© 2017 Nature America, Inc., part of Springer Nature. All rights reserved. A U P of 1 is apromising strategy for blocking Wnt signaling incancer. cates that the increase of of turnover and lination that treatment with NTZ stabilizes PAD2, thus increasing the citrul demonstratedWeproteincitrullination. catalyzingfurther enzyme Wnt/blocks NTZ Wntinhibitors, reported previously to contrast In APC. and in humans, inhibits Wnt/ which is US Food and drug administration (FDA)-approved for use therapeutic on Wnt/ effects β ( mutationsfrequent most the by activatedWnt oncogenicsignaling complex tion inhibitors, target the Wnt signaling pathway upstream of the destruc tankyrase andtesting) Porcupine clinical ing II inhibitorsPhase (in are still not ready for clinical use. Many of these compounds, they includ reported, cancer been have Wntinhibitors for of number targets a attractiveand therapy most the of one is signaling catenin activation of oncogenic WNT/ nuclear of accumulation aberrant to lead eventually GSK3 Axin-bound of degradation and ubiquitination the abolishing APC, truncated ate carcinoma endometrial cancerprostate cancer colorectal including types, tumor coding gene) are among the most frequently mutated genes in major coli) polyposis patients withWnt pathway mutations. of modulator a as NTZ of potential the highlight data Our treatment. NTZ degradation induced NTZ and of activity, transcriptional the disrupted residues arginine of Replacement cells. cancer colon in turnoverof and (citrullination) deamination PAD2,the targetingincreased ByNTZ Wnt inhibition. in NTZ of target pendent of APC. Using chemoproteomic approaches, we have identified peptidyl arginine deiminase 2 (PAD2) as the functional lacking. Here we report that nitazoxanide (NTZ), a clinically approved antiparasitic drug, are efficiently use inhibits clinical Wntfor pathway this however,signaling (APC);targeting inde coliagents therapeuticpolyposis adenomatous of mutation the of Wnt (wingless)/ P Yi Qu and inhibitsWnt signalingincancer S nature CH 8 7 D D C APC hytochemistry, ctnn in -catenin niversity of Zürich Hospital, Zürich, Switzerland. aul epartment of epartment entre for epartment of Medicine, T b In the present study, we report that the antiparasitic drug NTZ, antiparasiticdrug the that study,presentreport we the In Wnt/thatyears for 20 moreknownthan been has it Although raditional mall moleculepromotes -catenin. In Wnt-activated colon cancer cells, knockout of either PAD2or either of knockout cells, cancer Wnt-activatedcolon In -catenin. or or β S ope cnann Ai, GSK3 Axin, containing complex destruction the by controlled tightly is and signaling Wnt nuclear of ccumulation phosphorylation and thus to subsequent degradation. Both Both subsequentdegradation. to thusphosphorylationand 1 Hoffman – CTNNB1 3 E C , Jan MIC ancer C β 1 hinese Medicine,Shanghai, APC -catenin signaling through a distinct target,PAD2,distinct a through-catenin signaling an A C 0 C , and are therefore not likely to be effective against effective be to likely not therefore are and , 1 L BIOLOGY 4 linical Science, . In cancer patients, cancer In . β , hepatocellular carcinomahepatocellular , ollege of R B -catenin or or iomarkers, b ) in major cancer types cancer major in ) oger Olsen -catenin signaling is critical for tumor progression and is frequently activated in colorectal cancer as a result 7 , CTNNB1 A D 7

P β | Adv . Notably, most of these mutations gener mutations these of Notably,most . β ivision of harmacy, Second MilitaryMedical β nne Margrete Oyan 1 -catenin citrullination by a small molecule -catenin signaling independent of GSK3 , or mutant or , -catenin in cancer cells. Our work indi work Our cells. cancer in -catenin β U -catenin signaling mutant cancers. a U niversity of nce online public niversity of β β uae cne cls s rtcl for critical is cells cancer mutated -catenin signaling -catenin is a key step in canonical in step key a is -catenin I 1 nfectious , XingYuan APC P β .R. B -catenin that is resistant to resistant is that -catenin β B ergen, and and 1 ergen, C n AC (adenomatous APC and 2 1 ln adenocarcinoma lung , D 5 . Therefore, depletion ofTherefore, depletion . hina. , medulloblastoma , iseases and 6 B a roegelmann Research B CTNNB1 tion | B 3 ergen, D ergen, 4 epartment ofMicrobiology,epartment Haukeland 8, , 9 . 1 P www.nature.com/naturechemicalbiology , β 3 N hil FCheng , Weidong Zhang -catenin and -catenin N I orway. *e-mail: nternational Health, U ( orway. niversity, Shanghai, β -catenin 6 2 and and I nstitute of β L β 3 ------, aboratory,

pu 5 [email protected] , Mitchell scription, and observed that 35% of genes, including genes, of 35% that observed and scription, cells SW480 in genes target direct (Wntasymmetry) signaling Wnt of terms in division cell asymmetric induces NTZ NTZ, but not with control small molecules ( highly and dividing cells showed unequal GFP stablyexpression upon treatment of with 5% is than more Notably, passages. GFP multiple following expressed TCF-driven cells, SW480-7TGC In with cells HCT116 cells cancer and because of decreased colonyformation( decreased of because HCT116, and no SW480, clones were obtained in ten 96-well plates ( sgRNAconstruct (HCT116). We first knocked out mutant harboring cells cancer colon complex.destruction Wnt/ of inhibition NTZ ( phosphorylation overexpressing cells 293FT in ing Results substantially blocked by additional NTZ treatment ( but not mCherry, in 293FT-7TGC cells, and this GFP activation was expressionGFP,of the increased dramatically6BIOtreatment with driven GFP and an SV40 promoter-driven mCherry with a lentiviral Wnt reporter, 7TGC, containing a TCF4 promoter- ( 6-bromoindirubin-3inhibitor GSK3 the by vated ( ( NTZ assay luciferase) promoter optimal (TCF- TOPFlash the FDA-approvedusing of drugs screening a In NTZ blocks Wnt/ RESULTS b bli i. 1a Fig. I U e sesd h efcs f T o Wtatvtd human Wnt-activated on NTZ of effects the assessed We s nterdisciplinary 3a P h niversity of -catenin citrullination .R. D ed 2 ), confirming the critical role of role critical the confirming ), 1 epartment of epartment , , C 4 , soe sgiiat niiin f n sgaig acti signaling, Wnt of inhibition significant showed ) Supplementary Fig. 1a Fig. Supplementary b o *, Karl-HenningKalland hina. . o iulz Wt niiin w lbld 9F cells 293FT labeled we inhibition, Wnt visualize To ). n b 1 li 5 , P . Of note, NTZ caused much less growth inhibition in inhibitiongrowth less much caused NTZ note, Of .

