DOCSLIB.ORG

Muscle Progenitor Specification and Myogenic Differentiation

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Muscle Progenitor Specification and Myogenic Differentiation ARTICLE https://doi.org/10.1038/s41467-020-19999-w OPEN Muscle progenitor specification and myogenic differentiation are associated with changes in chromatin topology Nan Zhang1, Julen Mendieta-Esteban 2, Alessandro Magli 3,4, Karin C. Lilja1, Rita C. R. Perlingeiro 3,4, ✉ Marc A. Marti-Renom 2,5,6,7, Aristotelis Tsirigos 1 & Brian David Dynlacht1 1234567890():,; Using Hi-C, promoter-capture Hi-C (pCHi-C), and other genome-wide approaches in skeletal muscle progenitors that inducibly express a master transcription factor, Pax7, we system- atically characterize at high-resolution the spatio-temporal re-organization of compartments and promoter-anchored interactions as a consequence of myogenic commitment and dif- ferentiation. We identify key promoter-enhancer interaction motifs, namely, cliques and networks, and interactions that are dependent on Pax7 binding. Remarkably, Pax7 binds to a majority of super-enhancers, and together with a cadre of interacting transcription factors, assembles feed-forward regulatory loops. During differentiation, epigenetic memory and persistent looping are maintained at a subset of Pax7 enhancers in the absence of Pax7. We also identify and functionally validate a previously uncharacterized Pax7-bound enhancer hub that regulates the essential myosin heavy chain cluster during skeletal muscle cell differ- entiation. Our studies lay the groundwork for understanding the role of Pax7 in orchestrating changes in the three-dimensional chromatin conformation in muscle progenitors. 1 Department of Pathology and Perlmutter Cancer Institute, New York University School of Medicine, New York, NY 10016, USA. 2 CNAG-CRG, Centre for Genomic Regulation (CRG), Barcelona Institute of Science and Technology (BIST), Barcelona, Spain. 3 Department of Medicine, Lillehei Heart Institute, University of Minnesota, Minneapolis, MN 55455, USA. 4 Stem Cell Institute, University of Minnesota, Minneapolis, MN 55455, USA. 5 Centre for Genomic Regulation (CRG), Barcelona Institute of Science and Technology (BIST), Barcelona, Spain. 6 Universitat Pompeu Fabra (UPF), Barcelona, Spain. 7 ICREA, ✉ Barcelona, Spain. email: [email protected] NATURE COMMUNICATIONS | (2020) 11:6222 | https://doi.org/10.1038/s41467-020-19999-w | www.nature.com/naturecommunications 1 ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-020-19999-w hromatin structure and topology play important roles in and after its withdrawal, cells differentiate and display the mor- Cthe regulation of gene expression. Although it is well phology and gene expression profiles of myocytes (Fig. 1a)11,19. established that enhancers can activate or repress gene To characterize how chromatin structure is globally re-organized expression through looping to promoters1–5, the extent to which during skeletal muscle progenitor specification and differentia- this phenomenon directs specification of myogenic precursors tion, we generated chromosomal conformation maps using in situ and differentiation of skeletal muscle has not been extensively Hi-C and pCHi-C and performed chromatin immunoprecipita- investigated. Mammalian adult skeletal muscle has a robust tion (ChIP)-seq to detect CTCF and cohesin (Smc3) recruitment ability to regenerate, a process that depends on muscle stem cells, in both progenitor (+Dox) and differentiated (−Dox) iPax7 cells termed satellite cells. Satellite cells are characterized by expression (Fig. 1b) and compared our results to published data from mouse of the transcription factor (TF) paired-box 7 (Pax7), which plays ESCs22 (Supplementary Data 1). We identified between 2755 and a central role in satellite cell specification, maintenance, and 2841 topologically associated domains (TADs) in undifferentiated function6–8. Previous studies have shown that Pax7 can act as a ESCs, progenitor, and differentiated iPax7 cells (Supplementary pioneer factor to open local chromatin regions and preferentially Fig. 1A, B), and >85% of TAD boundaries were bound by CTCF bind to enhancers in skeletal muscle progenitors and the and cohesin (Smc3). As previously reported22, TAD boundaries pituitary9–11. However, it remains unclear whether and how Pax7 remained largely stable across different cell populations (Fig. 1c). can control gene expression through local chromatin remodeling, However, we