US 20080045471 A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2008/0045471 A1 NOrth (43) Pub. Date: Feb. 21, 2008 (54) NUCLEC ACDS FOR APOPTOSIS OF Publication Classification CANCER CELLS (51) Int. Cl. A6IR 48/00 (2006.01) (76) Inventor: Don Adams North, Arlington, TX (US) C7H 2L/00 (2006.01) CI2N 5/06 (2006.01) Correspondence Address: (52) U.S. Cl. ............................ 514/44; 435/375; 536/23.1 BAKER BOTTS LLP. (57) ABSTRACT PATENT DEPARTMENT The disclosure relates to nucleic acids having Apoptotic 98 SANJACINTO BLVD., SUITE 1500 Sequence Nos. 5, 8, 9, 11, 14, 60 and 66. It also relates to AUSTIN, TX 78701-4039 (US) agents targeting Apoptotic Sequences, said agents having SEQID NO:1, SEQID NO:2, SEQID NO:3, SEQID NO:4, SEQ ID NO: 5, SEQ ID NO:6, and SEQ ID NO:7. The (21) Appl. No.: 11/691,994 composition may also include a pharmaceutically acceptable carrier. The disclosure also includes a method of killing a Filed: Mar. 27, 2007 cancer cell by administering to a cancer cell a treatment (22) formulation including a nucleic acid having an Apoptotic Related U.S. Application Data Sequence targeting agent of: SEQID NO:1, SEQID NO:2. SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO. 5, SEQ ID (60) Provisional application No. 60/786,316, filed on Mar. NO:6, and SEQID NO:7 and a pharmaceutically acceptable 27, 2006. Provisional application No. 60/820,577, carrier. The cancer cell may be located in a subject with filed on Jul. 27, 2006. CaCC. random cancer mRNA portion --a- N'-1- gene A in colon cancer mRNA - Sy?- gene A in lung cancer mRNA gene B in breast cancer mRNA common mutant DNA sequence - CGCATGCGTGGCCACCA filter sky is f b a as s as sat as sis was a sup: a area as a sess was ess "''''''''"rriver.................................................., healthy s as is ss is............................ human as a Pruss at a a posse a a a as sisast asses as a sess as a a Pass was as sees ass so a sas. a present in either strand? O yes candidate DNA therapy discard Patent Application Publication Feb. 21, 2008 Sheet 1 of 9 US 2008/0045471 A1 Cancer SNP liver TGCCCTCCACAGGACTCTCCCTACTG CCTGAGCAAACCTGAG- C - CTCCCGGCAGACCCACCCA. ovary TGCCCTCCACA-GACTCCCCTACTG CCTGAGCAAACCTGAG- C G-TCCCGGCAGACCCACCCA. lung TGCCCCCACAGGACTCTCCCTACTG CCGAGCAAACCTGAG- C - CTCCCGGCAGACCCACCCA. testis GCCCTCCACAGGACTCTCCCTACTG CCTGAGCAAACCTGAG- C G-CCCGGCAGACCCACCCA. skin TGCCCTCCACAGGACTCTCCCTACTG CCTGAGCAAACCGAG-C G-TCCCGGCAGACCCACCCA. skin TGCCCTCCACAGGACTCTCCCTACTG CCTGAGCAAACCTGAG-C GCTCCCGGCAGACCCACCCA. colon TGCCCTCCACAGTACTCTCCCTACTG CCTGAGCAAACCTGAG- C GCTCCCGGCAGACCCACCCA. colon TG-CCT-CACA-GA-TCT-CCTAC CCTGAGCAAACCTGAG-C G-TCC-GGCAGACCCACCCA. | | | | | | | | | | | | | | | | | | | | | Healthy TGCCCTCCACAGGACTCTCCCTACTG CCGAGCAAACCTGAGGC - CTCCCGGCAGACCCACCCA. -IBR 697 6943 6960 6979 Figure 1 DNA Sequence 11: + CGCATGCGTGGCCACCA - TGGTGGCCACGCATGCG Melting Temp: 58 C Ranking: 5 cell lines Cancer Cell Line Genomic Mappping colon/rectal +NCI CGAP Co8) colon/rectal + NIH MGC 15) See Figure 2 brain + NIH MGC 47 lymph +NIH MGC 8 kidney + NIH MGC 89 Figure 4 Patent Application Publication Feb. 21, 2008 Sheet 3 of 9 US 2008/0045471 A1 random cancer mRNA portion V gene A in colon cancer mRNA -N-V -Ny/- gene A in lung cancer mRNA - Ny- gene B in breast cancer mRNA ---s common mutant DNA sequence - CGCATGCGTGGCCACCA so ............................................................................ healthy or to ............................................................................... human transcriptome present in either strand? /N. candidate DNA therapy discard Figure 3 Patent Application Publication Feb. 21, 2008 Sheet 4 of 9 US 2008/00454.71 A1 sequence || || || || | | | | | || || onewith of manysequence genes ab Tag Single primer Ill l) Denature TTTTT TTTTTTTTTTTT | | | | | | | | | | | | | | | | | 2) Anneal 3) Extension TTTTTTTTTTTT 4) Detection reagent plus wild sequence 5) Cycle repeats for each gene with sequence Sequence another of many || || || || | | | | | | | || genes with ab Tag mutation Single primer H Figure 5 Patent Application Publication Feb. 21, 2008 Sheet 5 of 9 US 2008/0045471 A1 28-29 30 - 31 32.34 33 reco 37, 36,38 and 5 39 42 46 - 49 50 - 53 54.57 62-65 Figure 6 Patent Application Publication Feb. 21, 2008 Sheet 6 of 9 US 2008/00454.71 A1 COLON 1 COLON 4 LUNG 1. AS BRAIN 2 PANCREAS 1 Š 47 SKN 2 EYE 1 PANCREAS 2 300 mg of GMP 300 mg of GMP TTGAACCCTAGGCATGT CGATTAACCACCGGCCT Dissolved in 30 ml PBS Dissolved in 30 ml PBS IV Administered IV Administered Over 30 Minutes Over 30 Minutes COLON 2 COLON 3 LUNG 2 BRAIN SKN 1 Q EYE 3 EYE 2 300 mg of GMP 300 mg of GMP GGCCTGCCAGAAGCACA AAGGGGGTTCCTTGGGC Dissolved in 30 ml PBS Dissolved in 30 ml PBS IV Administered IV Administered Over 30 Minutes Over 30 Minutes X f s Figure 7 Patent Application Publication Feb. 21, 2008 Sheet 7 of 9 US 2008/0045471 A1 S. f -- i s r s O O. O. OO V C s en en en (uu) ee.Ie euobos-SSOI) IOun) Patent Application Publication Feb. 21, 2008 Sheet 8 of 9 US 2008/00454.71 A1 Patent Application Publication Feb. 21, 2008 Sheet 9 of 9 US 2008/0045471 A1 9.InáH0I (uuLI) eo-Ie euobos-SSOI) IOun) US 2008/0045471 A1 Feb. 21, 2008 NUCLEC ACIDS FOR APOPTOSIS OF CANCER of the invention, the cancer therapeutic is targeted based on CELLS an Apoptotic Sequence with demonstrated ability to kill cancer cells that is specifically not a sequence of: SEQ ID PRIORITY CLAIM NO:1, SEQID NO:2, SEQID NO:3, SEQID NO:4, SEQID 0001. The present application claims priority under 35 NO:5, SEQID NO:6, and/or SEQ ID NO:7. U.S.C. S 119(e) to U.S. Provisional Patent Application Serial 0006. In other embodiments, Apoptotic Sequences of the No. Ser. No. 60/786,316, filed Mar. 27, 2006, titled “Gene invention encode RNA that target genes containing Cancer Targeting-Induced Apoptosis of Cancer Cells,” and to U.S. Marker Sequences, by antisense RNA, interfering RNA Provisional Patent Application Ser. No. 60/820,577, filed (RNAi) or Ribozyme mechanisms. Alternatively, the nucleic Jul. 27, 2006, titled “Nucleic Acid Targeted Cancer Cell acid may be an oligonucleotide, particularly one that uses Death Agents, both of which are incorporated by reference non-phosphodiester base linkages and is thus resistant to in herein in their entireties. Vivo degradation by endogenous exo- and endonucleases. Such oligonucleotides can be prepared using deoxyribo- or TECHNICAL FIELD ribo-nucleotide moieties. Another embodiment relates to a composition including a nucleic acid, e.g., having a 0002 The present invention, in some