DOCSLIB.ORG

TSHZ3 and SOX9 Regulate the Timing of Smooth Muscle Cell Differentiation

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
TSHZ3 and SOX9 Regulate the Timing of Smooth Muscle Cell Differentiation TSHZ3 and SOX9 regulate the timing of smooth muscle cell differentiation in the ureter by reducing myocardin activity Elise Martin, Xavier Caubit, Rannar Airik, Christine Vola, Ahmed Fatmi, Andreas Kispert, Laurent Fasano To cite this version: Elise Martin, Xavier Caubit, Rannar Airik, Christine Vola, Ahmed Fatmi, et al.. TSHZ3 and SOX9 regulate the timing of smooth muscle cell differentiation in the ureter by reducing myocardin activity. PLoS ONE, Public Library of Science, 2013, 8 (5), pp.e63721. 10.1371/journal.pone.0063721. hal- 00862094 HAL Id: hal-00862094 https://hal.archives-ouvertes.fr/hal-00862094 Submitted on 19 Sep 2018 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Distributed under a Creative Commons Attribution| 4.0 International License TSHZ3 and SOX9 Regulate the Timing of Smooth Muscle Cell Differentiation in the Ureter by Reducing Myocardin Activity Elise Martin1, Xavier Caubit1, Rannar Airik2, Christine Vola1, Ahmed Fatmi1, Andreas Kispert2, Laurent Fasano1* 1 Aix-Marseille Universite´, CNRS, IBDM UMR7288, Marseille, France, 2 Institut fu¨r Molekularbiologie, Medizinische Hochschule Hannover, Hannover, Germany Abstract Smooth muscle cells are of key importance for the proper functioning of different visceral organs including those of the urogenital system. In the mouse ureter, the two transcriptional regulators TSHZ3 and SOX9 are independently required for initiation of smooth muscle differentiation from uncommitted mesenchymal precursor cells. However, it has remained unclear whether TSHZ3 and SOX9 act independently or as part of a larger regulatory network. Here, we set out to characterize the molecular function of TSHZ3 in the differentiation of the ureteric mesenchyme. Using a yeast-two-hybrid screen, we identified SOX9 as an interacting protein. We show that TSHZ3 also binds to the master regulator of the smooth muscle program, MYOCD, and displaces it from the coregulator SRF, thereby disrupting the activation of smooth muscle specific genes. We found that the initiation of the expression of smooth muscle specific genes in MYOCD-positive ureteric mesenchyme coincides with the down regulation of Sox9 expression, identifying SOX9 as a possible negative regulator of smooth muscle cell differentiation. To test this hypothesis, we prolonged the expression of Sox9 in the ureteric mesenchyme in vivo. We found that Sox9 does not affect Myocd expression but significantly reduces the expression of MYOCD/SRF- dependent smooth muscle genes, suggesting that down-regulation of Sox9 is a prerequisite for MYOCD activity. We propose that the dynamic expression of Sox9 and the interaction between TSHZ3, SOX9 and MYOCD provide a mechanism that regulates the pace of progression of the myogenic program in the ureter. Citation: Martin E, Caubit X, Airik R, Vola C, Fatmi A, et al. (2013) TSHZ3 and SOX9 Regulate the Timing of Smooth Muscle Cell Differentiation in the Ureter by Reducing Myocardin Activity. PLoS ONE 8(5): e63721. doi:10.1371/journal.pone.0063721 Editor: Qingzhong Xiao, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, United Kingdom Received March 26, 2012; Accepted April 11, 2013; Published May 6, 2013 Copyright: ß 2013 Martin et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Funding: Research in the laboratory of LF was supported by the Centre National de la Recherche