DOCSLIB.ORG

FOXO Animal Models Reveal a Variety of Diverse Roles for FOXO Transcription Factors

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
FOXO Animal Models Reveal a Variety of Diverse Roles for FOXO Transcription Factors Oncogene (2008) 27, 2345–2350 & 2008 Nature Publishing Group All rights reserved 0950-9232/08 $30.00 www.nature.com/onc REVIEW FOXO animal models reveal a variety of diverse roles for FOXO transcription factors KC Arden Department of Medicine, Ludwig Institute for Cancer Research, University of California San Diego School of Medicine, La Jolla, CA, USA The Foxo subfamily of FOX transcription factors plays a organismal development, function of the immune and variety of roles in a broad assortment of diverse nervous systems, and metabolism. It has also allowed physiological processes including cellular differentiation, models ofhuman disease to be generated. These models tumor suppression, metabolism, cell cycle arrest, cell have been instrumental in determining the mechanism of death and protection from stress.Animal models have action ofnew therapies fordisease and have allowed proved to be invaluable tools in furthering our under- preclinical testing ofnew therapeutic approaches. standing of the role of particular genes in complex Multiple animal models have made unique contribu- organismal processes.Multiple animal models in diverse tions and invaluably aided our understanding ofthe species, including Caenorhabditis elegans, Drosophila. various roles ofthe FOXO familyoftranscription melanogaster and the laboratory mouse, exist for the factors. Foxo family of transcription factors. Foxo genes are highly conserved throughout the evolution and each of these model systems has provided valuable insight into the roles of Foxo factors.Many roles are conserved among The FOXO subfamily of FOX genes the different model organisms.Several Foxo-related animal model systems are reviewed here along with the The FOXO family of transcription factors regulates a knowledge gleaned to date from each model system. wide variety ofcellular and organismal processes both Oncogene (2008) 27, 2345–2350; doi:10.1038/onc.2008.27 during development and in the adult. The forkhead superfamily of transcription factors shares a highly Keywords: FOXO; FKHR; daf-16; dFoxo; animal conserved 100 amino-acid DNA binding or FOX models (Forkhead box) domain. The three predominant members ofthe mammalian Foxo subfamily ofthe Fox transcription factors (Foxo1, Foxo3 and Foxo4) were identified through the cloning ofchromosomal trans- location break points associated with cancer (reviewed Animal models by Arden, 2006). All three Foxo factors are similarly regulated through phosphorylation by a variety of The recent awarding ofthe 2007 Noble Prize in kinases, including AKT/protein kinase B (PKB), serum- Physiology or Medicine to Mario R Capecchi and and glucocorticoid-inducible kinase, casein kinase 1, Oliver Smithies and Sir Martin J Evans for gene dual-specificity tyrosine-phosphorylated and -regulated targeting in mice (Vogel, 2007) only serves to emphasize kinase 1A and anti-I-kappa-B kinase b, typically the importance ofanimal models in understanding the resulting in Foxo inactivation by active nuclear export role ofparticular genes in processes such as embryonic to the cytoplasm. In contrast, in response to stress development, adult physiology, disease and aging. stimuli, Foxo can be phosphorylated by the mitogen- Organisms used as animal models share the distinctive activated protein kinase family member, jun N-terminal characteristic that it is possible to manipulate the kinase (JNK), resulting in the opposite effect, the genome and modify specific genes. It is through the movement ofFoxo fromthe cytoplasm to the nucleus. raising and careful observation of these genetically The AKT and JNK pathways appear to operate in modified animals that clues are provided about the opposition by regulating subcellular localization of normal function of the gene or genes in question. These Foxo factors using environmental cues promoting signal types ofexperiments have provided valuable insight into transduction from different pathways (reviewed in Greer and Brunet, 2005). The Foxos have overlapping gene expression patterns Correspondence: Dr KC Arden, Department ofMedicine, Ludwig both during development and in the adult. In addition, Institute