DOCSLIB.ORG

Control of the Autophagy Pathway in Osteoarthritis: Key Regulators, Therapeutic Targets and Therapeutic Strategies

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Control of the Autophagy Pathway in Osteoarthritis: Key Regulators, Therapeutic Targets and Therapeutic Strategies International Journal of Molecular Sciences Review Control of the Autophagy Pathway in Osteoarthritis: Key Regulators, Therapeutic Targets and Therapeutic Strategies Maria Teresa Valenti 1 , Luca Dalle Carbonare 1,* , Donato Zipeto 2 and Monica Mottes 2 1 Department of Medicine, Section of Internal Medicine, University of Verona, 37134 Verona, Italy; [email protected] 2 Department of Neurosciences, Biomedicine and Movement Sciences, Section of Biology and Genetics, University of Verona, 37134 Verona, Italy; [email protected] (D.Z.); [email protected] (M.M.) * Correspondence: [email protected]; Tel.: +39-045-8126062 Abstract: Autophagy is involved in different degenerative diseases and it may control epigenetic modifications, metabolic processes, stem cells differentiation as well as apoptosis. Autophagy plays a key role in maintaining the homeostasis of cartilage, the tissue produced by chondrocytes; its impairment has been associated to cartilage dysfunctions such as osteoarthritis (OA). Due to their location in a reduced oxygen context, both differentiating and mature chondrocytes are at risk of premature apoptosis, which can be prevented by autophagy. AutophagomiRNAs, which regulate the autophagic process, have been found differentially expressed in OA. AutophagomiRNAs, as well as other regulatory molecules, may also be useful as therapeutic targets. In this review, we describe and discuss the role of autophagy in OA, focusing mainly on the control of autophagomiRNAs in OA pathogenesis and their potential therapeutic applications. Citation: Valenti, M.T.; Dalle Keywords: mesenchimal stem cells; chondrocytic commitment; autophagy; osteoarthritis; miRNAs Carbonare, L.; Zipeto, D.; Mottes, M. Control of the Autophagy Pathway in Osteoarthritis: Key Regulators, Therapeutic Targets and Therapeutic 1. Background Strategies. Int. J. Mol. Sci. 2021, 22, Chondrogenesis, the process by which cartilage is formed, occurs as a result of mes- 2700. https://doi.org/10.3390/ enchymal cell condensation and chondroprogenitor cell differentiation. SOX9 is the master ijms22052700 transcription factor for MSCs differentiation into chondrocytes [1]. During development, chondrogenesis is subject to complex regulation by several interplaying factors such as Academic Editor: Nicola Veronese fibroblast growth factor (FGF), transforming growth factor β (TGFβ), bone morphogenetic proteins (BMPs) and Wnt signaling pathways. Among regulatory factors, TGFβ plays a key Received: 16 February 2021 role in development. TGFβ receptors are present in many cells, and an integrin-applied Accepted: 4 March 2021 β Published: 7 March 2021 force is required to release TGF- from its prodomain. Force application has been shown to occurs through the prodomain of TGF-β and through the β subunit of the integrin [2]. Publisher’s Note: MDPI stays neutral In the process termed endochondral ossification, chondrocytes undergo proliferation and with regard to jurisdictional claims in terminal differentiation to hypertrophy and apoptosis, whereby hypertrophic cartilage is published maps and institutional affil- replaced by bone tissue. In mature articular cartilage, instead, chondrocytes are respon- iations. sible for the production and homeostatic maintenance of the extracellular matrix (ECM) components. Structural ECM components are: collagens (mainly type II collagen), proteoglycans, (including aggrecan, decorin, biglycan and fibromodulin) and noncollagenous proteins, such as cartilage oligomeric protein (COMP), cartilage matrix protein (CMP) and fibronectin. Copyright: © 2021 by the authors. Licensee MDPI, Basel, Switzerland. The primary matrix degrading enzymes involved in cartilage turnover are metallopro- This article is an open access article teinases (MMPs) and cathepsins (CTS). In healthy articular cartilage, balanced degradation distributed under the terms and and synthesis by chondrocytes ensure tissue homeostasis. conditions of the Creative Commons Autophagy plays a key role in the preservation of cartilage integrity [3]. Besides Attribution (CC BY) license (https:// playing a crucial role in adaptive response to different stimuli, it is also required for creativecommons.org/licenses/by/ intracellular quality control and is involved in removing and recycling misfolded proteins, 4.0/). damaged organelles or dysfunctional cell components [4]. Int. J. Mol. Sci. 2021, 22, 2700. https://doi.org/10.3390/ijms22052700 https://www.mdpi.com/journal/ijms Int. J. Mol. Sci. 2021, 22, x FOR PEER REVIEW 2 of 15 Autophagy plays a key role in the preservation of cartilage integrity [3]. Besides play- Int. J. Mol. Sci. 2021ing, 22, 2700a crucial role in adaptive response to different stimuli, it is also required for intracel- 2 of 15 lular quality control and is involved in removing and recycling misfolded proteins, dam- aged organelles or dysfunctional cell components [4]. Authophagy mayAuthophagy be distinguished may be distinguished into (i) macroautophagy; into (i) macroautophagy; (ii) microautophagy; (ii) microautophagy; (iii) (iii) chaperonechaperone mediated mediatedautophagy. autophagy. Macroautophagy Macroautophagy represents representsthe prevalent the form prevalent of form of au- autophagy in differenttophagy incell different types. cellIt starts types. with It starts a membrane with a membrane formation, formation, the phagophore, the phagophore, which which expandsexpands to engulf to engulfthe cellular the cellular cargo, cargo, genera generatingting the autophagosome. the autophagosome. This Thislatter latter structure structure maturesmatures through through fusion fusion with withlysosomes. lysosomes. mTOR mTOR is a major is a major player player in autophagy in autophagy and acts and acts as a signalingas a signaling control control point downstream point downstream of growth of growthfactor receptor factor receptorsignaling, signaling, hy- hypoxia, poxia, ATP levelsATP and levels insulin and insulinsignaling. signaling. It is activated It is activated downstream downstream of Akt kinase, of Akt kinase,PI3- PI3-kinase kinase and growthand growthfactor receptor factor receptor and acts and to inhibit acts to inhibitautophagy autophagy by modulating by modulating the Ulk1 the Ulk1 (Atg1) (Atg1) complex.complex. In response In response to the autophagy to the autophagy cascade activation, cascade activation, the IIIPI3K the complex IIIPI3K complexpro- produces duces PI3P andPI3P induces and induces other Atg other proteins Atg proteins,, such as such the asAtg12 the- Atg12-Atg5-Atg-16Atg5-Atg-16 and LC3 and LC3 (Atg8)- (Atg8)-phosphatidylethanolaminephosphatidylethanolamine complex complexes.es. After translation, After translation, proLC3 proLC3 is proteolytically is proteolytically cleaved cleaved generatinggenerating LC3-I. LC3-I.Upon induction Upon induction of autophagy, of autophagy, LC3-I is LC3-I conjugated is conjugated by the Atg7, by the Atg7, Atg3 Atg3 and Atg12and-Atg5 Atg12-Atg5-Atg16L-Atg16L complex complexeses to the highly to the highlylipophilic lipophilic phosphatidylethanola- phosphatidylethanolamine (PE) mine (PE) moietymoiety to generate to generate LC3 LC3-II.