based on five or 15 loci and 30 or more loci.
This result is not surprising given the large interlocus variance that exists when fewer numbers of loci are considered (Fig. 7.3). The pattern of differences in HP is not the
same across populations, and in most cases standard deviations of the means are greater
in populations of P. aquilonis than in populations of P. huronensis or P. dilatata. This
pattern seems to reflect the disparity in banding patterns that occur across populations of
P. aquilonis, and that are also indicated by the high level of differentiation observed in this species (ΦST = 0.69; Table 7.3). Because P. aquilonis populations exhibit strong
182
differences in the bands that are present, estimation of gene diversity in any one
population is strongly affected by the loci that are included. Many replications occurred
in which several loci were chosen but a band was not present in a population, resulting in
an estimate of no variation in the population. Although the differences become non-
significant between 50 loci and 59 loci, significant differences between 30 and 50 loci in
some populations suggest that diversity may not have been adequately estimated in this
species using 60 loci. Because more bands were evenly distributed across populations of
P. dilatata and P. huronensis, strong differences in HP generally were not observed across loci for these species. These results suggest that both the number of loci used and the variance across loci are important factors to consider when estimating genetic diversity with dominant markers. When there is strong differentiation among populations, more loci will provide more robust estimates of diversity (Mariette et al.
2002).
7.4.2 Comparisons to other species
Surveys of population genetic diversity and structure are most informative when comparisons are made between closely related species (Gitzendanner and Soltis 2000) as well as across measures of diversity that have been calculated in similar ways (e.g.,
Culley et al. 2002). Unlike the monumental reviews of allozyme diversity by Hamrick and Godt (1989; 1997), few generalizations can be made regarding diversity at dominant marker loci because estimation and reporting of diversity based on these markers vary widely across studies, and fewer studies of dominant markers have been published.
Consequently, comparisons to other studies can easily be misleading and must be interpreted with caution. In Table 7.6, estimates of diversity based on dominant markers
183
(ISSR, AFLP, and RAPD) have been compiled from the recent literature. Most apparent
from this table is the finding that measures of diversity, including the percentage of
polymorphic loci and gene diversity, vary considerably across species and with the type of marker that was used. Diversity is generally higher in outcrossing species or species with a mixed mating system compared to selfing and asexual species, and the various indices of diversity generally show similar trends. One exception is Aegiceras corniculatum, an animal-pollinated species for which little variation was found at ISSR loci, and also at allozyme loci (Ge and Sun 1999). The authors suggested that founder effects and low polymorphism in the ancestral population account for the low levels of diversity they observed compared to estimates in other woody plants with mixed or outcrossed mating systems.
Like the Platanthera species studied here, the percentage of polymorphic loci in most of the species in Table 7.6 increases substantially from the population level to the species level, regardless of the mating system. Mean population estimates of the percentage of polymorphic loci in P. aquilonis, P. dilatata, and P. huronensis are low in comparison to estimates from most other species in Table 7.6. However, the difference may simply be in the way this measure has been determined. The estimates of percentage of polymorphic loci in this study are conservatively based on a 95% criterion, but if all loci are considered, the number of polymorphic loci is considerably higher in most populations. Estimates of HG in P. aquilonis, P. dilatata, and P. huronensis are within the ranges found in most other species. Average estimates of H based on RAPD markers
(Nybom and Bartish 2000) appear to be higher than estimates from ISSR or AFLP studies
184
in species with outcrossing or mixed mating systems, but this pattern may simply reflect
a difference in the numbers of studies employing each marker or the species examined.
Like measures of genetic diversity, structure within a species is also influenced by
the type and number of markers employed, the method of analysis, and recent and
historical evolutionary changes in the populations being surveyed. Many studies
employing dominant markers have found concordance between estimates of population
differentiation estimated from phenotypic and allelic frequencies (e.g, Gaudeul et al.
2000; Nybom and Bartish 2000; Shim and Jorgensen 2000; Camacho and Liston 2001;
Wallace 2002). Perhaps, this is evidence that dominant data can yield robust estimates of
population differentiation. However, estimators of FST based on dominant data cannot be
interpreted on the same scale as that used for allozymes due to many of the same
problems in estimating levels of diversity discussed above. Estimates of population
structure based on RAPD markers tend to be higher than estimates of FST or GST derived
from allozyme markers for species with a given life history trait (compare Nybom and
Bartish 2000 with Hamrick and Godt 1989, 1997). Whether this is an artifact of the higher level of diversity observed with many dominant markers or a true biological phenomenon is not always apparent. Many more studies of genetic variation estimated from various types of dominant markers are needed before the utility and accuracy that these markers provide for revealing evolutionarily significant genetic variation in natural
populations can be adequately evaluated.
7.4.3 Genetic patterns in areas of sympatry
Hybridization can play an important creative force in the evolution of plant taxa
(e.g., Abbott 1992; Rieseberg and Wendel 1993; Soltis and Soltis 1993; Arnold 1997).
185
Hybrid zones involving contact between diploid and polyploid taxa are particularly interesting because they bring an extra level of complexity to the dynamic process of polyploidization. For example, gene flow across ploidal levels through semi-fertile hybrids between diploids and polyploids is expected to increase genetic diversity in polyploids. Triploids between diploids and polyploids can successfully serve as a bridge between ploidal levels or can act to reproductively isolate diploids and polyploids.
Hybrid zones between ploidal levels can result from primary or secondary contact
(reviewed in Petit et al. 1999). Primary zones occur when a newly formed polyploid emerges within a diploid population. Secondary zones occur as a result of contact between diploid and polyploid populations that were once geographically separated. In secondary zones, diploid and polyploid populations might exhibit fixed genetic differences as a result of having different evolutionary histories. Hybridization in secondary zones has not frequently been observed between allopolyploids and their diploid progenitors, but primary zones have been reported in allopolyploid complexes of relatively recent origin (reviewed in Soltis and Soltis 1993).
Interspecific hybridization is thought to occur frequently in section Limnorchis
(Schrenk 1978), but the evolutionary significance of hybridization has not been fully investigated in the group. Obviously, hybridization has been important in the evolution of P. huronensis. Because P. huronensis often occurs sympatrically with one or both of its diploid parental species, inter-ploidal hybridization may be an important factor in the genetic structure of this species.
Twelve of the populations surveyed occur in sympatry with another species, and four complete sets are included (Table 7.1). Upon visiting the populations, no flowering
186
individuals appeared to be of hybrid origin, but morphological and molecular characters are not always correlated in hybrids (reviewed in Rieseberg and Ellstrand 1993).
Obviously, the identification of hybrid individuals should not be based entirely on patterns depicted in scatter plots or cluster diagrams, but the results of such analyses can be useful indicators of unique patterns that warrant further investigation. In such diagrams, first generation hybrids are expected to cluster between individuals that represent the “pure” parental forms, but the clustering patterns of later generation hybrids can be skewed towards individuals of one of the parental taxa (Jensen and Eshbaugh
1976a, 1976b; Rieseberg and Ellstrand 1993).
The overall patterns depicted in the NJ tress do not provide clear and convincing evidence of interspecific hybridization in the individuals that were sampled in sympatry in this study (Figs. 7.2a-7.2d). All four NJ trees indicate clearly that the species are quite distinct from one another. Nevertheless, some clusters in some of the diagrams are disparate enough that they are worth mentioning. For example, although populations V of P. huronensis and K of P. dilatata are clearly distinguished in the tree (Fig. 7.2a), there is a substantial amount of variability among P. huronensis samples. Specifically, samples 1H, 14H, 16H, and 18H stand out apart from other P. huronensis individuals.
Although these individuals contain some bands that are not found in other individuals from this population, they are not strongly divergent compared to samples of P. huronensis from other populations. Thus, these individuals may be migrants from other populations. A similar pattern occurs between P. aquilonis (population G) and P. dilatata (population N) in Figure 7.2c. The samples of P. aquilonis form a more cohesive group than the samples of P. dilatata, but the branches within and between the two
187
groups of P. dilatata are shorter than branches within the P. aquilonis group. In Figure
7.2d, the degree of separation among the species and populations is striking. The closer similarity of population A to population J is especially surprising given that plants in
population B were found completely intermixed with the plants in population J, and both
were flowering at the same time.
Better indications of interspecific gene flow can be obtained if population-specific
or species-specific markers are found in individuals of the other species. Inspection and comparison of unique and fixed bands in each of the sympatric sets did indicate specific instances that might have resulted from interspecific hybridization in two of the sets of
sympatric populations. Between populations H and R, two bands have distinctive
patterns. One band amplified from ISSR-3 is found in all but one of the P. huronensis
individuals and five of the P. dilatata individuals, but this band is not common among other populations of these species. Another band amplified by ISSR-2 is monomorphic
in population H and in all but one of the individuals of population R. This band is
common among other populations of P. dilatata, but generally infrequent in P.
huronensis. Among populations A, B, and J, several bands have notable frequencies.
Two bands occur in all samples of P. dilatata (J) and of P. aquilonis in population B, but
are entirely absent from P. aquilonis in population A. One additional band shows a
similar pattern in populations B and J, but was also found in five of the individuals in
population A. All three of these bands are common in other populations of P. dilatata,
but are infrequent among other P. aquilonis populations. Similarly, three bands that are fixed (or nearly so) in populations A and B were also found in population J, but are generally infrequent in P. dilatata at the species level. Lastly, one frequent, although not
188
fixed, band in population B was not found in any other populations of P. aquilonis, but
was present in nine of the P. dilatata individuals in population J.
Given the genetic similarity of these species (Table 7.4) and the widespread accounts of interspecific hybridization in section Limnorchis (e.g., Luer 1975; Case
1987), it is surprising that greater evidence of interspecific hybridization was not found.
However, other studies of polyploid complexes have also not found overwhelming
evidence of hybridization in areas of secondary contact. For example, despite
widespread accounts of hybridization in the Dactylorhiza incarnate/maculata complex,
Hedrén (2001) failed to find a substantial number of hybrids in areas of contact between
diploids and polyploids. Additionally, Baumel et al. (2001) found no evidence of hybrids
in a mixed population of the allopolyploid Spartina anglica and one of its diploid
progenitors, Spartina maritima. The potential for hybridization among P. aquilonis, P.
dilatata, and P. huronensis is great because populations do often occur together, the
species flower at the same time, and many of the same types of pollinators are attracted to
the flowers of different species. Autogamous pollination in P. aquilonis may limit
hybridization involving this species if flowers are unavailable to pollinators, however.
Additionally, sterile triploids could severely limit introgression between ploidal levels.
In Centaurea jacea, Hardy and Vekemans (2001) found no allozyme evidence of gene flow between diploid and polyploid individuals in contact zones, and additional studies involving artificial crosses confirmed that sterile triploids create a strong post-zygotic isolating mechanism between diploids and tetraploids (Hardy et al. 2001).