for Cancer Research, University of California San Diego School ofMedicine, 9500 Gilman Drive, No. 0660, La Jolla, CA Foxo1, Foxo3 and Foxo4 bind to the same DNA target 92093-0660 USA. sequence and are capable ofregulating the same target E-mail: [email protected] genes. A fourth Foxo family member, FOXO6, whose Foxo function in complex organisms is revealed in model systems KC Arden 2346 expression is restricted to the brain, has been identified, regulatory pathway, so elegantly dissected in worms, but is more distantly related and is not regulated by may be conserved in higher level organisms that set subcellular localization (Jacobs et al., 2003). Foxo1, the stage for studies in higher organisms. Studies on Foxo3 and Foxo4 have been found to play important DAF-16 in C. elegans did not end with the discovery of roles in variety of processes including cellular differ- this regulatory mechanism. Further studies have entiation, tumor suppression, metabolism, cell cycle revealed that DAF-16 regulation is complex and arrest, cell death and protection from stress. These roles impacted by several additional pathways important to have been discovered through manipulation ofthe genes the biological processes of C. elegans including sensory encoding these factors in cell-based systems and in perception, germ line signaling and JNK signaling animals including Caenorhabditis elegans, Drosophila (reviewed by Mukhopadhyay and Tissenbaum, 2007). melanogaster and laboratory mice. Drosophila melanogaster Caenorhabditis elegans The fruit fly Drosophila melanogaster is another manip- The round worm C. elegans is the first animal in which a ulable animal model system. D. melanogaster has been FOXO ortholog was modified and the resulting used for genetic experiments for over a century. One of phenotype was characterized. This organism offers the reasons it continues to be a valuable model animal is several advantages for the study of gene function: it that much is known about how to optimally handle the has a short life cycle; every animal has a specific number flies. Similar to C. elegans, these are small animals with a ofcells; and much is known about how these cells relatively short life cycle of about 2 weeks. Mutant flies contribute to the adult organism. It also has the with defects in thousands of genes are readily available. distinction ofbeing the first multicellular animal to In fact, the name ‘forkhead’ comes from observations of have its genome sequenced. flies with mutations in the ‘forkhead’ gene. These flies Dauer larva formation in C. elegans is controlled by developed ectopic head structures giving the appearance environmental cues. The word ‘dauer’ comes from the oftwo heads. There are established and well-understood German meaning ‘endurance’ or ‘duration.’ C. elegans methods for manipulating the fly genome and the entire has the ability to halt development under conditions of genome has now been sequenced. starvation or overcrowding and to enter a dauer larval The amino-acid sequence ofthe D. melanogaster stage. This is a reversible stage ofdevelopment, in which homolog of daf-16, dFOXO, was highly conserved when the worms develop impermeable cuticles, their metabolic compared to DAF-16 (Kramer et al., 2003). It was rate slows down dramatically and they do not feed for up discovered that overexpression of dFOXO leads to a to 3 months. Ifnutrients become more abundant and the reduction in the size ofthe animal due to decreases in environment is less crowed, the worms sense the change, cell size and cell number. This phenotype was very exit the dauer stage and complete the developmental similar to starvation, suggesting that dFOXO plays a process to become a mature adult. The FOXO ortholog, role in nutrient sensing, similar to that observed in daf-16, was one ofa number ofgenes identified as a C. elegans (Kramer et al., 2003). Interestingly, over- mediator ofdauer formation by studying the effects of expression of dFOXO targeted to specific tissues in the gene mutation in C. elegans (Riddle et al., 1981). Over a fly results in a reduction in organ size by reducing cell decade later, the connection between DAF-16’s role in number but does not seem to have an effect on cell size dauer formation and its role in C. elegans life span was (Puig et al., 2003). Flies lacking dFOXO appear discovered (Kenyon et al., 1993). Daf-16 