Integrative and Perturbation‐Based Analysis of the Transcriptional
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Loss of Mafb and Maf Distorts Myeloid Cell Ratios and Disrupts Fetal Mouse Testis Vascularization and Organogenesisǂ
bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441488; this version posted April 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Loss of Mafb and Maf distorts myeloid cell ratios and disrupts fetal mouse testis vascularization and organogenesisǂ 5 Shu-Yun Li1,5, Xiaowei Gu1,5, Anna Heinrich1, Emily G. Hurley1,2,3, Blanche Capel4, and Tony DeFalco1,2* 1Division of Reproductive Sciences, Cincinnati Children’s Hospital Medical Center, Cincinnati, 10 OH 45229, USA 2Department of Pediatrics, University of Cincinnati College of Medicine, Cincinnati, OH 45267 USA 3Department of Obstetrics and Gynecology, University of Cincinnati College of Medicine, Cincinnati, OH 45267 USA 15 4Department of Cell Biology, Duke University Medical Center, Durham, NC 27710 USA 5These authors contributed equally to this work. ǂThis work was supported by the National Institutes of Health (R37HD039963 to BC, R35GM119458 to TD, R01HD094698 to TD, F32HD058433 to TD); March of Dimes (1-FY10- 355 to BC, Basil O’Connor Starter Scholar Award 5-FY14-32 to TD); Lalor Foundation 20 (postdoctoral fellowship to SL); and Cincinnati Children’s Hospital Medical Center (Research Innovation and Pilot funding, Trustee Award, and developmental funds to TD). *Corresponding Author: Tony DeFalco E-mail: [email protected] 25 Address: Division of Reproductive Sciences Cincinnati Children’s Hospital Medical Center 3333 Burnet Avenue, MLC 7045 Cincinnati, OH 45229 USA Phone: +1-513-803-3988 30 Fax: +1-513-803-1160 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441488; this version posted April 26, 2021. -
The Transcription Factor Pou3f1 Promotes Neural Fate Commitment
RESEARCH ARTICLE elifesciences.org The transcription factor Pou3f1 promotes neural fate commitment via activation of neural lineage genes and inhibition of external signaling pathways Qingqing Zhu1,2†, Lu Song1†, Guangdun Peng1, Na Sun3, Jun Chen1, Ting Zhang1, Nengyin Sheng1, Wei Tang1, Cheng Qian1, Yunbo Qiao1, Ke Tang4, Jing-Dong Jackie Han3, Jinsong Li1, Naihe Jing1* 1State Key Laboratory of Cell Biology, Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai, China; 2Department of Neurosurgery, West China Hospital, Sichuan University, Sichuan, China; 3Key Laboratory of Computational Biology, CAS-MPG Partner Institute for Computational Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai, China; 4Institute of Life Science, Nanchang University, Nanchang, Jiangxi, China Abstract The neural fate commitment of pluripotent stem cells requires the repression of extrinsic inhibitory signals and the activation of intrinsic positive transcription factors. However, how these two events are integrated to ensure appropriate neural conversion remains unclear. In this study, we showed that Pou3f1 is essential for the neural differentiation of mouse embryonic stem cells (ESCs), specifically during the transition from epiblast stem cells (EpiSCs) to neural progenitor cells (NPCs). Chimeric analysis showed that Pou3f1 knockdown leads to a markedly decreased *For correspondence: njing@ incorporation of ESCs in the neuroectoderm. By contrast, Pou3f1-overexpressing ESC derivatives sibcb.ac.cn preferentially contribute to the neuroectoderm. Genome-wide ChIP-seq and RNA-seq analyses †These authors contributed indicated that Pou3f1 is an upstream activator of neural lineage genes, and also is a repressor of equally to this work BMP and Wnt signaling. -
Reconstruction of the Global Neural Crest Gene Regulatory Network in Vivo