-II. Finally, Finally, PE PEpromotes promotes integration integration of ofLC3 LC3-II-II into into lipid lipid membranes membranes allowingallowing autophagosomes autophagosomes formation. formation. Due Due to toitsits crucial crucial role role as asa natural a natural de- defense mecha- fense mechanismnism against against inflammatory, inflammatory, i infectiousnfectious andand degenerativedegenerative disorders,disorders, the the autophagic au- process tophagic processmust must be tightlybe tightly regulated. regulated. Several Several molecular molecular mechanisms mechanisms of of autophagy autophagy regulation have regulation havebeen been investigated: investigated: microRNAs microRNAs (miRNAs) (miRNAs) stand stand out, out, among among others others [5]. [5] These. small non- These small noncodingcoding RNAs RNAs act act as as negative negative regulators regulators of of specific specific target target mRNAs mRNAs expression. expres- One single miRNA can act as a post-transcriptional repressor by binding to partially complementary sion. One single miRNA can act as0 a post-transcriptional repressor by binding to partially complementarysequences sequences in in the the 3 UTR3′UTR sites sites of of various various mRNAs. mRNAs. miRNAs miRNAs which which regulate regulate the autophagic the autophagicprocess, process, predominantly predominantly targeting targeting the the pathway pathway early early stages, stages, are are called called autophagomiRNAs. au- tophagomiRNAs.In several In several pathological pathological conditions, conditions, e.g., e.g. degenerative, degenerative disorders, disorders, autophagomiRNAs autoph- have been found to be differentially expressed [6]. agomiRNAs have been found to be differentially expressed [6]. Increasing evidence suggests that autophagy dysregulation is closely related to the Increasing evidence suggests that autophagy dysregulation is closely related to the pathogenesis of osteoarthritis (OA) [7] (Figure1). pathogenesis of osteoarthritis (OA) [7] (Figure 1). Figure 1. SchematicFigure 1. representation Schematic representation showing changes showing occurring changes in occurring the autophagic in the autophagic process in normalprocess versus in nor- osteoarthritic mal versus osteoarthritic chondrocytes. chondrocytes. OA, a chronic, age-related degenerative disease of articular cartilage, is associated with
Load more

Recommended publications
  • Loss of Mafb and Maf Distorts Myeloid Cell Ratios and Disrupts Fetal Mouse Testis Vascularization and Organogenesisǂ
    bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441488; this version posted April 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Loss of Mafb and Maf distorts myeloid cell ratios and disrupts fetal mouse testis vascularization and organogenesisǂ 5 Shu-Yun Li1,5, Xiaowei Gu1,5, Anna Heinrich1, Emily G. Hurley1,2,3, Blanche Capel4, and Tony DeFalco1,2* 1Division of Reproductive Sciences, Cincinnati Children’s Hospital Medical Center, Cincinnati, 10 OH 45229, USA 2Department of Pediatrics, University of Cincinnati College of Medicine, Cincinnati, OH 45267 USA 3Department of Obstetrics and Gynecology, University of Cincinnati College of Medicine, Cincinnati, OH 45267 USA 15 4Department of Cell Biology, Duke University Medical Center, Durham, NC 27710 USA 5These authors contributed equally to this work. ǂThis work was supported by the National Institutes of Health (R37HD039963 to BC, R35GM119458 to TD, R01HD094698 to TD, F32HD058433 to TD); March of Dimes (1-FY10- 355 to BC, Basil O’Connor Starter Scholar Award 5-FY14-32 to TD); Lalor Foundation 20 (postdoctoral fellowship to SL); and Cincinnati Children’s Hospital Medical Center (Research Innovation and Pilot funding, Trustee Award, and developmental funds to TD). *Corresponding Author: Tony DeFalco E-mail: [email protected] 25 Address: Division of Reproductive Sciences Cincinnati Children’s Hospital Medical Center 3333 Burnet Avenue, MLC 7045 Cincinnati, OH 45229 USA Phone: +1-513-803-3988 30 Fax: +1-513-803-1160 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441488; this version posted April 26, 2021.
