DOCSLIB.ORG

Reduced Expression of PROX1 Transitions Glioblastoma Cells Into a Mesenchymal

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Reduced Expression of PROX1 Transitions Glioblastoma Cells Into a Mesenchymal Author Manuscript Published OnlineFirst on August 22, 2018; DOI: 10.1158/0008-5472.CAN-18-0320 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Title: Reduced expression of PROX1 transitions glioblastoma cells into a mesenchymal gene expression subtype Running title: PROX1 regulation of glioblastoma subtype Author list: Kaveh M. Goudarzi1, Jaime A. Espinoza1, Min Guo2, Jiri Bartek1&3, Monica Nistér2, Mikael S. Lindström1, Daniel Hägerstrand2 Author affiliations: 1SciLifeLab, Division of Genome Biology, Department of Medical Biochemistry and Biophysics, Karolinska Institutet, SE-171 21 Stockholm, Sweden. 2Cancer Center Karolinska, Department of Oncology- Pathology, Karolinska Institutet and Karolinska University Hospital at Solna, SE-171 76 Stockholm, Sweden. 3The Danish Cancer Society Research Centre, DK-2100, Copenhagen, Denmark. Corresponding author contact information: email: [email protected] phone: +46 70 569 87 36 address: Department of Oncology-Pathology, Cancer Center Karolinska, CCK R8:05, Karolinska Institutet and Karolinska University Hospital at Solna, SE-171 76 Stockholm, Sweden. Conflict of Interest: The authors have no conflicts of interest to declare. Downloaded from cancerres.aacrjournals.org on September 28, 2021. © 2018 American Association for Cancer Research. Author Manuscript Published OnlineFirst on August 22, 2018; DOI: 10.1158/0008-5472.CAN-18-0320 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Abstract The homeodomain transcription factor PROX1 has been linked to several cancer types including gliomas, but its functions remain to be further elucidated. Here we describe a functional role and the prognostic value of PROX1 in glioblastoma. Low expression of PROX1 correlated with poor overall survival and the mesenchymal glioblastoma subtype signature. The latter finding was recapitulated in vitro where suppression or overexpression of PROX1 in glioma cell cultures transitioned cells to a mesenchymal or to a non-mesenchymal glioblastoma gene expression signature, respectively. PROX1 modulation affected proliferation rates that coincided with changes in protein levels of CCNA1 and CCNE1 as well as the cyclin inhibitors CDKN1A, CDKN1B, and CDKN1C. Overexpression of SOX2 increased PROX1 expression, but treatment with a CDK2 inhibitor subsequently decreased PROX1 expression, which was paralleled by decreased SOX2 levels. The THRAP3 protein was a novel binding partner for PROX1, and suppression of THRAP3 increased both transcript and protein levels of PROX1. Together these findings highlight the prognostic value of PROX1 and its role as a regulator of glioblastoma gene expression subtypes, intratumoral heterogeneity, proliferation, and cell cycle control. 2 Downloaded from cancerres.aacrjournals.org on September 28, 2021. © 2018 American Association for Cancer Research. Author Manuscript Published OnlineFirst on August 22, 2018; DOI: 10.1158/0008-5472.CAN-18-0320 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Introduction Glioblastoma represents the most common and aggressive primary brain tumor type in adults (1). Its intrusive growth and the plastic nature of the tumor make complete surgical resection impossible and the tumor cells prone to evade chemo- and radiation therapy (2). Stem cell regulatory pathways are shown activated in gliomas supporting self-renewal, tumor maintenance and survival under stress (3). Furthermore, glioblastomas are very heterogeneous on an intratumoral level, composed of tumor cells displaying different gene expression signatures constituting the different glioblastoma tumor subtypes (4). Thus, a glioma stem-like phenotype, cell motility and tumor cell heterogeneity are considered significant hurdles to overcome for developing new treatment against these tumors (5,6). Glioblastoma may arise from adult neural stem cells or multipotent neural progenitor cells that persist in proliferative niches in the human central nervous system, or