Much of the diversity in cultivated orchids has resulted from hybridization between congeneric species and even between species in different genera. While there is
189
great potential for widespread hybridization in orchids, the prevalence and importance of hybrids in natural species and populations have rarely been discussed. The taxonomic complexity of section Limnorchis makes it an interesting focus of studies on evolutionary processes at the population level. These data indicate that interspecific hybridization may occur between diploids and polyploids and additional molecular studies using better diagnostic markers and ecological studies are needed to fully evaluate the importance of hybridization among the species examined. Studies that shed light on prezygotic and postzygotic barriers to hybridization as well as ecological, morphological, and genetic mechanisms that promote and prevent interspecific hybridization should prove to be particularly interesting for understanding evolutionary diversification in Orchidaceae.
190
Population Location N NB %P HG HP
Platanthera aquilonis A* Aroostook Co., ME 20 19 23.3 0.089 0.049 B* Arrostook Co., ME 20 25 11.7 0.038 0.030 C Marquette Co., MI 12 16 15.0 0.061 0.061 D Flathead Co., MT 7 17 13.3 0.065 0.097 E Flathead Co., MT 12 36 43.3 0.152 0.130 F Essex Co., NY 20 20 16.7 0.042 0.036 G* Caledonia Co., VT 20 31 35.0 0139 0.150
Platanthera dilatata H* Fairbanks, AK 12 44 42.5 0.167 0.178 I Ontario, Canada 8 24 23.3 0.087 0.074 J* Aroostook Co., ME 20 33 37.0 0.145 0.112 K* Park Co., MT 12 36 31.5 0.112 0.125 L Ravalli Co., MT 10 32 37.0 0.151 0.151 M Herkimer Co., NY 20 35 37.0 0.136 0.122 N* Caledonia Co., VT 20 34 37.0 0.126 0.124 O Fremont Co., WY 20 41 43.8 0.141 0.161 P Sublette Co., WY 20 28 35.6 0.125 0.125 Q Sublette Co., WY 10 32 28.8 0.122 0.136
Platanthera huronensis R* Fairbanks, AK 12 29 22.8 0.099 0.092 S Carbon Co., MT 15 30 19.0 0.077 0.063 T Carbon Co., MT 15 34 27.8 0.113 0.088 U Carbon Co., MT 14 31 22.8 0.094 0.103 V* Park Co., MT 20 42 46.8 0.160 0.163 W Wallowa Co., OR 20 32 27.8 0.102 0.095 X Fremont Co., WY 20 43 44.3 0.147 0.138 Cont.
Table 7.1. Population names, locations, sample sizes (N), and estimates of genetic diversity based on ISSR bands. Populations occurring sympatrically with another species of Platanthera are indicated by asterisks. NB: total number of bands observed in a population; %P: percentage of polymorphic loci – 95% criterion; HG: Nei’s genetic diversity based on allele frequencies; HP: Nei’s genetic diversity based on phenotypic frequencies. Mean (± 1 SD) population and species level estimates of diversity are also reported. Significant differences in NB, %P, and HP among the three species are indicated by unlike letters superscripted after mean population level estimates of these three variables (P < 0.05; nonparametric Dunn’s multiple comparisons tests).
191
Table 7.1 (continued)
Population Location N NB %P HG HP
Y Park Co., WY 20 36 26.6 0.096 0.072 Z Park Co., WY 20 43 48.1 0.158 0.154 AA Sublette Co., WY 19 40 35.4 0.132 0.122 AB Teton Co., WY 7 32 26.6 0.094 0.102 AC Teton Co., WY 20 39 34.2 0.124 0.118 AD Teton Co., WY 14 48 40.5 0.155 0.165 AE Teton Co., WY 20 38 34.2 0.118 0.121
P. aquilonis Mean population 23.4 22.6 0.084 0.079 ± 7.59a ± 12.13a ± 0.046 ± 0.047a Species 60 61.7 0.184 0.263 P. dilatata Mean population 33.9 35.3 0.126 0.131 ± 5.76a,b ± 6.12b ± 0.022 ± 0.029b Species 73 57.5 0.182 0.228 P. huronensis Mean population 36.9 32.6 0.115 0.114 ± 5.82b ± 9.41a,b ± 0.027 ± 0.032a,b Species 79 43.0 0.172 0.187
192
NB %P HG %P 0.81
HG 0.78 0.96
HP 0.73 0.87 0.90
Table 7.2. Spearman’s rank correlations between five measures of genetic diversity: the number of bands per population (NB), percentage of polymorphic loci (%P), Nei’s gene diversity based on allele frequencies (HG), and Nei’s gene diversity based on phenotypic frequencies (HP). All correlations are significant at P < 0.001.
193
Source of variation df Sum of squares % Variation P-value Platanthera aquilonis Among groups 1 80.45 7.01 0.281 Among populations 5 432.42 62.44 <0.001 Within populations 104 260.96 30.55 Total 110 773.83 Platanthera dilatata Among groups 1 240.86 26.68 0.003 Among populations 8 295.67 21.77 <0.001 Within populations 142 725.72 51.55 Total 151 1262.24 Platanthera huronensis Among populations 13 660.41 36.34 <0.001 Within populations 223 1066.48 63.66 Total 236 1726.89
Table 7.3. Results from an analysis of molecular variance performed on each of the species, Platanthera dilatata, P. huronensis, and P. aquilonis. Population differentiation (Φst) is represented by the combined percentage of variation occurring among groups and among populations.
194
P. aquilonis P. dilatata P. huronensis
P. aquilonis 0.139
P. dilatata 0.173 0.122
P. huronensis 0.198 0.169 0.112
Table 7.4. Mean genetic distances within and between populations of Platanthera aquilonis, P. dilatata, and P. huronensis.
195
Population 5 loci 15 loci 30 loci 50 loci n-1 loci
A 0.053a 0.045a 0.067b 0.051a,b 0.049a,b B 0.022a 0.029a 0.031a 0.130b 0.129b C 0.056a 0.088a 0.078b 0.063a,b 0.062a,b D 0.055a 0.075a,b 0.072a 0.101b 0.098b E 0.121a 0.127a 0.109a 0.026b 0.029b F 0.040 0.040 0.046 0.035 0.037 G 0.212a,b 0.192a,b 0.202a 0.154b 0.151b H 0.177 0.170 0.190 0.179 0.177 I 0.066 0.071 0.077 0.073 0.074 J 0.124 0.114 0.129 0.116 0.111 K 0.119 0.122 0.113 0.119 0.125 L 0.116 0.139 0.141 0.149 0.150 M 0.145 0.127 0.141 0.121 0.122 N 0.127 0.127 0.138 0.128 0.123 O 0.178 0.112 0.153 0.169 0.161 P 0.153 0.107 0.130 0.118 0.125 Q 0.098 0.138 0.143 0.138 0.136 R 0.095 0.073 0.102 0.098 0.093 S 0.085 0.073 0.063 0.060 0.063 T 0.097 0.090 0.759 0.093 0.087 U 0.131 0.110 0.086 0.107 0.103 V 0.187 0.156 0.158 0.160 0.162 W 0.138a 0.115a,b 0.083b 0.095a,b 0.095a,b X 0.190a 0.163a 0.126b 0.134a,b 0.137a,b Y 0.081 0.081 0.077 0.070 0.071 Z 0.198 0.163 0.149 0.158 0.153 AA 0.145 0.140 0.113 0.122 0.122 AB 0.139 0105 0.107 0.105 0.102 AC 0.134 0.118 0.101 0.113 0.118 AD 0.160 0.183 0.161 0.165 0.164 AE 0.176 0.140 0.130 0.116 0.120
Table 7.5. Mean estimates of Nei’s H calculated from phenotypic frequencies based on 10 replications of 5, 15, 30, 50, or n-1 (n = the total number of loci for a species) loci used in the calculation of HP. Population names follow those in Table 7.1. Estimates found to differ from one another within a population are indicated by superscripted unlike letters (P < 0.05; nonparametric Nemenyi’s tests).
196
Species Reproduction %Pp %Psp Hp Hsp Structure Reference
ISSR studies Alliaria petiolata Mixed 0.77c Meekins et al., 2001 (Brassicaceae) Kochia scoparia Outcrossing 0.31 0.35 0.09a; 0.10c Mengistu and Messersmith, 2002 (Chenopodiaceae) Gaulthera fragrantissima Unknown 55 0.17 Deshpande et al., 2001 (Ericaceae) Monarda fistulosa var. Outcrossing 61 0.11 0.38d Kimball et al., 2001 fistulosa (Lamiaceae) Monarda fistulosa var. brevis Outcrossing 74 0.13 0.34d Kimball et al., 2001 197 (Lamiaceae) a Aegiceras corniculatum Outcrossing 7 16 0.03 0.04 0.18 Ge and Sun, 1999 (Myrsinaceae) Botrychium pumicola Sexual/ clonal 42 0.14 0.11a; 0.09b Camacho and Liston, 2001 (Ophioglossaceae) Platanthera integrilabia Outcrossing/ 0.21c Birchenko, 2001 (Orchidaceae) selfing Cont.
Table 7.6. Comparison of genetic diversity estimated from ISSR, AFLP, and RAPD data in the literature. Reported are estimates for percent of polymorphic loci (%P), gene diversity (H), and population differentiation (Structure). Subscript “p” refers to a population level estimate; subscript “sp” refers to a species level estimate. For RAPD studies, mean estimates of diversity for various life history traits are from a recent review by Nybom and Bartish (2000). aGst estimated from allele frequencies; assuming random mating; bGst estimated from allele frequencies, assuming non-random mating; cΦst estimated from AMOVA; dStructure estimated from Shannon-Weaver diversity based on band presence/absence
Table 7.6 (continued)
Species Reproduction %Pp %Psp Hp Hsp Structure Reference
Calamagrostis porteri ssp. Clonal 24 Esselman et al., 1999 inseparata (Poaceae) Oryza cultivars (Poaceae) Outcrossing 92 0.68 Davierwala et al., 2000 Oryza granulata (Poaceae) Clonal 18 46 0.84c Qian et al., 2001 Psammochloa villosa Clonal/selfing 15 70 0.87c Li and Ge, 2001 (Poaceae) Penstemon caryi Outcrossing 76 0.24c Lutz, 2001 (Scrophulariaceae) Symplocos laurina Unknown 84 0.15 0.24 0.46a Deshpande et al., 2001 198 (Symplocaceae) Eurya nitida (Theaceae) Dioecious 49 0.18 Deshpande et al., 2001 Viola pubescens (Violaceae) Mixed 77 100 Culley and Wolfe, 2001 AFLP studies Daucus carota (Apiaceae) Outcrossing 0.41 0.41a; 0.45c Shim and Jorgensen, 2000 a c Eryngium alpinum Mixed 54 0.20 0.42 ; 0.43 ; Gaudeul et al., 2000 (Apiaceae) 0.44d Astragalus cremnophylax Mixed 17 0.06 0.63c Travis et al., 1996 var. cremnophylax (Fabaceae) Calycophyllum spruceanum Outcrossing 0.28 0.09c Russell et al., 1999 (Rubiaceae) Cont.