-catenin citrullination for the treatment of cancer of treatment the for citrullination -catenin [email protected] ne: 30O U 5 Levesque V D b niversity Hospital, irginia School of Medicine, epartment of -catenin substantially increased resistance to resistance increased substantially -catenin I ntegrative 16, Supplementary Fig. 2a Fig. Supplementary upeetr Fg 1c Fig. Supplementary C 1 b 7 linical Science, CTNNB1 . To examine the effect of NTZ on NTZ of effect the Toexamine . c -catenin signaling t ob β -catenin signaling is downstream of the the of downstream is signaling -catenin er 2017 | B 5 D iomedical Research, Shanghai , Karl ermatology, eein ( deletion B , CTNNB1 ergen, b U ). NTZ also blocked Wntblocked signal also NTZ ). 1 , or niversity of 8

d , we profiled the mRNA tran mRNA the profiled we , β A oi ctnn eitn t GSK3 to resistant -catenin APC [email protected] Brokstad N upeetr Tbe 1 Table Supplementary C β : 10.1038/n orway. Supplementary Figs. 2d Figs. Supplementary U upeetr Fg 3b Fig. Supplementary 1 harlottesville, -catenin in Wnt-activatedin -catenin using a GFP-tagged Cas9 , niversity of Zürich, – 3 (SW480) and (SW480) in vitro , c Fig. 1 8 , eosrtn that demonstrating ), article ) * &XisongKe B 1 4 4 ergen, . However,. two only D epartment of of epartment c ′ ), indicating that ch -oxime (6BIO) -oxime and Supplementary Supplementary 6 1

3 B . As expected, e V ergen, AXIN2 mbio irginia,

U , in vivo b niversity

β CTNNB1 -catenin -catenin N .251 orway. U , ID2 SA. 1 0 , 2 , * ). ), 1 β e - - - - 1 2 ,

© 2017 Nature America, Inc., part of Springer Nature. All rights reserved. article we examined we of decrease the study further To NTZ depletes architecture or density ( intestinal morphology in terms of mucosa organization, crypt–villus stantially reduce body weight or induce a clear change in the normal oncogenic Wnt signaling ( adenomas NTZ-treated in area surface body for adjusted dose clinical the to comparable dose a at multiple villi) were dramatically decreased in mice treated (in with NTZ macroadenomas and villus) single (in microadenomas both of control mice harboring numerous intestinal adenomas, the numbers progressionin Wnt/of relevance high the confirmed tumors polyposis, nomatous NTZ-treated SW480cells ( WNT6 ( P Apc 162 t used for negative controls. of assessment before h 24 transduced with7 t experiments. 6 with treated Figure 1|NTZ inhibitsWnt/ 2 stimulated 293FT cells and confirmed the NTZ dose-dependent decrease of -test; * -test; ** f ost-hoc power analysis indicates thatbothmacroadenomas (0.84) andmicroadenomas (0.83) exceeded the minimumpower threshold of0.8.

) Representative immunohistochemistry stainingof We further evaluated NTZ in a murine model for familial ade familial for model murine a in NTZ evaluated further We min/+ β 2 0 -catenin direct target genes, 155were found inourarray. ( ( Fig. 1 , mice treated with vehicle (0.5% carboxymethylcellulose/H2 (0.5% vehicle with treated mice 1 P 9 WNT11 P <0.05; ** A strong A . <0.01. Scalebar, 20 ef d a Adenoma number e E BIO 10 ). In addition, a clear reduction of 12 rror bars represent meanvalues 0 β 4 8 6 2 Apc -catenin expression in cultured cells. Immunoblots cells. cultured in expression -catenin , b

and and WNT6 T CDX2 Vehicle O P -catenin independentlyof G

min/+ CXCL14 <0.01.(

C SLC7A8 O O β Macro vector andpurifiedonthebasisofGF NT CXCR4 ctnn nrae n l itsia adenomas intestinal all in increase -catenin Apc mice ( mice * KRT23 H N and and Supplementary Fig. 4b NTZ( Z at the indicated concentrations for 24 h. h. 24 for concentrations indicated the at Z in vivo in AXIN2 NTZ TC n min/+ N APC

=total counted paired cells over three independentexperiments. ID2 Fig. 1 b c 1 F-GF Fig. 1 Fig. FGF19 ) ) Representative images (top) and quantitation (bottom) of of (bottom) quantitation and (top) images Representative ) ZNRF3 S -catenin signaling. SupplementaryFig. 4a ie wih pnaeul generate spontaneously which mice, μ APCD1 m. ( mutant colon cancer cells ( . Notably, NTZ treatment did not sub Vehicle RASL11B P d CRYGN expression in paired cells. cells. paired in expression NO f ). d β IL17RD Micro ), supporting NTZ inhibition of inhibition NTZ supporting ), ) Heatmapofrepressed , were significantly repressedweresignificantlyin , ctnn n T-rae mice, NTZ-treated in -catenin 2

* SP5

β ZNRF3 NTZ -catenin signaling for tumor for signaling -catenin CKMT2 CDX2 MYH7B

± TNFRSF11B s.d.for thisandallfollowing experiments. NKD1 ( , β

c KRT74 a bc 6BIO (1 G β -catenin was found ). NTZ ( ) FASLG -catenin in 6BIO- SK3 β C WNT11 -catenin inintestinal adenoma(white traingles) of ). In). contrast to hemical structure ofnitazoxanide ( MSX1

µ Normalized µ M) nature SMTNL2 M) b luciferase activity TNFRSF19 20 orAPC Fig. 2 25 P 10 15 0 UGT8 5 expression. β T GABARAPL1 e -catenin direct target genes in wo unrelated small molecules, mitoxantrone (M mitoxantrone molecules, small unrelated wo ) )