    [Show full text]
  • The New Direction of Senolytic Drug Research Should Be on Cancer Prevention, Adjuvant Therapies in Cancer and Healthy Aging in Cancer Survivors
    The New Direction of Senolytic Drug Research Should Be on Cancer Prevention, Adjuvant Therapies in Cancer and Healthy Aging in Cancer Survivors Ozgur Tanriverdi ( [email protected] ) Mugla Sitki Kocman University Faculty Of Medicine, Department of Internal Medicine, Division of Medical Oncology, Mugla, Turkey https://orcid.org/0000-0002-0598-7284 Ummuhani Ozel Turkcu Mugla Sitki Kocman Universitesi Tip Fakultesi Research Article Keywords: Aging, Cancer, Cellular senescence, Senolytics drugs Posted Date: March 31st, 2021 DOI: https://doi.org/10.21203/rs.3.rs-307731/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/7 Abstract In cases where cellular senescence does not function properly, the use of drugs called senolytics in the prevention of chronic aging-related disorders such as cancer, diabetes and cardiovascular diseases has become a very interesting topic. There are studies showing that senolytic drugs can be used for the purpose of preventing cancer, preventing recurrence in individuals diagnosed with cancer, and delaying multimorbidity situations that may develop as long-term side effects of anti-cancer treatments. This article has been prepared with the aim of reminding general information about senolytic drugs and cellular senescence due to the fact that there are many controversial researches in the eld of oncology in the future Introduction There are many hypotheses to illuminate the aging process [1]. The most widely accepted of these hypotheses can be listed as follows: Oxidative stress hypotheses and mitochondrial dysfunction hypothesis as well as genetic and epigenetic alterations mechanisms such as somatic mutations, Apolipoprotein E allele polymorphisms and telomere-telomerase activity defects [1].
    [Show full text]
  • Reconstruction of the Global Neural Crest Gene Regulatory Network in Vivo
    Reconstruction of the global neural crest gene regulatory network in vivo Ruth M Williams1, Ivan Candido-Ferreira1, Emmanouela Repapi2, Daria Gavriouchkina1,4, Upeka Senanayake1, Jelena Telenius2,3, Stephen Taylor2, Jim Hughes2,3, and Tatjana Sauka-Spengler1,∗ Supplemental Material ∗Lead and corresponding author: Tatjana Sauka-Spengler ([email protected]) 1University of Oxford, MRC Weatherall Institute of Molecular Medicine, Radcliffe Department of Medicine, Oxford, OX3 9DS, UK 2University of Oxford, MRC Centre for Computational Biology, MRC Weatherall Institute of Molecular Medicine, Oxford, OX3 9DS, UK 3University of Oxford, MRC Molecular Haematology Unit, MRC Weatherall Institute of Molecular Medicine, Oxford, OX3 9DS, UK 4Present Address: Okinawa Institute of Science and Technology, Molecular Genetics Unit, Onna, 904-0495, Japan A 25 25 25 25 25 20 20 20 20 20 15 15 15 15 15 10 10 10 10 10 log2(R1_5-6ss) log2(R1_5-6ss) log2(R1_8-10ss) log2(R1_8-10ss) log2(R1_non-NC) 5 5 5 5 5 0 r=0.92 0 r=0.99 0 r=0.96 0 r=0.99 0 r=0.96 0 5 10 15 20 25 0 5 10 15 20 25 0 5 10 15 20 25 0 5 10 15 20 25 0 5 10 15 20 25 log2(R2_non-NC) log2(R2_5-6ss) log2(R3_5-6ss) log2(R2_8-10ss) log2(R3_8-10ss) 25 25 25 25 25 20 20 20 20 20 15 15 15 15 15 10 10 10 10 10 log2(R1_5-6ss) log2(R2_5-6ss) log2(R1_8-10ss) log2(R2_8-10ss) log2(R1_non-NC) 5 5 5 5 5 0 r=0.94 0 r=0.96 0 r=0.95 0 r=0.96 0 r=0.95 0 5 10 15 20 25 0 5 10 15 20 25 0 5 10 15 20 25 0 5 10 15 20 25 0 5 10 15 20 25 log2(R3_non-NC) log2(R4_5-6ss) log2(R3_5-6ss) log2(R4_8-10ss) log2(R3_8-10ss)
    [Show full text]
  • Tomo-Seq Identifies SOX9 As a Key Regulator of Cardiac Fibrosis During Ischemic Injury