influences life physically normal but show increased sensitivity span in the worm by mediating insulin-like metabolic to oxidative stress (Ju¨ nger et al., 2003). Expression signaling and confers life extension as well as resistance to of dFOXO in the adult pericerebral at body of stress (Murakami and Johnson, 1996; Lin et al., 1997; D. melanogaster has been shown to decrease mortality Ogg et al., 1997). Mutations in daf-16 prevent dauer and increase life span significantly (Giannakou et al., formation under the environmental conditions that 2004; Hwangbo et al., 2004). dFOXO has also been normally promote dauer formation. Through additional shown to play a role in the control ofinsulin receptor experimentation it was determined that the insulin-like (Insr). Starvation ofwild-type flies upregulates Insr pathway in worms included two C. elegans AKT-PKB expression. However, flies deficient for dFOXO cannot homologs that function primarily to inactivate Daf-16 upregulate Insr in response to starvation, suggesting that providing the first evidence
Load more

Recommended publications
  • The Title of the Dissertation
    UNIVERSITY OF CALIFORNIA SAN DIEGO Novel network-based integrated analyses of multi-omics data reveal new insights into CD8+ T cell differentiation and mouse embryogenesis A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Bioinformatics and Systems Biology by Kai Zhang Committee in charge: Professor Wei Wang, Chair Professor Pavel Arkadjevich Pevzner, Co-Chair Professor Vineet Bafna Professor Cornelis Murre Professor Bing Ren 2018 Copyright Kai Zhang, 2018 All rights reserved. The dissertation of Kai Zhang is approved, and it is accept- able in quality and form for publication on microfilm and electronically: Co-Chair Chair University of California San Diego 2018 iii EPIGRAPH The only true wisdom is in knowing you know nothing. —Socrates iv TABLE OF CONTENTS Signature Page ....................................... iii Epigraph ........................................... iv Table of Contents ...................................... v List of Figures ........................................ viii List of Tables ........................................ ix Acknowledgements ..................................... x Vita ............................................. xi Abstract of the Dissertation ................................. xii Chapter 1 General introduction ............................ 1 1.1 The applications of graph theory in bioinformatics ......... 1 1.2 Leveraging graphs to conduct integrated analyses .......... 4 1.3 References .............................. 6 Chapter 2 Systematic
    [Show full text]
  • The DNA Methylation of FOXO3 and TP53 As a Blood Biomarker of Late
    Yuan et al. J Transl Med (2020) 18:467 https://doi.org/10.1186/s12967-020-02643-y Journal of Translational Medicine RESEARCH Open Access The DNA methylation of FOXO3 and TP53 as a blood biomarker of late-onset asthma Lin Yuan1,2,3, Leyuan Wang2, Xizi Du2, Ling Qin1,3, Ming Yang4, Kai Zhou2, Mengping Wu2, Yu Yang2, Zhiyuan Zheng1,3, Yang Xiang2, Xiangping Qu2, Huijun Liu2, Xiaoqun Qin2 and Chi Liu1,2,5* Abstract Background: Late-onset asthma (LOA) is beginning to account for an increasing proportion of asthma patients, which is often underdiagnosed in the elderly. Studies on the possible relations between aging-related genes and LOA contribute to the diagnosis and treatment of LOA. Forkhead Box O3 (FOXO3) and TP53 are two classic aging-related genes. DNA methylation varies greatly with age which may play an important role in the pathogenesis of LOA. We supposed that the diferentially methylated sites of FOXO3 and TP53 associated with clinical phenotypes of LOA may be useful biomarkers for the early screening of LOA. Methods: The mRNA expression and DNA methylation of FOXO3 and TP53 in peripheral blood of 43 LOA patients (15 mild LOA, 15 moderate LOA and 13 severe LOA) and 60 healthy controls (HCs) were determined. The association of methylated sites with age was assessed by Cox regression to control the potential confounders. Then, the correlation between diferentially methylated sites (DMSs; p-value < 0.05) and clinical lung function in LOA patients was evalu- ated. Next, candidate DMSs combining with age were evaluated to predict LOA by receiver operating characteristic (ROC) analysis and principal components analysis (PCA).