MFSD11 01 –+ ch C a KRT71 ad and ounts of intestinal microadenomas (micro) and macroadenomas (macro) in in (macro) macroadenomas and (micro) microadenomas intestinal of ounts e D O C12orf34 mic N ata shown are normalized to Renilla luciferase activities in three independent independent three in activities luciferase Renilla to normalized are shown ata

·H IFI27 - -

ature ++ LOC157860 25 C a LRIG1 FOPFlash TOPFlash l, pH 2–3) or or 2–3) pH l, l C

* that NTZ-reduced mutant both reduced APC-involvedand ubiquitination rylation β GSK3 ofdent β division innormal asymmetric the stem seen cells to compared cells malignant in division symmetric of prevalence the considering advantage therapeutic of be could NTZ by metry ( cells dividing treated β unequal in increase significant a Wntasymmetry, with Consistent process.ofReduction dation is a proteasome-dependent, but ubiquitination-independent, ( of decrease no tein level, as it can blocked be by proteasome inhibitor MG132, and ( Fig.5b treatment NTZ by unchanged left was STAT3, Supplementary Fig. 5a nxetdy NZ lal dcesd h uiutnto lvl of β level ubiquitination the decreased clearly NTZ Unexpectedly, biology ABHD12B ells were singlyplated andtreated with Fig. 2 -catenin- indepen be should cells SW480 NTZ-treated in degradation -catenin -catenin staining ( staining -catenin -catenin ( MYO1F ** Because the Axin destruction complex is inactivated in SW480 cells SW480 in inactivated is complex destruction Axin the Because 10 Vehicle

SLC16A1 + PROX1

b NPNT ). Reduction ofReduction ).

), which is further supported by a pulse chase assay ( che | Adv DLX4

Δ ZAP70 Fig. 2 NT N47 or ABHD6 a β OXGR1 nce online public or APC. To confirm this, we transfected 293FT cells with with cells 293FT transfected Towe APC. this, or confirm Z at 200 mg/kg per day for 5 weeks (5 mice per group). group). per mice (5 weeks 5 for day per mg/kg 200 at Z m NT NT P PKIG values were determined by a two-tailed Student Student two-tailed a by determined were values CTNNB1

d MAP3K8 Z-induced Wnt asymmetry. SW480 cells were stably stably were cells SW480 asymmetry. Wnt Z-induced ical Z). ( β P NT ), suggesting that NTZ-mediated β TNIK -catenin is aprocess independent of GSK3 value was determined by atwo-tailed Student -catenin-4A, which are resistant to GSK3 ASPSCR1

β NTZ DMSO β Z- (10

b IL10 -catenin asymmetry) was observed in NTZ- in observed was asymmetry) -catenin -catenin variants ( variants -catenin β Phase ) β Fig. 2 Fig. ETV3 , Asymmetric -catenin was also visualized in SW480 cells. SW480 in visualized -cateninalso was b TOP

-cateninby appearedNTZ at pro tobe the

KCNQ1DN biolo

). As a control, another signaling molecule, cells (%) RA a fud n T-rae cells NTZ-treated in found was mRNA

KIAA1199 10 0 μ 5

Flash andF HYAL1 M) treated SW480 cells. Amongthe Apc e CTR9 DNA a ). Induction of Wnt/of Induction ). DMSO n tion | SYK =81 min/+ ACSS2 IT CTSZ gy ** NTZ DMSO mice. Scalebars, 100 mCherry ) and doxorubicin ( doxorubicin and ) www.nature.com/naturechemicalbiology n NTZ NTZ =90 D OP Fig. 2 Fig.

2 d MS 2 –2 . NTZ treatment significantly treatmentsignificantly NTZ . o Flash assays of293F Color key i O :

n 1 f or GF MIT =79 0 02 ), supporting the theory theory the supporting ), . PM 1 0 NT 3 8 2 Z (10 n 1 / β β DOX Supplementary Supplementary =83 . erged n -catenin degra -catenin asym -catenin c DO h μ e μ β M) for for M) m X), were were X), β m. phospho or APC. b Fig. 2 i T o

cells . 2

5 c 1 ). 0 1 - - - - - ,

© 2017 Nature America, Inc., part of Springer Nature. All rights reserved. N identified alistidentified of putative direct binding proteins ( NTZ ( by enriched were which of all lysates, cell SW480 NTZ-treated and revealedsix peptide spots with different intensities between DMSO- ples by 2D–DIGE (two-dimensional difference in gel electrophoresis) protectedand during enriched proteolysis stability) with the principle that binding small-molecule proteins are teins that bind directly using DARTS affinity (drug responsive target may that account for proteins the inhibition of Wnt target signaling, we first profiled the pro NTZ identify To cells. human in viously pre reported been has NTZ of target direct no knowledge, Toour NTZ inhibits significant. Full blotimages for and transfection, cells were treated with - ( counted paired cells over three independentexperiments. Scalebar, 20 (M D (bottom) of ( 6 hbefore immunoprecipitation ( cells were treated with ( ( catenin. representative oftriplicated experiments. ( For R NT SW480 cells. For immunoblotting,cells were pretreated with andR (left) 24 h.GA analysis of Figure 2|NTZ promotes nature CH tion of O β f e D ef cd a MS ) ) Representative immunofluorescent images (top) andquantitation -catenin-4A (4A) or ature ) or10 nline Methods). ( 0 –+ Z (10 IT I To see whether these candidate targets are involved in NTZ deple mmunoblots of293F e T O ) anddoxorubicin ( were determined by atwo-tailed Student’s NTZ DMSO - 05 or Fig. 3 PC DN β

Asymmetric Phase 0 h N PD 1 μ -catenin, we overexpressed them in Wnt-inactive 293FT cells μ R, cells were treated with

NT cells (%) + ascent M) for 16hbefore additionalMG132(20 E 20 M β 10 T MIC H was usedasprotein loadingcontrol. ( 0 β -catenin in293F - Z (10 DN a 10 PC -catenin asymmetry. SingleSW480 cells were treated with NT +

0.7 DMSO 1 h n and and che =72 A DNA R (right)analyses of b Z ( GAPDH β NTZ ( 6BIO ( L BIOLOGY β -catenin ** -catenin inSW480 cells was labeledbefore -catenin signalingby targeting PAD2 μ n DN N NTZ Supplementary Fig. 6 =86 d 0.5 2 h M) for 24 h.