    myocardial myocardial Eva van ◼ osis fibr SOX9 transcription ◼ PhD* PhD PhD PhD MSc, PhD naarden, MSc, PhD naarden, PhD* ventricular remodeling Correspondence to: Correspondence Rooij, MSc, PhD, Hubrecht Department of Institute, KNAW University Medical Cardiology, Uppsalalaan 8, Center Utrecht, The Netherlands. 3584CT Utrecht, E-mail [email protected] of Funding, see page 1408 Sources Key Words: ischemia ◼ © 2017 American Heart Association, Inc. *Drs. Lacraz and Junker contributed equally. Grégory P.A. Lacraz, MSc, P.A. Grégory MSc, Jan Philipp Junker, Monika M. Gladka, MSc, MSc Bas Molenaar, Scholman, MSc Koen T. MSc Marta Vigil-Garcia, BS Danielle Versteeg, BS Hesther de Ruiter, MSc, Vermunt, Marit W. MSc, Creyghton, Menno P. Manon M.H. Huibers, Nicolaas de Jonge, MD Alexander van Oude- Eva van Rooij, MSc, PhD 2017;136:1396–1409. DOI: 10.1161/CIRCULATIONAHA.117.027832 DOI: 2017;136:1396–1409. Circulation. blunted the cardiac fibrotic fibrotic blunted the cardiac Sox9 ). Subsequent correlation analysis allowed). Subsequent correlation Serca2 Editorial, see p 1410 , and Nppa Based on the exact local expression cues, tomo-seq can Based on the exact local expression Cardiac ischemic injury induces a pathological remodeling ischemic injury induces a pathological remodeling Cardiac , Although genome-wide transcriptome analysis on diseased tissues Tracing transcriptional differences with a high spatial resolution with a high spatial resolution transcriptional differences Tracing Col1a2 October 10, 2017 October 10, 1396 CONCLUSIONS: novel genes and key transcription factors involved in specific serve to reveal able to unveil the Using tomo-seq, we were remodeling. aspects of cardiac pointing fibrosis, of cardiac of SOX9 as a key regulator unknown relevance fibrosis.
    [Show full text]
  • Senolytics for Cancer Therapy: Is All That Glitters Really Gold?
    cancers Review Senolytics for Cancer Therapy: Is All that Glitters Really Gold? Valerie J. Carpenter 1,2, Tareq Saleh 3 and David A. Gewirtz 1,2,* 1 Department of Pharmacology and Toxicology and Medicine, School of Medicine, Virginia Commonwealth University, Richmond, VA 23298, USA; [email protected] 2 Massey Cancer Center, Richmond, VA 23298, USA 3 Department of Basic Medical Sciences, Faculty of Medicine, The Hashemite University, Zarqa 13133, Jordan; [email protected] * Correspondence: [email protected]; Tel.: +1-(804)-828-9523 Simple Summary: Senescence is an essential component of tumor cell biology and is a primary cell stress response to therapy. While the long-term impact of senescence in cancer therapy is not yet fully understood, the use of senolytics, drugs that selectively kill senescent cells, is an area of active investigation in cancer treatment. Several challenges and unanswered questions have arisen from the current preclinical literature, indicating the need to re-evaluate some of the basic premises and experimental approaches, as well as the potential utility for translating to the clinic the application of senolytics as adjuvants to current cancer therapy. Abstract: Senolytics represent a group of mechanistically diverse drugs that can eliminate senescent cells, both in tumors and in several aging-related pathologies. Consequently, senolytic use has been proposed as a potential adjuvant approach to improve the response to senescence-inducing conventional and targeted cancer therapies. Despite the unequivocal promise of senolytics, issues of universality, selectivity, resistance, and toxicity remain to be further clarified. In this review, we attempt to summarize and analyze the current preclinical literature involving the use of senolytics in senescent tumor cell models, and to propose tenable solutions and future directions to improve the Citation: Carpenter, V.J.; Saleh, T.; understanding and use of this novel class of drugs.