found that promoter-anchored inter-TAD interac- enhancer activation, and long-range interactions. tions (detected by pCHi-C) occurred more frequently in Whereas topological changes in chromatin have been exten- ESCs than in iPax7 skeletal muscle progenitors, and the sively investigated in diverse tissue and cell types12–18, technical number of interactions and average interaction distance did not obstacles have hindered similar discoveries in skeletal muscle further decrease during iPax7 cell differentiation (Fig. 1d, e progenitors. For example, satellite cells represent a low- and Supplementary Fig. 1C–E). These restrictions on inter-TAD abundance population in muscle tissue, and these cells sponta- interactions could result from changes in chromatin condensation neously differentiate once isolated. We sought to overcome this during the process of lineage specification and cell obstacle through the induced expression of Pax7 in mouse differentiation23. embryonic stem cells (ESCs), from which skeletal muscle pro- We also used our Hi-C data to explore genome compartmen- genitors, termed iPax7 cells, were derived. Upon transplantation talization, wherein active (A) and repressed (B) chromatin can be into dystrophic mice, iPax7 muscle progenitors functionally segregated into two compartments24. Notably, we observed mimic satellite cells and are able to seed the stem cell niche and striking compartmental switching from ESCs to iPax7 progeni- ameliorate muscle wasting19,20. Importantly, iPax7 progenitors tors, altering ~20% of the genome. In contrast, during iPax7 cell also recapitulate the transcriptomic and epigenetic features of differentiation, the scale of compartment reorganization was satellite cells11. Thus, iPax7 myogenic cells represent a good considerably dampened and comprised only ~6.5% of genomic model for investigating how this TF regulates genomic archi- regions (Fig. 1f, g). Overall, changes in the enrichment of active tecture in muscle progenitor cells. histone modifications and accessible chromatin were consistent To assess genome-wide changes during progenitor specifica- with the activity of switched compartments (Supplementary tion and differentiation in iPax7 cells, we performed Hi-C and Fig. 1F, G). Notably, genes within compartments undergoing promoter capture Hi-C (pCHi-C), which revealed an extensive switching were enriched for skeletal muscle development- and three-dimensional (3D) reorganization of chromatin. By com- cell identity-related annotations (Fig. 1h). Taken together, our paring our results with data from mouse ESCs21, and aided by 3D results suggest that chromatin conformational changes primarily modeling of pCHi-C interactions and proteome-wide capture of occur at an early stage during skeletal muscle lineage specifica- Pax7-interacting proteins, we identified enhancer hubs (EnHs) tion, with additional conformational changes occurring less and elucidated key promoter–enhancer (P–En) interaction frequently during myogenic differentiation. motifs, spatio-temporal rewiring of P–En interactions, and the corresponding impact on gene expression in each cell population during myogenesis. We identified two classes of Pax7-associated Demarcating stable and transient P–En interactions during P–En contacts, the maintenance of which was either Pax7- skeletal muscle specification and differentiation. To understand dependent or independent. Enhancers from the latter group were how cis-regulatory elements regulate myogenic differentiation associated with recruitment of additional myogenic TFs and and gene expression in adult skeletal muscle cells, we generated epigenetic memory during differentiation, and they retained their high-resolution pCHi-C maps capturing genome-wide, long- long-range interactions and an open and active state upon the range interactions with a curated set of 25,747 Ensembl annotated loss of Pax7. Furthermore, we show that Pax7 binds most super- promoters in iPax7 mouse skeletal muscle progenitors (+Dox) enhancers (SEs) that interact with target promoters in iPax7 and differentiating myocytes after Dox withdrawal (−Dox) muscle progenitors and that it establishes feed-forward loops with (Fig. 1b). We also compared our results with published data from a cohort of TFs with which it physically interacts, providing an mouse ESCs21, from which iPax7 cells originate. After merging explanation for the pivotal role of this factor in skeletal muscle data from replicates, we used CHiCAGO25 