DOCSLIB.ORG

Intersection of FOXO- and RUNX1-Mediated Gene PNAS PLUS Expression Programs in Single Breast Epithelial Cells During Morphogenesis and Tumor Progression

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Intersection of FOXO- and RUNX1-Mediated Gene PNAS PLUS Expression Programs in Single Breast Epithelial Cells During Morphogenesis and Tumor Progression Intersection of FOXO- and RUNX1-mediated gene PNAS PLUS expression programs in single breast epithelial cells during morphogenesis and tumor progression Lixin Wanga,1, Joan S. Bruggeb, and Kevin A. Janesa,1,2 aDepartment of Biomedical Engineering, University of Virginia, Charlottesville, VA 22908; and bDepartment of Cell Biology, Harvard Medical School, Boston, MA 02115 Edited by Yoshiaki Ito, Institute of Molecular and Cell Biology, Singapore, and accepted by the Editorial Board July 28, 2011 (received for review March 3, 2011) Gene expression networks are complicated by the assortment of be obtained with conventional oligonucleotide microarrays after regulatory factors that bind DNA and modulate transcription PCR-based amplification of cDNA from 10 microdissected cells combinatorially. Single-cell measurements can reveal biological (2, 22, 23). By surveying hundreds of cells overall, stochastic mechanisms hidden by population averages, but their value has profiling captures the most reproducible cell to cell expression not been fully explored in the context of mRNA regulation. Here, heterogeneities in a cell population. Individual transcripts that we adapted a single-cell expression profiling technique to exam- are nonuniformly expressed are then organized by the pattern ine the gene expression program downstream of Forkhead box O of their expression fluctuations to reveal coordinated single- (FOXO) transcription factors during 3D breast epithelial acinar mor- cell programs. phogenesis. By analyzing patterns of mRNA fluctuations among In this work, we report a detailed analysis centering around individual matrix-attached epithelial cells, we found that a subset one class of transcription factors—the FOXOs—whose expres- of FOXO target genes was jointly regulated by the transcription sion was found to be strongly nonuniform in our initial study factor Runt-related transcription factor 1 (RUNX1). Knockdown of (2). FOXO proteins are a subgroup of the Forkhead family of RUNX1 causes hyperproliferation and abnormal morphogenesis, transcriptional regulators that play important roles in cell cycle both of which require normal FOXO function. Down-regulating arrest, stress responses, and cell death (24). All FOXO isoforms SYSTEMS BIOLOGY RUNX1 and FOXOs simultaneously causes widespread oxidative recognize a common (A/G)TAAA(T/C)A DNA consensus, which stress, which arrests proliferation and restores normal acinar mor- is frequently observed in the extended promoters of many genes phology. In hormone-negative breast cancers lacking human epi- (SI Appendix, Table S1) (25, 26). However, FOXOs are often HER2 fi fi dermal growth factor receptor 2 ( ) ampli cation, we nd that not redundant, and isoform-specific functions have been widely RUNX1 down-regulation is strongly associated with up-regulation documented (27–29). FOXO transcriptional activity is regulated of FOXO1, which may be required to support growth of RUNX1- both positively and negatively by phosphorylation and ubiquiti- negative tumors. The coordinate function of these two tumor sup- nation (30–34). Although FOXOs predominantly function as tran- pressors may provide a failsafe mechanism that inhibits cancer- scriptional activators, they may also act as repressors in certain progression. contexts (35). Last, FOXOs can interact with at least a dozen other transcription factors, resulting in altered binding specificity heterogeneity | triple-negative | stochastic | systems biology and transcriptional activity (SI Appendix, Table S2) (36). Thus, in many ways, FOXO proteins are an archetype for the complexity enetically identical mammalian