DOCSLIB.ORG

N'-1- Gene a in Colon Cancer Mrna - Sy?- Gene a in Lung Cancer Mrna

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
N'-1- Gene a in Colon Cancer Mrna - Sy?- Gene a in Lung Cancer Mrna US 20080045471 A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2008/0045471 A1 NOrth (43) Pub. Date: Feb. 21, 2008 (54) NUCLEC ACDS FOR APOPTOSIS OF Publication Classification CANCER CELLS (51) Int. Cl. A6IR 48/00 (2006.01) (76) Inventor: Don Adams North, Arlington, TX (US) C7H 2L/00 (2006.01) CI2N 5/06 (2006.01) Correspondence Address: (52) U.S. Cl. ............................ 514/44; 435/375; 536/23.1 BAKER BOTTS LLP. (57) ABSTRACT PATENT DEPARTMENT The disclosure relates to nucleic acids having Apoptotic 98 SANJACINTO BLVD., SUITE 1500 Sequence Nos. 5, 8, 9, 11, 14, 60 and 66. It also relates to AUSTIN, TX 78701-4039 (US) agents targeting Apoptotic Sequences, said agents having SEQID NO:1, SEQID NO:2, SEQID NO:3, SEQID NO:4, SEQ ID NO: 5, SEQ ID NO:6, and SEQ ID NO:7. The (21) Appl. No.: 11/691,994 composition may also include a pharmaceutically acceptable carrier. The disclosure also includes a method of killing a Filed: Mar. 27, 2007 cancer cell by administering to a cancer cell a treatment (22) formulation including a nucleic acid having an Apoptotic Related U.S. Application Data Sequence targeting agent of: SEQID NO:1, SEQID NO:2. SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO. 5, SEQ ID (60) Provisional application No. 60/786,316, filed on Mar. NO:6, and SEQID NO:7 and a pharmaceutically acceptable 27, 2006. Provisional application No. 60/820,577, carrier. The cancer cell may be located in a subject with filed on Jul. 27, 2006. CaCC. random cancer mRNA portion --a- N'-1- gene A in colon cancer mRNA - Sy?- gene A in lung cancer mRNA gene B in breast cancer mRNA common mutant DNA sequence - CGCATGCGTGGCCACCA filter sky is f b a as s as sat as sis was a sup: a area as a sess was ess "''''''''"rriver.................................................., healthy s as is ss is............................ human as a Pruss at a a posse a a a as sisast asses as a sess as a a Pass was as sees ass so a sas. a present in either strand? O yes candidate DNA therapy discard Patent Application Publication Feb. 21, 2008 Sheet 1 of 9 US 2008/0045471 A1 Cancer SNP liver TGCCCTCCACAGGACTCTCCCTACTG CCTGAGCAAACCTGAG- C - CTCCCGGCAGACCCACCCA. ovary TGCCCTCCACA-GACTCCCCTACTG CCTGAGCAAACCTGAG- C G-TCCCGGCAGACCCACCCA. lung TGCCCCCACAGGACTCTCCCTACTG CCGAGCAAACCTGAG- C - CTCCCGGCAGACCCACCCA. testis GCCCTCCACAGGACTCTCCCTACTG CCTGAGCAAACCTGAG- C G-CCCGGCAGACCCACCCA. skin TGCCCTCCACAGGACTCTCCCTACTG CCTGAGCAAACCGAG-C G-TCCCGGCAGACCCACCCA. skin TGCCCTCCACAGGACTCTCCCTACTG CCTGAGCAAACCTGAG-C GCTCCCGGCAGACCCACCCA. colon TGCCCTCCACAGTACTCTCCCTACTG CCTGAGCAAACCTGAG- C GCTCCCGGCAGACCCACCCA. colon TG-CCT-CACA-GA-TCT-CCTAC CCTGAGCAAACCTGAG-C G-TCC-GGCAGACCCACCCA. | | | | | | | | | | | | | | | | | | | | | Healthy TGCCCTCCACAGGACTCTCCCTACTG CCGAGCAAACCTGAGGC - CTCCCGGCAGACCCACCCA. -IBR 697 6943 6960 6979 Figure 1 DNA Sequence 11: + CGCATGCGTGGCCACCA - TGGTGGCCACGCATGCG Melting Temp: 58 C Ranking: 5 cell lines Cancer Cell Line Genomic Mappping colon/rectal +NCI CGAP Co8) colon/rectal + NIH MGC 15) See Figure 2 brain + NIH MGC 47 lymph +NIH MGC 8 kidney + NIH MGC 89 Figure 4 Patent Application Publication Feb. 21, 2008 Sheet 3 of 9 US 2008/0045471 A1 random cancer mRNA portion V gene A in colon cancer mRNA -N-V -Ny/- gene A in lung cancer mRNA - Ny- gene B in breast cancer mRNA ---s common mutant DNA sequence - CGCATGCGTGGCCACCA so ............................................................................ healthy or to ............................................................................... human transcriptome present in either strand? /N. candidate DNA therapy discard Figure 3 Patent Application Publication Feb. 21, 2008 Sheet 4 of 9 US 2008/00454.71 A1 sequence || || || || | | | | | || || onewith of manysequence genes ab Tag Single primer Ill l) Denature TTTTT TTTTTTTTTTTT | | | | | | | | | | | | | | | | | 2) Anneal 3) Extension TTTTTTTTTTTT 4) Detection reagent plus wild sequence 5) Cycle repeats for each gene with sequence Sequence another of many || || || || | | | | | | | || genes with ab Tag mutation Single primer H Figure 5 Patent Application Publication Feb. 21, 2008 Sheet 5 of 9 US 2008/0045471 A1 28-29 30 - 31 32.34 33 reco 37, 36,38 and 5 39 42 46 - 49 50 - 53 54.57 62-65 Figure 6 Patent Application Publication Feb. 21, 2008 Sheet 6 of 9 US 2008/00454.71 A1 COLON 1 COLON 4 LUNG 1. AS BRAIN 2 PANCREAS 1 Š 47 SKN 2 EYE 1 PANCREAS 2 300 mg of GMP 300 mg of GMP TTGAACCCTAGGCATGT CGATTAACCACCGGCCT Dissolved in 30 ml PBS Dissolved in 30 ml PBS IV Administered IV Administered Over 30 Minutes Over 30 Minutes COLON 2 COLON 3 LUNG 2 BRAIN SKN 1 Q EYE 3 EYE 2 300 mg of GMP 300 mg of GMP GGCCTGCCAGAAGCACA AAGGGGGTTCCTTGGGC Dissolved in 30 ml PBS Dissolved in 30 ml PBS IV Administered IV Administered Over 30 Minutes Over 30 Minutes X f s Figure 7 Patent Application Publication Feb. 21, 2008 Sheet 7 of 9 US 2008/0045471 A1 S. f -- i s r s O O. O. OO V C s en en en (uu) ee.Ie euobos-SSOI) IOun) Patent Application Publication Feb. 21, 2008 Sheet 8 of 9 US 2008/00454.71 A1 Patent Application Publication Feb. 21, 2008 Sheet 9 of 9 US 2008/0045471 A1 9.InáH0I (uuLI) eo-Ie euobos-SSOI) IOun) US 2008/0045471 A1 Feb. 21, 2008 NUCLEC ACIDS FOR APOPTOSIS OF CANCER of the invention, the cancer therapeutic is targeted based on CELLS an Apoptotic Sequence with demonstrated ability to kill cancer cells that is specifically not a sequence of: SEQ ID PRIORITY CLAIM NO:1, SEQID NO:2, SEQID NO:3, SEQID NO:4, SEQID 0001. The present application claims priority under 35 NO:5, SEQID NO:6, and/or SEQ ID NO:7. U.S.C. S 119(e) to U.S. Provisional Patent Application Serial 0006. In other embodiments, Apoptotic Sequences of the No. Ser. No. 60/786,316, filed Mar. 27, 2006, titled “Gene invention encode RNA that target genes containing Cancer Targeting-Induced Apoptosis of Cancer Cells,” and to U.S. Marker Sequences, by antisense RNA, interfering RNA Provisional Patent Application Ser. No. 60/820,577, filed (RNAi) or Ribozyme mechanisms. Alternatively, the nucleic Jul. 27, 2006, titled “Nucleic Acid Targeted Cancer Cell acid may be an oligonucleotide, particularly one that uses Death Agents, both of which are incorporated by reference non-phosphodiester base linkages and is thus resistant to in herein in their entireties. Vivo degradation by endogenous exo- and endonucleases. Such oligonucleotides can be prepared using deoxyribo- or TECHNICAL FIELD ribo-nucleotide moieties. Another embodiment relates to a composition including a nucleic acid, e.g., having a 