to identify 107,330 to stem cell specification and maintenance. Lastly, using epigenome 121,802 high-confidence interactions between annotated pro- editing, we show that a previously uncharacterized Pax7-bound moters and distal promoter-interacting DNA fragments in ESCs, EnH within the myosin heavy chain (Myh) cluster can activate Dox-treated, and differentiated conditions (Supplementary three Myh genes needed to build muscle. Fig. 2A and Supplementary Data 1). The majority (>99%) of captured interactions were found in cis (Supplementary Data 1), and >65% of them linked promoter to non-promoter regions in Results all three cell populations, with median distances between 131 and Global chromatin conformational changes during muscle cell 155 kb (Supplementary
Load more

Recommended publications
  • Six3 Overexpression Initiates the Formation of Ectopic Retina
    Downloaded from genesdev.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press RESEARCH COMMUNICATION in the developing eye and ventral forebrain. Recently, in Six3 overexpression initiates Drosophila a member of the Six subclass of homeobox the formation of ectopic retina genes, optix, has been isolated, which by sequence com- parison of the homeobox appears to be the ortholog of Felix Loosli, Sylke Winkler, Six3 (Toy et al. 1998). Functional analysis of optix, how- 1 and Joachim Wittbrodt ever, has not yet been reported. In medaka fish (Oryzias latipes) Six3 is expressed in Sonderforschungsbereich (SFB) Junior Group, Institute for Human Genetics, University of Go¨ ttingen, c/o the anterior-most neuroectoderm at gastrula stages and Max-Planck-Institute (MPI) for Biophysical Chemistry, Am later in the developing retina (Loosli et al. 1998). Mosaic Fassberg, 37077 Go¨ttingen, Germany misexpression of mouse Six3 in small clones, in response to injected plasmid DNA, resulted in the formation of The homeobox gene sine oculis (so) is essential for visual ectopic lenses in the region of the otic vesicle, suggesting system formation in Drosophila. A vertebrate member a decisive role for Six3 during vertebrate lens develop- of the so/Six gene family, Six3, is expressed in the devel- ment (Oliver et al. 1996). Considering the expression of oping eye and forebrain. Injection of Six3 RNA into Six3 in the retinal primordia and the essential role of a medaka fish embryos causes ectopic Pax6 and Rx2 ex- Drosophila homolog, so,inDrosophila eye develop- pression in midbrain and cerebellum, resulting in the ment, we investigated a potential role of Six3 in early formation of ectopic retinal primordia.
    [Show full text]
  • Genetic Epidemiology
    Received: 10 May 2019 | Revised: 31 July 2019 | Accepted: 28 August 2019 DOI: 10.1002/gepi.22260 RESEARCH ARTICLE Population‐wide copy number variation calling using variant call format files from 6,898 individuals Grace Png1,2,3 | Daniel Suveges1,4 | Young‐Chan Park1,2 | Klaudia Walter1 | Kousik Kundu1 | Ioanna Ntalla5 | Emmanouil Tsafantakis6 | Maria Karaleftheri7 | George Dedoussis8 | Eleftheria Zeggini1,3* | Arthur Gilly1,3,9* 1Wellcome Sanger Institute, Wellcome Genome Campus, Hinxton, United Abstract Kingdom Copy number variants (CNVs) play an important role in a number of human 2Department of Medical Genetics, diseases, but the accurate calling of CNVs remains challenging. Most current University of Cambridge, Cambridge, approaches to CNV detection use raw read alignments, which are computationally United Kingdom intensive to process. We use a regression tree‐based approach to call germline CNVs 3Institute of Translational Genomics, Helmholtz Zentrum München—German from whole‐genome sequencing (WGS, >18x) variant call sets in 6,898 samples Research Center for Environmental across four European cohorts, and describe a rich large variation landscape Health, Neuherberg, Germany comprising 1,320 CNVs. Eighty‐one percent of detected events have been previously 4European Bioinformatics Institute, ‐ ‐ Wellcome Genome Campus, Hinxton, reported in the Database of Genomic Variants. Twenty three percent of high quality United Kingdom deletions affect entire genes, and we recapitulate known events such as the GSTM1 5William Harvey Research Institute, Barts and RHD gene deletions. We test for association between the detected deletions and and The London School of Medicine and 275 protein levels in 1,457 individuals to assess the potential clinical impact of the Dentistry, Queen Mary University of London, London, United Kingdom detected CNVs.