cells often display patterns that lies between signal transduction and gene expression. Gof gene protein expression that are profoundly different (1– Here, we asked whether a focused examination of endogenous 3). Cell to cell heterogeneity has been recognized in cancer for FOXOs by stochastic profiling would yield insights into their nearly half a century (4, 5). However, only lately have heteroge- function at the network level. Instead of using constitutively neous cell populations been exploited as a means for uncover- active FOXO alleles to homogenize signaling (SI Appendix, ing new mechanisms of biological regulation (6–8). With recently Table S3), we quantified fluctuations in FOXO expression and developed techniques that can interrogate single-cell states, we activity that occur naturally during 3D organotypic culture of are now poised to embrace heterogeneity rather than average it breast epithelial cells (2, 37). By mapping these fluctuations onto out (9–11). a panel of FOXO target genes, we discovered that the measured Nonuniformities emerge at the earliest steps of gene expression FOXO expression signature divides into two groups with distinct (12–14). Therefore, measurements of mRNA expression hetero- single-cell patterns. One of these groups receives a key second geneity may help to uncover new biology if combined with systems input from another transcription factor, RUNX1, which is var- approaches for analysis (11). This possibility offers a particularly iably active. RUNX1 is required for the proper timing of pro- rich opportunity for unraveling transcriptional networks, where liferative suppression in 3D spheroids, and its stable knockdown complex combinations of factors work together to mediate pro- results in abnormal hyperproliferative acinar structures. In- grams of gene expression (15). Early pioneering studies initially terestingly, this phenotype requires native single-cell regulation focused on describing the fundamental kinetics and statistics of transcription in single cells (1, 12–14, 16–19). Now, an open question is how methods that provide single-cell information should be applied to help understand the coordination of tran- Author contributions: L.W., J.S.B., and K.A.J. designed research; L.W. and K.A.J. performed scriptional programs and their role in cell phenotype (20, 21). research; L.W., J.S.B., and K.A.J. analyzed data; and J.S.B. and K.A.J. wrote the paper. For this purpose, we recently developed a technique called The authors declare no conflict of interest. stochastic profiling (2). Stochastic profiling does not attempt to This article is a PNAS Direct Submission. Y.I. is a guest editor invited by the Editorial Board. quantify mRNA levels in single cells but instead, gleans single- 1L.W. and K.A.J. contributed equally to this work. cell information by analyzing the statistical fluctuations in 15–20 2To whom correspondence should be addressed. E-mail: [email protected]. repeated measurements of 10 cells. The increased amount of This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. starting material allows high-quality, transcriptome-wide data to 1073/pnas.1103423108/-/DCSupplemental. www.pnas.org/cgi/doi/10.1073/pnas.1103423108 PNAS Early Edition | 1of10 Downloaded by guest on September 24, 2021 of FOXO function to withstand the increased oxidative stress expressed was the transcription factor FOXO1. The pattern of caused by RUNX1 knockdown. Combined inhibition of RUNX1 single-cell FOXO1 expression correlated with many transcripts and FOXO leads to an acute state of oxidative stress that induces that had been previously linked to oxidative stress and proliferative proliferation arrest and restores normal 3D morphology. In a suppression, suggesting a coordinated cellular response. Because large study of estrogen receptor (ER)-, progesterone receptor FOXO family transcriptional activity is itself linked to oxidative (PR)-, and HER2-negative breast cancers, we find that reduced stress and proliferation