alternatively from differentiated cells of different lineages as for example astrocytes or oligodendrocytes (7). The human glioblastoma transcriptome has been found to resemble normal outer radial glial cells and intermediate progenitors (8). In support of this, it was recently shown that glioblastoma initiation is associated to aberrant reactivation of a normal developmental program in the brain (9). Therefore, a better understanding of developmental pathways and their involvement in glioblastoma is thought to lead to new therapeutic possibilities. PROX1 (Prospero-Related Homeobox 1) is a transcription factor that mediates cell fate decisions of neuroblasts, as reviewed in (10). In several instances PROX1 has been shown to play an active role in cancer. For example, PROX1 suppresses the growth of neuroblastoma (11), whereas it enhances colorectal cancer progression as a - 3 Downloaded from cancerres.aacrjournals.org on September 28, 2021. © 2018 American Association for Cancer Research. Author Manuscript Published OnlineFirst on August 22, 2018; DOI: 10.1158/0008-5472.CAN-18-0320 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. catenin/TCF/LEF target gene contributing to a transition from early to a dysplastic stage (12). Prox1 regulates the number of cancer stem cells, by promoting cell proliferation and thereby expanding the cancer stem cell population in intestinal adenomas and colorectal cancer after activation of the Wnt-pathway (13). In human astrocytic brain tumors, the percentage of PROX1+ cells has been shown to increase with tumor grade (14). Furthermore, level of PROX1 predicted survival in grade II gliomas, where a percentage of PROX1+ cells over 10% correlated with worse outcome (15). Moreover, PROX1 has been proposed as a novel pathway-specific prognostic biomarker for high-grade astrocytomas (16). Here we sought further understanding of the role of PROX1 in glioblastoma by analyzing publicly available gene expression data from tumor samples and by performing in vitro experiments. 4 Downloaded from cancerres.aacrjournals.org on September 28, 2021. © 2018 American Association for Cancer Research. Author Manuscript Published OnlineFirst on August 22, 2018; DOI: 10.1158/0008-5472.CAN-18-0320 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Material and methods Cell culture Glioblastoma cell lines U-343 MG, U-343 MGa, U-343 MGa Cl2:6, U118MG, U178MG, U373MG, and U1242MG have previously been characterized (17-21) and references therein. The high-grade glioma cultures 4, 11 and 18 were initially characterized based on gene expression and phenotypes (22), and have in other studies also been referred to as U2975, U2982 and U2987 (23), respectively. For unity, these cultures are referred to as U2975(4), U2982(11) and U2987(18) in this study. The cell lines and cultures above were retrieved from authors’ lab stocks (22) and subsequently cultured for less than 3 months. All cell lines were maintained in Dulbecco’s modified Eagle’s medium (DMEM) (Thermo Fisher Scientific) with 10% FBS, 2mM L-glutamine and penicillin-streptomycin at 37°C with 5% CO2, and 5% O2 and >95% humidity. The other glioma cell lines (U87MG, U251MG, M059J and M059K), as well as the osteosarcoma line U2-OS and colon cancer line SW480 were purchased from ATCC and cultured per standard guidelines for less than a month. SOX2 and YFP (control) overexpressing U-343 MG cultures were generated by lentiviral transduction with pLEX-Blast-V5-SOX2 and pLEX- Blast-V5-YFP by methods previously described (24). To confirm the relationship between the U-343 clones they were subjected to STR profiling at NGI-Uppsala, SciLifeLab, Uppsala University, using the AmpFISTR Identifiler PCR Amplification kit (Thermo Fisher) (Table S1). The cultures used in this study were screened for mycoplasma using the MycoAlert™ Mycoplasma Detection Kit (LT07-218, Lonza). Stock solution of CVT-313 (Santa Cruz) was prepared by dissolving powder in DMSO, stored at -20 ℃, and used by dissolving stock solution in cell culture media and incubating with cells at concentration and time indicated. 