embodiments, sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, relates to a subset of Cancer Marker Sequences termed SEQID NO:4, SEQID NO:5, SEQID NO:6, SEQID NO:7. Apoptotic Sequences found in particular cancer specific The invention also provides for a composition that targets an mutations. These unique Apoptotic Sequences provide tar Apoptotic Sequence, that is specifically not a sequence of gets for the action of Suitable targeting agents, which cause SEQID NO:1, SEQID NO:2, SEQID NO:3, SEQID NO:4, induction of cell death in cancer cells while leaving healthy SEQ ID NO:5, SEQ ID NO:6, or SEQ ID NO:7 and a cells unharmed. The present invention, in some embodi pharmaceutically acceptable carrier. The cancer cell may be ments, provides for targeting agents whose design or activity located in a subject with cancer. The composition may also is based on knowledge of Apoptotic Sequences. Other include a pharmaceutically acceptable carrier. embodiments of the invention also relate to targeting agents, particularly oligonucleotides, which induce death in cancer 0007 Yet another embodiment relates to a method of cells using nucleic acid sequence information from the killing a cancer cell by administering to a cancer cell a Cancer Marker or Apoptotic Sequences. pharmaceutical composition including a nucleic acid e.g., an oligonucleotide targeting agent, that targets an Apoptotic BACKGROUND Sequence, such as a sequence of: SEQ ID NO:1, SEQ ID NO:2, SEQID NO:3, SEQID NO:4, SEQID NO:5, SEQID 0003 Cancer results when a cell in the body malfunctions NO:6, or SEQ ID NO:7 and a pharmaceutically acceptable and begins to replicate abnormally. The safest, most effec carrier. In yet another embodiment, the invention provides tive cancer treatments kill cancer cells without significantly for a method of killing a cancer cell by administering to a harming healthy cells. This relies upon distinguishing cancer cancer cell a pharmaceutical composition including a cells from healthy cells, which current methods of chemo nucleic acid e.g., an oligonucleotide targeting agent, that therapy and radiotherapy do quite poorly. targets an Apoptotic Sequence, that is specifically not a 0004 Much cancer research focuses on emergence of sequence of: SEQ ID NO:1, SEQ ID NO:2, SEQID NO:3, oncogenes and inactivating mutations of tumor suppressor SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, or SEQ ID genes because these genes have a clearly delineated asso NO:7 and a pharmaceutically acceptable carrier. The cancer ciation with abnormal cell replication. However, addressing cell may be located in a subject with cancer. tumor therapy to these types of genes has only been mod 0008 Embodiments of the present invention may be estly effective. There remains in the art a need to find better understood through reference to the following Figures effective cancer therapies that have minimal toxicity and and Detailed Description. other adverse effects. BRIEF DESCRIPTION OF THE DRAWINGS SUMMARY 0009 FIG. 1 illustrates a Cancer Marker Sequence according to an embodiment of the present invention found 0005. In one embodiment, the invention provides nucleic in the LTBR gene as aligned to the mRNA from healthy cell acids, particularly oligonucleotides that are found in cancer transcriptomes (SEQ ID NOS: 133-141).