    [Show full text]
  • The E–Id Protein Axis Modulates the Activities of the PI3K–AKT–Mtorc1
    Downloaded from genesdev.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press The E–Id protein axis modulates the activities of the PI3K–AKT–mTORC1– Hif1a and c-myc/p19Arf pathways to suppress innate variant TFH cell development, thymocyte expansion, and lymphomagenesis Masaki Miyazaki,1,8 Kazuko Miyazaki,1,8 Shuwen Chen,1 Vivek Chandra,1 Keisuke Wagatsuma,2 Yasutoshi Agata,2 Hans-Reimer Rodewald,3 Rintaro Saito,4 Aaron N. Chang,5 Nissi Varki,6 Hiroshi Kawamoto,7 and Cornelis Murre1 1Department of Molecular Biology, University of California at San Diego, La Jolla, California 92093, USA; 2Department of Biochemistry and Molecular Biology, Shiga University of Medical School, Shiga 520-2192, Japan; 3Division of Cellular Immunology, German Cancer Research Center, D-69120 Heidelberg, Germany; 4Department of Medicine, University of California at San Diego, La Jolla, California 92093, USA; 5Center for Computational Biology, Institute for Genomic Medicine, University of California at San Diego, La Jolla, California 92093, USA; 6Department of Pathology, University of California at San Diego, La Jolla, California 92093, USA; 7Department of Immunology, Institute for Frontier Medical Sciences, Kyoto University, Kyoto 606-8507, Japan It is now well established that the E and Id protein axis regulates multiple steps in lymphocyte development. However, it remains unknown how E and Id proteins mechanistically enforce and maintain the naı¨ve T-cell fate. Here we show that Id2 and Id3 suppressed the development and expansion of innate variant follicular helper T (TFH) cells. Innate variant TFH cells required major histocompatibility complex (MHC) class I-like signaling and were associated with germinal center B cells.
    [Show full text]
  • A Flexible Microfluidic System for Single-Cell Transcriptome Profiling
    www.nature.com/scientificreports OPEN A fexible microfuidic system for single‑cell transcriptome profling elucidates phased transcriptional regulators of cell cycle Karen Davey1,7, Daniel Wong2,7, Filip Konopacki2, Eugene Kwa1, Tony Ly3, Heike Fiegler2 & Christopher R. Sibley 1,4,5,6* Single cell transcriptome profling has emerged as a breakthrough technology for the high‑resolution understanding of complex cellular systems. Here we report a fexible, cost‑efective and user‑ friendly droplet‑based microfuidics system, called the Nadia Instrument, that can allow 3′ mRNA capture of ~ 50,000 single cells or individual nuclei in a single run. The precise pressure‑based system demonstrates highly reproducible droplet size, low doublet rates and high mRNA capture efciencies that compare favorably in the feld. Moreover, when combined with the Nadia Innovate, the system can be transformed into an adaptable setup that enables use of diferent bufers and barcoded bead confgurations to facilitate diverse applications. Finally, by 3′ mRNA profling asynchronous human and mouse cells at diferent phases of the cell cycle, we demonstrate the system’s ability to readily distinguish distinct cell populations and infer underlying transcriptional regulatory networks. Notably this provided supportive evidence for multiple transcription factors that had little or no known link to the cell cycle (e.g. DRAP1, ZKSCAN1 and CEBPZ). In summary, the Nadia platform represents a promising and fexible technology for future transcriptomic studies, and other related applications, at cell resolution. Single cell transcriptome profling has recently emerged as a breakthrough technology for understanding how cellular heterogeneity contributes to complex biological systems. Indeed, cultured cells, microorganisms, biopsies, blood and other tissues can be rapidly profled for quantifcation of gene expression at cell resolution.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Forkhead Transcription Factors and Ageing
    Oncogene (2008) 27, 2351–2363 & 2008 Nature Publishing Group All rights reserved 0950-9232/08 $30.00 www.nature.com/onc REVIEW Forkhead transcription factors and ageing L Partridge1 and JC Bru¨ ning2 1Institute of Healthy Ageing, GEE, London, UK; 2Department of Mouse Genetics and Metabolism, Institute for Genetics University of Cologne, Cologne, Germany Mutations in single genes and environmental interventions Forkhead transcription factors are turning out to play can extend healthy lifespan in laboratory model organi- a key role in invertebrate models ofextension ofhealthy sms. Some of the mechanisms involved show evolutionary lifespan by single-gene mutations, and evidence is conservation, opening the way to using simpler inverte- mounting for their importance in mammals. Forkheads brates to understand human ageing. Forkhead transcrip- can also play a role in extension oflifespanby dietary tion factors have been found to play a key role in lifespan restriction, an environmental intervention that also extension by alterations in the insulin/IGF pathway and extends lifespan in diverse organisms (Kennedy et al., by dietary restriction. Interventions that extend lifespan 2007). Here, we discuss these findings and their have also been found to delay or ameliorate the impact of implications. The forkhead family of transcription ageing-related pathology and disease, including cancer. factors is characterized by a type of DNA-binding Understanding the mode of action of forkheads in this domain known as the forkhead box (FOX) (Weigel and context will illuminate the mechanisms by which ageing Jackle, 1990). They are also called winged helix acts as a risk factor for ageing-related disease, and could transcription factors because of the crystal structure lead to the development of a broad-spectrum, preventative ofthe FOX, ofwhich the forkheadscontain a medicine for the diseases of ageing.