5 Downloaded from cancerres.aacrjournals.org on September 28, 2021. © 2018 American Association for Cancer Research. Author Manuscript Published OnlineFirst on August 22, 2018; DOI: 10.1158/0008-5472.CAN-18-0320 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Lentiviral transduction and transfection of plasmids or siRNA constructs To generate a PROX1 overexpressing cell culture, U-343 MG-PROX1, purified lentivirus (Lentifect™) for PROX1 transduction into U-343 MG was purchased (PROX1 containing virus LPP-F0925-Lv105-100-S and negative control virus LPP-NEG-LV105-100-C, GeneCopoeia), and used according to manufacturer’s instructions. To study PROX1 suppression in U-343 MGa, the cell line U-343 MGa-shPROX1 was generated using lentiviral vectors against PROX1 (TRCN0000232123, Sigma-Aldrich) or unrelated control shRNA targeting GFP (TRCN0000072178, clonetechGfp_438s1c1, previously described (24)). Virus production was performed by calcium-phosphate-mediated co- transfection of HEK 293T cells with packaging plasmids (MISSION Lentiviral Packaging Mix, SHP001, Sigma-Aldrich). 24 hours after transfection the different supernatants were collected two times with 24-hour intervals, filtered and then used to
Load more

Recommended publications
  • Loss of Mafb and Maf Distorts Myeloid Cell Ratios and Disrupts Fetal Mouse Testis Vascularization and Organogenesisǂ
    bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441488; this version posted April 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Loss of Mafb and Maf distorts myeloid cell ratios and disrupts fetal mouse testis vascularization and organogenesisǂ 5 Shu-Yun Li1,5, Xiaowei Gu1,5, Anna Heinrich1, Emily G. Hurley1,2,3, Blanche Capel4, and Tony DeFalco1,2* 1Division of Reproductive Sciences, Cincinnati Children’s Hospital Medical Center, Cincinnati, 10 OH 45229, USA 2Department of Pediatrics, University of Cincinnati College of Medicine, Cincinnati, OH 45267 USA 3Department of Obstetrics and Gynecology, University of Cincinnati College of Medicine, Cincinnati, OH 45267 USA 15 4Department of Cell Biology, Duke University Medical Center, Durham, NC 27710 USA 5These authors contributed equally to this work. ǂThis work was supported by the National Institutes of Health (R37HD039963 to BC, R35GM119458 to TD, R01HD094698 to TD, F32HD058433 to TD); March of Dimes (1-FY10- 355 to BC, Basil O’Connor Starter Scholar Award 5-FY14-32 to TD); Lalor Foundation 20 (postdoctoral fellowship to SL); and Cincinnati Children’s Hospital Medical Center (Research Innovation and Pilot funding, Trustee Award, and developmental funds to TD). *Corresponding Author: Tony DeFalco E-mail: [email protected] 25 Address: Division of Reproductive Sciences Cincinnati Children’s Hospital Medical Center 3333 Burnet Avenue, MLC 7045 Cincinnati, OH 45229 USA Phone: +1-513-803-3988 30 Fax: +1-513-803-1160 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441488; this version posted April 26, 2021.
    [Show full text]
  • Reconstruction of the Global Neural Crest Gene Regulatory Network in Vivo
    Reconstruction of the global neural crest gene regulatory network in vivo Ruth M Williams1, Ivan Candido-Ferreira1, Emmanouela Repapi2, Daria Gavriouchkina1,4, Upeka Senanayake1, Jelena Telenius2,3, Stephen Taylor2, Jim Hughes2,3, and Tatjana Sauka-Spengler1,∗ Supplemental Material ∗Lead and corresponding author: Tatjana Sauka-Spengler ([email protected]) 1University of Oxford, MRC Weatherall Institute of Molecular Medicine, Radcliffe Department of Medicine, Oxford, OX3 9DS, UK 2University of Oxford, MRC Centre for Computational Biology, MRC Weatherall Institute of Molecular Medicine, Oxford, OX3 9DS, UK 3University of Oxford, MRC Molecular Haematology Unit, MRC Weatherall Institute of Molecular Medicine, Oxford, OX3 9DS, UK 4Present Address: Okinawa Institute of Science and Technology, Molecular Genetics Unit, Onna, 904-0495, Japan A 25 25 25 25 25 20 20 20 20 20 15 15 15 15 15 10 10 10 10 10 log2(R1_5-6ss) log2(R1_5-6ss) log2(R1_8-10ss) log2(R1_8-10ss) log2(R1_non-NC) 5 5 5 5 5 0 r=0.92 0 r=0.99 0 r=0.96 0 r=0.99 0 r=0.96 0 5 10 15 20 25 0 5 10 15 20 25 0 5 10 15 20 25 0 5 10 15 20 25 0 5 10 15 20 25 log2(R2_non-NC) log2(R2_5-6ss) log2(R3_5-6ss) log2(R2_8-10ss) log2(R3_8-10ss) 25 25 25 25 25 20 20 20 20 20 15 15 15 15 15 10 10 10 10 10 log2(R1_5-6ss) log2(R2_5-6ss) log2(R1_8-10ss) log2(R2_8-10ss) log2(R1_non-NC) 5 5 5 5 5 0 r=0.94 0 r=0.96 0 r=0.95 0 r=0.96 0 r=0.95 0 5 10 15 20 25 0 5 10 15 20 25 0 5 10 15 20 25 0 5 10 15 20 25 0 5 10 15 20 25 log2(R3_non-NC) log2(R4_5-6ss) log2(R3_5-6ss) log2(R4_8-10ss) log2(R3_8-10ss)