) µ ) treatment, whichwas detected by m

µ

M)

M) NT β NT β DO n -catenin- T MIT ical -cat =75 DN b Z decreases cells transfected withHA- Z (10 0.2 4 h

| Adv -catenin degradation. X) were usedasnegative controls. b T n DOX – – =69 cells treated with6 a Merged β N/D ratio TAMRA μ a – -catenin

T + – IP f M) andMG132(20 Δ nce online public biolo are shown in wo unrelated compounds mitoxantrone N ) andimmunoblotting( NT NT ++ 47 ( – β -catenin ( β Z orMG132for 12h,anddataare Z (10 -catenin ubiquitination.SW480 + Δ N c ) GAPDH β NTZ MG132 47). Four hours after gy ). MS analysis of these spots -catenin μ P 2 ulse-chase assay of M) for 24 h. 3 Supplementary Figure 18 . Resolving. DARTS sam CTNNB1 t GAPDH

( -test; ** BIO d β IP: a FLAG -catenin b o μ a ) GAPDH ) tion | β IB: Ub M) treatment for 6h. i β Input (1 μ I Relative : NTZ -catenin (W I mmunoblotting -cat

mmunoblotting NTZ M) asindicated for 1 HA

mRNA level 0 ) expression in Fig. 3 μ 2.0 0.5 1.0 1.5 T P . M) and 1 –– 0 IB AMRA antibody <0.01, n.s.,not 0 www.nature.com/naturechemicalbiology DMSO P NTZ 10 DMSO –+ ). values in 3 4A – D

NTZ 20 8 n.s.

n a D / MS MG132 10 µ =total +– ). M n MS – WT MG132 20 NT MG132 ∆ µ c T O β –+ N47 M h O ), - or +

Z for µ e

M +

b m μ

µ M m. b . i - - - - o

. 2 5 with overexpression of brown dots). ( with seriallydiluted NT ( intensity ratios between Supplementary Figure 6 and MSassays. NT Figure 3|PAD2 isthedirect target ofNTZ. of small molecules to target proteins in intact living cells living intact proteinstargetin to molecules small of bindingphysical of detection allowed (CETSA) assay shift thermal ( concentrations nanomolar at even detectable K assay thermophoresis (MST) microscale by PAD2 and NTZ between binding SW480 cells. 9c Fig. deletion clones was less sensitive to NTZ treatment ( ( inhibition contact cell reduced had and cells wild-type than faster 8c Fig. two and cells, deletion clones were identified among parental15 colonies ( of that to similar was cells SW480 ( failed contrastgrowth.In the to 8a Fig. reduced these candidates increased ofform active againstantibody anbythe mined and Wnt-activated SW480 cells ( shown in using immunoblottingwithindicated antibodies.Full blotimage for temperatures. volume of and and Wntinhibition in NTZ of target functional of a PAD2as supporting decrease NTZ-mediated the blocked β cells SW480 in PAD2 GSK3 of 7e Fig. β Similarly to NTZ treatment, cells. SW480-PAD2overexpression in Wntsignaling of of inhibition PAD2 the supporting strongly reduced of the Wnt target genes ( construct PAD2 GFP-tagged the with transfected cells SW480 in of decrease the Immunofluorescenceconfirmed staining 1 b Supplementary Fig. 9a 3a Fig. Supplementary Supplementary Fig. 7c RN115 a PAD2 ctnn n TPls atvt ( activity TOPFlash and -catenin or -catenin-4A CALR 0 d ) Microscale thermophoresis (MS 4.6 7.0 3.7 estimated in the low micromolar range, although binding was binding although range, micromolar low the in estimated Z and Z-protected proteins inSW480 cell lysates by To verify the DARTS and MS data, we first determined the direct We further knocked out knocked We further β -catenin degradation. ), further supporting PAD2 as a functional target of NTZ in NTZ of target functional PAD2supportinga as further ), , ), suggesting that the decrease of decrease the that suggesting ), 30 , d 29 19 26 b P Supplementary Figure 18 β ENOA ). Interestingly, cells with PAD2 deletion grew a little bit little a grew deletion PAD2 with Interestingly,cells ). β D A ) and evaluated the effect on NTZ inhibition of cell cell of inhibition NTZ on effect the evaluated and ) /APC as well. On the other hand, shRNA knockdown of knockdownshRNA hand, other the On well. as /APC 18 20 2.1 27 31 ctnn n oh el ye ( types cell both in -catenin MS D 2. c 2

C 22 4 ) O T Epcel, T raiy on t PD wt a with PAD2 to bound readily NTZ Expectedly, . ells were lysed, andthesolubleproportions were analyzed NT 28 32 I he fullimages ofthe2 at37 ° mmunoblot analysis of -647 fluorescent dye-labeled β NT CEP89 IKZF1 GAPDH -catenin- 2.6 5.5 PAD2 c P Z. Graph shows duplicated experiments (blueand A Tm NT C . AXIN2 NTZ (nM) D D for 2hbefore beingheated attheindicated ). Consistently, RT-PCR revealed repression , etected proteins inassigned spotswithtop b 2 were incubated with Z- and ), the clonogenic growth of GFP-positive of growth clonogenic the ), b ). Notably, the clonogenic growth of PAD2 50

β Fraction bound[-] Δ PAD2 -catenin in 293FT cells, and only PAD2 0.5 4 i 23T el ( cells 293FT in N47 and and 0 1 D 10 . T CTNNB1 MS Supplementary Fig. 7a DMSO –1 K ) analysis ofthebindingaffinity of in SW480 cells ( cells SW480 in d ASCL2