Reconstruction of the global neural crest gene regulatory network in vivo Ruth M Williams1, Ivan Candido-Ferreira1, Emmanouela Repapi2, Daria Gavriouchkina1,4, Upeka Senanayake1, Jelena Telenius2,3, Stephen Taylor2, Jim Hughes2,3, and Tatjana Sauka-Spengler1,∗ Supplemental Material ∗Lead and corresponding author: Tatjana Sauka-Spengler ([email protected]) 1University of Oxford, MRC Weatherall Institute of Molecular Medicine, Radcliffe Department of Medicine, Oxford, OX3 9DS, UK 2University of Oxford, MRC Centre for Computational Biology, MRC Weatherall Institute of Molecular Medicine, Oxford, OX3 9DS, UK 3University of Oxford, MRC Molecular Haematology Unit, MRC Weatherall Institute of Molecular Medicine, Oxford, OX3 9DS, UK 4Present Address: Okinawa Institute of Science and Technology, Molecular Genetics Unit, Onna, 904-0495, Japan A 25 25 25 25 25 20 20 20 20 20 15 15 15 15 15 10 10 10 10 10 log2(R1_5-6ss) log2(R1_5-6ss) log2(R1_8-10ss) log2(R1_8-10ss) log2(R1_non-NC) 5 5 5 5 5 0 r=0.92 0 r=0.99 0 r=0.96 0 r=0.99 0 r=0.96 0 5 10 15 20 25 0 5 10 15 20 25 0 5 10 15 20 25 0 5 10 15 20 25 0 5 10 15 20 25 log2(R2_non-NC) log2(R2_5-6ss) log2(R3_5-6ss) log2(R2_8-10ss) log2(R3_8-10ss) 25 25 25 25 25 20 20 20 20 20 15 15 15 15 15 10 10 10 10 10 log2(R1_5-6ss) log2(R2_5-6ss) log2(R1_8-10ss) log2(R2_8-10ss) log2(R1_non-NC) 5 5 5 5 5 0 r=0.94 0 r=0.96 0 r=0.95 0 r=0.96 0 r=0.95 0 5 10 15 20 25 0 5 10 15 20 25 0 5 10 15 20 25 0 5 10 15 20 25 0 5 10 15 20 25 log2(R3_non-NC) log2(R4_5-6ss) log2(R3_5-6ss) log2(R4_8-10ss) log2(R3_8-10ss) -
Tomo-Seq Identifies SOX9 As a Key Regulator of Cardiac Fibrosis During Ischemic Injury
myocardial myocardial Eva van ◼ osis fibr SOX9 transcription ◼ PhD* PhD PhD PhD MSc, PhD naarden, MSc, PhD naarden, PhD* ventricular remodeling Correspondence to: Correspondence Rooij, MSc, PhD, Hubrecht Department of Institute, KNAW University Medical Cardiology, Uppsalalaan 8, Center Utrecht, The Netherlands. 3584CT Utrecht, E-mail [email protected] of Funding, see page 1408 Sources Key Words: ischemia ◼ © 2017 American Heart Association, Inc. *Drs. Lacraz and Junker contributed equally. Grégory P.A. Lacraz, MSc, P.A. Grégory MSc, Jan Philipp Junker, Monika M. Gladka, MSc, MSc Bas Molenaar, Scholman, MSc Koen T. MSc Marta Vigil-Garcia, BS Danielle Versteeg, BS Hesther de Ruiter, MSc, Vermunt, Marit W. MSc, Creyghton, Menno P. Manon M.H. Huibers, Nicolaas de Jonge, MD Alexander van Oude- Eva van Rooij, MSc, PhD 2017;136:1396–1409. DOI: 10.1161/CIRCULATIONAHA.117.027832 DOI: 2017;136:1396–1409. Circulation. blunted the cardiac fibrotic fibrotic blunted the cardiac Sox9 ). Subsequent correlation analysis allowed). Subsequent correlation Serca2 Editorial, see p 1410 , and Nppa Based on the exact local expression cues, tomo-seq can Based on the exact local expression Cardiac ischemic injury induces a pathological remodeling ischemic injury induces a pathological remodeling Cardiac , Although genome-wide transcriptome analysis on diseased tissues Tracing transcriptional differences with a high spatial resolution with a high spatial resolution transcriptional differences Tracing Col1a2 October 10, 2017 October 10, 1396 CONCLUSIONS: novel genes and key transcription factors involved in specific serve to reveal able to unveil the Using tomo-seq, we were remodeling. aspects of cardiac pointing fibrosis, of cardiac of SOX9 as a key regulator unknown relevance fibrosis. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
The Versatile Functions of Sox9 in Development, Stem Cells, And
Genes & Diseases (2014) 1, 149e161 HOSTED BY Available online at www.sciencedirect.com ScienceDirect journal homepage: http://ees.elsevier.com/gendis/default.asp REVIEW ARTICLE The versatile functions of Sox9 in development, stem cells, and human diseases Alice Jo a, Sahitya Denduluri a, Bosi Zhang a, Zhongliang Wang a,b, Liangjun Yin a,b, Zhengjian Yan a,b, Richard Kang a, Lewis L. Shi a, James Mok a, Michael J. Lee a, Rex C. Haydon a,* a Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, IL 60637, USA b Departments of Orthopaedic Surgery, The Affiliated Hospitals of Chongqing Medical University, Chongqing 400046, China Received 3 September 2014; accepted 6 September 2014 Available online 16 October 2014 KEYWORDS Abstract The