Table 7.6 (continued)
Species Reproduction %Pp %Psp Hp Hsp Structure Reference
c Pedicularis palustris Outcrossing 64 0.49 Schmidt and Jensen, 2000 (Scophulariaceae) RAPD studies Long-lived perennial 0.24 0.23a; 0.25c Nybom and Bartish, 2000 Widespread distribution 0.21 0.33a; 0.42c Self mating system 0.09 0.59a; 0.70c Mixed mating system 0.22 0.19a; 0.27c Outcrossing mating system 0.26 0.23a; 0.28c Wind dispersed seeds 0.26 0.23a; 0.25c
199
T U W Y
S 78 AC HURONENSIS X AA
98 AD
Z V R I 71 M 90 DILATATA 7 J N B 100 F
C 60 D 64 AQUILONIS 7 E 51 G A L
H 79 O DILATATA 87 P 5 K
Q
AB HURONENSIS AE
Figure 7.1. Unrooted strict consensus phylogram of populations of Platanthera aquilonis, P. dilatata, and P. huronensis based on a neighbor-joining analysis of 96 ISSR loci. Population names follow those in Table 1. Bootstrap support values >50% based on 100 replications are reported above branches.
200
Figure 7.2. Unrooted phylograms based on neighbor-joining analyses of ISSR banding patterns of individuals in each of the four sets of sympatric populations. A: Platanthera dilatata (pop. K) and P. huronensis (pop. V); B: P. dilatata (pop. H) and P. huronensis (pop. R); C: P. aquilonis (pop. G) and P. dilatata (pop. N); D: P. aquilonis (pops. A and B) and P. dilatata (pop. J). Individuals are identified by a number and the first letter of the species to which they belong. A = P. aquilonis; D = P. dilatata; H = P. huronensis.
201
Fig. 7.2
10H 12H (A) 2H (B) 6H 8H 11H 4H 7H 3H 6H 7H 5H 9H 1H 18H 3H 16H 15H 11H 20H 12H 8H 9H 2H 10H 19H
202 4H 5H 20D 17H 13H 12D 19D 3D 21D 7D 22D 2D 23D 1D 24D 6D 17D 9D 18D 8D 5D 16D 4D 0.1 13D 11D 14D 10D 15D 1H 0.1 14H Cont.
Fig 7.2 (continued) 47D 32D 31D 1D 21D 11D (D) 18D 18D 23D 16D 34D 43D 19D 37D 15D 26D (C) 16D 13D 11D 9D 14D 46D 12D 14D 28D 1D 30D 3D 2D 4D 10D 20D 39D 41A 9A
203 8A 43A 11A 47A 17A 57A 18A 59A 4A 44A 15A 42A 1A 46A 3A 62A 2A 55A 7A16 45A 20A 54A 38A 5A 64A 35A 23A 56A 5A 22A 51A 42A 19A 48A 41A 13A 6A 21A 52A 40A 10A 49A 13A 68A 27A 66A 9A 4A 17D 8A 5D 7A 7D 25A 10D 44A 0.1 8D 19A 12A 6D 0.1 3A 2D 45A 48A
.02
.01 Interlocus variance
0.00 5 loci 15 loci 30 loci 50 loci N-1 loci
Number of loci
Figure 7.3. Number of loci used to calculate phenotypic diversity compared against the variance in estimates of diversity across loci for populations of Platanthera aquilonis, P. dilatata, and P. huronensis.
204
LIST OF REFERENCES
Abbott, R. J. 1992. Plant invasions, interspecific hybridization, and the evolution of new plant taxa. Trends in Ecology and Evolution 7: 401-404.
Ackerman, J. D., and A. M. Montalvo. 1990. Short- and long-term limitations to fruit production in a tropical orchid. Ecology 71: 263-272.
Ackerman, J. D., and J. C. Montero Oliver. 1985. Reproductive biology of Oncidium variegatum: moon phases, pollination, and fruit set. American Orchid Society Bulletin 54: 326-329.
Adams, R.P. and L. H. Rieseberg. 1998. The effects of non-homology in RAPD bands on similarity and multivariate statistical ordination in Brassica and Helianthus. Theoretical and Applied Genetics 97: 323-326.
Ågren, J. 1996. Population size, pollinator limitation, and seed set in the self- incompatible herb Lythrum salicaria. Ecology 77: 1779-1790.
Alexandersson, R., and J. Ågren. 2000. Genetic structure in the nonrewarding, bumblebee-pollinated orchid Calypso bulbosa. Heredity 85: 401-409.
Allnutt T. R., A. C. Newton, A. Lara, A. Premoli, J. J. Armesto, R. Vergara, and M. Gardner. 1999. Genetic variation in Fitzroya cupressoides (alerce), a threatened South American conifer. Molecular Ecology 8: 975-987.
Ames, O. 1910. Orchidaceae: Illustrations and studies of the family Orchidaceae Vol. IV: The genus Habenaria in North America. Merrymount Press, Boston, MA, USA.
Amos, W. and A. Balmford. 2001. When does conservation genetics matter? Heredity 87: 257-265.
Arft, A. M. and T. A. Ranker. 1998. Allopolyploid origin and population genetics of the rare orchid Spiranthes diluvialis. American Journal of Botany 85: 110-122.
205
Arnheim, N. 1983. Concerted evolution of multigene families. Pp. 38-61 in Evolution of Genes and Gene Proteins, eds. M. Nei and R. K. Koehn. Sinauer Associates, Sunderland, Massachusetts, USA.
Arnold, M. L. 1997. Natural Hybridization and Evolution. Oxford University Press, Oxford, UK.
Baldwin, B. G., M. J. Sanderson, J. M. Porter, M. F. Wojciechowski, C. S. Campbell, and M. J. Donoghue. 1995. The ITS region of nuclear ribosomal DNA: a valuable source of evidence on angiosperm phylogeny. Annals of the Missouri Botanical Garden 82: 247-277.
Barrett, S. C. H. and D. Charlesworth. 1991. Effects of a change in the level of inbreeding on the genetic load. Nature 352: 522-524.
Barrett, S. C. H. and J. R. Kohn. 1991. Genetic and evolutionary consequences of small population size in plants: Implications for conservation. Pp. 3-30 in Genetics and Conservation of Rare Plants, eds. D. A. Falk and K. E. Holsinger. Oxford University Press, Oxford, UK.
Bateman, R. M., A. M. Pridgeon, and M. W. Chase. 1997. Phylogenetics of subtribe Orchidinae (Orchidoideae, Orchidaceae) based on nuclear ITS sequences. 2. Infrageneric relationships and reclassification to achieve monophyly of Orchis sensu stricto. Lindleyana 12: 113-141.
Baumel, A., M. L. Ainouche, and J. E. Levasseur. 2001. Molecular investigations in populations of Spartina anglica C. E. Hubbard (Poaceae) invading coastal Brittany (France). Molecular Ecology 10: 1689-1701.
Berry, R. J. 1971. Conservation aspects of the genetical constitution of populations. Pp. 177-206 in The Scientific Management of Animal and Plant Communities for Conservation, eds. E. Duffey and A. S. Watt. Blackwell Scientific, Oxford, UK.
Birchenko, I. V. 2001. Genetic diversity and microsite characterization of the rare “Monkeyface orchid”, Platanthera integrilabia (Orchidaceae), in the southeastern United States. M.S. thesis, Ohio University, Athens, Ohio, USA.
Black, W. C. 1995. FORTRAN programs for the analysis of RAPD-PCR markers in populations. Colorado State University, Ft. Collins, Colorado, USA.
Boland, J. T. 1993. The floral biology of Platanthera dilatata (Pursh.) Lindl. (Orchidaceae). M.S. thesis, Memorial University of Newfoundland, St. John’s, Newfoundland, Canada.
206
Booy G., R. J. J. Hendriks, M. J. M. Smulders, J. M. Van Groenendael, and B. Vosman. 2000. Genetic diversity and the survival of populations. Plant Biology 2: 379-395.
Borba, E. L., J. Semir, and G. J. Shepherd. 2001. Self-incompatability, inbreeding depression and crossing potential in five Brazilian Pleurothallis (Orchidaceae) species. Annals of Botany 88: 89-99.
Bowles, M. L. 1983. The tallgrass prairie orchids Platanthera leucophaea (Nutt.) Lindl. and Cypripedium candidum Muhl. ex Willd.: Some aspects of their status, biology, and ecology, and implications toward management. Natural Areas Journal 3: 14-37.
Bowles, M. L., R. Flakne, and R. Dombeck. 1992. Status and population fluctuations of the eastern prairie fringed orchid [Platanthera leucophaea (Nutt.) Lindl.] in Illinois. Erigenia (Illinois Native Plant Society Bulletin) 12: 26-40.
Bowles, M. L., K., A. Jacobs, L. W. Zettler, and T. W. Delaney. 2002. Crossing effects on seed viability and experimental germination of the federal threatened Platanthera leucophaea (Orchidaceae). Rhodora 104: 14-30.
Boyce, M. S. 1992. Population viability analysis. Annual Review of Ecology and Systematics 23: 481-506.
Bremer, K. 1988. The limits of amino acid sequence data in angiosperm phylogenetic reconstruction. Evolution 42: 795-803.
Brochmann, C., T. Nilsson, and T. M. Gabrielsen. 1996. A classic example of postglacial allopolyploid speciation re-examined using RAPD markers and nucleotide sequences: Saxifraga osloensis (Saxifragaceae). Symbolae Botanicae Upsaliensis 31: 75-89.
Brochmann, C., Q. Xiang, S. J. Brunsfeld, D. E. Soltis, and P. S. Soltis. 1998. Molecular evidence for polyploid origins in Saxifraga (Saxifragaceae): the narrow Arctic endemic S. svalbardensis and its widespread allies. American Journal of Botany 85: 135-143.
Brownell V.R. 1984. Status report on the prairie white fringed orchid Platanthera leucophaea: A rare species in Canada. Unpublished report to the Canadian government.
Bullini, L., R. Cianchi, P. Arduino, L. De Bonis, M. C. Mosco, A. Verardi, D. Porretta, B. Corrias, and W. Rossi. 2001. Molecular evidence for allopolyploid speciation and a single origin of the western Mediterranean orchid Dactylorhiza insularis (Orchidaceae). Biological Journal of the Linnaean Society 72: 193-201.
207
Bussell, J.D. 1999. The distribution of random amplified polymorphic DNA (RAPD) diversity amongst populations of Isotoma petraea (Lobeliaceae). Molecular Ecology 8: 775-789.
Byers, D. L. and D. M. Waller. 1999. Do plant populations purge their genetic load? Effects of population size and mating history on inbreeding depression. Annual Review of Ecology and Systematics 30: 479-513.
Calvo, R. N. 1993. Evolutionary demography of orchids: intensity and frequency of pollination and the cost of fruiting. Ecology 74: 1033-1042.