    [Show full text]
  • Identification of the Binding Partners for Hspb2 and Cryab Reveals
    Brigham Young University BYU ScholarsArchive Theses and Dissertations 2013-12-12 Identification of the Binding arP tners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non- Redundant Roles for Small Heat Shock Proteins Kelsey Murphey Langston Brigham Young University - Provo Follow this and additional works at: https://scholarsarchive.byu.edu/etd Part of the Microbiology Commons BYU ScholarsArchive Citation Langston, Kelsey Murphey, "Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non-Redundant Roles for Small Heat Shock Proteins" (2013). Theses and Dissertations. 3822. https://scholarsarchive.byu.edu/etd/3822 This Thesis is brought to you for free and open access by BYU ScholarsArchive. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of BYU ScholarsArchive. For more information, please contact [email protected], [email protected]. Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non-Redundant Roles for Small Heat Shock Proteins Kelsey Langston A thesis submitted to the faculty of Brigham Young University in partial fulfillment of the requirements for the degree of Master of Science Julianne H. Grose, Chair William R. McCleary Brian Poole Department of Microbiology and Molecular Biology Brigham Young University December 2013 Copyright © 2013 Kelsey Langston All Rights Reserved ABSTRACT Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactors and Non-Redundant Roles for Small Heat Shock Proteins Kelsey Langston Department of Microbiology and Molecular Biology, BYU Master of Science Small Heat Shock Proteins (sHSP) are molecular chaperones that play protective roles in cell survival and have been shown to possess chaperone activity.
    [Show full text]
  • The Role of E2F7 and E2F8 in Squamous Differentiation, UV- and Chemotherapy-Induced Responses in Keratinocytes
    The role of E2F7 and E2F8 in squamous differentiation, UV- and chemotherapy-induced responses in keratinocytes Mehlika Hazar Rethinam MScBiotech (Hons) A thesis submitted for the degree of Doctor of Philosophy at The University of Queensland in 2014 UQ Diamantina Institute i Abstract Among keratinocyte-derived squamous cell carcinoma (SCC), cutaneous SCC (CSCC) is the second most common cutaneous cancer type and the most common of the potentially fatal skin cancers. Approximately 90% of head and neck cancers are SCC (HNSCC) and HNSCC worldwide is the sixth most common cancer type afflicting mankind. While resectable disease may be treated by surgery with radiation or chemoradiation, there are still no curative options for advanced, unresectable disease. However, chemotherapy alone may offer a hope for unresectable, disseminated SCC, where 50-60% of patients have disease recurrence within 2 years and approximately 30% of these develop metastatic disease. The mainstay of chemotherapeutic treatment in SCC is the platinum-based drug, cisplatin, 5-fluorouracil (5- FU), taxanes, and anti-EGFR monoclonal antibody such as Cetuximab. Nonetheless, despite advances in treatment techniques, the 5-year survival rate still remains at around 55%. Therefore, there remains a lack of options for recurrent or metastatic disease. The E2F family of transcription factors has emerged as key regulators of proliferation, differentiation and response to stress and apoptotic stimuli in keratinocytes. Consistent with these roles, dysregulation of E2F expression/activity is a common occurrence in cancer and SCC in particular. Thus, better understanding of the E2F family of proteins is essential to establish how these processes are disrupted during SCC genesis.
    [Show full text]
  • Table S1 the Four Gene Sets Derived from Gene Expression Profiles of Escs and Differentiated Cells