    [Show full text]
  • Tomo-Seq Identifies SOX9 As a Key Regulator of Cardiac Fibrosis During Ischemic Injury
    myocardial myocardial Eva van ◼ osis fibr SOX9 transcription ◼ PhD* PhD PhD PhD MSc, PhD naarden, MSc, PhD naarden, PhD* ventricular remodeling Correspondence to: Correspondence Rooij, MSc, PhD, Hubrecht Department of Institute, KNAW University Medical Cardiology, Uppsalalaan 8, Center Utrecht, The Netherlands. 3584CT Utrecht, E-mail [email protected] of Funding, see page 1408 Sources Key Words: ischemia ◼ © 2017 American Heart Association, Inc. *Drs. Lacraz and Junker contributed equally. Grégory P.A. Lacraz, MSc, P.A. Grégory MSc, Jan Philipp Junker, Monika M. Gladka, MSc, MSc Bas Molenaar, Scholman, MSc Koen T. MSc Marta Vigil-Garcia, BS Danielle Versteeg, BS Hesther de Ruiter, MSc, Vermunt, Marit W. MSc, Creyghton, Menno P. Manon M.H. Huibers, Nicolaas de Jonge, MD Alexander van Oude- Eva van Rooij, MSc, PhD 2017;136:1396–1409. DOI: 10.1161/CIRCULATIONAHA.117.027832 DOI: 2017;136:1396–1409. Circulation. blunted the cardiac fibrotic fibrotic blunted the cardiac Sox9 ). Subsequent correlation analysis allowed). Subsequent correlation Serca2 Editorial, see p 1410 , and Nppa Based on the exact local expression cues, tomo-seq can Based on the exact local expression Cardiac ischemic injury induces a pathological remodeling ischemic injury induces a pathological remodeling Cardiac , Although genome-wide transcriptome analysis on diseased tissues Tracing transcriptional differences with a high spatial resolution with a high spatial resolution transcriptional differences Tracing Col1a2 October 10, 2017 October 10, 1396 CONCLUSIONS: novel genes and key transcription factors involved in specific serve to reveal able to unveil the Using tomo-seq, we were remodeling. aspects of cardiac pointing fibrosis, of cardiac of SOX9 as a key regulator unknown relevance fibrosis.
    [Show full text]
  • The Versatile Functions of Sox9 in Development, Stem Cells, And
    Genes & Diseases (2014) 1, 149e161 HOSTED BY Available online at www.sciencedirect.com ScienceDirect journal homepage: http://ees.elsevier.com/gendis/default.asp REVIEW ARTICLE The versatile functions of Sox9 in development, stem cells, and human diseases Alice Jo a, Sahitya Denduluri a, Bosi Zhang a, Zhongliang Wang a,b, Liangjun Yin a,b, Zhengjian Yan a,b, Richard Kang a, Lewis L. Shi a, James Mok a, Michael J. Lee a, Rex C. Haydon a,* a Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, IL 60637, USA b Departments of Orthopaedic Surgery, The Affiliated Hospitals of Chongqing Medical University, Chongqing 400046, China Received 3 September 2014; accepted 6 September 2014 Available online 16 October 2014 KEYWORDS Abstract The transcription factor Sox9 was first discoveredinpatientswithcampomelic Development; dysplasia, a haploinsufficiency disorder with skeletal deformities caused by dysregulation of Sox9; Sox9 expression during chondrogenesis. Since then, its role as a cell fate determiner during Stem cells; embryonic development has been well characterized; Sox9 expression differentiates cells Transcription factor derived from all three germ layers into a large variety of specialized tissues and organs. How- ever, recent data has shown that ectoderm- and endoderm-derived tissues continue to express Sox9 in mature organs and stem cell pools, suggesting its role in cell maintenance and speci- fication during adult life. The versatility of Sox9 may be explained by a combination of post- transcriptional modifications, binding partners, and the tissue type in which it is expressed. Considering its importance during both development and adult life, it follows that dysregula- tion of Sox9 has been implicated in various congenital and acquired diseases, including fibrosis and cancer.