transcription factor Sox9 was first discoveredinpatientswithcampomelic Development; dysplasia, a haploinsufficiency disorder with skeletal deformities caused by dysregulation of Sox9; Sox9 expression during chondrogenesis. Since then, its role as a cell fate determiner during Stem cells; embryonic development has been well characterized; Sox9 expression differentiates cells Transcription factor derived from all three germ layers into a large variety of specialized tissues and organs. How- ever, recent data has shown that ectoderm- and endoderm-derived tissues continue to express Sox9 in mature organs and stem cell pools, suggesting its role in cell maintenance and speci- fication during adult life. The versatility of Sox9 may be explained by a combination of post- transcriptional modifications, binding partners, and the tissue type in which it is expressed. Considering its importance during both development and adult life, it follows that dysregula- tion of Sox9 has been implicated in various congenital and acquired diseases, including fibrosis and cancer. -
Curcumin Attenuates Environment-Derived Osteoarthritis by Sox9/NF-Kb Signaling Axis
International Journal of Molecular Sciences Article Curcumin Attenuates Environment-Derived Osteoarthritis by Sox9/NF-kB Signaling Axis Constanze Buhrmann 1,2, Aranka Brockmueller 1, Anna-Lena Mueller 1, Parviz Shayan 3 and Mehdi Shakibaei 1,* 1 Musculoskeletal Research Group and Tumor Biology, Chair of Vegetative Anatomy, Institute of Anatomy, Faculty of Medicine, Ludwig-Maximilian-University Munich, Pettenkoferstr. 11, D-80336 Munich, Germany; [email protected] (C.B.); [email protected] (A.B.); [email protected] (A.-L.M.) 2 Institute of Anatomy and Cell Biology, Faculty of Medicine, University of Augsburg, Universitaetsstr. 2, D-86159 Augsburg, Germany 3 Department of Parasitology, Faculty of Veterinary Medicine, University of Tehran, Tehran 141556453, Iran; [email protected] * Correspondence: [email protected]; Tel.: +49-89-2180-72624 Abstract: Inflammation has a fundamental impact on the pathophysiology of osteoarthritis (OA), a common form of degenerative arthritis. It has previously been established that curcumin, a component of turmeric (Curcuma longa), has anti-inflammatory properties. This research evaluates the potentials of curcumin on the pathophysiology of OA in vitro. To explore the anti-inflammatory efficacy of curcumin in an inflamed joint, an osteoarthritic environment (OA-EN) model consisting of fibroblasts, T-lymphocytes, 3D-chondrocytes is constructed and co-incubated with TNF-α, antisense oligonucleotides targeting NF-kB (ASO-NF-kB), or an IkB-kinase (IKK) inhibitor (BMS-345541). Our results show that OA-EN, similar to TNF-α, suppresses chondrocyte viability, which is accompanied Citation: Buhrmann, C.; by a significant decrease in cartilage-specific proteins (collagen II, CSPG, Sox9) and an increase in NF- Brockmueller, A.; Mueller, A.-L.; kB-driven gene proteins participating in inflammation, apoptosis, and breakdown (NF-kB, MMP-9, Shayan, P.; Shakibaei, M. -
Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1. -
Functional Genomics Atlas of Synovial Fibroblasts Defining Rheumatoid Arthritis
medRxiv preprint doi: https://doi.org/10.1101/2020.12.16.20248230; this version posted December 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Functional genomics atlas of synovial fibroblasts defining rheumatoid arthritis heritability Xiangyu Ge1*, Mojca Frank-Bertoncelj2*, Kerstin Klein2, Amanda Mcgovern1, Tadeja Kuret2,3, Miranda Houtman2, Blaž Burja2,3, Raphael Micheroli2, Miriam Marks4, Andrew Filer5,6, Christopher D. Buckley5,6,7, Gisela Orozco1, Oliver Distler2, Andrew P Morris1, Paul Martin1, Stephen Eyre1* & Caroline Ospelt2*,# 1Versus Arthritis Centre for Genetics and Genomics, School of Biological Sciences, Faculty of Biology, Medicine and Health, The University of Manchester, Manchester, UK 2Department of Rheumatology, Center of Experimental Rheumatology, University Hospital