    Table S1 The four gene sets derived from gene expression profiles of ESCs and differentiated cells Uniform High Uniform Low ES Up ES Down EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol 269261 Rpl12 11354 Abpa 68239 Krt42 15132 Hbb-bh1 67891 Rpl4 11537 Cfd 26380 Esrrb 15126 Hba-x 55949 Eef1b2 11698 Ambn 73703 Dppa2 15111 Hand2 18148 Npm1 11730 Ang3 67374 Jam2 65255 Asb4 67427 Rps20 11731 Ang2 22702 Zfp42 17292 Mesp1 15481 Hspa8 11807 Apoa2 58865 Tdh 19737 Rgs5 100041686 LOC100041686 11814 Apoc3 26388 Ifi202b 225518 Prdm6 11983 Atpif1 11945 Atp4b 11614 Nr0b1 20378 Frzb 19241 Tmsb4x 12007 Azgp1 76815 Calcoco2 12767 Cxcr4 20116 Rps8 12044 Bcl2a1a 219132 D14Ertd668e 103889 Hoxb2 20103 Rps5 12047 Bcl2a1d 381411 Gm1967 17701 Msx1 14694 Gnb2l1 12049 Bcl2l10 20899 Stra8 23796 Aplnr 19941 Rpl26 12096 Bglap1 78625 1700061G19Rik 12627 Cfc1 12070 Ngfrap1 12097 Bglap2 21816 Tgm1 12622 Cer1 19989 Rpl7 12267 C3ar1 67405 Nts 21385 Tbx2 19896 Rpl10a 12279 C9 435337 EG435337 56720 Tdo2 20044 Rps14 12391 Cav3 545913 Zscan4d 16869 Lhx1 19175 Psmb6 12409 Cbr2 244448 Triml1 22253 Unc5c 22627 Ywhae 12477 Ctla4 69134 2200001I15Rik 14174 Fgf3 19951 Rpl32 12523 Cd84 66065 Hsd17b14 16542 Kdr 66152 1110020P15Rik 12524 Cd86 81879 Tcfcp2l1 15122 Hba-a1 66489 Rpl35 12640 Cga 17907 Mylpf 15414 Hoxb6 15519 Hsp90aa1 12642 Ch25h 26424 Nr5a2 210530 Leprel1 66483 Rpl36al 12655 Chi3l3 83560 Tex14 12338 Capn6 27370 Rps26 12796 Camp 17450 Morc1 20671 Sox17 66576 Uqcrh 12869 Cox8b 79455 Pdcl2 20613 Snai1 22154 Tubb5 12959 Cryba4 231821 Centa1 17897
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • E2f8 Mediates Tumor Suppression in Postnatal Liver Development
    Downloaded from http://www.jci.org on January 18, 2017. https://doi.org/10.1172/JCI85506 The Journal of Clinical Investigation RESEARCH ARTICLE E2f8 mediates tumor suppression in postnatal liver development Lindsey N. Kent,1,2,3 Jessica B. Rakijas,1,2,3 Shusil K. Pandit,4 Bart Westendorp,4 Hui-Zi Chen,1,2,3,5 Justin T. Huntington,1,2,3,6 Xing Tang,1,2,3 Sooin Bae,1,2,3 Arunima Srivastava,1,2,3,7 Shantibhusan Senapati,1,2,3 Christopher Koivisto,1,2,3 Chelsea K. Martin,1,2,3 Maria C. Cuitino,1,2,3 Miguel Perez,1,2,3 Julian M. Clouse,1,2,3 Veda Chokshi,1,2,3 Neelam Shinde,1,2,3 Raleigh Kladney,1,2,3 Daokun Sun,1,2,3 Antonio Perez-Castro,1,2,3 Ramadhan B. Matondo,4 Sathidpak Nantasanti,4 Michal Mokry,8 Kun Huang,9 Raghu Machiraju,7 Soledad Fernandez,9 Thomas J. Rosol,10 Vincenzo Coppola,1,3 Kamal S. Pohar,11 James M. Pipas,12 Carl R. Schmidt,6 Alain de Bruin,4,13 and Gustavo Leone1,2,3 1Department of Cancer Biology and Genetics, College of Medicine, 2Department of Molecular Genetics, College of Biological Sciences, and 3Comprehensive Cancer Center, The Ohio State University, Columbus, Ohio, USA. 4Department of Pathobiology, Faculty of Veterinary Medicine, Utrecht University, Utrecht, Netherlands. 5Division of Medical Oncology, Department of Internal Medicine, 6Department of Surgery, College of Medicine, and 7Department of Computer Science and Engineering, College of Engineering, The Ohio State University, Columbus, Ohio, USA. 8Department of Pediatrics, Wilhelmina Children’s Hospital, University Medical Center Utrecht, Utrecht, Netherlands.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • The E–Id Protein Axis Modulates the Activities of the PI3K–AKT–Mtorc1
    Downloaded from genesdev.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press The E–Id protein axis modulates the activities of the PI3K–AKT–mTORC1– Hif1a and c-myc/p19Arf pathways to suppress innate variant TFH cell development, thymocyte expansion, and lymphomagenesis Masaki Miyazaki,1,8 Kazuko Miyazaki,1,8 Shuwen Chen,1 Vivek Chandra,1 Keisuke Wagatsuma,2 Yasutoshi Agata,2 Hans-Reimer Rodewald,3 Rintaro Saito,4 Aaron N. Chang,5 Nissi Varki,6 Hiroshi Kawamoto,7 and Cornelis Murre1 1Department of Molecular Biology, University of California at San Diego, La Jolla, California 92093, USA; 2Department of Biochemistry and Molecular Biology, Shiga University of Medical School, Shiga 520-2192, Japan; 3Division of Cellular Immunology, German Cancer Research Center, D-69120 Heidelberg, Germany; 4Department of Medicine, University of California at San Diego, La Jolla, California 92093, USA; 5Center for Computational Biology, Institute for Genomic Medicine, University of California at San Diego, La Jolla, California 92093, USA; 6Department of Pathology, University of California at San Diego, La Jolla, California 92093, USA; 7Department of Immunology, Institute for Frontier Medical Sciences, Kyoto University, Kyoto 606-8507, Japan It is now well established that the E and Id protein axis regulates multiple steps in lymphocyte development. However, it remains unknown how E and Id proteins mechanistically enforce and maintain the naı¨ve T-cell fate. Here we show that Id2 and Id3 suppressed the development and expansion of innate variant follicular helper T (TFH) cells. Innate variant TFH cells required major histocompatibility complex (MHC) class I-like signaling and were associated with germinal center B cells.