    [Show full text]
  • Curcumin Attenuates Environment-Derived Osteoarthritis by Sox9/NF-Kb Signaling Axis
    International Journal of Molecular Sciences Article Curcumin Attenuates Environment-Derived Osteoarthritis by Sox9/NF-kB Signaling Axis Constanze Buhrmann 1,2, Aranka Brockmueller 1, Anna-Lena Mueller 1, Parviz Shayan 3 and Mehdi Shakibaei 1,* 1 Musculoskeletal Research Group and Tumor Biology, Chair of Vegetative Anatomy, Institute of Anatomy, Faculty of Medicine, Ludwig-Maximilian-University Munich, Pettenkoferstr. 11, D-80336 Munich, Germany; [email protected] (C.B.); [email protected] (A.B.); [email protected] (A.-L.M.) 2 Institute of Anatomy and Cell Biology, Faculty of Medicine, University of Augsburg, Universitaetsstr. 2, D-86159 Augsburg, Germany 3 Department of Parasitology, Faculty of Veterinary Medicine, University of Tehran, Tehran 141556453, Iran; [email protected] * Correspondence: [email protected]; Tel.: +49-89-2180-72624 Abstract: Inflammation has a fundamental impact on the pathophysiology of osteoarthritis (OA), a common form of degenerative arthritis. It has previously been established that curcumin, a component of turmeric (Curcuma longa), has anti-inflammatory properties. This research evaluates the potentials of curcumin on the pathophysiology of OA in vitro. To explore the anti-inflammatory efficacy of curcumin in an inflamed joint, an osteoarthritic environment (OA-EN) model consisting of fibroblasts, T-lymphocytes, 3D-chondrocytes is constructed and co-incubated with TNF-α, antisense oligonucleotides targeting NF-kB (ASO-NF-kB), or an IkB-kinase (IKK) inhibitor (BMS-345541). Our results show that OA-EN, similar to TNF-α, suppresses chondrocyte viability, which is accompanied Citation: Buhrmann, C.; by a significant decrease in cartilage-specific proteins (collagen II, CSPG, Sox9) and an increase in NF- Brockmueller, A.; Mueller, A.-L.; kB-driven gene proteins participating in inflammation, apoptosis, and breakdown (NF-kB, MMP-9, Shayan, P.; Shakibaei, M.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Table S2.Up Or Down Regulated Genes in Tcof1 Knockdown Neuroblastoma N1E-115 Cells Involved in Differentbiological Process Anal
    Table S2.Up or down regulated genes in Tcof1 knockdown neuroblastoma N1E-115 cells involved in differentbiological process analysed by DAVID database Pop Pop Fold Term PValue Genes Bonferroni Benjamini FDR Hits Total Enrichment GO:0044257~cellular protein catabolic 2.77E-10 MKRN1, PPP2R5C, VPRBP, MYLIP, CDC16, ERLEC1, MKRN2, CUL3, 537 13588 1.944851 8.64E-07 8.64E-07 5.02E-07 process ISG15, ATG7, PSENEN, LOC100046898, CDCA3, ANAPC1, ANAPC2, ANAPC5, SOCS3, ENC1, SOCS4, ASB8, DCUN1D1, PSMA6, SIAH1A, TRIM32, RNF138, GM12396, RNF20, USP17L5, FBXO11, RAD23B, NEDD8, UBE2V2, RFFL, CDC GO:0051603~proteolysis involved in 4.52E-10 MKRN1, PPP2R5C, VPRBP, MYLIP, CDC16, ERLEC1, MKRN2, CUL3, 