Camacho, F. J. and A. Liston. 2001. Population structure and genetic diversity of Botrychium pumicola (Ophioglossaceae) based on inter-simple sequence repeats (ISSR). American Journal of Botany 88: 1065-1070.
Campbell, D. R., N. M. Waser, M. V. Price, E. A. Lynch, and R. J. Mitchell. 1991. Components of phenotypic selection: pollen export and flower corolla width in Ipomopsis aggregata. Evolution 45: 1458-1467.
Cardoso, M. A., J. Provan, W. Powell, P. C. G. Ferreiras, and D. E. de Oliveira. 1998. High genetic differentiation among remnant populations of the endangered Caesalpinia echinata Lam. (Leguminosae-Caesalpinioideae). Molecular Ecology 7: 601-608.
Case, F. W. Jr. 1987. Orchids of the Western Great Lakes Region. Cranbrook Institute of Science Bulletin 48, Bloomfield Hills, Michigan, USA.
Case, F. W. Jr. and R. B. Case. 1990. Habitat survey, population census, and management suggestions for the endangered white-fringed orchid (Platanthera leucophaea) in Michigan. Unpublished report to the Michigan Department of Natural Resources.
Case, M. A. 2002. Evolutionary patterns in Cypripedium: inferences from allozyme analyses. Pp. 192-202 in Proceedings of the 16th World Orchid Conference, eds. J. Clark, W. M. Elliott, G. Tingley, and J. Biro. Vancouver Orchid Society, Richmond, British Columbia, Canada.
Catling, P. M. 1983. Autogamy in eastern Canadian Orchidaceae: a review of current knowledge and some new observations. Le Naturaliste Canadien 110: 37-53.
Catling, P. M. 1990. Auto-pollination in the Orchidaceae. Pp. 121-158 in Orchid Biology: Reviews and Perspectives, V, ed J Arditti. Timber Press, Portland, Oregon, USA.
Catling, P. M. and V. R. Catling. 1989. Observations of the pollination of Platanthera huronensis in southwest Colorado. Lindleyana 4: 78-84.
208
Catling, P. M. and V. R. Catling. 1991. A synopsis of breeding systems and pollination in North American orchids. Lindleyana 6: 187-210.
Catling, P. M. and V. R. Catling. 1997. Morphological discrimination of Platanthera huronensis in the Canadian Rocky Mountains. Lindleyana 12: 72-78.
Chang, S. B., W. H. Chen, H. H. Chen, Y. M. Fu, and Y. S. Lin. 2000. RFLP and inheritance patterns of chloroplast DNA in intergeneric hybrids of Phalaenopsis and Doritis. Botanical Bulletin of Academia Sinica 41: 219-223.
Charlesworth, D. and B. Charlesworth. 1987. Inbreeding depression and its evolutionary consequences. Annual Review of Ecology and Systematics 18: 237-268.
Chase, M. W., M. Van Der Bank, D. Devey, and M. Fay. 2002. Nuclear ribosomal DNA sequences and the evolution of multiple lineages of allotetraploids in Dactylorhiza (Orchidaceae). Meeting abstract, Botany 2002 Conference, Madison, Wisconsin, USA.
Cheng, Y. P., C. T. Chien, and T. P. Lin. 2000. Population genetics of geographically restricted and widespread species of Myrica (Myricaceae). Journal of Heredity 91: 61-66.
Clausen, J., D. D. Keck, and W. M. Hiesey. 1945. Experimental studies on the nature of species. II. Plant evolution through amphiploidy and autoploidy, with examples from the Madiinae. Publication 564. Carneige Institute of Washington, Washington, D.C., USA.
Cook, L. M., P. S. Soltis, S. J. Brunsfeld, and D. E. Soltis. 1998. Multiple independent formations of Tragopogon tetraploids (Asteraceae): evidence from RAPD markers. Molecular Ecology 7: 1293-1302.
Correll, D. S. 1950. Native Orchids of North America North of Mexico. Chronica Botanica, Waltham, MA, USA.
Cowden, N. F. F. 1993. A biosystematic Study of Platanthera ciliaris, P. blephariglottis, and P. x bicolor, emphasizing the northern portion of their range. Ph.D. dissertation, Miami University, Oxford, Ohio, USA.
Crandall, K.A., O. R. P. Bininda-Edmonds, G. M. Mace, and R. K. Wayne. 2000. Considering evolutionary processes in conservation biology. Trends in Ecology and Evolution 15: 290-295.
Crawford, D. J. 1990. Plant Molecular Systematics, Macromolecular Approaches. John Wiley and Sons, NY, USA.
209
Crawford, D. J., T. F. Stuessy, D. W. Haines, M. B. Cosner, D. Weins, and P. Lopez. 1994. Lactoris fernandeziana on the Juan Fernandez Islands: Allozyme uniformity and field observations. Conservation Biology 8: 277-280.
Cronberg, N. 2000. Genetic diversity of the epiphytic bryophyte Leucodon sciuroides in formerly glaciated versus non-glaciated parts of Europe. Heredity 84: 710-720.
Cruden, R. W. 1976. Pollen-ovule ratios: a conservative indicator of breeding systems in flowering plants. Evolution 31: 32-46.
Culley, T. M. and A. D. Wolfe. 2001. Population genetic structure of the cleistogamous plant species Viola pubescens Aiton (Violaceae), as indicated by allozyme and ISSR molecular markers. Heredity 86: 545-56.
Culley, T. M., L. E. Wallace, K. M. Gengler-Nowak, and D. J. Crawford. 2002. A comparison of two methods of calculating GST, a genetic measure of population differentiation. American Journal of Botany 89: 460-465.
Curtis, J. T. 1939. The relation of specificity of orchid mycorrhizal fungi to the problem of symbiosis. American Journal of Botany 26: 390-399.
Cuthrell, D. L. 1994. Insects associated with the prairie fringed orchids, Platanthera praeclara Sheviak and Bowles and P. leucophaea (Nuttall) Lindley. M.S. thesis, North Dakota State University, Fargo, North Dakota, USA.
Darwin, C. R. 1877. The Various Contrivances by which Orchids are Fertilised by Insects, 2nd ed. D. Appleton and Company, New York, New York, USA.
Davierwala, A. P., K. V. Chowdari, S. Kumar, A. P. K. Reddy, P. K. Ranjekar, and V. S. Gupta. 2000. Use of three different marker systems to estimate genetic diversity of Indian elite rice varieties. Genetica 108: 269-284.
del Castillo, R. F. 1994. Factors influencing the genetic structure of Phacelia dubia, a species with a seed bank and large fluctuations in population size. Heredity 72: 446-458.
Deshpande, A. U., G. S. Apte, R. A. Bahulikar, M. D. Lagu, B. G. Kulkarni, H. S. Suresh, N. P. Singh, M. K. V. Rao, V. S. Gupta, A. Pant, and R. K. Ranjekar. 2001. Genetic diversity across natural populations of three montane plant species from the Western Ghats, India revealed by intersimple sequence repeats. Molecular Ecology 10: 2397-2408.
deWet, J. M. J. 1980. Origins of polyploids. Pp. 3-15 in Polyploidy: Biological Relevance, ed. W. H. Lewis. Plenum Press, New York, New York, USA.
210
Dodson, C. H. and R. J. Gillespie. 1967. The Biology of Orchids. Mid-America Congress, Pensacola, Florida, USA.
Doyle, J. J. and J. L. Doyle. 1987. A rapid DNA isolation procedure for small amounts of fresh leaf tissue. Phytochemical Bulletin 19: 11-15.
Dressler R. L. 1993. Phylogeny and classification of the orchid family. Dioscorides Press, Portland, Oregon, USA.
Dudash, M. R. 1990. Relative fitness of selfed and outcrossed progeny in a self- compatible protandrous species, Sabatia angularis L. (Gentianaceae): a comparison in three environments. Evolution 44: 1129-1139.
Eckert, C. G. and S. C. H. Barrett. 1994. Inbreeding depression in the partially self- fertilizing Decodon verticillatus (Lythraceae): population genetic and experimental analyses. Evolution 48: 952-964.
Ellstrand, N. C. and D. R. Elam. 1993. Population genetic consequences of small population size: Implications for plant conservation. Annual Review of Ecology and Systematics 24: 217-242.
Ennos, R. A. 1989. Detection and measurement of selection: Genetic and ecological approaches. Pp. 200-214 in Plant Population Genetics, Breeding, and Genetic Resources, eds. A. H. D. Brown, M. T. Clegg, A. L. Kahler, and B. S. Weir. Sinauer, Sunderland, Massachusetts, USA.
Epling, C., H. Lewis, and F. M. Ball. 1960. The breeding group and seed storage: A study in population dynamics. Evolution 14: 238-255.
Esselman, E. J., D. J. Crawford, S. Brauner, T. F. Stuessy, G. J. Anderson, and O. M. Silva. 2000. RAPD marker diversity within and divergence among species of Dendroseris (Asteraceae: Lactuceae). American Journal of Botany 87: 591-596.
Esselman, E. J., L. Jianqiang, D. J. Crawford, J. L. Windus, and A. D. Wolfe. 1999. Clonal diversity in the rare Calamagrostis porteri spp. inseparata (Poaceae): comparative results for allozymes, and random amplified polymorphic DNA (RAPD) and intersimple sequence repeat (ISSR) markers. Molecular Ecology 8: 443-451.
Excoffier, L., P. E. Smouse, and J. M. Quattro. 1992. Analysis of molecular variance inferred from metric distances among DNA haplotypes: application to human mitochrondrial DNA restriction data. Genetics 131: 479-491.
Fang, D. Q. and M. L. Roose. 1999. Inheritance of inter-simple sequence repeat markers in citrus. The Journal of Heredity 90: 247-248.
211
Felsenstein, J. 1993. PHYLIP, vers. 3.5c. Distributed by the author. Department of Genetics, University of Washington, Seattle, Washington, USA.
Fernald, M. L. 1950. Gray’s Manual of Botany, 8th ed. D. Van Nostrand Co., New York, New York, USA.
Fischer, M. and D. Matthies. 1997. Mating structure and inbreeding and outbreeding depression in the rare plant Gentianella germanica (Gentianaceae). American Journal of Botany 84: 1685-1692.
Frankham, R. 1995a. Effective population size/adult population size ratios in wildlife: A review. Genetical Research 66: 95-107.
Frankham, R. 1995b. Inbreeding and extinction: a threshold effect. Conservation Biology 9: 792-799.
Garay, L. A. 1972. On the origin of the Orchidaceae, II. Journal of the Arnold Arboretum 53:202-215.
Gaudeul, M., P. Taberlet, and I. Till-Bottraud. 2000. Genetic diversity in an endangered alpine plant, Eryngium alpinum L. (Apiaceae), inferred from amplified fragment length polymorphism markers. Molecular Ecology 9: 1625-1637.
Gaut, B. S., L. P. Tredway, C. Kubik, R. L. Gaut, and W. Meyer. 2000. Phylogenetic relationships and genetic diversity among members of the Festuca-Lolium complex (Poaceae) based on ITS sequence data. Plant Systematics and Evolution 224: 33-53.