D = 3.7 O 0 CET – -treated samplesare marked. DI upeetr Fg 7f Fig. Supplementary µ ( G M SA samples.SW480 cells 10 a upeetr Fg 7b Fig. Supplementary ( E ) β 1 deletion cloneformationdeletion assays are shown in Supplementary Fig. 7d E -catenin is independent is -catenin 68 P xamination of D 10 A NT 50 AR D 2 2 (25nM)was mixed Fig. 3 Fig. Z (10 T β 10 article S, 2 -catenin,noneof 3 Supplementary Supplementary Supplementary Supplementary Supplementary Supplementary μ D 10 b M) orequal NTZ – 4 ). A cellular A ). DI ). As deter 2 G 10 β 5 . Indeed, . -catenin E 5 c

is PAD2 68

, g ), ). ), 3 -

© 2017 Nature America, Inc., part of Springer Nature. All rights reserved. article striking striking increase of the overall citrullination was observed in SW480 by targeting PAD2. Indeed, similar to the overexpression of PAD2, a affects NTZ whether determined Wenext NTZ stabilizes PAD2 andincreases protein citrullination disrupts transcriptional the activity of lination is required for reduced by NTZ treatment ( of ity activ transcriptional the reduced significantly residuesarginine of ( treatment NTZ upon degraded mutant This residues. lysine by replaced mutant a created investigate the potential consequence of coverage.Tosequence oflow the offully because MS by residuesdetected was arginine citrullinated of subset a only that requirementthe of PAD2 enzyme activity for protein level in SW480 cells ( Consistently, overexpression of mutPAD2 did not change the ( cells SW480-mutPAD2 in not observe any increase in citrullination of whole proteins or PAD2, 647 W348A/C647A; cysteine and (W348) 348 (C647) tryptophan on dependent is PAD2 and of citrullination and binding direct the ( cells SW480 in (R550) nine 2 Table Supplementary found to be citrullinated in PAD2-treated in citrullinated be to found two (R18 and R698) out of six nonredundant arginine residues were mined lination in the presence of 200 of dramaticincrease a titrations revealed Calcium PAD2 dose-dependent increase of human recombinantpurified an performed we tion, ( precipitates proteinsaround were kDa 100–120 in detected cells overexpressing PAD2 ( citrullinated of increase significant a revealed immunoprecipitation, performed PAD2, which ofwe substrate the overexpressingPAD2( by increased strongly was and cells SW480 and 293FT in low very blotting with an anti-citrulline antibody, the citrullination level was citrullinationdeamination,or called arginine residue to citrulline. This post-translational modification is assay with an estimated andPAD2 of binding direct PAD2and between interaction physical the endog enous PAD2, FLAG-tagged overexpressing cells SW480 in immunoprecipitation anti-FLAG performed we when Reciprocally, β endogenous against antibody an usingprecipitates the in detected readily was PAD2 cells. SW480 in (Co-IP) immunoprecipitation whether of decrease the by Motivated PAD2 directly interacts withandcitrullinates NTZ to PAD2 PAD2( of stability thermal the increased significantly h for2 NTZ with cells SW480 incubationof 4 -catenin, but was not seen in mouse IgG control samples (

s rti ctulnto i uuly extensive usually is citrullination protein As of activity catalytic full the that indicated have studies Previous protein the conversionof the catalyzes that enzyme an PAD2is in vivo β β 27, -catenin, and this low transcriptional activity was not further β -catenin was readily detected as well ( well as detected readily was -catenin 2 -catenin citrullination by MS. In 17 sequenced peptides, peptides, sequenced 17 In MS. by citrullination -catenin 8 β , which were replaced by alanine in a mutant PAD2 (mutPAD2mutant a in alanine by replaced were which , ctnn s drc tre o PD b promn co- performing by PAD2 of target direct a is -catenin . Fig. 4 Fig. Fig. 4 Fig. in vitro β ctnn muorcpttd rm NTZ-treated from immunoprecipitated -catenin β d -catenin in which all 39 arginine residues were residues arginine 39 all which in -catenin g ). To further characterize To further ). and and and Supplementary Fig. 10a β Fig. 4 Fig. K -catenin degradation by NTZ and probably n vitro in ). In addition, we identified another argi another identified we addition, In ). d Supplementary Table3 Supplementary of 324nM( in vivo Fig. 4 Supplementary Fig. 10b i. 4 Fig. Fig. 4 c β ). To whether ). determine β β μ -catenin was also validated by MST by validated also was -catenin Fig. 3 Fig. -catenin and PAD2, and detected a detected PAD2,and and -catenin -catenin by PAD2, we next studied next PAD2,we by -catenin irliain sa b incubating by assay citrullination M calcium ( d Fig. 4 Fig. . d i ). Notably, additional citrullinated β ), suggesting that arginine citrul and and -catenin citrullination ( 2 6 c . As determined by immunoby determined As . β ), confirming the binding of binding the confirming ), Fig. 4 h -catenin. β β ). In addition, replacementaddition, In ). upeetr Fg 10b Fig. Supplementary -catenin by PAD2by -catenin -catenin citrullination, we β β β -catenin was no longer no was -catenin β Fig. 4 b -catenin turnover. β -catenin citrullination -catenin -catenin ( -catenin ). -catenin ). As weexpected, did β β Fig. 4 Fig. β -catenin citrullina -catenin -catenin in SW480 in -catenin 2 -cateninimmuno 9 f i i vr likely very is it , ), demonstrating ), β ). We deter also ), demonstrating -catenin citrul -catenin b a ), supporting ), -catenin nature in vivo in Fig. 4 Fig. β -catenin is -catenin β β β Fig. 4 -catenin Fig. 4 -catenin -catenin in vitro in g ch . The . and and e a e mic N ). ). ). ). ------