0002 The present invention, in some embodiments, sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, relates to a subset of Cancer Marker Sequences termed SEQID NO:4, SEQID NO:5, SEQID NO:6, SEQID NO:7. Apoptotic Sequences found in particular cancer specific The invention also provides for a composition that targets an mutations. These unique Apoptotic Sequences provide tar Apoptotic Sequence, that is specifically not a sequence of gets for the action of Suitable targeting agents, which cause SEQID NO:1, SEQID NO:2, SEQID NO:3, SEQID NO:4, induction of cell death in cancer cells while leaving healthy SEQ ID NO:5, SEQ ID NO:6, or SEQ ID NO:7 and a cells unharmed. The present invention, in some embodi pharmaceutically acceptable carrier. The cancer cell may be ments, provides for targeting agents whose design or activity located in a subject with cancer. The composition may also is based on knowledge of Apoptotic Sequences. Other include a pharmaceutically acceptable carrier. embodiments of the invention also relate to targeting agents, particularly oligonucleotides, which induce death in cancer 0007 Yet another embodiment relates to a method of cells using nucleic acid sequence information from the killing a cancer cell by administering to a cancer cell a Cancer Marker or Apoptotic Sequences. pharmaceutical composition including a nucleic acid e.g., an oligonucleotide targeting agent, that targets an Apoptotic BACKGROUND Sequence, such as a sequence of: SEQ ID NO:1, SEQ ID NO:2, SEQID NO:3, SEQID NO:4, SEQID NO:5, SEQID 0003 Cancer results when a cell in the body malfunctions NO:6, or SEQ ID NO:7 and a pharmaceutically acceptable and begins to replicate abnormally. The safest, most effec carrier. In yet another embodiment, the invention provides tive cancer treatments kill cancer cells without significantly for a method of killing a cancer cell by administering to a harming healthy cells. This relies upon distinguishing cancer cancer cell a pharmaceutical composition including a cells from healthy cells, which current methods of chemo nucleic acid e.g., an oligonucleotide targeting agent, that therapy and radiotherapy do quite poorly. targets an Apoptotic Sequence, that is specifically not a 0004 Much cancer research focuses on emergence of sequence of: SEQ ID NO:1, SEQ ID NO:2, SEQID NO:3, oncogenes and inactivating mutations of tumor suppressor SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, or SEQ ID genes because these genes have a clearly delineated asso NO:7 and a pharmaceutically acceptable carrier. The cancer ciation with abnormal cell replication. However, addressing cell may be located in a subject with cancer. tumor therapy to these types of genes has only been mod 0008 Embodiments of the present invention may be estly effective. There remains in the art a need to find better understood through reference to the following Figures effective cancer therapies that have minimal toxicity and and Detailed Description. other adverse effects. BRIEF DESCRIPTION OF THE DRAWINGS SUMMARY 0009 FIG. 1 illustrates a Cancer Marker Sequence according to an embodiment of the present invention found 0005. In one embodiment, the invention provides nucleic in the LTBR gene as aligned to the mRNA from healthy cell acids, particularly oligonucleotides that are found in cancer transcriptomes (SEQ ID NOS: 133-141).