arrest (38, 39), we chose to investigate the RUNX1 expression correlates with FOXO1 up-regulation, which interplay between the expression of FOXOs and FOXO-dependent presumably enables tumor progression. Our results illustrate target genes. how careful single-cell analysis of gene expression can reveal The MCF10A clone 5E (MCF10A-5E) used for 3D culture functional interactions within transcriptional networks that are expresses not only FOXO1 but also FOXO3 (SI Appendix, Fig. important for cancer-relevant cell phenotypes. S1), and we found that both FOXO proteins were heteroge- neously expressed and localized in individual acini during mor- Results phogenesis (Fig. 1A). Together with the two FOXOs, we mon- Dissecting Single-Cell FOXO Coregulation by Stochastic Sampling. We itored time-dependent changes in the levels of 18 transcripts previously cataloged the transcriptional heterogeneities that during morphogenesis: eight genes were validated or reported emerge among individual matrix-attached breast epithelial cells FOXO targets (BTG1, CAV1, CDKN1A, FBXO32, SEMA3C, during acinar morphogenesis in a 3D culture model (2, 37). One SESN1, SOD2, and SOX4)(SI Appendix, Table S3), five genes gene that was predicted with high confidence to be nonuniformly were constitutively expressed (GAPDH, HINT1, PRDX6, S100A6, AB) FOXO1 FOXO3 BTG1 CDKN1A FBXO32 SOD2 SESN1 CAV1 SEMA3C SOX4 10 FOXO1 FOXO3 1 0 -1 Validated FOXO target d induction (log Reported FOXO target Fol 4 6 8 1012 4 6 8 1012 4 6 8 1012 4 6 8 1012 4 6 8 1012 4 6 8 1012 4 6 8 1012 4 6 8 1012 4 6 8 1012 4 6 8 1012 E-cadherin DAPI ) PRDX6 HDPAG HINT1 S100A6 UBC CDKN1C KRT10 1BNCC BCL2L13 CCNI 10 1 0 -1 Loading controls d induction (log Other Fol 4 6 8 1012 4 6 8 1012 4 6 8 1012 4 6 8 1012 4 6 8 1012 4 6 8 1012 4 6 8 1012 4 6 8 1012 4 6 8 1012 4 6 8 1012 Day of morphogenesis C D p E Log10 (homogeneously expressed) 0 -4 -8 -12 -16 CCNB1 CCNB1 3 KRT10 3 SOD2 Candidate SOD2 BCL2L13 heterogeneities KRT10 2 2 CCNI FBXO32 SOX4 SESN1 FOXO1 1 1 CDKN1C FOXO3 BTG1 CDKN1A CCNI 0 0 FOXO3 BCL2L13 FOXO1 CDKN1A -1 CAV1 -1 FBXO32 CAV1 UBC change from geometric mean SOX4 2 -2 GAPDH -2 SEMA3C BTG1 Log False-discovery rate PRDX6 CDKN1C -3 HINT1 Standard deviations from geometric mean -3 S100A6 SESN1 61 11 9 3412 14 7813 5618 71 12 1015 123456789101112131415161718 10-cell stochastic samplings 10-cell stochastic samplings Fig. 1. Focused stochastic sampling of a FOXO expression dichotomy in 3D breast epithelial cultures. (A) Heterogeneous expression and localization of FOXO1 and FOXO3 proteins at day 10 of morphogenesis.
Load more

Recommended publications
  • The E–Id Protein Axis Modulates the Activities of the PI3K–AKT–Mtorc1
    Downloaded from genesdev.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press The E–Id protein axis modulates the activities of the PI3K–AKT–mTORC1– Hif1a and c-myc/p19Arf pathways to suppress innate variant TFH cell development, thymocyte expansion, and lymphomagenesis Masaki Miyazaki,1,8 Kazuko Miyazaki,1,8 Shuwen Chen,1 Vivek Chandra,1 Keisuke Wagatsuma,2 Yasutoshi Agata,2 Hans-Reimer Rodewald,3 Rintaro Saito,4 Aaron N. Chang,5 Nissi Varki,6 Hiroshi Kawamoto,7 and Cornelis Murre1 1Department of Molecular Biology, University of California at San Diego, La Jolla, California 92093, USA; 2Department of Biochemistry and Molecular Biology, Shiga University of Medical School, Shiga 520-2192, Japan; 3Division of Cellular Immunology, German Cancer Research Center, D-69120 Heidelberg, Germany; 4Department of Medicine, University of California at San Diego, La Jolla, California 92093, USA; 5Center for Computational Biology, Institute for Genomic Medicine, University of California at San Diego, La Jolla, California 92093, USA; 6Department of Pathology, University of California at San Diego, La Jolla, California 92093, USA; 7Department of Immunology, Institute for Frontier Medical Sciences, Kyoto University, Kyoto 606-8507, Japan It is now well established that the E and Id protein axis regulates multiple steps in lymphocyte development. However, it remains unknown how E and Id proteins mechanistically enforce and maintain the naı¨ve T-cell fate. Here we show that Id2 and Id3 suppressed the development and expansion of innate variant follicular helper T (TFH) cells. Innate variant TFH cells required major histocompatibility complex (MHC) class I-like signaling and were associated with germinal center B cells.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Forkhead Transcription Factors and Ageing