Scientifique (CNRS) with additional funding from the Association Franc¸aise contre les Myopathies (AFM, grants 12545, 13013) and the Agence Nationale de la Recherche (ANR, grant ANR-09-GENO-027-01). Work in the laboratory of AK was supported by a grant (DFG Ki728/7-1) from the Deutsche Forschungsgemeinschaft (German Research Council). E. Martin was a fellow of the AFM. Part of this work was performed using France-BioImaging infrastructure supported by the Agence Nationale de la Recherche (ANR-10-INSB-04-01, call ‘‘Investissements d’Avenir’’). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing Interests: The authors have declared that no competing interests exist. * E-mail: [email protected] Introduction homeodomain-containing protein SIX1 and the high-mobility- group (HMG) domain transcription factor SOX9 are expressed in Smooth muscle (SM) is a frequent investment of visceral organs, SMC precursors and are important for the cytodifferentiation of and is required to assure their rigidity and contractility. In the ureteric mesenchyme [9,10,11,12]. Phenotypic and molecular urinary tract, SM is present in the renal pelvis, the ureter, the analyses of Tbx18 mutant ureters have indicated that Tbx18 is bladder and the urethra and plays a crucial role in the functional required for specifying mesenchymal cell precursors to a ureteric and structural integrity of these organs. fate [9]. Six1 acts synergistically with Tbx18 in regulating the In vivo characterization of visceral smooth muscle cell (SMC) proliferation and differentiation of SMC precursors [12]. Teashirt development in the ureter has provided evidence for a role for 3(Tshz3) is expressed in precursors, and in differentiating and Sonic hedgehog (SHH) and Bone morphogenetic protein 4 differentiated SMCs; its expression is maintained in adult ureteric (BMP4) signaling in the differentiation of the mesenchymal cells SM. In Tshz3 mutant ureters the myogenic program is not that surround the urothelium [1,2,3,4,5,6,7,8]. Targeted removal activated in the proximal region due to the absence of expression of Shh signal production in the ureteric epithelium resulted in a of myocardin (Myocd), a key regulator of SM differentiation [11,13]. reduction of ureteral mesenchymal cell proliferation and delayed It was suggested that SM differentiation depends on a signaling SM differentiation, which is likely to play a causal role in the axis starting with secreted SHH and ending with ureteric SMC observed hydroureter [8]. Moreover, removal of Shh resulted in a differentiation, with Tszh3 downstream of Bmp4 but upstream of deficit of Bmp4-expressing peri-ureteral mesenchyme, while Myocd and SMC contractile protein synthesis [11,14]. This work conditional deletion of Bmp4 dramatically reduced expression of also provided some indication concerning the temporal control of SM specific genes [1,8]. Four transcription factors, the T-box SMC differentiation. In the wild type ureter, MYOCD and SMC protein TBX18, the zinc-finger protein Teashirt 3 (TSHZ3), the markers are detected at E15.5, shortly before onset of urine PLOS ONE | www.plosone.org 1 May 2013 | Volume 8 | Issue 5 | e63721 Timing the Ureteric Myogenic Program production at E16.0 to E16.5. Tshz32/2 mice as well as other serum and 50 units/ml penicillin, 50 mg/ml streptomycin, 1% mutants with defects in ureteric SM differentiation consequently sodium pyruvate. develop hydroureter at around E16.5 [11]. Recently, it was shown that the high mobility group domain transcription factor gene Sox9 Yeast Two-hybrid Screen (Y2H) plays