Load more

Recommended publications
  • Table 2. Significant
    Table 2. Significant (Q < 0.05 and |d | > 0.5) transcripts from the meta-analysis Gene Chr Mb Gene Name Affy ProbeSet cDNA_IDs d HAP/LAP d HAP/LAP d d IS Average d Ztest P values Q-value Symbol ID (study #5) 1 2 STS B2m 2 122 beta-2 microglobulin 1452428_a_at AI848245 1.75334941 4 3.2 4 3.2316485 1.07398E-09 5.69E-08 Man2b1 8 84.4 mannosidase 2, alpha B1 1416340_a_at H4049B01 3.75722111 3.87309653 2.1 1.6 2.84852656 5.32443E-07 1.58E-05 1110032A03Rik 9 50.9 RIKEN cDNA 1110032A03 gene 1417211_a_at H4035E05 4 1.66015788 4 1.7 2.82772795 2.94266E-05 0.000527 NA 9 48.5 --- 1456111_at 3.43701477 1.85785922 4 2 2.8237185 9.97969E-08 3.48E-06 Scn4b 9 45.3 Sodium channel, type IV, beta 1434008_at AI844796 3.79536664 1.63774235 3.3 2.3 2.75319499 1.48057E-08 6.21E-07 polypeptide Gadd45gip1 8 84.1 RIKEN cDNA 2310040G17 gene 1417619_at 4 3.38875643 1.4 2 2.69163229 8.84279E-06 0.0001904 BC056474 15 12.1 Mus musculus cDNA clone 1424117_at H3030A06 3.95752801 2.42838452 1.9 2.2 2.62132809 1.3344E-08 5.66E-07 MGC:67360 IMAGE:6823629, complete cds NA 4 153 guanine nucleotide binding protein, 1454696_at -3.46081884 -4 -1.3 -1.6 -2.6026947 8.58458E-05 0.0012617 beta 1 Gnb1 4 153 guanine nucleotide binding protein, 1417432_a_at H3094D02 -3.13334396 -4 -1.6 -1.7 -2.5946297 1.04542E-05 0.0002202 beta 1 Gadd45gip1 8 84.1 RAD23a homolog (S.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Early Alterations of RNA Metabolism and Splicing from Adult Corticospinal Neurons In
    bioRxiv preprint doi: https://doi.org/10.1101/667733; this version posted June 12, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Early alterations of RNA metabolism and splicing from adult corticospinal neurons in 2 an ALS mouse model 3 4 Christine Marques1,2, Mathieu Fischer1,3, Céline Keime4, Thibaut Burg1, Aurore Brunet1, 5 Jelena Scekic-Zahirovic1 & Caroline Rouaux1* 6 7 8 9 1Inserm UMR_S 1118, Mécanismes centraux et périphériques de la neurodégénérescence, 10 Faculté de Médecine, Université de Strasbourg, Strasbourg, France. 11 2Current address: Department of Neurobiology, Harvard Medical School, Boston, MA, USA; 12 Department of Neurology, Massachusetts General Hospital, Boston, MA, USA. 13 3Current address: Department of Paediatrics, John Radcliffe Hospital, University of Oxford, 14 Oxford, UK. 15 4Inserm UMR_S 1258, CRNS UMR_S 7104, Université de Strasbourg, IGBMC, Strasbourg, 16 France. 17 18 *Correspondence should be addressed to: C.R. ([email protected]) 1 bioRxiv preprint doi: https://doi.org/10.1101/667733; this version posted June 12, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Amyotrophic lateral sclerosis (ALS) is a devastating neurodegenerative disease clinically defined as the combined degeneration of corticospinal and corticobulbar neurons (CSN), and bulbar and spinal motor neurons (MN). A growing body of evidence points to the motor cortex, where CSN are located, as the potential initiation site of ALS. However, little is known about the spatiotemporal dynamics of CSN degeneration and the molecular pathways involved.