ature a l

does notdoes regulate calcium sensitivity or PAD2 enzyme activation. 50 to up in changecant PAD2( NTZ-treatedof dependence calcium the changein a reveal not did enzyme the of dence which act as a ‘calcium switch’ to control the overall calcium depen SW480 cells, NTZ was completely metabolized to TIZ in 30 min ( 30 in TIZ to metabolized completely was NTZ water cells, SW480 in dissolved ( h is 10 in equilibrium it reaches and once TIZ to hydrolyzes spontaneously ( NTZ to similar level a at PAD2Notably,administration.stabilizedoral upon also (TIZ) TIZ bilizes PAD2 and increases citrullination NTZ-treated ( in citrullination protein in increase consistentand clear a revealed intestines small the Examinationof and normal tissues in NTZ-treated mice ( adjacent normal tissues, whereas it was comparable tumorbetween Apc protein( PAD2 the cyclohexim of half-life inhibitor the extended synthesis significantly NTZ protein (CHX), ide the of presence the In ( level mRNA, the not butprotein, the PAD2at increased an te idn sts f acu 35 ( 3–5 calcium of sites binding the tains (ref. domain-2 immunoglobulin-like N-terminal the in 138–175) dues detected PAD2 peptides revealed a frequently detected region (resi proteolysis against protected remain typically domain will drug-binding the DARTS, of principle the to According PAD2.and NTZ between interface binding the predicted Wefirst PAD2. of level protein or sensitivity calcium activity, enzyme the induceshypothesizedproteinthatNTZ citrullinationbyincreasing induced down cells ( β PAD2( of knockdown with cells in citrullinationprotein increase to failed ( cells HCT116 and 10c Fig. cells treated with NTZ at 10 did notsignificantlychangedid stabilities the ofPAD1, PAD3 orPAD4 treatment NTZ constructs, PAD individual with transfected cells of PAD2 is required. tein citrullination in NTZ-treated cells, and further stabilization increase alone is not sufficient for reaching level of full the pro critical be lination,calcium-dependentitasa is process; however, calcium could calcium cytosolic and is probably increase the prerequisite for to NTZ-induced protein citrul ability the that ( stability PAD2 15b Fig. ( NTZ with treated those than calcium plus cin citrullination level was much lower in cells treated with ionomy ( TIZ or NTZ μ ionomycin as a control. In SW480 cells, 1 and PAD2 citrullination stabilization ionophore the NTZ-treatedin weused cells, protein to contributed calcium in increase solic Ca studies done using NTZ. cellular in contributor main the was TIZ metabolite its that cates biology Supplementary Fig. 14d Fig. Supplementary SupplementaryFig.12c -catenin citrullination in wild-type cells, but not in PAD2in knock not but cells, wild-type in citrullination -catenin M calcium increased cytosolic calcium to a level comparable to It is established that NTZ is rapidly metabolized to tizoxanide to metabolized rapidly is NTZ that established is It On the other hand, NTZ treatment clearly and dose-dependently osdrn ta PD i a acu-eedn ezm, we enzyme, calcium-dependent a is PAD2 that Considering PAD2 belongs to a family with four active members. In SW480 In members. active four with family a to PAD2belongs cyto raises PAD2NTZ andenzyme,calcium-dependent a is min/+ 2 8

; mice, PAD2 staining was weaker in adenomas relative to relative adenomas in weaker was staining PAD2 mice, Fig. 5 Fig.

Supplementary Fig. 11d Fig. Supplementary che | Adv ). NTZ-induced citrullination was also observed in 293FT in observed also was citrullination NTZ-induced ). 2+ Supplementary Fig. 11a Fig. Supplementary β Fig. 5 Fig. μ ). In addition, ionomycin and calcium did not regulatenot did ionomycincalcium addition,andIn ). levels in mammalian cells -catenin citrullination. M NTZ ( NTZ M Fig. 5 a a nce online public m ). In accordance with this, NTZ treatment increased treatment NTZ this, with accordanceIn ). d β upeetr Fg 15a Fig. Supplementary ), suggesting the stabilization of PAD2 by NTZ. In PAD2NTZ. ofstabilization by the suggesting ), -catenin citrullination by PAD2 in the presence of presence PAD2 the by in citrullination -catenin ical upeetr Fg 15c Fig. Supplementary b ), supporting the requirement of PAD2 for NTZ- Supplementary Fig. 12a Fig. Supplementary upeetr Fg 10d Fig. Supplementary 2 8 Hwvr an However, .

biolo ), demonstrating), that treatmentNTZ sta , e Supplementary Fig. 13 Fig. Supplementary μ ). The rapid metabolism of NTZ indi NTZ of metabolism rapid The ). M for 6 h ( h 6 for M a tion | ). In addition, we found a signifi a found we addition, In ). , b gy Supplementary Fig. 14a Fig. Supplementary ). Interestingly,con ). region this www.nature.com/naturechemicalbiology 3 0

. To determine whether the n vitro in d Fig. 5 o Supplementary Fig. 12b in vitro upeetr Fg 5c Fig. Supplementary i , lhuh h protein the although ), μ :

1 M ionomycin plus 200 . hs dt suggest data These ). ), suggesting that NTZ thatsuggesting ), 0 a . 1 and and irliain assay citrullination 0 3 . oee, NTZ However, ). and 8 Supplementary Supplementary / ). Supplementary Supplementary 2 n 3 . Mapping the the Mapping . c n vitro In in vivo Apc h e m min/+ Fig. 5 Fig. b . i – o , NTZ , mice c . ). In ). 2 5 c 1 ). ). ). ), 0 ------

© 2017 Nature America, Inc., part of Springer Nature. All rights reserved. N control ( Renilla luciferase activities in three independent experiments. assay of293F cells stablyexpressing F intensity. Symbols a,bandyrepresent ions generated by MS/MS andusedfor makingthecall.Red “R”s indicate citrullinated arginine residues. ( right, endogenous concentrations. ( incubated at37 ° control SW480 cells ( citrullination in293F was mixed withseriallydiluted (bottom) were immunoprecipitated andblotted usingtheindicated antibodies.( Figure 4|PAD2 directly bindsto andcitrullinates for a short time increased protein citrullination in all cells, and cells NTZ overexpressingwith PADs,treatmentcells In cells. wild-type in observed was citrullination of increase the before NTZ of time treatment the determined first PADactivity,we on NTZ of effects presence the in of( CHX nature CH ature C trl). E MIC T

P d h g a che cells transfected with W value was determined by atwo-tailed Student A g C L BIOLOGY a0(7), a*(7) Input

CM Input ) Spectrumofcitrullinated b0(7), b*(7) β for 1h.( 800 b(7) Ctrl -catenin immunoprecipitated from T andSW480 cells transfected withhuman m C IgG IgG PAD2 ) orfrom thoseoverexpressing wild-type (W)ormutant(M) L

a(8) IP IP AG-tagged wild-type (W 1,000 b(8) ical W 02

f β | Adv FLAG -cat ) SupplementaryFig.16a b0(9), b*(9) C b(9) alcium-dependent β GAPDH PAD2 GAPDH β β β protein Associated IB: anti-cit IP: -catenin 1,200 -catenin. a -catenin -catenin

WT nce online public β b(10) biolo

y(9) -catenin 51 y(10) b*(11), b0(11) b(11) 1,400 T

andmutant(39R/K) y(11), b0(12) B 00

SA (bottom) was usedasanegative control. y(12) gy β e b

-catenin peptides. y(13) 1,600 F (‰) F (‰) b(13) Norm Norm 880 870 834 865 836 875 832 835 833 831