an important role both in kidney and ureter development in The screen has been previously reported in [20]. the mouse [10,15]. Sox9 is transiently expressed in the undiffer- entiated ureteric mesenchyme. Conditional inactivation of Sox9 in Immunological and in situ hybridization analysis this domain led to a significant down-regulation of Myocd Tissues were fixed in 4% paraformaldehyde/PBS. Immuno- expression and perturbed differentiation into SMC, which resulted staining was performed either on 10 mm cryosections of tissues or in strong proximal hydroureter formation due to functional on paraffin embedded sections after quenching endogenous obstruction. The involvement of visceral SMCs in pelvi-ureteric peroxidase activity and antigen retrieval followed by reaction junction obstruction (PUJO), a frequent cause for persisting with secondary antibodies. Primary and secondary antibodies used dilatation of the upper urinary tract (hydronephrosis), underlies were mouse anti-smooth muscle a actin (SMaA, 1A4, Sigma; 1/ the significant interest in understanding the mechanisms that 1000), guinea-pig anti-TSHZ3 antibody (1/5000) produced by A. control the differentiation of visceral SMCs [16,17,18,19]. Garratt’s laboratory (Max-Delbrueck-Center, Berlin, Germany). Previous data suggested that both TSHZ3 and SOX9 critically Rabbit anti-SOX9 antibody (1/1000) was kindly provided by Dr regulate the onset of the myogenic program in the developing Pascal de Santa Barbara (Inserm, ERI25, Montpellier, France). ureter. However it is not clear whether TSHZ3 and SOX9 act Other primary antibodies were rabbit anti-b-galactosidase (Cap- independently or are part of a regulatory network that controls b cytodifferentiation of the ureteric mesenchyme. Here, we set out to pel, 1/500), mouse anti- -galactosidase
Load more

Recommended publications
  • Loss of Mafb and Maf Distorts Myeloid Cell Ratios and Disrupts Fetal Mouse Testis Vascularization and Organogenesisǂ
    bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441488; this version posted April 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Loss of Mafb and Maf distorts myeloid cell ratios and disrupts fetal mouse testis vascularization and organogenesisǂ 5 Shu-Yun Li1,5, Xiaowei Gu1,5, Anna Heinrich1, Emily G. Hurley1,2,3, Blanche Capel4, and Tony DeFalco1,2* 1Division of Reproductive Sciences, Cincinnati Children’s Hospital Medical Center, Cincinnati, 10 OH 45229, USA 2Department of Pediatrics, University of Cincinnati College of Medicine, Cincinnati, OH 45267 USA 3Department of Obstetrics and Gynecology, University of Cincinnati College of Medicine, Cincinnati, OH 45267 USA 15 4Department of Cell Biology, Duke University Medical Center, Durham, NC 27710 USA 5These authors contributed equally to this work. ǂThis work was supported by the National Institutes of Health (R37HD039963 to BC, R35GM119458 to TD, R01HD094698 to TD, F32HD058433 to TD); March of Dimes (1-FY10- 355 to BC, Basil O’Connor Starter Scholar Award 5-FY14-32 to TD); Lalor Foundation 20 (postdoctoral fellowship to SL); and Cincinnati Children’s Hospital Medical Center (Research Innovation and Pilot funding, Trustee Award, and developmental funds to TD). *Corresponding Author: Tony DeFalco E-mail: [email protected] 25 Address: Division of Reproductive Sciences Cincinnati Children’s Hospital Medical Center 3333 Burnet Avenue, MLC 7045 Cincinnati, OH 45229 USA Phone: +1-513-803-3988 30 Fax: +1-513-803-1160 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441488; this version posted April 26, 2021.