    Oncogene (2008) 27, 2351–2363 & 2008 Nature Publishing Group All rights reserved 0950-9232/08 $30.00 www.nature.com/onc REVIEW Forkhead transcription factors and ageing L Partridge1 and JC Bru¨ ning2 1Institute of Healthy Ageing, GEE, London, UK; 2Department of Mouse Genetics and Metabolism, Institute for Genetics University of Cologne, Cologne, Germany Mutations in single genes and environmental interventions Forkhead transcription factors are turning out to play can extend healthy lifespan in laboratory model organi- a key role in invertebrate models ofextension ofhealthy sms. Some of the mechanisms involved show evolutionary lifespan by single-gene mutations, and evidence is conservation, opening the way to using simpler inverte- mounting for their importance in mammals. Forkheads brates to understand human ageing. Forkhead transcrip- can also play a role in extension oflifespanby dietary tion factors have been found to play a key role in lifespan restriction, an environmental intervention that also extension by alterations in the insulin/IGF pathway and extends lifespan in diverse organisms (Kennedy et al., by dietary restriction. Interventions that extend lifespan 2007). Here, we discuss these findings and their have also been found to delay or ameliorate the impact of implications. The forkhead family of transcription ageing-related pathology and disease, including cancer. factors is characterized by a type of DNA-binding Understanding the mode of action of forkheads in this domain known as the forkhead box (FOX) (Weigel and context will illuminate the mechanisms by which ageing Jackle, 1990). They are also called winged helix acts as a risk factor for ageing-related disease, and could transcription factors because of the crystal structure lead to the development of a broad-spectrum, preventative ofthe FOX, ofwhich the forkheadscontain a medicine for the diseases of ageing.
    [Show full text]
  • Biophysical Investigation of the Dual Binding Surfaces of Human Transcription Factors FOXO4 and P53
    bioRxiv preprint doi: https://doi.org/10.1101/2021.01.11.425814; this version posted January 11, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Biophysical investigation of the dual binding surfaces of human transcription factors FOXO4 and p53 Jinwoo Kim+, Dabin Ahn+, and Chin-Ju Park* Department of Chemistry, Gwangju Institute of Science and Technology, Gwangju, 61005, Korea *Correspondence to: [email protected]. + These authors contributed equally to this work. 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.01.11.425814; this version posted January 11, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Abstract Cellular senescence is protective against external oncogenic stress, but its accumulation causes aging- related diseases. Forkhead box O4 (FOXO4) and p53 are human transcription factors known to promote senescence by interacting in the promyelocytic leukemia bodies. Inhibiting their binding is a strategy for inducing apoptosis of senescent cells, but the binding surfaces that mediate the interaction of FOXO4 and p53 remain elusive. Here, we investigated two binding sites involved in the interaction between FOXO4 and p53 by using NMR spectroscopy. NMR chemical shift perturbation analysis showed that the binding between FOXO4’s forkhead domain (FHD) and p53’s transactivation domain (TAD), and between FOXO4’s C-terminal transactivation domain (CR3) and p53’s DNA binding domain (DBD), mediate the FOXO4-p53 interaction.