    [Show full text]
  • WO 2019/079361 Al 25 April 2019 (25.04.2019) W 1P O PCT
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization I International Bureau (10) International Publication Number (43) International Publication Date WO 2019/079361 Al 25 April 2019 (25.04.2019) W 1P O PCT (51) International Patent Classification: CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, C12Q 1/68 (2018.01) A61P 31/18 (2006.01) DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, C12Q 1/70 (2006.01) HR, HU, ID, IL, IN, IR, IS, JO, JP, KE, KG, KH, KN, KP, KR, KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, (21) International Application Number: MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, PCT/US2018/056167 OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, (22) International Filing Date: SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, 16 October 2018 (16. 10.2018) TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (25) Filing Language: English (84) Designated States (unless otherwise indicated, for every kind of regional protection available): ARIPO (BW, GH, (26) Publication Language: English GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, TZ, (30) Priority Data: UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, 62/573,025 16 October 2017 (16. 10.2017) US TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR, HR, HU, ΓΕ , IS, IT, LT, LU, LV, (71) Applicant: MASSACHUSETTS INSTITUTE OF MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, SM, TECHNOLOGY [US/US]; 77 Massachusetts Avenue, TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, Cambridge, Massachusetts 02139 (US).
    [Show full text]
  • Datasheet: VPA00586KT Product Details
    Datasheet: VPA00586KT Description: EIF3E ANTIBODY WITH CONTROL LYSATE Specificity: EIF3E Format: Purified Product Type: PrecisionAb™ Polyclonal Isotype: Polyclonal IgG Quantity: 2 Westerns Product Details Applications This product has been reported to work in the following applications. This information is derived from testing within our laboratories, peer-reviewed publications or personal communications from the originators. Please refer to references indicated for further information. For general protocol recommendations, please visit www.bio-rad-antibodies.com/protocols. Yes No Not Determined Suggested Dilution Western Blotting 1/1000 PrecisionAb antibodies have been extensively validated for the western blot application. The antibody has been validated at the suggested dilution. Where this product has not been tested for use in a particular technique this does not necessarily exclude its use in such procedures. Further optimization may be required dependant on sample type. Target Species Human Species Cross Reacts with: Rat Reactivity N.B. Antibody reactivity and working conditions may vary between species. Product Form Purified IgG - liquid Preparation 20μl Rabbit polyclonal antibody purified by affinity chromatography Buffer Solution Phosphate buffered saline Preservative 0.09% Sodium Azide (NaN3) Stabilisers 2% Sucrose Immunogen Synthetic peptide directed towards the middle region of human EIF3E External Database Links UniProt: P60228 Related reagents Entrez Gene: 3646 EIF3E Related reagents Synonyms EIF3S6, INT6 Page 1 of 2 Specificity Rabbit anti Human EIF3E antibody recognizes the eukaryotic translation initiation factor 3 subunit E, also known as eIF-3 p48, eukaryotic translation initiation factor 3 subunit 6, mammary tumor- associated protein INT6 or viral integration site protein INT-6 homolog. Rabbit anti Human EIF3E antibody detects a band of 48 kDa.
    [Show full text]
  • Apoptotic Genes As Potential Markers of Metastatic Phenotype in Human Osteosarcoma Cell Lines
    17-31 10/12/07 14:53 Page 17 INTERNATIONAL JOURNAL OF ONCOLOGY 32: 17-31, 2008 17 Apoptotic genes as potential markers of metastatic phenotype in human osteosarcoma cell lines CINZIA ZUCCHINI1, ANNA ROCCHI2, MARIA CRISTINA MANARA2, PAOLA DE SANCTIS1, CRISTINA CAPANNI3, MICHELE BIANCHINI1, PAOLO CARINCI1, KATIA SCOTLANDI2 and LUISA VALVASSORI1 1Dipartimento di Istologia, Embriologia e Biologia Applicata, Università di Bologna, Via Belmeloro 8, 40126 Bologna; 2Laboratorio di Ricerca Oncologica, Istituti Ortopedici Rizzoli; 3IGM-CNR, Unit of Bologna, c/o Istituti Ortopedici Rizzoli, Via di Barbiano 1/10, 40136 Bologna, Italy Received May 29, 2007; Accepted July 19, 2007 Abstract. Metastasis is the most frequent cause of death among malignant primitive bone tumor, usually developing in children patients with osteosarcoma. We have previously demonstrated and adolescents, with a high tendency to metastasize (2). in independent experiments that the forced expression of Metastases in osteosarcoma patients spread through peripheral L/B/K ALP and CD99 in U-2 OS osteosarcoma cell lines blood very early and colonize primarily the lung, and later markedly reduces the metastatic ability of these cancer cells. other skeleton districts (3). Since disseminated hidden micro- This behavior makes these cell lines a useful model to assess metastases are present in 80-90% of OS patients at the time the intersection of multiple and independent gene expression of diagnosis, the identification of markers of invasiveness signatures concerning the biological problem of dissemination. and metastasis forms a target of paramount importance in With the aim to characterize a common transcriptional profile planning the treatment of osteosarcoma lesions and enhancing reflecting the essential features of metastatic behavior, we the prognosis.