    [Show full text]
  • Biophysical Investigation of the Dual Binding Surfaces of Human Transcription Factors FOXO4 and P53
    bioRxiv preprint doi: https://doi.org/10.1101/2021.01.11.425814; this version posted January 11, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Biophysical investigation of the dual binding surfaces of human transcription factors FOXO4 and p53 Jinwoo Kim+, Dabin Ahn+, and Chin-Ju Park* Department of Chemistry, Gwangju Institute of Science and Technology, Gwangju, 61005, Korea *Correspondence to: [email protected]. + These authors contributed equally to this work. 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.01.11.425814; this version posted January 11, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Abstract Cellular senescence is protective against external oncogenic stress, but its accumulation causes aging- related diseases. Forkhead box O4 (FOXO4) and p53 are human transcription factors known to promote senescence by interacting in the promyelocytic leukemia bodies. Inhibiting their binding is a strategy for inducing apoptosis of senescent cells, but the binding surfaces that mediate the interaction of FOXO4 and p53 remain elusive. Here, we investigated two binding sites involved in the interaction between FOXO4 and p53 by using NMR spectroscopy. NMR chemical shift perturbation analysis showed that the binding between FOXO4’s forkhead domain (FHD) and p53’s transactivation domain (TAD), and between FOXO4’s C-terminal transactivation domain (CR3) and p53’s DNA binding domain (DBD), mediate the FOXO4-p53 interaction.
    [Show full text]
  • Regulation of PERK Expression by FOXO3: a Vulnerability of Drug- Resistant Cancer Cells
    Oncogene (2019) 38:6382–6398 https://doi.org/10.1038/s41388-019-0890-7 ARTICLE Regulation of PERK expression by FOXO3: a vulnerability of drug- resistant cancer cells 1 1 1 1 1 Glowi Alasiri ● Yannasittha Jiramongkol ● Stefania Zona ● Lavender Y. -N. Fan ● Zimam Mahmud ● 2 2 1 Gyungyub Gong ● Hee Jin Lee ● Eric W. -F. Lam Received: 15 February 2019 / Revised: 28 June 2019 / Accepted: 2 July 2019 / Published online: 16 July 2019 © The Author(s) 2019. This article is published with open access Abstract The major impediment to effective cancer therapy has been the development of drug resistance. The tumour suppressive transcription factor FOXO3 promotes cell cycle arrest, senescence and cell death, and mediates the cytotoxic and cytostatic functions of cancer therapeutics. In consequence, FOXO3 is often downregulated as an adaptive response in cancer and particularly in chemotherapeutic drug-resistant cells. Consistently, we find that FOXO3 expression is attenuated in the drug- resistant MCF-7-EpiR and MCF-7-TaxR compared to the parental MCF-7 breast cancer cells. Using ChIP, short-interfering RNA (siRNA) knockdown, and overexpression assays as well as Foxo1/3/4−/− MEFs, we establish the endoplasmic reticulum 1234567890();,: 1234567890();,: (ER)-stress defence modulator PERK (eIF2AK3) as a direct downstream transcriptional target of FOXO3. In agreement, there is also a positive correlation between FOXO3 and PERK expression at the protein and RNA levels in breast cancer patient samples. We uncover that PERK expression is downregulated but its activity constitutively elevated in the drug- resistant cells. With this in mind, we exploit this adaptive response of low FOXO3 and PERK expression, and high PERK activity in drug-resistant breast cancer cells and show that these drug-resistant cells are specifically sensitive to PERK inhibition.