Ge, X. J. and M. Sun. 1999. Reproductive biology and genetic diversity of a cryptoviviparous mangrove Aegiceras corniculatum (Myrsinaceae) using allozyme and intersimple sequence repeat (ISSR) analysis. Molecular Ecology 8: 2061-2069.
Gillies, A. C. M., C. Navarro, A. J. Lowe, A. C. Newton, M. Hernandez, J. Wilson, and J. P. Cornelius. 1999. Genetic diversity in Mesoamerican populations of mahogany (Swietenia macrophylla), assessed using RAPDs. Heredity 83: 722-732.
Gitzendanner, M. A. and P. S. Soltis. 2000. Patterns of genetic variation in rare and widespread congeners. American Journal of Botany 87: 783-792.
Gleason, H. A. and A. Cronquist. 1991. Manual of Vascular Plants of Northeastern United States and Adjacent Canada, 2nd ed. The New York Botanical Garden, New York, New York, USA.
212
Grant, V. 1981. Plant Speciation, 2nd ed. Columbia University Press, New York, New York, USA.
Gray, A. 1862. Enumeration of the plants of Dr. Parry’s collection in the Rocky Mountains. The American Journal of Science and Arts 2(34): 249-261.
Gray, A. 1862b. Fertilization of orchids through the agency of insects. The American Journal of Science and Arts 2: 420-429.
Groom, M. J. and T. E. Preuninger. 2000. Population type can influence the magnitude of inbreeding depression in Clarkia concinna (Onagraceae). Evolutionary Ecology 14: 155-180.
Hamrick, J. L. and M. J. W. Godt. 1989. Allozyme diversity in plant species. Pp. 43-63 in Plant Population Genetics, Breeding, and Genetic Resources, eds. A. H. D. Brown, M. T. Clegg, A. L. Kahler, and B. S. Weir. Sinauer, Sunderland, Massachusetts, USA.
Hamrick, J. L. and M. J. W. Godt. 1997. Effects of life history traits on genetic diversity in plant species. Pp. 102-118 in Plant Life Histories: Ecology, Phylogeny, and Evolution, eds. J. Silvertown, M. Franco, and J. L. Harper. Cambridge University Press, Cambridge, UK.
Hanson, R. E., M. N. Islam-Faridi, E. A. Percival, C. F. Crane, Y. Ji, T. D. McKnight, D. M. Stelly, and H. J. Price. 1996. Distribution of 5S and 18S-26S rDNA loci in a tetraploid cotton (Gossypium hirsutum L.) and its putative diploid ancestors. Chromosoma 105: 55-61.
Hapeman, J. R. and K. Inoue. 1997. Plant-pollinator interactions and floral radiation in Platanthera (Orchidaceae). Pp. 433-454 in Molecular Evolution and Adaptive Radiation, eds. T. J. Givnish and K. J. Sytsma. Cambridge University Press, Cambridge, UK.
Hardy, O. J. and X. Vekemans. 2001. Patterns of allozyme variation in diploid and tetraploid Centaurea jacea at different spatial scales. Evolution 55: 943-954.
Hardy, O. J., M. De Loose, X. Vekemans, and P. Meerts. 2001. Allozyme segregation and intercytotype reproductive barriers in the polyploid complex Centaurea jacea. Heredity 87: 136-145.
Hartl, D. L. and A. G. Clark. 1997. Principles of Population Genetics. Sinauer, Sunderland, Massachusetts, USA.
213
Havens, K. and A. Buerkle. 1999. A population genetic analysis of Platanthera leucophaea in northeastern Illinois. Unpublished report to the U.S. Fish and Wildlife Service, Region 3, Fort Snelling, Minnesota, USA.
Hedrén, M. 2001. Systematics of the Dactylorhiza euxina/incarnata/maculate polyploid complex (Orchidaceae) in Turkey: evidence from allozyme data. Plant Systematics and Evolution 229: 23-44.
Hedrén, M., E. Klein, and H. Teppner. 2000. Evolution of polyploids in the European orchid genus Nigritella: evidence from allozyme data. Phyton 40: 239-275.
Hedrén, M., M. F. Fay, and M. W. Chase. 2001. Amplified fragment length polymorphisms AFLP) reveal details of polyploid evolution in Dactylorhiza (Orchidaceae). American Journal of Botany 88: 1868-1880.
Hedrick, P. W. 1992. Genetic conservation in captive populations and endangered species. Pp. 45-68 in Applied Population Biology, eds. S. Kain and L. W. Botsford. Kluwer Academic Publishers, Dordrecht, The Netherlands.
Hillis, D., C. Moritz, C. Porter, and R. Baker. 1991. Evidence for biased gene conversion in concerted evolution of ribosomal DNA. Science 251: 308-310.
Hodges, S. A. and M. L. Arnold. 1995. Spurring plant diversification: are floral nectar spurs a key innovation? Proceedings of the Royal Society of London B 262: 343- 348.
Holsinger, K. E. 1988. Inbreeding depression doesn’t matter: the genetic basis of mating- system evolution. Evolution 42: 1235-1244.
Holsinger, K. E. 2000. Reproductive systems and evolution in vascular plants. Proceedings of the National Academy of Sciences, USA 97: 7037-7042.
Holsinger, K. E. and P. Vitt. 1997. The future of conservation biology: What’s a geneticist to do? Pp. 202-216 in The Ecological Basis of Conservation, eds. S. T. A. Pickett, R. S. Ostfeld, M. Shachak, and G. E. Likens. Chapman and Hall, New York, New York, USA.
Huenneke, L. F. 1991. Ecological implications of genetic variation in plant populations. Pp. 31-44 in Genetics and Conservation of Rare Plants, eds. D. A. Falk and K. E. Holsinger. Oxford University Press, New York, New York, USA.
Husband, B. C. and D. W. Schemske. 1996. Evolution of the magnitude and timing of inbreeding depression in plants. Evolution 50: 54-70.
214
Hutchinson, D. W. and A. R. Templeton. 1999. Correlation of pairwise genetic and geographic distance measures: Inferring the relative influences of gene flow and drift on the distribution of genetic variability. Evolution 53: 1898-1914.
Inoue, K. 1983. Systematics of the genus Platanthera (Orchidaceae) in Japan and adjacent regions with special reference to pollination. Journal of the Faculty of Science of the University of Tokyo, Section III, Botany 13(3): 285-374.
Jennersten, O. and S. G. Nilsson. 1993. Insect flower visitation frequency and seed production in relation to patch size of Viscaria vulgans (Caryophyllaceae). Oikos 68: 283-292.
Jensen, R. J., and W. H. Eshbaugh. 1976a. Numerical taxonomic studies of hybridization in Quercus. I. Populations of restricted aerial distribution and low taxonomic diversity. Systematic Botany 1: 1-10.
Jensen, R. J. and W. H. Eshbaugh. 1976b. Numerical taxonomic studies of hybridization in Quercus. II. Populations with wide aerial distributions and high taxonomic diversity. Systematic Botany 1: 11-19.
Johnston, M. O. 1992. Effects of cross and self-fertilization on progeny fitness in Lobelia cardinalis and L. siphilitica. Evolution 46: 688-702.
Johnson, S. D. 1994. Evidence for Batesian mimicry in a butterfly pollinated orchid. Biological Journal of the Linnaean Society 53: 9-104.
Johnson, S. D. and L. A. Nilsson. 1999. Pollen carryover, geitonogamy, and the evolution of deceptive pollination systems in orchids. Ecology 80: 2607-2619.
Jordan, W. C., M. W. Courtney, and J. E. Neigel. 1996. Low levels of intraspecific genetic variation at a rapidly evolving chloroplast DNA locus in North American duckweeds (Lemnaceae). American Journal of Botany 83: 430-439.
Karron, J. D. 1987. A comparison of levels of genetic polymorphism and self- compatibility in geographically restricted and widespread plant congeners. Evolutionary Ecology 1: 47-58.
Kearns, C. A. and D. W. Inouye. 1997. Pollinators, flowering plants, and conservation biology. Much remains to be learned about pollinators and plants. Bioscience 47: 297-307.
Kimball, R. T., D. J. Crawford, J. R. Page, and P. J. Harmon. 2001. Inter-simple sequence repeat (ISSR) diversity within Monarda fistulosa var. brevis (Lamiaceae) and divergence between var. fistulosa in West Virginia. Brittonia 53: 511-518.
215
Kimura, M. and G. H. Weiss. 1964. The stepping-stone model of population structure and the decrease of genetic correlation with distance. Genetics 49: 561-576.
Kipping, J. L. 1971. Pollination studies of native orchids. M.A. thesis, San Francisco State College, San Francisco, California, USA.
Kraenzlin, F. 1893. Beitraege zur einer monographie der gattung Habenaria. Botanische Jahrbücher für Systematic, Pflanzengeshichte und Pflanzengeographie 16: 52- 223.
Krauss, S. L. 2000. Accurate gene diversity estimates from amplified fragment length polymorphism (AFLP) markers. Molecular Ecology 9: 1241-1245.
Kull, T. 1998. Fruit-set and recruitment in populations of Cypripedium calceolus L. in Estonia. Botanical Journal of the Linnean Society 126: 27-38.
Kunin, W.E. 1997. Population size and density effects in pollination: Pollinator foraging and plant reproductive success in experimental arrays of Brassica kaber. Journal of Ecology 85: 225-234.
Lande R. and G. F. Barrowclough. 1987. Effective population size, genetic variation, and their use in population management. Pp. 87-124 in Viable Populations for Conservation, ed. M. E. Soulé. Cambridge University Press, Cambridge, UK.
Lande, R. and D. W. Schemske. 1985. The evolution of self-fertilization and inbreeding depression in plants. I. Genetic models. Evolution 39: 24-40.
Leitch, I. J. and M. D. Bennett. 1997. Polyploidy in angiosperms. Trends in Plant Science 2: 470-476.
Les, D. H., D. J. Crawford, E. Landolt, J. D. Gabel, and R. T. Kimball. 2002. Phylogeny and systematics of Lemnaceae, the duckweed family. Systematic Botany 27: 221- 240.
Lesica, P. 1993. Using plant community diversity in reserve design for pothole prairie on the Blackfeet Indian Reservation, Montana, USA. Biological Conservation 65: 69-75.
Levin, D. A. 1983. Polyploidy and novelty in flowering plants. The American Naturalist 122: 1-25.
Lewis, P. O. and D. Zaykin. 2001. Genetic Data Analysis: Computer program for the analysis of allelic data. Version 1.0 (d16c). Free program distributed by the authors over the internet from http://lewis.eeb.uconn.edu/lewishome/software.html
216
Lewontin, R. C. 1972. The apportionment of human diversity. Evolutionary Biology 6: 381-398.
Li, A. and S. Ge. 2001. Genetic variation and clonal diversity of Psammachloa villosa (Poaceae) detected by ISSR markers. Annals of Botany 87: 585-590.