534 13588 1.93519 1.41E-06 7.04E-07 8.18E-07 cellular protein catabolic process ISG15, ATG7, PSENEN, LOC100046898, CDCA3, ANAPC1, ANAPC2, ANAPC5, SOCS3, ENC1, SOCS4, ASB8, DCUN1D1, PSMA6, SIAH1A, TRIM32, RNF138, GM12396, RNF20, USP17L5, FBXO11, RAD23B, NEDD8, UBE2V2, RFFL, CDC GO:0044265~cellular macromolecule 6.09E-10 MKRN1, PPP2R5C, VPRBP, MYLIP, CDC16, ERLEC1, MKRN2, CUL3, 609 13588 1.859332 1.90E-06 6.32E-07 1.10E-06 catabolic process ISG15, RBM8A, ATG7, LOC100046898, PSENEN, CDCA3, ANAPC1, ANAPC2, ANAPC5, SOCS3, ENC1, SOCS4, ASB8, DCUN1D1, PSMA6, SIAH1A, TRIM32, RNF138, GM12396, RNF20, XRN2, USP17L5, FBXO11, RAD23B, UBE2V2, NED GO:0030163~protein catabolic process 1.81E-09 MKRN1, PPP2R5C, VPRBP, MYLIP, CDC16, ERLEC1, MKRN2, CUL3, 556 13588 1.87839 5.64E-06 1.41E-06 3.27E-06 ISG15, ATG7, PSENEN, LOC100046898, CDCA3, ANAPC1, ANAPC2, ANAPC5, SOCS3, ENC1, SOCS4,
    [Show full text]
  • Estrogen Promotes Mandibular Condylar Fibrocartilage
    www.nature.com/scientificreports OPEN Estrogen Promotes Mandibular Condylar Fibrocartilage Chondrogenesis and Inhibits Received: 27 November 2017 Accepted: 18 May 2018 Degeneration via Estrogen Published: xx xx xxxx Receptor Alpha in Female Mice Jennifer L. Robinson 1,3, Paola Soria2, Manshan Xu2, Mark Vrana1, Jefrey Luchetti1, Helen H. Lu3, Jing Chen2 & Sunil Wadhwa2 Temporomandibular joint degenerative disease (TMJ-DD) is a chronic form of TMJ disorder that specifcally aficts people over the age of 40 and targets women at a higher rate than men. Prevalence of TMJ-DD in this population suggests that estrogen loss plays a role in the disease pathogenesis. Thus, the goal of the present study was to determine the role of estrogen on chondrogenesis and homeostasis via estrogen receptor alpha (ERα) during growth and maturity of the joint. Young and mature WT and ERαKO female mice were subjected to ovariectomy procedures and then given placebo or estradiol treatment. The efect of estrogen via ERα on fbrocartilage morphology, matrix production, and protease activity was assessed. In the young mice, estrogen via ERα promoted mandibular condylar fbrocartilage chondrogenesis partly by inhibiting the canonical Wnt signaling pathway through upregulation of sclerostin (Sost). In the mature mice, protease activity was partly inhibited with estrogen treatment via the upregulation and activity of protease inhibitor 15 (Pi15) and alpha-2- macroglobulin (A2m). The results from this work provide a mechanistic understanding of estradiol on TMJ growth and homeostasis and can be utilized for development of therapeutic targets to promote regeneration and inhibit degeneration of the mandibular condylar fbrocartilage. Temporomandibular joint degenerative disease (TMJ-DD) is marked by degradation and premature calcifcation of the extracellular matrix (ECM) of the articular mandibular condylar fbrocartilage.