    [Show full text]
  • Up-Regulation of Foxo4 Mediated by Hepatitis B Virus X Protein Confers Resistance to Oxidative Stress-Induced Cell Death
    INTERNATIONAL JOURNAL OF MoleCular MEDICine 28: 255-260, 2011 Up-regulation of Foxo4 mediated by hepatitis B virus X protein confers resistance to oxidative stress-induced cell death Ratakorn SRISUTTEE1, SANG SEOK KOH3, EUN HEE PARK1, IL-RAE CHO1, HYE JIN MIN3, BYUNG HAK JHUN2, DAE-YEUL YU4, SUN PARK5, DO YUN PARK6, MI OCK LEE7, DIEGO H. CASTRILLON8, RANDAL N. Johnston9 and YOUNG-Hwa CHUNG1 1WCU Department of Cogno-Mechatronics Engineering and 2Department of Nanomedical Engineering, BK21 Nanofusion Technology Team, Pusan National University, Busan; 3Therapeutic Antibody Research Center and 4Disease Model Research Center, Korea Research Institute of Bioscience and Biotechnology, Daejeon; 5Department of Microbiology, Ajou University School of Medicine, Suwon; 6Department of Pathology, College of Medicine, Pusan National University, Yangsan; 7College of Pharmacy, Seoul National University, Seoul, Republic of Korea; 8Department of Pathology and Simmons Comprehensive Cancer Center, University of Texas Southwestern Medical Center, Dallas, TX, USA; 9Department of Biochemistry and Molecular Biology, University of Calgary, Calgary, Alberta, Canada Received January 27, 2011; Accepted March 17, 2011 DOI: 10.3892/ijmm.2011.699 Abstract. The hepatitis B virus X (HBX) protein, a regula- may be a useful target for suppression in the treatment of tory protein of the hepatitis B virus (HBV), has been shown HBV-associated hepatocellular carcinoma cells. to generate reactive oxygen species (ROS) in human liver cell lines; however, the mechanism by which cells protect them- Introduction selves under this oxidative stress is poorly understood. Here, we show that HBX induces the up-regulation of Forkhead box The human hepatitis B virus (HBV) induces acute and class O 4 (Foxo4) not only in Chang cells stably expressing chronic hepatitis and is closely associated with the incidence HBX (Chang-HBX) but also in primary hepatic tissues of human liver cancer (1,2).
    [Show full text]
  • Genequery™ Human Stem Cell Transcription Factors Qpcr Array
    GeneQuery™ Human Stem Cell Transcription Factors qPCR Array Kit (GQH-SCT) Catalog #GK125 Product Description ScienCell's GeneQuery™ Human Stem Cell Transcription Factors qPCR Array Kit (GQH-SCT) surveys a panel of 88 transcription factors related to stem cell maintenance and differentiation. Transcription factors are proteins that can regulate target gene transcription level by binding to specific regions of the genome known as enhancers or silencers. Brief examples of how genes may be grouped according to their functions are shown below: • Pluripotency transcription factors: NANOG, POU5F1, SOX2 • Embryonic development: EOMES, FOXC2/D3/O1, HOXA9/A10, KLF2/5, LIN28B, MAX, PITX2, SMAD1, TBX5, ZIC1 • Germ layer formation and differentiation: FOXA2, GATA6, HAND1, ISL1, KLF4, SMAD2, SOX9 • Organ morphogenesis: EZH2, HOXA11/B3/B5/C9, MSX2, MYC, PAX5/8, VDR • Angiogenesis: CDX2, JUN, NR2F2, RUNX1, WT1 • Hematopoiesis and osteogenesis: EGR3, ESR1, GATA1/2/3, GLI2, NFATC1, PAX9, RB1, SOX6, SP1, STAT1 • Neural stem cell maintenance and differentiation: ATF2, CREB1, FOSB, FOXO3, HES1, HOXD10, MCM2/7, MEF2C, NEUROD1/G1, OLIG1/2, PAX3/6, POU4F1, PPARG, SMAD3/4, SNAI1, STAT3 Note : all gene names follow their official symbols by the Human Genome Organization Gene Nomenclature Committee (HGNC). GeneQuery™ qPCR array kits are qPCR ready in a 96-well plate format, with each well containing one primer set that can specifically recognize and efficiently amplify a target gene's cDNA. The carefully designed primers ensure that: (i) the optimal annealing temperature in qPCR analysis is 65°C (with 2 mM Mg 2+ , and no DMSO); (ii) the primer set recognizes all known transcript variants of target gene, unless otherwise indicated; and (iii) only one gene is amplified.