    [Show full text]
  • Up-Regulation of Foxo4 Mediated by Hepatitis B Virus X Protein Confers Resistance to Oxidative Stress-Induced Cell Death
    INTERNATIONAL JOURNAL OF MoleCular MEDICine 28: 255-260, 2011 Up-regulation of Foxo4 mediated by hepatitis B virus X protein confers resistance to oxidative stress-induced cell death Ratakorn SRISUTTEE1, SANG SEOK KOH3, EUN HEE PARK1, IL-RAE CHO1, HYE JIN MIN3, BYUNG HAK JHUN2, DAE-YEUL YU4, SUN PARK5, DO YUN PARK6, MI OCK LEE7, DIEGO H. CASTRILLON8, RANDAL N. Johnston9 and YOUNG-Hwa CHUNG1 1WCU Department of Cogno-Mechatronics Engineering and 2Department of Nanomedical Engineering, BK21 Nanofusion Technology Team, Pusan National University, Busan; 3Therapeutic Antibody Research Center and 4Disease Model Research Center, Korea Research Institute of Bioscience and Biotechnology, Daejeon; 5Department of Microbiology, Ajou University School of Medicine, Suwon; 6Department of Pathology, College of Medicine, Pusan National University, Yangsan; 7College of Pharmacy, Seoul National University, Seoul, Republic of Korea; 8Department of Pathology and Simmons Comprehensive Cancer Center, University of Texas Southwestern Medical Center, Dallas, TX, USA; 9Department of Biochemistry and Molecular Biology, University of Calgary, Calgary, Alberta, Canada Received January 27, 2011; Accepted March 17, 2011 DOI: 10.3892/ijmm.2011.699 Abstract. The hepatitis B virus X (HBX) protein, a regula- may be a useful target for suppression in the treatment of tory protein of the hepatitis B virus (HBV), has been shown HBV-associated hepatocellular carcinoma cells. to generate reactive oxygen species (ROS) in human liver cell lines; however, the mechanism by which cells protect them- Introduction selves under this oxidative stress is poorly understood. Here, we show that HBX induces the up-regulation of Forkhead box The human hepatitis B virus (HBV) induces acute and class O 4 (Foxo4) not only in Chang cells stably expressing chronic hepatitis and is closely associated with the incidence HBX (Chang-HBX) but also in primary hepatic tissues of human liver cancer (1,2).
    [Show full text]
  • Stimulation of Sirt1-Regulated Foxo Protein Function by the Ligand-Bound Vitamin D Receptorᰔ Beum-Soo An,1 Luz E
    MOLECULAR AND CELLULAR BIOLOGY, Oct. 2010, p. 4890–4900 Vol. 30, No. 20 0270-7306/10/$12.00 doi:10.1128/MCB.00180-10 Copyright © 2010, American Society for Microbiology. All Rights Reserved. Stimulation of Sirt1-Regulated FoxO Protein Function by the Ligand-Bound Vitamin D Receptorᰔ Beum-Soo An,1 Luz E. Tavera-Mendoza,2 Vassil Dimitrov,2 Xiaofeng Wang,1 Mario R. Calderon,1 Hui-Jun Wang,1 and John H. White1,2* Departments of Physiology1 and Medicine,2 McGill University, Montreal, Quebec, Canada Received 12 February 2010/Returned for modification 8 April 2010/Accepted 4 August 2010 Hormonal vitamin D, 1,25-dihydroxyvitamin D (1,25D), signals through the nuclear vitamin D receptor (VDR). 1,25D regulates cell proliferation and differentiation and has been identified as a cancer chemopre- ventive agent. FoxO proteins are transcription factors that control cell proliferation and survival. They function as tumor suppressors and are associated with longevity in several organisms. Accumulating data have revealed that 1,25D and FoxO proteins regulate similarly common target genes. We show here that the ligand-bound VDR regulates the posttranslational modification and function of FoxO proteins. 1,25D treat- ment enhances binding of FoxO3a and FoxO4 within4htopromoters of FoxO target genes and blocks mitogen-induced FoxO protein nuclear export. The VDR associates directly with FoxO proteins and regulators, the sirtuin 1 (Sirt1) class III histone deacetylase (HDAC), and protein phosphatase 1. In addition, phosphatase activity and trichostatin A-resistant HDAC activity coimmunoprecipitate with the VDR. 1,25D treatment rapidly (in <4 h) induces FoxO deacetylation and dephosphorylation, consistent with activation.