    [Show full text]
  • The Effects of Autophagy and Senescence on Sensitivity to Cisplatin in Head and Neck Cancer
    Virginia Commonwealth University VCU Scholars Compass Theses and Dissertations Graduate School 2020 The Effects of Autophagy and Senescence on Sensitivity to Cisplatin in Head and Neck Cancer Zara H. Siddiqui Virginia Commonwealth University Follow this and additional works at: https://scholarscompass.vcu.edu/etd Part of the Medical Pharmacology Commons, Medical Toxicology Commons, and the Oncology Commons © The Author Downloaded from https://scholarscompass.vcu.edu/etd/6204 This Thesis is brought to you for free and open access by the Graduate School at VCU Scholars Compass. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of VCU Scholars Compass. For more information, please contact [email protected]. THE EFFECTS OF AUTOPHAGY AND SENESCENCE ON SENSITIVITY TO CISPLATIN IN HEAD AND NECK CANCER by Zara Hafeez Siddiqui, B.A. April 2020 A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science at Virginia Commonwealth University Principal Investigator: Dr. David Gewirtz Department of Pharmacology & Toxicology Virginia Commonwealth University 1 Acknowledgements: I would like to take this opportunity to thank my family, who have been an enormous support system throughout my educational career and in my life. I would also like to thank Dr. David Gewirtz for giving me the opportunity to study in his lab and for guiding me through my thesis work. Thank you to the entire Gewirtz lab for helping me, and especially to Nipa Patel who took the time and effort to train me in the lab, guide me in my research, and patiently answer my questions at every step of the way.
    [Show full text]
  • The Versatile Functions of Sox9 in Development, Stem Cells, And
    Genes & Diseases (2014) 1, 149e161 HOSTED BY Available online at www.sciencedirect.com ScienceDirect journal homepage: http://ees.elsevier.com/gendis/default.asp REVIEW ARTICLE The versatile functions of Sox9 in development, stem cells, and human diseases Alice Jo a, Sahitya Denduluri a, Bosi Zhang a, Zhongliang Wang a,b, Liangjun Yin a,b, Zhengjian Yan a,b, Richard Kang a, Lewis L. Shi a, James Mok a, Michael J. Lee a, Rex C. Haydon a,* a Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, IL 60637, USA b Departments of Orthopaedic Surgery, The Affiliated Hospitals of Chongqing Medical University, Chongqing 400046, China Received 3 September 2014; accepted 6 September 2014 Available online 16 October 2014 KEYWORDS Abstract The transcription factor Sox9 was first discoveredinpatientswithcampomelic Development; dysplasia, a haploinsufficiency disorder with skeletal deformities caused by dysregulation of Sox9; Sox9 expression during chondrogenesis. Since then, its role as a cell fate determiner during Stem cells; embryonic development has been well characterized; Sox9 expression differentiates cells Transcription factor derived from all three germ layers into a large variety of specialized tissues and organs. How- ever, recent data has shown that ectoderm- and endoderm-derived tissues continue to express Sox9 in mature organs and stem cell pools, suggesting its role in cell maintenance and speci- fication during adult life. The versatility of Sox9 may be explained by a combination of post- transcriptional modifications, binding partners, and the tissue type in which it is expressed. Considering its importance during both development and adult life, it follows that dysregula- tion of Sox9 has been implicated in various congenital and acquired diseases, including fibrosis and cancer.