    [Show full text]
  • Quantitative Analysis of the Human Ovarian Carcinoma Mitochondrial Phosphoproteome
    www.aging-us.com AGING 2019, Vol. 11, No. 16 Research Paper Quantitative analysis of the human ovarian carcinoma mitochondrial phosphoproteome Na Li1,2,3, Shehua Qian1,2,3, Biao Li1,2,3, Xianquan Zhan1,2,3,4 1Key Laboratory of Cancer Proteomics of Chinese Ministry of Health, Xiangya Hospital, Central South University, Changsha 410008, Hunan, P. R. China 2Hunan Engineering Laboratory for Structural Biology and Drug Design, Xiangya Hospital, Central South University, Changsha 410008, Hunan, P. R. China 3State Local Joint Engineering Laboratory for Anticancer Drugs, Xiangya Hospital, Central South University, Changsha 410008, Hunan, P. R. China 4National Clinical Research Center for Geriatric Disorders, Xiangya Hospital, Central South University, Changsha 410008, Hunan P. R. China Correspondence to: Xianquan Zhan; email: [email protected] Keywords: ovarian cancer, mitochondria, TiO2 enrichment, iTRAQ quantitative proteomics, mitochondrial phosphoprotein (mtPP) Received: June 15, 2019 Accepted: August 10, 2019 Published: August 22, 2019 Copyright: Li et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT To investigate the existence and their potential biological roles of mitochondrial phosphoproteins (mtPPs) in human ovarian carcinoma (OC), mitochondria purified from OC and control tissues were analyzed with TiO2 enrichment-based iTRAQ quantitative proteomics. Totally 67 mtPPs with 124 phosphorylation sites were identified, which of them included 48 differential mtPPs (mtDPPs). Eighteen mtPPs were reported previously in OCs, and they were consistent in this study compared to previous literature.
    [Show full text]
  • Membrane Proteomics of Cervical Cancer Cell Lines Reveal Insights on the Process of Cervical Carcinogenesis
    INTERNATIONAL JOURNAL OF ONCOLOGY 53: 2111-2122, 2018 Membrane proteomics of cervical cancer cell lines reveal insights on the process of cervical carcinogenesis KALLIOPI I. PAPPA1,2, POLYXENI CHRISTOU3,4, AMARILDO XHOLI3, GEORGE MERMELEKAS3, GEORGIA KONTOSTATHI3,4, VASILIKI LYGIROU3,4, MANOUSOS MAKRIDAKIS3, JEROME ZOIDAKIS3 and NICHOLAS P. ANAGNOU1,4 1Cell and Gene Therapy Laboratory, Centre of Basic Research II, Biomedical Research Foundation of the Academy of Athens, 11527 Athens; 2First Department of Obstetrics and Gynecology, University of Athens School of Medicine, Alexandra Hospital, 11528 Athens; 3Biotechnology Division, Centre of Basic Research, Biomedical Research Foundation of the Academy of Athens; 4Laboratory of Biology, University of Athens School of Medicine, 11527 Athens, Greece Received March 22, 2018; Accepted May 4, 2018 DOI: 10.3892/ijo.2018.4518 Abstract. The available therapeutic approaches for cervical biological pathways relevant to malignancy, including ‘HIPPO cancer can seriously affect the fertility potential of patient; signaling’, ‘PI3K/Akt signaling’, ‘cell cycle: G2/M DNA thus, there is a pressing requirement for less toxic and damage checkpoint regulation’ and ‘EIF2 signaling’. These targeted therapies. The membrane proteome is a potential unique membrane protein identifications offer insights on a source of therapeutic targets; however, despite the signifi- previously inaccessible region of the cervical cancer proteome, cance of membrane proteins in cancer, proteomic analysis and may represent putative
    [Show full text]
  • 1 1 2 Pharmacological Dimerization and Activation of the Exchange