    [Show full text]
  • Reconstruction of the Global Neural Crest Gene Regulatory Network in Vivo
    Reconstruction of the global neural crest gene regulatory network in vivo Ruth M Williams1, Ivan Candido-Ferreira1, Emmanouela Repapi2, Daria Gavriouchkina1,4, Upeka Senanayake1, Jelena Telenius2,3, Stephen Taylor2, Jim Hughes2,3, and Tatjana Sauka-Spengler1,∗ Supplemental Material ∗Lead and corresponding author: Tatjana Sauka-Spengler ([email protected]) 1University of Oxford, MRC Weatherall Institute of Molecular Medicine, Radcliffe Department of Medicine, Oxford, OX3 9DS, UK 2University of Oxford, MRC Centre for Computational Biology, MRC Weatherall Institute of Molecular Medicine, Oxford, OX3 9DS, UK 3University of Oxford, MRC Molecular Haematology Unit, MRC Weatherall Institute of Molecular Medicine, Oxford, OX3 9DS, UK 4Present Address: Okinawa Institute of Science and Technology, Molecular Genetics Unit, Onna, 904-0495, Japan A 25 25 25 25 25 20 20 20 20 20 15 15 15 15 15 10 10 10 10 10 log2(R1_5-6ss) log2(R1_5-6ss) log2(R1_8-10ss) log2(R1_8-10ss) log2(R1_non-NC) 5 5 5 5 5 0 r=0.92 0 r=0.99 0 r=0.96 0 r=0.99 0 r=0.96 0 5 10 15 20 25 0 5 10 15 20 25 0 5 10 15 20 25 0 5 10 15 20 25 0 5 10 15 20 25 log2(R2_non-NC) log2(R2_5-6ss) log2(R3_5-6ss) log2(R2_8-10ss) log2(R3_8-10ss) 25 25 25 25 25 20 20 20 20 20 15 15 15 15 15 10 10 10 10 10 log2(R1_5-6ss) log2(R2_5-6ss) log2(R1_8-10ss) log2(R2_8-10ss) log2(R1_non-NC) 5 5 5 5 5 0 r=0.94 0 r=0.96 0 r=0.95 0 r=0.96 0 r=0.95 0 5 10 15 20 25 0 5 10 15 20 25 0 5 10 15 20 25 0 5 10 15 20 25 0 5 10 15 20 25 log2(R3_non-NC) log2(R4_5-6ss) log2(R3_5-6ss) log2(R4_8-10ss) log2(R3_8-10ss)
    [Show full text]
  • Tomo-Seq Identifies SOX9 As a Key Regulator of Cardiac Fibrosis During Ischemic Injury
    myocardial myocardial Eva van ◼ osis fibr SOX9 transcription ◼ PhD* PhD PhD PhD MSc, PhD naarden, MSc, PhD naarden, PhD* ventricular remodeling Correspondence to: Correspondence Rooij, MSc, PhD, Hubrecht Department of Institute, KNAW University Medical Cardiology, Uppsalalaan 8, Center Utrecht, The Netherlands. 3584CT Utrecht, E-mail [email protected] of Funding, see page 1408 Sources Key Words: ischemia ◼ © 2017 American Heart Association, Inc. *Drs. Lacraz and Junker contributed equally. Grégory P.A. Lacraz, MSc, P.A. Grégory MSc, Jan Philipp Junker, Monika M. Gladka, MSc, MSc Bas Molenaar, Scholman, MSc Koen T. MSc Marta Vigil-Garcia, BS Danielle Versteeg, BS Hesther de Ruiter, MSc, Vermunt, Marit W. MSc, Creyghton, Menno P. Manon M.H. Huibers, Nicolaas de Jonge, MD Alexander van Oude- Eva van Rooij, MSc, PhD 2017;136:1396–1409. DOI: 10.1161/CIRCULATIONAHA.117.027832 DOI: 2017;136:1396–1409. Circulation. blunted the cardiac fibrotic fibrotic blunted the cardiac Sox9 ). Subsequent correlation analysis allowed). Subsequent correlation Serca2 Editorial, see p 1410 , and Nppa Based on the exact local expression cues, tomo-seq can Based on the exact local expression Cardiac ischemic injury induces a pathological remodeling ischemic injury induces a pathological remodeling Cardiac , Although genome-wide transcriptome analysis on diseased tissues Tracing transcriptional differences with a high spatial resolution with a high spatial resolution transcriptional differences Tracing Col1a2 October 10, 2017 October 10, 1396 CONCLUSIONS: novel genes and key transcription factors involved in specific serve to reveal able to unveil the Using tomo-seq, we were remodeling. aspects of cardiac pointing fibrosis, of cardiac of SOX9 as a key regulator unknown relevance fibrosis.