    [Show full text]
  • Triplet Repeat Length Bias and Variation in the Human Transcriptome
    Triplet repeat length bias and variation in the human transcriptome Michael Mollaa,1,2, Arthur Delcherb,1, Shamil Sunyaevc, Charles Cantora,d,2, and Simon Kasifa,e aDepartment of Biomedical Engineering and dCenter for Advanced Biotechnology, Boston University, Boston, MA 02215; bCenter for Bioinformatics and Computational Biology, University of Maryland, College Park, MD 20742; cDepartment of Medicine, Division of Genetics, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA 02115; and eCenter for Advanced Genomic Technology, Boston University, Boston, MA 02215 Contributed by Charles Cantor, July 6, 2009 (sent for review May 4, 2009) Length variation in short tandem repeats (STRs) is an important family including Huntington’s disease (10) and hereditary ataxias (11, 12). of DNA polymorphisms with numerous applications in genetics, All Huntington’s patients exhibit an expanded number of copies in medicine, forensics, and evolutionary analysis. Several major diseases the CAG tandem repeat subsequence in the N terminus of the have been associated with length variation of trinucleotide (triplet) huntingtin gene. Moreover, an increase in the repeat length is repeats including Huntington’s disease, hereditary ataxias and spi- anti-correlated to the onset age of the disease (13). Multiple other nobulbar muscular atrophy. Using the reference human genome, we diseases have also been associated with copy number variation of have catalogued all triplet repeats in genic regions. This data revealed tandem repeats (8, 14). Researchers have hypothesized that inap- a bias in noncoding DNA repeat lengths. It also enabled a survey of propriate repeat variation in coding regions could result in toxicity, repeat-length polymorphisms (RLPs) in human genomes and a com- incorrect folding, or aggregation of a protein.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Forkhead Transcription Factors and Ageing
    Oncogene (2008) 27, 2351–2363 & 2008 Nature Publishing Group All rights reserved 0950-9232/08 $30.00 www.nature.com/onc REVIEW Forkhead transcription factors and ageing L Partridge1 and JC Bru¨ ning2 1Institute of Healthy Ageing, GEE, London, UK; 2Department of Mouse Genetics and Metabolism, Institute for Genetics University of Cologne, Cologne, Germany Mutations in single genes and environmental interventions Forkhead transcription factors are turning out to play can extend healthy lifespan in laboratory model organi- a key role in invertebrate models ofextension ofhealthy sms. Some of the mechanisms involved show evolutionary lifespan by single-gene mutations, and evidence is conservation, opening the way to using simpler inverte- mounting for their importance in mammals. Forkheads brates to understand human ageing. Forkhead transcrip- can also play a role in extension oflifespanby dietary tion factors have been found to play a key role in lifespan restriction, an environmental intervention that also extension by alterations in the insulin/IGF pathway and extends lifespan in diverse organisms (Kennedy et al., by dietary restriction. Interventions that extend lifespan 2007). Here, we discuss these findings and their have also been found to delay or ameliorate the impact of implications. The forkhead family of transcription ageing-related pathology and disease, including cancer. factors is characterized by a type of DNA-binding Understanding the mode of action of forkheads in this domain known as the forkhead box (FOX) (Weigel and context will illuminate the mechanisms by which ageing Jackle, 1990). They are also called winged helix acts as a risk factor for ageing-related disease, and could transcription factors because of the crystal structure lead to the development of a broad-spectrum, preventative ofthe FOX, ofwhich the forkheadscontain a medicine for the diseases of ageing.
    [Show full text]