Light, M. H. S. and M. MacConaill. 1998. Factors affecting germinable seed yield in Cypripedium calceolus var. pubescens (Willd.) Correll and Epipactis helleborine (L.) Crantz (Orchidaceae). Botanical Journal of the Linnean Society 126: 3-26.
Lindley, J. 1840. The Genera and Species of Orchidaceous Plants. Ridgways, Piccadilly, London, UK.
Linhart, Y. B. and J. A. Mendenhall. 1977. Pollen dispersal by hawkmoths in a Lindenia rivalis Benth. population in Belize. Biotropica 9: 143.
Loew, S. S. 2000. Role of genetics in conservation biology. Pp. 226-258 in Quantitative Methods for Conservation Biology, eds. S. Ferson and M. Burgman. Springer- Verlag, New York, New York, USA.
Lowe, A. J., A. C. M. Gillies, J. Wilson, and K. Dawson. 2000. Conservation genetics of bush mango from central/west Africa: Implications from random amplified polymorphic DNA analysis. Molecular Ecology 9: 831-841.
Luer, C. A. 1975. The Native Orchids of the United States and Canada, Excluding Florida. New York Botanical Garden, New York, USA.
Lutz, A. 2001. Patterns of genetic diversity in Penstemon caryi Pennel. (Scrophulariaceae S.L.), an endemic to limestone substrates. M.S. Thesis, The Ohio State University, Columbus, Ohio, USA.
Luyt, R. and S. D. Johnson. 2001. Hawkmoth pollination of the African epiphytic orchid Mystacidium venosum, with special reference to flower and pollen longevity. Plant Systematics and Evolution 228: 49-62.
Lynch, M. and B. G. Milligan. 1994. Analysis of population genetic structure with RAPD markers. Molecular Ecology 3: 91-99.
Maad, J. 2000. Phenotypic selection in hawkmoth-pollinated Platanthera bifolia: targets and fitness surfaces. Evolution 54: 112-123.
Maguire, T.L. and M. Sedgley. 1997. Genetic diversity in Banksia and Dryandra (Proteaceae) with emphasis on Banksia cuneata, a rare and endangered species. Heredity 79: 394-401.
217
Maluszynska, J. and J. S. Heslop-Harrison. 1993. Physical mapping of rDNA loci in Brassica species. Genome 36: 774-781.
Mariette, S., V. Le Corre, F. Austerlitz, and A. Kremer. 2002. Sampling within the genome for measuring within-population diversity: trade-offs between markers. Molecular Ecology 11: 1145-1156.
Martín, C., M. E. González-Benito, and J. M. Iriondo. 1997. Genetic diversity within and among populations of a threatened species: Erodium paularense Fern. Gonz. & Izco. Molecular Ecology 6: 813-820.
Martín, C., M. E. González-Benito M.E., and J. M. Iriondo. 1999. The use of genetic markers in the identification and characterization of three recently discovered populations of a threatened plant species. Molecular Ecology 8: S31-S40.
Masterson, J. 1994. Stomatal size in fossil plants: evidence for polyploidy in majority of angiosperms. Science 264: 421-423.
McCauley, D. E., J. Raveill, and J. Antonovics. 1995. Local founding events as determinants of genetic structure in a plant metapopulation. Heredity 75: 630-636.
Meekins, J. F., H. E. Ballard, and B. C. McCarthy. 2001. Genetic variation and molecular biogeography of a North American invasive plant species (Alliaria petiolata, Brassicaceae). International Journal of Plant Sciences 162: 161-169.
Melendez-Ackerman, E. J. and J. D. Ackerman. 2001. Density-dependent variation in reproductive success in a terrestrial orchid. Plant Systematics and Evolution 227: 27-36.
Menges, E. S. 1992. Stochastic modeling of extinction in plant populations. Pp. 253-275 in Conservation Biology: The Theory and Practice of Nature Conservation, Preservation, and Management, eds. P. L. Fiedler and S. K. Jain. Chapman and Hall, New York, New York, USA.
Mengistu, L. W. and C. G. Messersmith. 2002. Genetic diversity of kochia. Weed Science 50: 498-503.
Miller, M. P. 1997. TFPGA (Tools for population genetic analysis): a Windows program for the analysis of allozyme and molecular population genetic data. Department of Fisheries and Wildlife, Utah State University, Logan, Utah, USA. Available free at http://bioweb.usu.edu/mpmbio/index.htm.
Milligan, B. G., J. Leebens-Mack, and A. E. Strand. 1994. Conservation genetics: Beyond the maintenance of marker diversity. Molecular Ecology 3: 423-435.
218
Mills, S. L. and P. Smouse. 1994. Demographic consequences of inbreeding in remnant populations. American Naturalist 144: 412-431.
Mitton, J. B. 1989. Physiological and demographic variation associated with allozyme variation. Pp. 127-145 in Isozymes in Plant Biology, eds. D. Soltis and P. Soltis. Dioscorides Press, Portland, Oregon, USA.
Morris, F. and E. A. Eames. 1929. Our Wild Orchids. Scribner’s Sons, New York, New York, USA.
Nei, M. 1973. Analysis of gene diversity in subdivided populations. Proceedings of the National Academy of Sciences, USA 70: 3321-3323.
Nei, M. and W. H. Li. 1979. Mathematical model for studying genetic variation in terms of restriction endonucleases. Proceedings of the National Academy of Sciences, USA 76: 5269-5273.
Neiland, M. R. M. and C. C. Wilcock. 1995. Maximization of reproductive success by European Orchidaceae under conditions of infrequent pollination. Protoplasma 187: 39-48.
Newman, D. and D. Pilson. 1997. Increased probability of extinction due to decreased genetic effective population size: Experimental populations of Clarkia pulchella. Evolution 51: 354-362.
Nilsson, L. A. 1979. Anthecological studies on the Lady’s slipper, Cypripedium calceolus (Orchidaceae). Botanica Notiser 132: 329-347.
Nilsson, L. A. 1983. Anthecology of Orchis mascula (Orchidaceae). Nordic Journal of Botany 3: 157-179.
Nilsson, L. A. 1988. The evolution of flowers with deep corolla tubes. Nature 334: 147- 149.
Nunney, L. and D. R. Elam. 1994. Estimating the effective population size of conserved populations. Conservation Biology 8: 175-184.
Nybom, H. and I. V. Bartish. 2000. Effects of life history traits and sampling strategies on genetic diversity estimates obtained with RAPD markers in plants. Perspectives in Plant Ecology, Evolution, and Systematics 3: 93-114.
Ortiz-Barney, E. and J. D. Ackerman. 1999. The cost of selfing in Encyclia cochleata (Orchidaceae). Plant Systematics and Evolution 219: 55-64.
219
Otto, S. P. and J. Whitton. 2000. Polyploid incidence and evolution. Annual Review of Genetics 34: 401-437.
Ozkan, H., A. A. Levy, and M. Feldman. 2001. Allopolyploidy-induced rapid genome evolution in the wheat (Aegilops-Triticum) group. The Plant Cell 13: 1735-1747.
Padgett, D. J., D. H. Les, and G. E. Crow. 1998. Evidence for the hybrid origin of Nuphar x rubrodisca (Nymphaceae). American Journal of Botany 85: 1468-1476.
Palacios, C. and F. González-Candelas. 1997. Analysis of population genetic structure and variability using RAPD markers in the endemic and endangered Limonium dufourii (Plumbaginaceae). Molecular Ecology 6: 1107-1121.
Patt, J. M., M. W. Merchant, D. R. E. Williams, and B. J. D. Meeuse. 1989. Pollination biology of Platanthera stricta (Orchidaceae) in Olympic National Park, Washington. American Journal of Botany 76: 1097-1106.
Peakall, R. and A. J. Beattie. 1996. Ecological and genetic consequences of pollination by sexual deception in the orchid Caladenia tentactulata. Evolution 50: 2207- 2220.
Peakall, R. and S. H. James. 1989. Outcrossing in an ant pollinated clonal orchid. Heredity 62: 161-167.
Petit, C., F. Bretagnolle, and F. Felber. 1999. Evolutionary consequences of diploid- polyploid hybrid zones in wild species. Trends in Ecology and Evolution 14: 306- 311.
Popp, M. and B. Oxelman. 2001. Inferring the history of the polyploid Silene aegaea (Caryophyllaceae) using plastid and homeologous nuclear DNA sequences. Molecular Phylogenetics and Evolution 20: 474-481.
Prathepha, P. and V. Baimai. 1999. Genetic differentiation in Thai populations of the rare species Afgekia sericea Craib (Leguminosae) revealed by RAPD-PCR assays. Genetica 105: 193-202.
Price, M. V. and N. M. Waser. 1979. Pollen dispersal and optimal outcrossing in Delphinium nelsonii. Nature 277: 294-297.
Pridgeon, A. M., R. M. Bateman, A. V. Cox, J. R. Hapeman, and M. W. Chase. 1997. Phylogenetics of subtribe Orchidinae (Orchidoideae, Orchidaceae) based on nuclear ITS sequences. 1. Intergeneric relationships and polyphyly of Orchis sensu lato. Lindleyana 12: 89-109.
220
Primack, R. and E. Stacy. 1998. Cost of reproduction in the Pink lady’s slipper orchid (Cypripedium acaule, Orchidaceae): an eleven-year experimental study of three populations. American Journal of Botany 85: 1672-1679.
Qamaruz-Zaman F., M. F. Fay, J. S. Parker, and M. W. Chase. 1998. Molecular techniques employed in the assessment of genetic diversity: A review focusing on orchid conservation. Lindleyana 13: 259-283.
Qian, W., S. Ge, and D. Y. Hong. 2001. Genetic variation within and among populations of a wild rice Oryza granulate from China detected by RAPD and ISSR markers. Theoretical and Applied Genetics 102: 440-449.
Raijmann, L. E. L., N. C. Leeuwen, R. Kersten, J. G. B. Oostermeijer, H. C. M. Den Nijs, and S. B. J. Menken. 1994. Genetic variation and outcrossing rate in relation to population size in Gentiana pneumonanthe L. Conservation Biology 8: 1014- 1026.
Ramsey, J. and D. W. Schemske. 1998. Pathways, mechanisms, and rates of polyploid formation in flowering plants. Annual Review of Ecology and Systematics 29: 467-501.
Ranker, T. A. and A. F. Schnabel. 1986. Allozymic and morphological evidence for a progenitor-derivative species pair in Camassia (Liliaceae). Systematic Botany 11: 433-445.
Rasmussen, H. N. 1995. Terrestrial Orchids from Seed to Mycotrophic Plant. Cambridge University Press, Cambridge, UK.
Reddoch, J. M. and A. H. Reddoch. 1997. The orchids in the Ottawa district: floristics, phytogeography, population studies, and historical review. The Canadian Field- Naturalist 111: 1-185.
Reinartz, J.A. 1995. Planting state-listed endangered and threatened plants. Conservation Biology 9: 771-781.