    [Show full text]
  • The Versatile Functions of Sox9 in Development, Stem Cells, And
    Genes & Diseases (2014) 1, 149e161 HOSTED BY Available online at www.sciencedirect.com ScienceDirect journal homepage: http://ees.elsevier.com/gendis/default.asp REVIEW ARTICLE The versatile functions of Sox9 in development, stem cells, and human diseases Alice Jo a, Sahitya Denduluri a, Bosi Zhang a, Zhongliang Wang a,b, Liangjun Yin a,b, Zhengjian Yan a,b, Richard Kang a, Lewis L. Shi a, James Mok a, Michael J. Lee a, Rex C. Haydon a,* a Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, IL 60637, USA b Departments of Orthopaedic Surgery, The Affiliated Hospitals of Chongqing Medical University, Chongqing 400046, China Received 3 September 2014; accepted 6 September 2014 Available online 16 October 2014 KEYWORDS Abstract The transcription factor Sox9 was first discoveredinpatientswithcampomelic Development; dysplasia, a haploinsufficiency disorder with skeletal deformities caused by dysregulation of Sox9; Sox9 expression during chondrogenesis. Since then, its role as a cell fate determiner during Stem cells; embryonic development has been well characterized; Sox9 expression differentiates cells Transcription factor derived from all three germ layers into a large variety of specialized tissues and organs. How- ever, recent data has shown that ectoderm- and endoderm-derived tissues continue to express Sox9 in mature organs and stem cell pools, suggesting its role in cell maintenance and speci- fication during adult life. The versatility of Sox9 may be explained by a combination of post- transcriptional modifications, binding partners, and the tissue type in which it is expressed. Considering its importance during both development and adult life, it follows that dysregula- tion of Sox9 has been implicated in various congenital and acquired diseases, including fibrosis and cancer.
    [Show full text]
  • Curcumin Attenuates Environment-Derived Osteoarthritis by Sox9/NF-Kb Signaling Axis
    International Journal of Molecular Sciences Article Curcumin Attenuates Environment-Derived Osteoarthritis by Sox9/NF-kB Signaling Axis Constanze Buhrmann 1,2, Aranka Brockmueller 1, Anna-Lena Mueller 1, Parviz Shayan 3 and Mehdi Shakibaei 1,* 1 Musculoskeletal Research Group and Tumor Biology, Chair of Vegetative Anatomy, Institute of Anatomy, Faculty of Medicine, Ludwig-Maximilian-University Munich, Pettenkoferstr. 11, D-80336 Munich, Germany; [email protected] (C.B.); [email protected] (A.B.); [email protected] (A.-L.M.) 2 Institute of Anatomy and Cell Biology, Faculty of Medicine, University of Augsburg, Universitaetsstr. 2, D-86159 Augsburg, Germany 3 Department of Parasitology, Faculty of Veterinary Medicine, University of Tehran, Tehran 141556453, Iran; [email protected] * Correspondence: [email protected]; Tel.: +49-89-2180-72624 Abstract: Inflammation has a fundamental impact on the pathophysiology of osteoarthritis (OA), a common form of degenerative arthritis. It has previously been established that curcumin, a component of turmeric (Curcuma longa), has anti-inflammatory properties. This research evaluates the potentials of curcumin on the pathophysiology of OA in vitro. To explore the anti-inflammatory efficacy of curcumin in an inflamed joint, an osteoarthritic environment (OA-EN) model consisting of fibroblasts, T-lymphocytes, 3D-chondrocytes is constructed and co-incubated with TNF-α, antisense oligonucleotides targeting NF-kB (ASO-NF-kB), or an IkB-kinase (IKK) inhibitor (BMS-345541). Our results show that OA-EN, similar to TNF-α, suppresses chondrocyte viability, which is accompanied Citation: Buhrmann, C.; by a significant decrease in cartilage-specific proteins (collagen II, CSPG, Sox9) and an increase in NF- Brockmueller, A.; Mueller, A.-L.; kB-driven gene proteins participating in inflammation, apoptosis, and breakdown (NF-kB, MMP-9, Shayan, P.; Shakibaei, M.