    [Show full text]
  • Genome-Wide Identification of Foxo-Dependent Gene Networks In
    Judge et al. BMC Cancer 2014, 14:997 http://www.biomedcentral.com/1471-2407/14/997 RESEARCH ARTICLE Open Access Genome-wide identification of FoxO-dependent gene networks in skeletal muscle during C26 cancer cachexia Sarah M Judge1, Chia-Ling Wu2, Adam W Beharry1, Brandon M Roberts1, Leonardo F Ferreira3, Susan C Kandarian2 and Andrew R Judge1* Abstract Background: Evidence from cachectic cancer patients and animal models of cancer cachexia supports the involvement of Forkhead box O (FoxO) transcription factors in driving cancer-induced skeletal muscle wasting. However, the genome-wide gene networks and associated biological processes regulated by FoxO during cancer cachexia are unknown. We hypothesize that FoxO is a central upstream regulator of diverse gene networks in skeletal muscle during cancer that may act coordinately to promote the wasting phenotype. Methods: To inhibit endogenous FoxO DNA-binding, we transduced limb and diaphragm muscles of mice with AAV9 containing the cDNA for a dominant negative (d.n.) FoxO protein (or GFP control). The d.n.FoxO construct consists of only the FoxO3a DNA-binding domain that is highly homologous to that of FoxO1 and FoxO4, and which outcompetes and blocks endogenous FoxO DNA binding. Mice were subsequently inoculated with Colon-26 (C26) cells and muscles harvested 26 days later. Results: Blocking FoxO prevented C26-induced muscle fiber atrophy of both locomotor muscles and the diaphragm and significantly spared force deficits. This sparing of muscle size and function was associated with the differential regulation of 543 transcripts (out of 2,093) which changed in response to C26. Bioinformatics analysis of upregulated gene transcripts that required FoxO revealed enrichment of the proteasome, AP-1 and IL-6 pathways, and included several atrophy-related transcription factors, including Stat3, Fos,andCebpb.
    [Show full text]
  • Morphology Regulation in Vascular Endothelial Cells Kiyomi Tsuji-Tamura1,2* and Minetaro Ogawa1
    Tsuji-Tamura and Ogawa Inflammation and Regeneration (2018) 38:25 Inflammation and Regeneration https://doi.org/10.1186/s41232-018-0083-8 REVIEW Open Access Morphology regulation in vascular endothelial cells Kiyomi Tsuji-Tamura1,2* and Minetaro Ogawa1 Abstract Morphological change in endothelial cells is an initial and crucial step in the process of establishing a functional vascular network. Following or associated with differentiation and proliferation, endothelial cells elongate and assemble into linear cord-like vessels, subsequently forming a perfusable vascular tube. In vivo and in vitro studies have begun to outline the underlying genetic and signaling mechanisms behind endothelial cell morphology regulation. This review focuses on the transcription factors and signaling pathways regulating endothelial cell behavior, involved in morphology, during vascular development. Keywords: Vasculature, Endothelial cells, Angiogenesis, Morphology, Elongation Background known as the hemogenic endothelium reportedly gener- Vascular system development ates hematopoietic stem cells directly [3, 7–10]. During the earliest stages of embryonic development, Specification of angioblasts to either arterial or venous vascular formation occurs in connection with blood cell endothelial cells is established prior to forming blood formation (hematopoiesis) [1, 2]. There are various the- vessel structures [11–13]. The receptor tyrosine kinase ories about the origin of endothelial cells, but the meso- EphB4 and its transmembrane ligand ephrinB2 are derm has been reported to generate an endothelial cell demonstrated to be significant factors for arteriovenous progenitor (angioblast) and a common progenitor of definition [14]. The binding of vascular endothelial hematopoietic cells and endothelial cells (hemangioblast) growth factor (VEGF) to its receptor VEGFR2, also [3] (Fig. 1).