    1 2 3 Pharmacological dimerization and activation of the exchange factor eIF2B antagonizes the 4 integrated stress response 5 6 7 *Carmela Sidrauski1,2, *Jordan C. Tsai1,2, Martin Kampmann2,3, Brian R. Hearn4, Punitha 8 Vedantham4, Priyadarshini Jaishankar4 , Masaaki Sokabe5, Aaron S. Mendez1,2, Billy W. 9 Newton6, Edward L. Tang6.7, Erik Verschueren6, Jeffrey R. Johnson6,7, Nevan J. Krogan6,7,, 10 Christopher S. Fraser5, Jonathan S. Weissman2,3, Adam R. Renslo4, and Peter Walter 1,2 11 12 1Department of Biochemistry and Biophysics, University of California, San Francisco, United 13 States 14 2Howard Hughes Medical Institute, University of California, San Francisco, United States 15 3Department of Cellular and Molecular Pharmacology, University of California, San Francisco, 16 United States 17 4Department of Pharmaceutical Chemistry and the Small Molecule Discovery Center, University 18 of California at San Francisco, United States 19 5Department of Molecular and Cellular Biology, College of Biological Sciences, University of 20 California, Davis, United States 21 6QB3, California Institute for Quantitative Biosciences, University of California, San Francisco, 22 United States 23 7Gladstone Institutes, San Francisco, United States 24 25 * Both authors contributed equally to this work 26 27 28 Abstract 29 30 The general translation initiation factor eIF2 is a major translational control point. Multiple 31 signaling pathways in the integrated stress response phosphorylate eIF2 serine-51, inhibiting 32 nucleotide exchange by eIF2B. ISRIB, a potent drug-like small molecule, renders cells 33 insensitive to eIF2α phosphorylation and enhances cognitive function in rodents by blocking 34 long-term depression. ISRIB was identified in a phenotypic cell-based screen, and its mechanism 35 of action remained unknown.
    [Show full text]
  • Relevance of Translation Initiation in Diffuse Glioma Biology and Its
    cells Review Relevance of Translation Initiation in Diffuse Glioma Biology and its Therapeutic Potential Digregorio Marina 1, Lombard Arnaud 1,2, Lumapat Paul Noel 1, Scholtes Felix 1,2, Rogister Bernard 1,3 and Coppieters Natacha 1,* 1 Laboratory of Nervous System Disorders and Therapy, GIGA-Neurosciences Research Centre, University of Liège, 4000 Liège, Belgium; [email protected] (D.M.); [email protected] (L.A.); [email protected] (L.P.N.); [email protected] (S.F.); [email protected] (R.B.) 2 Department of Neurosurgery, CHU of Liège, 4000 Liège, Belgium 3 Department of Neurology, CHU of Liège, 4000 Liège, Belgium * Correspondence: [email protected] Received: 18 October 2019; Accepted: 26 November 2019; Published: 29 November 2019 Abstract: Cancer cells are continually exposed to environmental stressors forcing them to adapt their protein production to survive. The translational machinery can be recruited by malignant cells to synthesize proteins required to promote their survival, even in times of high physiological and pathological stress. This phenomenon has been described in several cancers including in gliomas. Abnormal regulation of translation has encouraged the development of new therapeutics targeting the protein synthesis pathway. This approach could be meaningful for glioma given the fact that the median survival following diagnosis of the highest grade of glioma remains short despite current therapy. The identification of new targets for the development of novel therapeutics is therefore needed in order to improve this devastating overall survival rate. This review discusses current literature on translation in gliomas with a focus on the initiation step covering both the cap-dependent and cap-independent modes of initiation.