    [Show full text]
  • The E–Id Protein Axis Modulates the Activities of the PI3K–AKT–Mtorc1
    Downloaded from genesdev.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press The E–Id protein axis modulates the activities of the PI3K–AKT–mTORC1– Hif1a and c-myc/p19Arf pathways to suppress innate variant TFH cell development, thymocyte expansion, and lymphomagenesis Masaki Miyazaki,1,8 Kazuko Miyazaki,1,8 Shuwen Chen,1 Vivek Chandra,1 Keisuke Wagatsuma,2 Yasutoshi Agata,2 Hans-Reimer Rodewald,3 Rintaro Saito,4 Aaron N. Chang,5 Nissi Varki,6 Hiroshi Kawamoto,7 and Cornelis Murre1 1Department of Molecular Biology, University of California at San Diego, La Jolla, California 92093, USA; 2Department of Biochemistry and Molecular Biology, Shiga University of Medical School, Shiga 520-2192, Japan; 3Division of Cellular Immunology, German Cancer Research Center, D-69120 Heidelberg, Germany; 4Department of Medicine, University of California at San Diego, La Jolla, California 92093, USA; 5Center for Computational Biology, Institute for Genomic Medicine, University of California at San Diego, La Jolla, California 92093, USA; 6Department of Pathology, University of California at San Diego, La Jolla, California 92093, USA; 7Department of Immunology, Institute for Frontier Medical Sciences, Kyoto University, Kyoto 606-8507, Japan It is now well established that the E and Id protein axis regulates multiple steps in lymphocyte development. However, it remains unknown how E and Id proteins mechanistically enforce and maintain the naı¨ve T-cell fate. Here we show that Id2 and Id3 suppressed the development and expansion of innate variant follicular helper T (TFH) cells. Innate variant TFH cells required major histocompatibility complex (MHC) class I-like signaling and were associated with germinal center B cells.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Forkhead Transcription Factors and Ageing
    Oncogene (2008) 27, 2351–2363 & 2008 Nature Publishing Group All rights reserved 0950-9232/08 $30.00 www.nature.com/onc REVIEW Forkhead transcription factors and ageing L Partridge1 and JC Bru¨ ning2 1Institute of Healthy Ageing, GEE, London, UK; 2Department of Mouse Genetics and Metabolism, Institute for Genetics University of Cologne, Cologne, Germany Mutations in single genes and environmental interventions Forkhead transcription factors are turning out to play can extend healthy lifespan in laboratory model organi- a key role in invertebrate models ofextension ofhealthy sms. Some of the mechanisms involved show evolutionary lifespan by single-gene mutations, and evidence is conservation, opening the way to using simpler inverte- mounting for their importance in mammals. Forkheads brates to understand human ageing. Forkhead transcrip- can also play a role in extension oflifespanby dietary tion factors have been found to play a key role in lifespan restriction, an environmental intervention that also extension by alterations in the insulin/IGF pathway and extends lifespan in diverse organisms (Kennedy et al., by dietary restriction. Interventions that extend lifespan 2007). Here, we discuss these findings and their have also been found to delay or ameliorate the impact of implications. The forkhead family of transcription ageing-related pathology and disease, including cancer. factors is characterized by a type of DNA-binding Understanding the mode of action of forkheads in this domain known as the forkhead box (FOX) (Weigel and context will illuminate the mechanisms by which ageing Jackle, 1990). They are also called winged helix acts as a risk factor for ageing-related disease, and could transcription factors because of the crystal structure lead to the development of a broad-spectrum, preventative ofthe FOX, ofwhich the forkheadscontain a medicine for the diseases of ageing.