Zurich, University of Zurich, Zurich, Switzerland 3Department of Rheumatology, University Medical Centre, Ljubljana, Slovenia 4Schulthess Klinik, Zurich, Switzerland 5Institute of Inflammation and Ageing, University of Birmingham, Birmingham, UK 6NIHR Birmingham Biomedical Research Centre, University Hospitals Birmingham NHS Foundation Trust, University of Birmingham, Birmingham, UK 7Kennedy Institute of Rheumatology, University of Oxford Roosevelt Drive Headington Oxford UK *These authors contributed equally #corresponding author: [email protected] NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. 1 medRxiv preprint doi: https://doi.org/10.1101/2020.12.16.20248230; this version posted December 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. -
SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line -
Table S2.Up Or Down Regulated Genes in Tcof1 Knockdown Neuroblastoma N1E-115 Cells Involved in Differentbiological Process Anal
Table S2.Up or down regulated genes in Tcof1 knockdown neuroblastoma N1E-115 cells involved in differentbiological process analysed by DAVID database Pop Pop Fold Term PValue Genes Bonferroni Benjamini FDR Hits Total Enrichment GO:0044257~cellular protein catabolic 2.77E-10 MKRN1, PPP2R5C, VPRBP, MYLIP, CDC16, ERLEC1, MKRN2, CUL3, 537 13588 1.944851 8.64E-07 8.64E-07 5.02E-07 process ISG15, ATG7, PSENEN, LOC100046898, CDCA3, ANAPC1, ANAPC2, ANAPC5, SOCS3, ENC1, SOCS4, ASB8, DCUN1D1, PSMA6, SIAH1A, TRIM32, RNF138, GM12396, RNF20, USP17L5, FBXO11, RAD23B, NEDD8, UBE2V2, RFFL, CDC GO:0051603~proteolysis involved in 4.52E-10 MKRN1, PPP2R5C, VPRBP, MYLIP, CDC16, ERLEC1, MKRN2, CUL3, 534 13588 1.93519 1.41E-06 7.04E-07 8.18E-07 cellular protein catabolic process ISG15, ATG7, PSENEN, LOC100046898, CDCA3, ANAPC1, ANAPC2, ANAPC5, SOCS3, ENC1, SOCS4, ASB8, DCUN1D1, PSMA6, SIAH1A, TRIM32, RNF138, GM12396, RNF20, USP17L5, FBXO11, RAD23B, NEDD8, UBE2V2, RFFL, CDC GO:0044265~cellular macromolecule 6.09E-10 MKRN1, PPP2R5C, VPRBP, MYLIP, CDC16, ERLEC1, MKRN2, CUL3, 609 13588 1.859332 1.90E-06 6.32E-07 1.10E-06 catabolic process ISG15, RBM8A, ATG7, LOC100046898, PSENEN, CDCA3, ANAPC1, ANAPC2, ANAPC5, SOCS3, ENC1, SOCS4, ASB8, DCUN1D1, PSMA6, SIAH1A, TRIM32, RNF138, GM12396, RNF20, XRN2, USP17L5, FBXO11, RAD23B, UBE2V2, NED GO:0030163~protein catabolic process 1.81E-09 MKRN1, PPP2R5C, VPRBP, MYLIP, CDC16, ERLEC1, MKRN2, CUL3, 556 13588 1.87839 5.64E-06 1.41E-06 3.27E-06 ISG15, ATG7, PSENEN, LOC100046898, CDCA3, ANAPC1, ANAPC2, ANAPC5, SOCS3, ENC1, SOCS4, -
Transitions in Cell Potency During Early Mouse Development Are Driven by Notch
bioRxiv preprint doi: https://doi.org/10.1101/451922; this version posted October 24, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. Menchero et al. Transitions in cell potency during early mouse development are driven by Notch Sergio Menchero1, Antonio Lopez-Izquierdo1, Isabel Rollan1, Julio Sainz de Aja1, Ϯ, Maria Jose Andreu1, Minjung Kang2, Javier Adan1, Rui Benedito3, Teresa Rayon1, †, Anna-Katerina Hadjantonakis2 and Miguel Manzanares1,* 1 Centro Nacional de Investigaciones Cardiovasculares Carlos III (CNIC), Melchor Fernández Almagro 3, 28029 Madrid, Spain. 2 Developmental Biology Program, Sloan Kettering Institute, New York NY 10065, USA. 3 Molecular Genetics of Angiogenesis Group, Centro Nacional de Investigaciones Cardiovasculares Carlos III (CNIC), Melchor Fernández Almagro 3, 28029 Madrid, Spain. Ϯ Current address: Children's Hospital, Stem Cell Program, 300 Longwood Ave, Boston MA 02115, USA. † Current address: The Francis Crick Institute, 1 Midland Road, London NW1 1AT, UK. * Corresponding author ([email protected]) 1 bioRxiv preprint doi: https://doi.org/10.1101/451922; this version posted October 24, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. Menchero et al. Abstract The Notch signalling pathway plays fundamental roles in diverse developmental processes in metazoans, where it is important in driving cell fate and directing differentiation of various cell types.