    [Show full text]
  • Control of the Autophagy Pathway in Osteoarthritis: Key Regulators, Therapeutic Targets and Therapeutic Strategies
    International Journal of Molecular Sciences Review Control of the Autophagy Pathway in Osteoarthritis: Key Regulators, Therapeutic Targets and Therapeutic Strategies Maria Teresa Valenti 1 , Luca Dalle Carbonare 1,* , Donato Zipeto 2 and Monica Mottes 2 1 Department of Medicine, Section of Internal Medicine, University of Verona, 37134 Verona, Italy; [email protected] 2 Department of Neurosciences, Biomedicine and Movement Sciences, Section of Biology and Genetics, University of Verona, 37134 Verona, Italy; [email protected] (D.Z.); [email protected] (M.M.) * Correspondence: [email protected]; Tel.: +39-045-8126062 Abstract: Autophagy is involved in different degenerative diseases and it may control epigenetic modifications, metabolic processes, stem cells differentiation as well as apoptosis. Autophagy plays a key role in maintaining the homeostasis of cartilage, the tissue produced by chondrocytes; its impairment has been associated to cartilage dysfunctions such as osteoarthritis (OA). Due to their location in a reduced oxygen context, both differentiating and mature chondrocytes are at risk of premature apoptosis, which can be prevented by autophagy. AutophagomiRNAs, which regulate the autophagic process, have been found differentially expressed in OA. AutophagomiRNAs, as well as other regulatory molecules, may also be useful as therapeutic targets. In this review, we describe and discuss the role of autophagy in OA, focusing mainly on the control of autophagomiRNAs in OA pathogenesis and their potential therapeutic applications. Citation: Valenti, M.T.; Dalle Keywords: mesenchimal stem cells; chondrocytic commitment; autophagy; osteoarthritis; miRNAs Carbonare, L.; Zipeto, D.; Mottes, M. Control of the Autophagy Pathway in Osteoarthritis: Key Regulators, Therapeutic Targets and Therapeutic 1. Background Strategies.
    [Show full text]
  • MAFB Promotes Cancer Stemness and Tumorigenesis in Osteosarcoma Through a Sox9-Mediated Positive Feedback Loop
    Author Manuscript Published OnlineFirst on March 31, 2020; DOI: 10.1158/0008-5472.CAN-19-1764 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. MAFB promotes cancer stemness and tumorigenesis in osteosarcoma through a Sox9-mediated positive feedback loop Yanyan Chen1,†, Bin Wang2, †, Mengxi Huang1, †, Tao Wang 2, †, Chao Hu 3,†, Qin Liu 2, Dong Han 4, Cheng Chen1, Junliang Zhang5, Zhiping Li4, Chao Liu 6, Wenbin Lei 7,Yue Chang1, Meijuan Wu1,Dan Xiang1, Yitian Chen1, Rui Wang1, Weiqian Huang5, Zengjie Lei1 ,* and Xiaoyuan Chu1, * 1 Department of Medical Oncology, Affiliated Jinling Hospital, Medical School of Nanjing University, Nanjing, Jiangsu Province, People’s Republic of China 2 Department of Gastroenterology, Daping Hospital, Third Military Medical University (Ar- my Medical University), Chongqing, People’s Republic of China 3 Department of Orthopedics, 904 Hospital of PLA, North Xingyuan Road, Beitang Dis- trict, Wuxi, Jiangsu, People’s Republic of China 4 Department of Medical Oncology, Jinling Hospital, Nanjing Clinical School of Southern Medical University, Nanjing, Jiangsu Province, People’s Republic of China 5 Department of Orthopedics, Affiliated Jinling Hospital, Medical School of Nanjing Univer- sity, Nanjing, Jiangsu Province, People’s Republic of China 6 Department of Medical Oncology, Jinling Hospital, Nanjing Clinical School of Nanjing Medical University, Nanjing, Jiangsu Province, People’s Republic of China 7Department of Orthopedics, Tianshui Cooperation of Chinese and Western Medicine Hospi- tal, Tianshui, Gansu Province, People’s Republic of China * To whom correspondence should be addressed. Xiaoyuan Chu, Tel: +86-25-80860131, Fax: +86-25-80860131, Email: [email protected]; Zengjie Lei, Email: leiz- [email protected] ; †The authors wish it to be known that, in their opinion, the first five authors should be regard- ed as joint First Authors.