    [Show full text]
  • Biophysical Investigation of the Dual Binding Surfaces of Human Transcription Factors FOXO4 and P53
    bioRxiv preprint doi: https://doi.org/10.1101/2021.01.11.425814; this version posted January 11, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Biophysical investigation of the dual binding surfaces of human transcription factors FOXO4 and p53 Jinwoo Kim+, Dabin Ahn+, and Chin-Ju Park* Department of Chemistry, Gwangju Institute of Science and Technology, Gwangju, 61005, Korea *Correspondence to: [email protected]. + These authors contributed equally to this work. 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.01.11.425814; this version posted January 11, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Abstract Cellular senescence is protective against external oncogenic stress, but its accumulation causes aging- related diseases. Forkhead box O4 (FOXO4) and p53 are human transcription factors known to promote senescence by interacting in the promyelocytic leukemia bodies. Inhibiting their binding is a strategy for inducing apoptosis of senescent cells, but the binding surfaces that mediate the interaction of FOXO4 and p53 remain elusive. Here, we investigated two binding sites involved in the interaction between FOXO4 and p53 by using NMR spectroscopy. NMR chemical shift perturbation analysis showed that the binding between FOXO4’s forkhead domain (FHD) and p53’s transactivation domain (TAD), and between FOXO4’s C-terminal transactivation domain (CR3) and p53’s DNA binding domain (DBD), mediate the FOXO4-p53 interaction.
    [Show full text]
  • Table S2.Up Or Down Regulated Genes in Tcof1 Knockdown Neuroblastoma N1E-115 Cells Involved in Differentbiological Process Anal
    Table S2.Up or down regulated genes in Tcof1 knockdown neuroblastoma N1E-115 cells involved in differentbiological process analysed by DAVID database Pop Pop Fold Term PValue Genes Bonferroni Benjamini FDR Hits Total Enrichment GO:0044257~cellular protein catabolic 2.77E-10 MKRN1, PPP2R5C, VPRBP, MYLIP, CDC16, ERLEC1, MKRN2, CUL3, 537 13588 1.944851 8.64E-07 8.64E-07 5.02E-07 process ISG15, ATG7, PSENEN, LOC100046898, CDCA3, ANAPC1, ANAPC2, ANAPC5, SOCS3, ENC1, SOCS4, ASB8, DCUN1D1, PSMA6, SIAH1A, TRIM32, RNF138, GM12396, RNF20, USP17L5, FBXO11, RAD23B, NEDD8, UBE2V2, RFFL, CDC GO:0051603~proteolysis involved in 4.52E-10 MKRN1, PPP2R5C, VPRBP, MYLIP, CDC16, ERLEC1, MKRN2, CUL3, 534 13588 1.93519 1.41E-06 7.04E-07 8.18E-07 cellular protein catabolic process ISG15, ATG7, PSENEN, LOC100046898, CDCA3, ANAPC1, ANAPC2, ANAPC5, SOCS3, ENC1, SOCS4, ASB8, DCUN1D1, PSMA6, SIAH1A, TRIM32, RNF138, GM12396, RNF20, USP17L5, FBXO11, RAD23B, NEDD8, UBE2V2, RFFL, CDC GO:0044265~cellular macromolecule 6.09E-10 MKRN1, PPP2R5C, VPRBP, MYLIP, CDC16, ERLEC1, MKRN2, CUL3, 609 13588 1.859332 1.90E-06 6.32E-07 1.10E-06 catabolic process ISG15, RBM8A, ATG7, LOC100046898, PSENEN, CDCA3, ANAPC1, ANAPC2, ANAPC5, SOCS3, ENC1, SOCS4, ASB8, DCUN1D1, PSMA6, SIAH1A, TRIM32, RNF138, GM12396, RNF20, XRN2, USP17L5, FBXO11, RAD23B, UBE2V2, NED GO:0030163~protein catabolic process 1.81E-09 MKRN1, PPP2R5C, VPRBP, MYLIP, CDC16, ERLEC1, MKRN2, CUL3, 556 13588 1.87839 5.64E-06 1.41E-06 3.27E-06 ISG15, ATG7, PSENEN, LOC100046898, CDCA3, ANAPC1, ANAPC2, ANAPC5, SOCS3, ENC1, SOCS4,
    [Show full text]
  • Up-Regulation of Foxo4 Mediated by Hepatitis B Virus X Protein Confers Resistance to Oxidative Stress-Induced Cell Death