    [Show full text]
  • Control of the Autophagy Pathway in Osteoarthritis: Key Regulators, Therapeutic Targets and Therapeutic Strategies
    International Journal of Molecular Sciences Review Control of the Autophagy Pathway in Osteoarthritis: Key Regulators, Therapeutic Targets and Therapeutic Strategies Maria Teresa Valenti 1 , Luca Dalle Carbonare 1,* , Donato Zipeto 2 and Monica Mottes 2 1 Department of Medicine, Section of Internal Medicine, University of Verona, 37134 Verona, Italy; [email protected] 2 Department of Neurosciences, Biomedicine and Movement Sciences, Section of Biology and Genetics, University of Verona, 37134 Verona, Italy; [email protected] (D.Z.); [email protected] (M.M.) * Correspondence: [email protected]; Tel.: +39-045-8126062 Abstract: Autophagy is involved in different degenerative diseases and it may control epigenetic modifications, metabolic processes, stem cells differentiation as well as apoptosis. Autophagy plays a key role in maintaining the homeostasis of cartilage, the tissue produced by chondrocytes; its impairment has been associated to cartilage dysfunctions such as osteoarthritis (OA). Due to their location in a reduced oxygen context, both differentiating and mature chondrocytes are at risk of premature apoptosis, which can be prevented by autophagy. AutophagomiRNAs, which regulate the autophagic process, have been found differentially expressed in OA. AutophagomiRNAs, as well as other regulatory molecules, may also be useful as therapeutic targets. In this review, we describe and discuss the role of autophagy in OA, focusing mainly on the control of autophagomiRNAs in OA pathogenesis and their potential therapeutic applications. Citation: Valenti, M.T.; Dalle Keywords: mesenchimal stem cells; chondrocytic commitment; autophagy; osteoarthritis; miRNAs Carbonare, L.; Zipeto, D.; Mottes, M. Control of the Autophagy Pathway in Osteoarthritis: Key Regulators, Therapeutic Targets and Therapeutic 1. Background Strategies.
    [Show full text]
  • The Myocardin Family of Transcriptional Coactivators: Versatile Regulators of Cell Growth, Migration, and Myogenesis
    Downloaded from genesdev.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press REVIEW The myocardin family of transcriptional coactivators: versatile regulators of cell growth, migration, and myogenesis G.C. Teg Pipes, Esther E. Creemers, and Eric N. Olson1 Department of Molecular Biology, University of Texas Southwestern Medical Center, Dallas, Texas 75390, USA The association of transcriptional coactivators with se- gene regulation and expands the regulatory potential of quence-specific DNA-binding proteins provides versatil- individual cis-regulatory elements. ity and specificity to gene regulation and expands the The regulation of serum response factor (SRF) and its regulatory potential of individual cis-regulatory DNA se- target genes provides a classic example of the diversity of quences. Members of the myocardin family of coactiva- genes controlled by a single DNA-binding protein and tors activate genes involved in cell proliferation, migra- the importance of cofactor interactions in the control of tion, and myogenesis by associating with serum re- gene expression (Shore and Sharrocks 1995). Among the sponse factor (SRF). The partnership of myocardin family many target genes of SRF are genes involved in cell pro- members and SRF also controls genes encoding compo- liferation and muscle differentiation, which represent nents of the actin cytoskeleton and confers responsive- opposing programs of gene expression: Muscle genes are ness to extracellular growth signals and intracellular repressed by growth factor signals and generally do not changes in the cytoskeleton, thereby creating a tran- become activated until myoblasts exit the cell cycle. The scriptional–cytoskeletal regulatory circuit. These func- ability of SRF to regulate different sets of downstream tions are reflected in defects in smooth muscle differen- effector genes depends on its association with positive tiation and function in mice with mutations in myocar- and negative cofactors (Treisman 1994; Shore and Shar- din family members.