    [Show full text]
  • Curcumin Attenuates Environment-Derived Osteoarthritis by Sox9/NF-Kb Signaling Axis
    International Journal of Molecular Sciences Article Curcumin Attenuates Environment-Derived Osteoarthritis by Sox9/NF-kB Signaling Axis Constanze Buhrmann 1,2, Aranka Brockmueller 1, Anna-Lena Mueller 1, Parviz Shayan 3 and Mehdi Shakibaei 1,* 1 Musculoskeletal Research Group and Tumor Biology, Chair of Vegetative Anatomy, Institute of Anatomy, Faculty of Medicine, Ludwig-Maximilian-University Munich, Pettenkoferstr. 11, D-80336 Munich, Germany; [email protected] (C.B.); [email protected] (A.B.); [email protected] (A.-L.M.) 2 Institute of Anatomy and Cell Biology, Faculty of Medicine, University of Augsburg, Universitaetsstr. 2, D-86159 Augsburg, Germany 3 Department of Parasitology, Faculty of Veterinary Medicine, University of Tehran, Tehran 141556453, Iran; [email protected] * Correspondence: [email protected]; Tel.: +49-89-2180-72624 Abstract: Inflammation has a fundamental impact on the pathophysiology of osteoarthritis (OA), a common form of degenerative arthritis. It has previously been established that curcumin, a component of turmeric (Curcuma longa), has anti-inflammatory properties. This research evaluates the potentials of curcumin on the pathophysiology of OA in vitro. To explore the anti-inflammatory efficacy of curcumin in an inflamed joint, an osteoarthritic environment (OA-EN) model consisting of fibroblasts, T-lymphocytes, 3D-chondrocytes is constructed and co-incubated with TNF-α, antisense oligonucleotides targeting NF-kB (ASO-NF-kB), or an IkB-kinase (IKK) inhibitor (BMS-345541). Our results show that OA-EN, similar to TNF-α, suppresses chondrocyte viability, which is accompanied Citation: Buhrmann, C.; by a significant decrease in cartilage-specific proteins (collagen II, CSPG, Sox9) and an increase in NF- Brockmueller, A.; Mueller, A.-L.; kB-driven gene proteins participating in inflammation, apoptosis, and breakdown (NF-kB, MMP-9, Shayan, P.; Shakibaei, M.
    [Show full text]
  • The E–Id Protein Axis Modulates the Activities of the PI3K–AKT–Mtorc1
    Downloaded from genesdev.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press The E–Id protein axis modulates the activities of the PI3K–AKT–mTORC1– Hif1a and c-myc/p19Arf pathways to suppress innate variant TFH cell development, thymocyte expansion, and lymphomagenesis Masaki Miyazaki,1,8 Kazuko Miyazaki,1,8 Shuwen Chen,1 Vivek Chandra,1 Keisuke Wagatsuma,2 Yasutoshi Agata,2 Hans-Reimer Rodewald,3 Rintaro Saito,4 Aaron N. Chang,5 Nissi Varki,6 Hiroshi Kawamoto,7 and Cornelis Murre1 1Department of Molecular Biology, University of California at San Diego, La Jolla, California 92093, USA; 2Department of Biochemistry and Molecular Biology, Shiga University of Medical School, Shiga 520-2192, Japan; 3Division of Cellular Immunology, German Cancer Research Center, D-69120 Heidelberg, Germany; 4Department of Medicine, University of California at San Diego, La Jolla, California 92093, USA; 5Center for Computational Biology, Institute for Genomic Medicine, University of California at San Diego, La Jolla, California 92093, USA; 6Department of Pathology, University of California at San Diego, La Jolla, California 92093, USA; 7Department of Immunology, Institute for Frontier Medical Sciences, Kyoto University, Kyoto 606-8507, Japan It is now well established that the E and Id protein axis regulates multiple steps in lymphocyte development. However, it remains unknown how E and Id proteins mechanistically enforce and maintain the naı¨ve T-cell fate. Here we show that Id2 and Id3 suppressed the development and expansion of innate variant follicular helper T (TFH) cells. Innate variant TFH cells required major histocompatibility complex (MHC) class I-like signaling and were associated with germinal center B cells.