    [Show full text]
  • Expression of Eukaryotic Translation Initiation Factor 3 Subunit B in Liver Cancer and Its Prognostic Significance
    436 EXPERIMENTAL AND THERAPEUTIC MEDICINE 20: 436-446, 2020 Expression of eukaryotic translation initiation factor 3 subunit B in liver cancer and its prognostic significance QING YUE1*, LINGYU MENG2*, BAOXING JIA2 and WEI HAN2 Departments of 1Oncology and 2Hepatobiliary and Pancreatic Surgery, The First Hospital of Jilin University, Changchun, Jilin 130021, P.R. China Received July 16, 2019; Accepted December 19, 2019 DOI: 10.3892/etm.2020.8726 Abstract. Liver cancer is one of the major malignancies with in high EIF3B expression and low EIF3B expression groups. the worst prognosis among all solid tumor types. It is therefore In conclusion, high EIF3B expression was indicated to be an ponderable to explore prognostic biomarkers and therapeutic independent prognostic biomarker for patients with liver cancer. targets for liver cancer. Eukaryotic translation initiation factor 3 subunit B (EIF3B) is closely linked to the transcription initia- Introduction tion of cancer-associated genes. In the present study, EIF3B was indicated to be a potential prognostic biomarker of liver cancer. Liver cancer is a common malignant tumor type with high The mRNA expression level of EIF3B in liver cancer was morbidity and mortality (1). Although various treatments have assessed by analyzing the Cancer Genome Atlas dataset. χ2 and been improved, the mortality rate of liver cancer is still high Fisher's exact tests were used to assess the association of EIF3B and the prognosis remains poor (2,3). Therefore, prognostic expression with clinical parameters. Receiver-operating char- biomarkers of liver cancer have become one of the hotspots acteristic curve analysis was used for evaluating the diagnostic of current research (4).
    [Show full text]
  • Lncrna SNHG8 Is Identified As a Key Regulator of Acute Myocardial
    Zhuo et al. Lipids in Health and Disease (2019) 18:201 https://doi.org/10.1186/s12944-019-1142-0 RESEARCH Open Access LncRNA SNHG8 is identified as a key regulator of acute myocardial infarction by RNA-seq analysis Liu-An Zhuo, Yi-Tao Wen, Yong Wang, Zhi-Fang Liang, Gang Wu, Mei-Dan Nong and Liu Miao* Abstract Background: Long noncoding RNAs (lncRNAs) are involved in numerous physiological functions. However, their mechanisms in acute myocardial infarction (AMI) are not well understood. Methods: We performed an RNA-seq analysis to explore the molecular mechanism of AMI by constructing a lncRNA-miRNA-mRNA axis based on the ceRNA hypothesis. The target microRNA data were used to design a global AMI triple network. Thereafter, a functional enrichment analysis and clustering topological analyses were conducted by using the triple network. The expression of lncRNA SNHG8, SOCS3 and ICAM1 was measured by qRT-PCR. The prognostic values of lncRNA SNHG8, SOCS3 and ICAM1 were evaluated using a receiver operating characteristic (ROC) curve. Results: An AMI lncRNA-miRNA-mRNA network was constructed that included two mRNAs, one miRNA and one lncRNA. After RT-PCR validation of lncRNA SNHG8, SOCS3 and ICAM1 between the AMI and normal samples, only lncRNA SNHG8 had significant diagnostic value for further analysis. The ROC curve showed that SNHG8 presented an AUC of 0.850, while the AUC of SOCS3 was 0.633 and that of ICAM1 was 0.594. After a pairwise comparison, we found that SNHG8 was statistically significant (P SNHG8-ICAM1 = 0.002; P SNHG8-SOCS3 = 0.031).
    [Show full text]