Reynolds, J., B. S. Weir, and C. C. Cockerham. 1983. Estimation of the coancestry coefficient: Basis for a short-term genetic distance. Genetics 105: 767-779.
Rieseberg, L. H. 1991. Homoploid reticulate evolution in Helianthus (Asteraceae): evidence from ribosomal genes. American Journal of Botany 78: 1218-1237.
Rieseberg, L. H. 1996. Homology among RAPD fragments in interspecific comparisons. Molecular Ecology 5: 99-105.
221
Rieseberg, L. H. and J. F. Wendel. 1993. Introgression and its consequences in plants. Pp. 70-110 in Hybrid Zones and the Evolutionary Process, ed. R. Harrison. Oxford University Press, New York, New York, USA.
Rieseberg, L. H. and N. C. Ellstrand. 1993. What can molecular and morphological markers tell us about plant hybridization? Critical Reviews in Plant Sciences 12: 213-241.
Rieseberg, L. H., H. C. Choi, R. Chan, and C. Spore. 1993. Genomic map of a diploid hybrid species. Heredity 70: 285-293.
Robertson, C. 1893. Flowers and insects. Botanical Gazette 18: 47-54.
Robertson, J. L. and R. Wyatt. 1990. Evidence for pollination ecotypes in the yellow- fringed orchid, Platanthera ciliaris. Evolution 44: 121-133.
Roelofs, D. J. Van Velzen, P. Kuperus, and K. Bachmann. 1997. Molecular evidence for an extinct parent of the tetraploid species Microseris acuminate and M. campestris (Asteraceae, Lactuceae). Molecular Ecology 6: 641-649.
Rohlf, F.J. (1997) NTSYS-pc: Numerical taxonomy and multivariate analysis system. Version 2.0. Exeter Software, Setauket, New York, USA.
Rosenzweig, M.L. and M. V. Lomolino. 1997. Who gets the short bits of the broken stick? Pp. 63-90 in The Biology of Rarity, eds. W. E. Kunin and K. J. Gaston. Chapman and Hall, London, UK.
Russell, J. R., J. C. Weber, A. Booth, W. Powell, C. Sotelo-Montes, and I. K. Dawson. 1999. Genetic variation of Calcophyllum spruceanum in the Peruvian Amazon Basin, revealed by amplified fragment length polymorphism (AFLP) analysis. Molecular Ecology 8: 199-204.
Rydberg, P. A. 1901. The American species of Limnorchis and Piperia, north of Mexico. Bulletin of the Torrey Botanical Club 28: 605-643.
Ryder, O. L. 1986. Species conservation and systematics: The dilemma of subspecies. Trends in Ecology and Evolution 1: 9-10.
Sang, T., D. J. Crawford, and T. F. Stuessy. 1995. Documentation of reticulate evolution in peonies (Paeonia) using internal transcribed spacer sequences of nuclear ribosomal DNA: implications for biogeography and concerted evolution. Proceedings of the National Academy of Sciences, USA 92: 6813-6817.
222
Schemske, D. W., B. C. Husband, M. H. Ruckelshaus, C. Goodwillie, I. M. Parker, and J. G. Bishop. 1994. Evaluating approaches to the conservation of rare and endangered plants. Ecology 75: 584-606.
Schlötterer, C. 1998. Are microsatellites really simple sequences? Current Biology 8: R132-R134.
Schmidt, K. and K. Jensen. 2000. Genetic structure and AFLP variation of remnant populations in the rare plant Pedicularis palustris (Scrophulariaceae) and its relation to population size and reproductive components. American Journal of Botany 87: 678-689.
Schneider, S., D. Roessli, and L. Excoffier. 2000. ARLEQUIN, version 2.0: a software for population genetics data analysis. Genetics and Biometry Laboratory, University of Geneva, Switzerland. Available free at http://anthro.unige.ch/arlequin.
Schrenk, W. J. 1978. North American Platantheras: evolution in the making. American Orchid Society Bulletin 47: 429-437.
Sheviak, C. J. 1999. The identities of Platanthera hyperborea and P. huronensis, with the description of a new species from North America. Lindleyana 14: 193-203.
Sheviak, C. J. and M. L. Bowles. 1986. The prairie fringed orchids: A pollinator-isolated species pair. Rhodora 88: 267-290.
Sheviak, C. J. and M. Bracht. 1998. New chromosome numbers determinations in Platanthera. Native North American Orchid Journal 4: 168-172.
Shim, S. I. and R. B. Jorgensen. 2000. Genetic structure in cultivated and wild carrots (Daucus carota L.) revealed by AFLP analysis. Theoretical and Applied Genetics 101: 227-233.
Shore, J. S. 1991. Tetrasomic inheritance and isozyme variation in Turnera ulmifolia vars. elegans Urb. and intermedia Urb. (Turneraceae). Heredity 66: 305-312.
Simmons, M. P. and H. Ochoterena. 2000. Gaps as characters in sequence-based phylogenetic analyses. Systematic Biology 49: 369-381.
Slatkin, M. 1977. Gene flow and genetic drift in a species subject to frequent local extinctions. Theoretical Population Biology 12: 253-262.
Smith, J. F., C. C. Burke, and W. L. Wagner. 1996. Interspecific hybridization in natural populations of Cyrtandra (Gesneriaceae) on the Hawaiian Islands: evidence from RAPD markers. Plant Systematics and Evolution 200: 61-77.
223
Snow, A. A. and D. F. Whigham. 1989. Cost of flower and fruit production in Tipularia discolor. Ecology 70: 1286-1293.
Sokal, R. R. and F. J. Rohlf. 1995. Biometry. Freeman, New York, New York, USA.
Soliva, M., A. Kocyan, and A. Widmer. 2001. Molecular phylogenetics of the sexually deceptive orchid genus Ophrys (Orchidaceae) based on nuclear and chloroplast DNA sequences. Molecular Phylogenetics and Evolution 20: 78-88.
Soltis, D. E. and P. S. Soltis. 1993. Molecular data and the dynamic nature of polyploidy. Critical Reviews in Plant Sciences 12: 243-273.
Soltis, D. E. and P. S. Soltis. 1998. Choosing an approach and an appropriate gene for phylogenetic analysis. Pp. 1-42 in Molecular Systematics of Plants II: DNA Sequencing, eds. D. E. Soltis, P. S. Soltis, and J. J. Doyle. Kluwer Academic Publishers, Boston, Massachusetts, USA.
Soltis, D. E., C. H. Haufler, D. C. Darrow, and G. J. Gastony. 1983. Starch gel electrophoresis of ferns: A compilation of grinding buffers, gel and electrode buffers, and staining schedules. American Fern Journal 73: 9-27.
Soltis, D. E., M. A. Gitzendanner, D. D. Strenge, and P. S. Soltis. 1997. Chloroplast DNA intraspecific phylogeography of plants from the Pacific Northwest of North America. Plant Systematics and Evolution 206: 353-373.
Soltis, P. S., D. E. Soltis, T. L. Tucker, and F. A. Lang. 1992. Allozyme variability is absent in the narrow endemic Bensoniella oregona (Saxifragaceae). Conservation Biology 6: 131-134.
Soltis, P. S. and D. E. Soltis. 2000. The role of genetic and genomic attributes in the success of polyploids. Proceedings of the National Academy of Sciences, USA 97: 7051-7057.
Soltis, P. S., G. M. Plunkett, S. J. Novak, and D. E. Soltis. 1995. Genetic variation in Tragopogon species: additional origins of the allotetraploids T. mirus and T. miscellus (Compositae). American Journal of Botany 82: 1329-1341.
Song, K., P. Lu, K. Tang, and T. C. Osborn. 1995. Rapid genome change in synthetic polyploids of Brassica and its implications for polyploid evolution. Proceedings of the National Academy of Sciences, USA 92: 7719-7723.
Sorensen, M. D. 1999. TreeRot, version 2. Boston University, Boston, Massachusetts, USA.
224
SPSS, Inc. 1999. Statistical software package, Version 10. SPSS, Inc., Chicago, Illinois, USA.
Stebbins, G. L. Jr. 1950. Variation and Evolution in Plants. Columbia University Press, New York, New York, USA.
Stebbins, G. L. Jr. 1970. Adaptive radiation of reproductive characteristics in Angiosperms, I: pollination mechanisms. Annual Review of Ecology and Systematics 1: 307-326.
Stebbins, G. L., Jr. 1971. Chromosomal Evolution in Higher Plants. Edward Arnold, London, UK.
Steffan-Dewener, I. and T. Tscharntke. 1999. Effects of habitat isolation on pollinator communities and seed set. Oecologia 121: 432-440.
Stoutamire, W. P. 1996. Seeds and seedlings of Platanthera leucophaea (Orchidaceae). Pp. 54-61 in North American Native Terrestrial Orchids, Propagation and Production: North American Native Orchid Conference Proceedings, ed. C. Allen. Chadds Ford, Pennsylvania, USA.
Sun, M. 1997. Genetic diversity in three colonizing orchids with contrasting mating systems. American Journal of Botany 84: 224-232.
Swofford, D. L. 1999. PAUP*. Phylogenetic analysis using parsimony (* and other methods), version 4.0. Sinauer Associates, Sunderland, Massachusetts, USA.
Taberlet, P., G. Ludovic, G. Pautou, and J. Bouvet. 1991. Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Molecular Biology 17: 1105-1109.
Tanaka, R. and H. Kamemoto. 1984. Chromosomes in orchids: counting and numbers. Pp. 323-410 in Orchid biology reviews and perspectives, III, ed. J. Arditti. Cornell University Press, Ithaca, New York, USA.
Tansley, S. A. and C. R. Brown. 2000. RAPD variation in the rare and endangered Leucadendron elimense (Proteaceae): Implications for their conservation. Biological Conservation 95: 39-48.
Taylor, N. L. and R. R. Smith. 1979. Red clover breeding and genetics. Advances in Agronomy 31: 125-154.
Templeton, A. R. 1986. Coadaptation and outbreeding depression. Pp. 105-116 in Conservation Biology: The Science of Scarcity and Diversity, ed. M. E. Soulé. Sinauer, Sunderland, Massachusetts, USA.
225
Thompson, J. D. and R. Lumaret. 1992. The evolutionary dynamics of polyploid plants: origins, establishment, and persistence. Trends in Ecology and Evolution 7: 302- 307.
Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position gap penalties, and weight matrix choice. Nucleic Acids Research 22: 4673-4680.
Thompson, J. N., B. M. Cunningham, K. A. Seagraves, D. M. Althoff, and D. Wagner. 1997. Plant polyploidy and insect/plant interactions. The American Naturalist 150: 730-743.
Travis, S. E., J. Maschinski, and P. Keim. 1996. An analysis of genetic variation in Astragalus cremnophylax var. cremnophylax, a critically endangered plant, using AFLP markers. Molecular Ecology 5: 735-745.