    [Show full text]
  • Senotherapeutics for Healthy Ageing of Its Broad Efficacy
    CORRESPONDENCE LINK TO ORIGINAL ARTICLE careful consideration when defining a seno- lytic or senomorphic drug and the likelihood Senotherapeutics for healthy ageing of its broad efficacy. Once evidence is found for senolytic activ- Laura J. Niedernhofer and Paul D. Robbins ity of a compound in vitro, it is even more difficult to document potential senolytic activity in vivo (TABLE 1). Demonstrating that The recent manuscript by Childs et al. in The natural compounds fisetin3, a quercetin- a compound reduces the number of SA-ß-gal+ Nature Reviews Drug Discovery1 thoroughly related flavonoid, and piperlongumine also cells or the level of p16ink4a expression, such as reviewed the important role senescent cells exhibit evidence of senolytic or senomorphic through the use of p16ink4a–luciferase reporter play in driving ageing and age-related dis- activity in certain cell types in vitro. Clinically mice, does not definitively demonstrate kill- eases. The review also highlighted the clinical used compounds targeting the co-chaperone ing, let alone selective killing, of senescent importance of developing senotherapeutic heat shock protein 90 (HSP90) were also iden- cells. Also, since senolytics are cell type-spe- approaches to selectively kill senescent cells tified as a novel class of potential senolytics, cific, the lack of an effect on a specific tissue (senolytics) or to suppress the senescence- able to induce apoptosis of senescent murine doesn’t preclude senolytic activity in other associated secretory phenotype (SASP) that and human cells in vitro and improve health- tissues. Even more rigorous approaches, such drives sterile inflammation associated with span in vivo4. Finally, the FDA-approved as the injection of labelled senescent cells fol- ageing (senomorphics), in order to extend histone deacetylase inhibitor panobinostat lowed by drug treatment, only serve to docu- healthspan and potentially lifespan.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Forkhead Transcription Factors and Ageing
    Oncogene (2008) 27, 2351–2363 & 2008 Nature Publishing Group All rights reserved 0950-9232/08 $30.00 www.nature.com/onc REVIEW Forkhead transcription factors and ageing L Partridge1 and JC Bru¨ ning2 1Institute of Healthy Ageing, GEE, London, UK; 2Department of Mouse Genetics and Metabolism, Institute for Genetics University of Cologne, Cologne, Germany Mutations in single genes and environmental interventions Forkhead transcription factors are turning out to play can extend healthy lifespan in laboratory model organi- a key role in invertebrate models ofextension ofhealthy sms. Some of the mechanisms involved show evolutionary lifespan by single-gene mutations, and evidence is conservation, opening the way to using simpler inverte- mounting for their importance in mammals. Forkheads brates to understand human ageing. Forkhead transcrip- can also play a role in extension oflifespanby dietary tion factors have been found to play a key role in lifespan restriction, an environmental intervention that also extension by alterations in the insulin/IGF pathway and extends lifespan in diverse organisms (Kennedy et al., by dietary restriction. Interventions that extend lifespan 2007). Here, we discuss these findings and their have also been found to delay or ameliorate the impact of implications. The forkhead family of transcription ageing-related pathology and disease, including cancer. factors is characterized by a type of DNA-binding Understanding the mode of action of forkheads in this domain known as the forkhead box (FOX) (Weigel and context will illuminate the mechanisms by which ageing Jackle, 1990). They are also called winged helix acts as a risk factor for ageing-related disease, and could transcription factors because of the crystal structure lead to the development of a broad-spectrum, preventative ofthe FOX, ofwhich the forkheadscontain a medicine for the diseases of ageing.
    [Show full text]