    INTERNATIONAL JOURNAL OF MoleCular MEDICine 28: 255-260, 2011 Up-regulation of Foxo4 mediated by hepatitis B virus X protein confers resistance to oxidative stress-induced cell death Ratakorn SRISUTTEE1, SANG SEOK KOH3, EUN HEE PARK1, IL-RAE CHO1, HYE JIN MIN3, BYUNG HAK JHUN2, DAE-YEUL YU4, SUN PARK5, DO YUN PARK6, MI OCK LEE7, DIEGO H. CASTRILLON8, RANDAL N. Johnston9 and YOUNG-Hwa CHUNG1 1WCU Department of Cogno-Mechatronics Engineering and 2Department of Nanomedical Engineering, BK21 Nanofusion Technology Team, Pusan National University, Busan; 3Therapeutic Antibody Research Center and 4Disease Model Research Center, Korea Research Institute of Bioscience and Biotechnology, Daejeon; 5Department of Microbiology, Ajou University School of Medicine, Suwon; 6Department of Pathology, College of Medicine, Pusan National University, Yangsan; 7College of Pharmacy, Seoul National University, Seoul, Republic of Korea; 8Department of Pathology and Simmons Comprehensive Cancer Center, University of Texas Southwestern Medical Center, Dallas, TX, USA; 9Department of Biochemistry and Molecular Biology, University of Calgary, Calgary, Alberta, Canada Received January 27, 2011; Accepted March 17, 2011 DOI: 10.3892/ijmm.2011.699 Abstract. The hepatitis B virus X (HBX) protein, a regula- may be a useful target for suppression in the treatment of tory protein of the hepatitis B virus (HBV), has been shown HBV-associated hepatocellular carcinoma cells. to generate reactive oxygen species (ROS) in human liver cell lines; however, the mechanism by which cells protect them- Introduction selves under this oxidative stress is poorly understood. Here, we show that HBX induces the up-regulation of Forkhead box The human hepatitis B virus (HBV) induces acute and class O 4 (Foxo4) not only in Chang cells stably expressing chronic hepatitis and is closely associated with the incidence HBX (Chang-HBX) but also in primary hepatic tissues of human liver cancer (1,2).
    [Show full text]
  • Reduced Expression of PROX1 Transitions Glioblastoma Cells Into a Mesenchymal
    Author Manuscript Published OnlineFirst on August 22, 2018; DOI: 10.1158/0008-5472.CAN-18-0320 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Title: Reduced expression of PROX1 transitions glioblastoma cells into a mesenchymal gene expression subtype Running title: PROX1 regulation of glioblastoma subtype Author list: Kaveh M. Goudarzi1, Jaime A. Espinoza1, Min Guo2, Jiri Bartek1&3, Monica Nistér2, Mikael S. Lindström1, Daniel Hägerstrand2 Author affiliations: 1SciLifeLab, Division of Genome Biology, Department of Medical Biochemistry and Biophysics, Karolinska Institutet, SE-171 21 Stockholm, Sweden. 2Cancer Center Karolinska, Department of Oncology- Pathology, Karolinska Institutet and Karolinska University Hospital at Solna, SE-171 76 Stockholm, Sweden. 3The Danish Cancer Society Research Centre, DK-2100, Copenhagen, Denmark. Corresponding author contact information: email: [email protected] phone: +46 70 569 87 36 address: Department of Oncology-Pathology, Cancer Center Karolinska, CCK R8:05, Karolinska Institutet and Karolinska University Hospital at Solna, SE-171 76 Stockholm, Sweden. Conflict of Interest: The authors have no conflicts of interest to declare. Downloaded from cancerres.aacrjournals.org on September 28, 2021. © 2018 American Association for Cancer Research. Author Manuscript Published OnlineFirst on August 22, 2018; DOI: 10.1158/0008-5472.CAN-18-0320 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Abstract The homeodomain transcription factor PROX1 has been linked to several cancer types including gliomas, but its functions remain to be further elucidated. Here we describe a functional role and the prognostic value of PROX1 in glioblastoma. Low expression of PROX1 correlated with poor overall survival and the mesenchymal glioblastoma subtype signature.
    [Show full text]