    [Show full text]
  • The Prrx1 Homeodomain Transcription Factor Plays a Central Role in Pancreatic Regeneration and Carcinogenesis
    Downloaded from genesdev.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press The Prrx1 homeodomain transcription factor plays a central role in pancreatic regeneration and carcinogenesis Maximilian Reichert,1,2,3 Shigetsugu Takano,1,2,3 Johannes von Burstin,1,2,3 Sang-Bae Kim,4 Ju-Seog Lee,4 Kaori Ihida-Stansbury,5,6 Christopher Hahn,1,2,3 Steffen Heeg,1,2,3 Gu¨ nter Schneider,7 Andrew D. Rhim,1,2,3 Ben Z. Stanger,1,2,3 and Anil K. Rustgi1,2,3,8,9 1Division of Gastroenterology, 2Department of Medicine, 3Abramson Cancer Center, University of Pennsylvania, Philadelphia, Pennsylvania 19104, USA; 4Department of Systems Biology, The University of Texas MD Anderson Cancer Center, Houston, Texas 77054, USA; 5Department of Medicine and Pathology, 6Laboratory Medicine, University of Pennsylvania, Philadelphia, Pennsylvania 19104, USA; 7II. Medizinische Klinik, Technical University of Munich, Munich 81675, Germany; 8Department of Genetics, University of Pennsylvania, Philadelphia, Pennsylvania 19104, USA Pancreatic exocrine cell plasticity can be observed during development, pancreatitis with subsequent regenera- tion, and also transformation. For example, acinar–ductal metaplasia (ADM) occurs during acute pancreatitis and might be viewed as a prelude to pancreatic intraepithelial neoplasia (PanIN) and pancreatic ductal adenocarcinoma (PDAC) development. To elucidate regulatory processes that overlap ductal development, ADM, and the progression of normal cells to PanIN lesions, we undertook a systematic approach to identify the Prrx1 paired homeodomain Prrx1 transcriptional factor as a highly regulated gene in these processes. Prrx1 annotates a subset of pancreatic ductal epithelial cells in Prrx1creERT2-IRES-GFP mice. Furthermore, sorted Prrx1+ cells have the capacity to self-renew and expand during chronic pancreatitis.
    [Show full text]
  • Single Cell Transcriptomic Analysis of Human Pluripotent Stem Cell Chondrogenesis
    ARTICLE https://doi.org/10.1038/s41467-020-20598-y OPEN Single cell transcriptomic analysis of human pluripotent stem cell chondrogenesis Chia-Lung Wu1,2,5,6, Amanda Dicks1,2,3,6, Nancy Steward1,2, Ruhang Tang1,2, Dakota B. Katz1,2,3, ✉ Yun-Rak Choi1,2,4 & Farshid Guilak 1,2,3 The therapeutic application of human induced pluripotent stem cells (hiPSCs) for cartilage regeneration is largely hindered by the low yield of chondrocytes accompanied by unpre- 1234567890():,; dictable and heterogeneous off-target differentiation of cells during chondrogenesis. Here, we combine bulk RNA sequencing, single cell RNA sequencing, and bioinformatic analyses, including weighted gene co-expression analysis (WGCNA), to investigate the gene reg- ulatory networks regulating hiPSC differentiation under chondrogenic conditions. We identify specific WNTs and MITF as hub genes governing the generation of off-target differentiation into neural cells and melanocytes during hiPSC chondrogenesis. With heterocellular signaling models, we further show that WNT signaling produced by off-target cells is responsible for inducing chondrocyte hypertrophy. By targeting WNTs and MITF, we eliminate these cell lineages, significantly enhancing the yield and homogeneity of hiPSC-derived chondrocytes. Collectively, our findings identify the trajectories and molecular mechanisms governing cell fate decision in hiPSC chondrogenesis, as well as dynamic transcriptome profiles orches- trating chondrocyte proliferation and differentiation. 1 Dept. of Orthopaedic Surgery, Washington University in Saint Louis, St. Louis, MO 63110, USA. 2 Shriners Hospitals for Children—St. Louis, St. Louis, MO 63110, USA. 3 Dept. of Biomedical Engineering, Washington University in Saint Louis, St. Louis, MO 63110, USA. 4 Dept. of Orthopaedic Surgery, Yonsei University, Seoul, South Korea.
    [Show full text]