    [Show full text]
  • Klf6 Protects &Beta
    Original Article Klf6 protects b-cells against insulin resistance- induced dedifferentiation Christopher Dumayne 1, David Tarussio 1, Ana Rodriguez Sanchez-Archidona 1,2, Alexandre Picard 1, Davide Basco 1, Xavier Pascal Berney 1, Mark Ibberson 2, Bernard Thorens 1,* ABSTRACT Objectives: In the pathogenesis of type 2 diabetes, development of insulin resistance triggers an increase in pancreatic b-cell insulin secretion capacity and b-cell number. Failure of this compensatory mechanism is caused by a dedifferentiation of b-cells, which leads to insufficient insulin secretion and diabetic hyperglycemia. The b-cell factors that normally protect against dedifferentiation remain poorly defined. Here, through a systems biology approach, we identify the transcription factor Klf6 as a regulator of b-cell adaptation to metabolic stress. Methods: We used a b-cell specific Klf6 knockout mouse model to investigate whether Klf6 may be a potential regulator of b-cell adaptation to a metabolic stress. Results: We show that inactivation of Klf6 in b-cells blunts their proliferation induced by the insulin resistance of pregnancy, high-fat high- sucrose feeding, and insulin receptor antagonism. Transcriptomic analysis showed that Klf6 controls the expression of b-cell proliferation genes and, in the presence of insulin resistance, it prevents the down-expression of genes controlling mature b-cell identity and the induction of disallowed genes that impair insulin secretion. Its expression also limits the transdifferentiation of b-cells into a-cells. Conclusion: Our study identifies a new transcription factor that protects b-cells against dedifferentiation, and which may be targeted to prevent diabetes development. Ó 2020 The Authors.
    [Show full text]
  • Policing Cancer: Vitamin D Arrests the Cell Cycle
    International Journal of Molecular Sciences Review Policing Cancer: Vitamin D Arrests the Cell Cycle Sachin Bhoora 1 and Rivak Punchoo 1,2,* 1 Department of Chemical Pathology, Faculty of Health Sciences, University of Pretoria, Pretoria 0083, Gauteng, South Africa; [email protected] 2 National Health Laboratory Service, Tshwane Academic Division, Pretoria 0083, South Africa * Correspondence: [email protected] Received: 30 October 2020; Accepted: 26 November 2020; Published: 6 December 2020 Abstract: Vitamin D is a steroid hormone crucial for bone mineral metabolism. In addition, vitamin D has pleiotropic actions in the body, including anti-cancer actions. These anti-cancer properties observed within in vitro studies frequently report the reduction of cell proliferation by interruption of the cell cycle by the direct alteration of cell cycle regulators which induce cell cycle arrest. The most recurrent reported mode of cell cycle arrest by vitamin D is at the G1/G0 phase of the cell cycle. This arrest is mediated by p21 and p27 upregulation, which results in suppression of cyclin D and E activity which leads to G1/G0 arrest. In addition, vitamin D treatments within in vitro cell lines have observed a reduced C-MYC expression and increased retinoblastoma protein levels that also result in G1/G0 arrest. In contrast, G2/M arrest is reported rarely within in vitro studies, and the mechanisms of this arrest are poorly described. Although the relationship of epigenetics on vitamin D metabolism is acknowledged, studies exploring a direct relationship to cell cycle perturbation is limited. In this review, we examine in vitro evidence of vitamin D and vitamin D metabolites directly influencing cell cycle regulators and inducing cell cycle arrest in cancer cell lines.
    [Show full text]