β T d

b y(14) -catenin citrullination. ) andmutant(39R/K) b(14) o a 25 -catenin. 39R/K tion | 1,800 i 10 200 : NT

01 1 –2 k ). To). examine the 0 10 d

Z-treated SW480 cells (10 = 324nM . –2 1 0 www.nature.com/naturechemicalbiology 10 200 800 3 –1 C y(6) ( 04 10 t 8 10 -test; ** ells transfected with empty vector and treated with β a / –1 ) SW480 cells (top) alone or with overexpression of F -catenin andtreated with P L n A eft andmiddle, eft y(7) c 200 NTZ ( GAPDH FLAG D 1,000 h 04 0 β 01 2 plasmidsfor 24 h.( -catenin (nM) e BSA (nM) P

µ b(9) m <0.01. Full blotimages for M) 400 b P β 1,200 0 A 0 y(9) i -catenin were treated with o 10 1 D 1 . 2 2 (40 ng) and β Anti-Cit PAD2 (ng) β 5

y0(10), y*(10),b(11) -catenin -catenin (ng) ther increased proteinther citrullination. Fig. 15a tion could be caused by increased calcium by NTZ ( 16b Fig. overexpressing PAD2 showed the strongest change ( 10 b y(10) 1 P ) MS 2 0 1,400 b(12) A 10 D P 2 μ 10 2-treated recombinant A T M; sequence coverage, 13.1%). 3 D assay of F 1,600

N b(13) ), whereas in SW480-PAD2 cells, stabilization of PAD2 fur 2. ( ). We assumed that the overall slight increase of citrullina of increase slightWeoverall ). the thatassumed orm d D y(13) 10 10 ) MS , normalized fluoresence. ( β e i 3 4 I mmunoblots ofimmunoprecipitated ) -catenin (200 ng) were incubated with calcium at indicated TOPFlash activity

I O 40 20 50 30 10 mmunoblots ofrecombinant 1,800 0 P or10 A a D , c f 2 bindingto Ctrl c 200 NT –

μ y(1) f and 0 M 0 Z for 24 hbefore immunoblotting.(

400 y(3) NT SW480

VEGV, QQQ 0.02 DMSO 0.5 β h -catenin (sequence coverage, 17.6%); Z for 24 h. are shown in 600 y(5) 0.05 Calcium (mM) WT β 2.5 D -catenin (top). y(6) 800 MS 0. NTZ T L

y(7) 10 c he 0 AG-tagged O ) 1,000 E D for 24 h were considered as y(8) 293FT x .2 xamination of protein axisindicates mass and ata shown are normalized to b*(10) 0.5

Supplementary Figure 19 y(9) DMSO 1,200 β 0.

-catenin and y*(10) 51 2.5 39R/K

1,400 y(12), b*(12) P β P A -catenin from A y(13) D NTZ D Anti-Cit PAD2 ( GAPDH 1,600 y(14) Anti-Cit β 2 (25 nM) 2 -catenin y0(15) article y(15)

Supplementary Supplementary Supplementary 1,800 µ P g) A i ) D TOP h 2 ) SW480

Flash y

axis is . 5 - - © 2017 Nature America, Inc., part of Springer Nature. All rights reserved. article ue ognis cls otiig h GPtge PD showed PAD2 GFP-tagged the containing cells organoids, duced R-spondinofindependent structuressphere whole of deletion genetic the with organoids requires R-spondin, activator growth signal Wnt which external in cells organoids, ‘crypt-like’ progenitor wild-type crypt intestinal mouse from LGR6 of of (62/155) 40% of expression the PAD2repressed NTZ, to Similarly in ( genes activated of 26.8% and SW480-PAD2consistentlyin cells changedwere cells NTZ-treated genes repressed of 45% to up CTNNB1 HCT116 colony the not but cells, agarHCT116 and SW480 both soft of formation the inhibited strongly PAD2 of overexpression Similarly,cells. cancer colon of growth anchorageindependent the ( spheres, pact were which much in smaller com and large formed HCT116 and SW480 whereas days, few a in died and clusters cell loose formed cells Wnt-inactivatedRKO CTNNB1 in than extent lesser a to but cells, HCT116 wild-type formationof 17a Fig. ( PAD2mutant, not but wild-type, overexpressing cells SW480 in clo inhibition growth by strong cells revealing assay, cancernogenic Wnt-activated in PAD2 of role the assessed regulates negatively PAD2 Because PAD2 inhibitsthegrowth ofWnt-activated cancer cells at indicated times.Full blotimages for with ( was determined by atwo tailedStudent’s data are representative of triplicatedexpression inSW480 cells treated with10 experiments, and statistical( difference I transfected with shR citrulline and β or negative control vector for 24 h,ortreated with20 SW480 cells were treated with10 and GA as indicated. ( Figure 5|NTZ stabilizes PAD2 andincreases protein citrullination. 6 n d c a Fig. 6 Fig. 6 -catenin was immunoprecipitated and blotted with antibodies against

ab ) ) ) b 0 β I I , cells treated with I e et vlae te fet o PD i ognis derived organoids in PAD2 of effects the evaluated next We Weprofiled PAD2 the further gene affected expression. Notably, mmunoblotting (left) and R mmunoblots of SW480 cells following mmunoblots of SW480 cells overexpression D -catenin direct target genes, including genes, target direct -catenin MS , 25 PD a b NKD1 shCtrl ), indicating the requirement for Wnt/ ), further ), supportingfurther PAD2 as the functional target of NTZ. O . n diin oeepeso o PD ihbtd colony inhibited PAD2 of overexpression addition, In ). H separately. ( deletion clones ( ( clones deletion or C β 10 ell lysates were blotted with antibodies against citrulline -catenin separately. NT shPAD2 and 5 Z (10 10 N D WNT11 A control plasmid and GAPDH Anti-Cit NTZ ( Apc MS μ b M) for 6htogether withcycloheximide ( ) µ O r h eo 3 of 3 exon the or M) I mmunoblot analysis of for 24 h were considered as control ( d T ( Fig. 6 - Supplementary Fig. 17b Fig. Supplementary PC Fig. 6 0 Ctrl μ I n M R (right) analysis of a

1 shCtrl a and NT NTZ – a DMSO d ). 2 c

t shPAD2 are shown in Z and transfected with sh -test; n.s., not significant. ). μ b NT M 34 , sh P A β MG132 Z treatment and transfections NT D ctnn inln, e next we signaling, -catenin C β -catenin trl and sh 2-shR P IP: β-catenin Z for 24 h. A Ctnnb1 6 IB: anti-Cit CTNNB1 β D μ -catenin citrullination. AXIN2 c 2. 0 3 M MG132 for 6 h. N 1 Supplementary Figure 20 β . In lentivirally trans lentivirallyIn .