Tsumara, Y., K. Ohba, and S. H. Strauss. 1996. Diversity and inheritance of inter-simple sequence repeat polymorphisms in Douglas-fir (Pseudotsuga menziesii) and Sugi (Cryptomeria japonica). Theoretical and Applied Genetics 92: 40-45.
USFWS (United States Fish & Wildlife Service). 1999. Eastern prairie fringed orchid, Platanthera leucophaea (Nuttall) Lindley Recovery Plan. Region 3, Fort Snelling, Minnesota, USA.
Vallius, E. 2000. Position-dependent reproductive success of flowers in Dactylorhiza maculata (Orchidaceae). Functional Ecology 14: 573-579.
Van der Pijl, L. and C. H. Dodson. 1966. Orchid flowers: their pollination and evolution. University of Miami Press, Coral Gables, Florida, USA.
Vargas, P., H. A. McAllister, C. Morton, S. L. Jury, and M. J. Wilkinson. 1999. Polyploid speciation in Hedera (Araliaceae): phylogenetic and biogeographic insights based on chromosome counts and ITS sequences. Plant Systematics and Evolution 219: 165-179.
Villar, R., E. J. Veneklaas, P. Jordano, and H. Lambers. 1998. Relative growth rate and biomass allocation in 20 Aegilops (Poaceae) species. New Phytologist 140: 425- 437.
Volkov, R., N. Borisjuk, I. Panchuk, D. Schweizer, and V. Hemleben. 1999. Elimination and rearrangement of parental rDNA in the allotetraploid Nicotiana tabacum. Molecular Biology and Evolution 16: 311-320.
226
von Well, E. and A. Fossey. 1998. A comparative investigation of seed germination, metabolism, and seedling growth between two polyploid Triticum species. Euphytica 101: 83-89.
Vrijenhoek, R. C. 1987. Population genetics and conservation. Pp. 89-98 in Conservation for the 21st Century, eds. D. Western and M. C. Pearl. Oxford University Press, New York, New York, USA.
Wade, M. J. and D. E. McCauley. 1988. Extinction and recolonization: their effects on the genetic differentiation of local populations. Evolution 42: 995-1005.
Wagner, W. H., Jr. 1970. Biosystematics and evolutionary noise. Taxon 19: 146-151.
Wallace, L. E. 2002. Examining the effects of fragmentation on genetic variation in Platanthera leucophaea (Orchidaceae): Inferences from allozyme and random amplified polymorphic DNA markers. Plant Species Biology 17: 37-49.
Waser, N. M. 1993. Population structure, optimal outbreeding, and assortative mating in angiosperms. Pp. 173-199 in The Natural History of Inbreeding and Outbreeding: Theoretical and Empirical Perspectives, ed. N. T. Wilmsen. University of Chicago Press, Chicago, Illinois, USA.
Washitani, I. 1996. Predicted genetic consequences of strong fertility selection due to pollinator loss in an isolated population of Primula sieboldii. Conservation Biology 10: 59-64.
Waters, E. R. and B. A. Schaal. 1995. Biased gene conversion is not occurring among rDNA repeats in the Brassica species. Genome 39: 150-154.
Wedderburn, F. M. and A. J. Richards. 1992. Secondary homostyly in Primula L.: evidence for the model of the “S” super-gene. New Phytologist 121: 649-655.
Weir, B. S. 1996. Genetic Data Analysis II. Sinauer, Sunderland, Massachusetts, USA.
Welsh, S. L., N. D. Atwood, S. Goodrich, and L. C. Higgins. 1987. A Utah flora, 2nd ed, Brigham Young University, Provo, Utah, USA.
Wen, J. and E. A. Zimmer. 1996. Phylogeny of Panax L. (the ginseng genus, Araliaceae): inference from ITS sequences of nuclear ribosomal DNA. Molecular Phylogenetics and Evolution 6: 167-177.
Wendel, J. F. 1989. New World tetraploid cottons contain Old World cytoplasm. Proceedings of the National Academy of Sciences 86: 4132-4136.
227
Wendel, J. F. 2000. Genome evolution in polyploids. Plant Molecular Biology 42: 225- 249.
Wendel, J. F., A. Schnabel, and T. Seelanan. 1995. Bidirectional interlocus concerted evolution following allopolyploid speciation in cotton (Gossypium). Proceedings of the National Academy of Sciences, USA 92: 280-284.
Whitlock, M. C. and D. E. McCauley. 1990. Some population genetic consequences of colony formation and extinction: genetic correlations within founding groups. Evolution 44: 1717-1724.
Wichman, S. R., S. D. Wright, E. K. Cameron, D. Jeannette Keeling, and R. C. Gardner. 2002. Elevated genetic heterogeneity and Pleistocene climatic instability: inferences from nrDNA in New Zealand Coprosma (Rubiaceae). Journal of Biogeography 29: 943-954.
Widmer, A. and M. Baltisberger. 1999. Molecular evidence for allopolyploid speciation and a single origin of the narrow endemic Draba ladina (Brassicaceae). American Journal of Botany 86: 1282-1289.
Williams, J. G. K., A. R. Kubelik, K. J. Livak, J. A. Rafalski, and S. V. Tingey. 1990. DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Research 18: 6531-6535.
Windus, J. L. and K. E. Cochrane. 1997. Monitoring of eastern prairie white-fringed orchid (Platanthera leucophaea) in Ohio: 1992-1996, a summary of data to date. Report to the U.S. Fish and Wildlife Service. Ohio Department of Natural Resources, Columbus, Ohio, USA.
Wolfe, A. D. and A. Liston. 1998. Contributions of PCR-based methods to plant systematics and evolutionary biology. Pp. 43-86 in Molecular Systematics of Plants II DNA Sequencing, eds. D. E. Soltis, P. S. Soltis, and J. J. Doyle. Kluwer, Boston, Massachusetts, USA.
Wolfe, A. D. and C. P. Randle. 2001. Relationships within and among species of the holoparasitic genus Hyobanche (Orobanchaceae) inferred from ISSR banding patterns and nucleotide sequences. Systematic Botany 26: 120-130.
Wolfe, A. D., Q. Y. Xiang, and S. R. Kephart. 1998a. Diploid hybrid speciation in Penstemon (Scrophulariaceae). Proceedings of the National Academy of Sciences USA 95: 5112-5115.
Wolfe, A. D., Q. Y. Xiang, and S. R. Kephart. 1998b. Assessing hybridization in natural populations of Penstemon (Scrophulariaceae) using hypervariable inter simple sequence repeat markers. Molecular Ecology 7: 1107-1125.
228
Wolff, K. and M. Morgan-Richards. 1998. PCR markers distinguish Plantago major subspecies. Theoretical and Applied Genetics 96: 282-286.
Wong, K. C. and M. Sun. 1999. Reproductive biology and conservation genetics of Goodyera procera (Orchidaceae). American Journal of Botany 86: 1406-1413.
Wright, S. 1977. Evolution and the Genetics of Populations, Vol. 3. University of Chicago Press, Chicago, Illinois, USA.
Wright, S. 1978. Evolution and the Genetics of Populations, Vol. 4. University of Chicago Press, Chicago, Illinois, USA.
Wyatt, R. 1983. Pollinator-plant interactions and the evolution of breeding systems. Pp. 51-96 in Pollination biology, ed. L. Real. Academic Press, New York, New York, USA.
Yeh, F. C., D. K. X. Chong, and R. C. Yang. 1995. RAPD variation within and among natural populations of Trembling aspen (Populus tremuloides Michx.) from Alberta. Journal of Heredity 86: 454-460.
Yeh, F. C., R. C Yang, and T. Boyle. 1999. POPGENE: Microsoft Windows based freeware for population genetic analysis. Department of Renewable Resources, University of Alberta, Edmonton, Alberta, Canada. Available free at http://www.ualberta.ca/~fyeh.
Young, A., T. Boyle, and T. Brown. 1996. The population genetic consequences of habitat fragmentation for plants. Trends in Ecology and Evolution 11: 413-418.
Zar, J. H. 1996. Biostatistical Analysis. Prentice Hall, Upper Saddle River, New Jersey, USA.
Zettler, L. W., S. L. Stewart, M. L. Bowles, and K. A. Jacobs. 2001. Mycorrhizal fungi and cold-assisted symbiotic germination of the federally threatened eastern prairie fringed orchid, Platanthera leucophaea (Nuttall) Lindley. American Midland Naturalist 145: 168-175.
Zhang, D. and T. Sang. 1999. Physical mapping of ribosomal RNA genes in peonies (Paeonia, Paeoniaceae) by fluorescent in situ hybridization: implications for phylogeny and concerted evolution. American Journal of Botany 86: 735-740.
Zhang, W., L. J. Qu, H. Gu, W. Gao, M. Liu, J. Chen, and Z. Chen. 2002. Studies on the origin and evolution of tetraploid wheats based on the internal transcribed spacer (ITS) sequences of nuclear ribosomal DNA. Theoretical and Applied Genetics 104: 1099-1106.
229
Zimmer, E., S. Martin, S. Beverley, Y. Kan, and A. Wilson. 1980. Rapid duplication and loss of genes coding for the alpha-chains of hemoglobin. Proceedings of the National Academy o f Sciences, USA 77: 2158-2162.
Zimmerman, J. K. and T. M. Aide. 1989. Patterns of fruit production in neotropical orchids: pollinators vs. resource limitation. American Journal of Botany 76: 67- 73.
230
Appendix. Matrix of bands present in each of the 22 chloroplast haplotypes (A-V). Bands 1-26: digestion of trnT-F with MseI; bands 27-29: digestion of trnT-F with BstNI; bands 30-35: digestion of rpl16 with EcoRV. + indicates the presence of a band, - indicates the absence of a band.
RFLP Type
Band A B C D E F G H I J K L M N O P Q R S T U V
1 ------+ ------+
2 ------+ - -
3 ------+ ------
4 ------+ + - - -
5 + + + + + + + + + + + - + ------+ -
6 ------+ ------
7 ------+ + - - - - -
8 + ------
9 - + ------+ + - + - + - - -
10 ------+ - - + ------+
11 ------+ + ------
12 + + + + - + + + + + ------+ -
13 ------+ ------
14 ------+ - -
15 + + + + + + + + + + + + + + + + + + + + + -
16 ------+
17 + + + + + ------
18 ------+ + + - + + + + + + + + + - -
19 - - - - - + ------
231
RFLP Type
Band A B C D E F G H I J K L M N O P Q R S T U V
20 ------+ ------
21 ------+ ------+ -
22 ------+
23 ------+
24 + + + + + + + + + + + + + + + + + + + + + -
25 + + + + + + + + + + + + + + + + + + + + + -
26 ------+
27 ------+ + + ------
28 + + + + + + + + + + + + + + + + + + + + + +
29 + + + + + + + + + + - - - + + + + + + + + +
30 ------+ + + + + + + + -
31 - - - + ------
32 - - - + ------
33 ------+ + + + + + + + -
34 ------+
35 + + + - + + + + + + + + + ------
232