    [Show full text]
  • In Vitro Targeting of Transcription Factors to Control the Cytokine Release Syndrome in 2 COVID-19 3
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.29.424728; this version posted December 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. 1 In vitro Targeting of Transcription Factors to Control the Cytokine Release Syndrome in 2 COVID-19 3 4 Clarissa S. Santoso1, Zhaorong Li2, Jaice T. Rottenberg1, Xing Liu1, Vivian X. Shen1, Juan I. 5 Fuxman Bass1,2 6 7 1Department of Biology, Boston University, Boston, MA 02215, USA; 2Bioinformatics Program, 8 Boston University, Boston, MA 02215, USA 9 10 Corresponding author: 11 Juan I. Fuxman Bass 12 Boston University 13 5 Cummington Mall 14 Boston, MA 02215 15 Email: [email protected] 16 Phone: 617-353-2448 17 18 Classification: Biological Sciences 19 20 Keywords: COVID-19, cytokine release syndrome, cytokine storm, drug repurposing, 21 transcriptional regulators 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.29.424728; this version posted December 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. 22 Abstract 23 Treatment of the cytokine release syndrome (CRS) has become an important part of rescuing 24 hospitalized COVID-19 patients. Here, we systematically explored the transcriptional regulators 25 of inflammatory cytokines involved in the COVID-19 CRS to identify candidate transcription 26 factors (TFs) for therapeutic targeting using approved drugs.
    [Show full text]
  • Stimulation of Sirt1-Regulated Foxo Protein Function by the Ligand-Bound Vitamin D Receptorᰔ Beum-Soo An,1 Luz E
    MOLECULAR AND CELLULAR BIOLOGY, Oct. 2010, p. 4890–4900 Vol. 30, No. 20 0270-7306/10/$12.00 doi:10.1128/MCB.00180-10 Copyright © 2010, American Society for Microbiology. All Rights Reserved. Stimulation of Sirt1-Regulated FoxO Protein Function by the Ligand-Bound Vitamin D Receptorᰔ Beum-Soo An,1 Luz E. Tavera-Mendoza,2 Vassil Dimitrov,2 Xiaofeng Wang,1 Mario R. Calderon,1 Hui-Jun Wang,1 and John H. White1,2* Departments of Physiology1 and Medicine,2 McGill University, Montreal, Quebec, Canada Received 12 February 2010/Returned for modification 8 April 2010/Accepted 4 August 2010 Hormonal vitamin D, 1,25-dihydroxyvitamin D (1,25D), signals through the nuclear vitamin D receptor (VDR). 1,25D regulates cell proliferation and differentiation and has been identified as a cancer chemopre- ventive agent. FoxO proteins are transcription factors that control cell proliferation and survival. They function as tumor suppressors and are associated with longevity in several organisms. Accumulating data have revealed that 1,25D and FoxO proteins regulate similarly common target genes. We show here that the ligand-bound VDR regulates the posttranslational modification and function of FoxO proteins. 1,25D treat- ment enhances binding of FoxO3a and FoxO4 within4htopromoters of FoxO target genes and blocks mitogen-induced FoxO protein nuclear export. The VDR associates directly with FoxO proteins and regulators, the sirtuin 1 (Sirt1) class III histone deacetylase (HDAC), and protein phosphatase 1. In addition, phosphatase activity and trichostatin A-resistant HDAC activity coimmunoprecipitate with the VDR. 1,25D treatment rapidly (in <4 h) induces FoxO deacetylation and dephosphorylation, consistent with activation.
    [Show full text]