C PAD2 mRNA P 02 A plasmid, respectively. -catenin signaling in 1.0 A 0.5 ells were treated 12 1.5 P 0 D 3 A rw s compact as grow

1 DMSO T 2 I cnrs to contrast In . D , NTZ he R Supplementary Supplementary

2 are cells deletion clones ZNRF3 ). In soft agar, soft In ). n.s. 34 NTZ 51 C C T nature

P hx, 50 - trl). A

PC

0 D

6 R

2 GAPDH PAD2 NTZ ( ,

CDX2 μ

GAPDH PAD2 Chx (h) ch g/ml) µ

m) e mic N - - - , .

ature a l

sor of c-Myc that is downregulated in NTZ-treated cancer cells cancer NTZ-treated downregulatedin is c-Myc thatof sor repres transcriptional and protein binding promoter a is ENOA instance,For NTZ. of effects reported the to connected potentially Although not all of these are addressed in the present study, some are IKZF1. and RNF115 includingPAD2, NTZ CALR, ENOA,CEP89, of proteins direct-binding candidate of number a identified have cells. In human the present study,in by using chemoproteomicNTZ approachesof we targets direct the about known previously was parasites protozoaland wasdrug approved for treatment the of intestinal the cancer.cateninin signaling antianas developed initially was NTZ studyInnovel this a wehaveas NTZ inhibitor identified ofWnt/ DISCUSSION indicating that PAD2 blocks Wnt/ enhances virus replication virus enhances C hepatitis against agent an as is NTZ virus- and C carcinoma, hepatocellular hepatitis related in increased is expression ENOA addition, In cancers and parasites viruses, bacteria, against activities of spectrum broad a exhibits and studied extensively been has NTZ mediumwithout R-spondin ( culture in depleted significantly were cells PAD2-overexpressing ( viability and proliferation formation, sphere in abilities lower significantly of PAD2 stabilization by NTZ. We first PAD2observed stabilization proteins ( tive charge. Alternatively, direct citrullination of posi net of loss the of because proteins associated with interaction affects potentially citrullination example, for rullination; there could be other mechanisms for Wnt signaling regulation by cit PAD2as citrullinationof results same the showing signaling, Wntinhibits potentially PAD4 signaling, PAD4 GSK3citrullination and stabilization of GSK3 that Given PAD4(ref. by stabilized is and citrullination of substrate a also accumulated abnormally deplete to opportunity unique a provides degradation mediated citrullinationPAD2 Nevertheless, clarified. be Whether these changes were solely due to citrullination still needs to noted, itnotargininesasbe is likely39 are that all PAD2 substrates. should study the in strategy 39R/K the of limitation However, the nificantly disrupted NTZ mediated supported by our data that replacement of the arginine residues sig proteolyticdegradationand proteasome association to vulnerable more proteins renders and regions (unfolding) ordered analogously to oxidization of proteins, citrullination, facilitates that the presence assume of less- we interactions, (ionic) intramolecular of disruption the causes residues arginine of charge positive the of extensive quite usually is citrullination protein that reported previously been has citrullination by ity decreases and linates NTZ treatment for cancer patients that have Wnt pathway mutations. mutant with depletes Notably,NTZ Wnt/growth. dependent inhibits strongly NTZ that demonstrated have we aberrationsWntpathway has frequently that cancer colorectal in obtained were data these of drug anti-cancer potential a is NTZ that gests direct binding proteins indifferent contexts. interaction replication virus B titis biology An important issue to be clarified is the underlying mechanismunderlying the is clarified be to issueimportant An Notably,Wnt/another citrul PAD2directly that is study present the in finding key A sug evidence emerging clear, not was mechanism the Although

che | Adv Cryptosporidium parvum Cryptosporidium Fig. 4 Fig. 6d Fig. 3 3 9 6 . It will be interesting to verify the role of these NTZ these of role the verify to interesting be will It . a CL i urgltd y h hptts vrs and virus B hepatitis the by upregulated is CALR . APC β nce online public m -catenin inWnt-activated cancer cells. d ) could regulate Wnt/ ical , or or e and and β s ngtv rgltr f Wnt/ of regulator negative a is CTNNB1 3 8 β

. CALR is also critical forhost–parasite the critical also is CALR . Supplementary Fig. 17c Fig. Supplementary biolo ctnn Rglto o sbtae stabil substrate of Regulation -catenin. β β -catenin.Asidefrom 3 -catenin signaling component,GSK3 signaling -catenin 7 , whereas NTZ is an inhibitor of hepa of inhibitor an is NTZ whereas , Fig.6 a sgetn te oeta bnft of benefits potential the suggesting , tion | β gy and and -catenin-dependent cell growth. β f and and www.nature.com/naturechemicalbiology -catenin degradation ( β

-catenin signaling as well. d Giardialamblia o SupplementaryFig.17e i : β

1 -catenin in cancer cells cells cancer in -catenin 1 0 1 . In the present study,present the In . . 35, 1 β 0 β 40– 35, -catenin-associated 3 -catenindepletion, 8 , 40 4 d 43, / 2 , 4 . Notably, many many Notably, . ). In organoids, In ). n 4 2 2 4 , a tumor type type tumor a , 9 c . Considering . , and the loss the and , β 45, h 3 implies that 2 e 4 . Although . 6 β m β , which is which , β β -catenin- Fig. 4 -catenin b -catenin -catenin 3 i 3 o , little , . 2 β 4 34, 5 h , is is , 3 β 1 3 ), ). ). ). ). 5 0 ------.

© 2017 Nature America, Inc., part of Springer Nature. All rights reserved. N according the DARTS and MS data, and (2) there is significant con sitesbinding data: Ca3–5 the at predicted followingis region binding NTZ the (1) the considering effects allosteric to due be could complicated, the underlying mechanism of PAD2 ligand stabilization that protein. Although the fate of principle the target protein the target the of with proteolysis against resistance the consistentincreases saturation assay DARTS the in medium withoutR-spondin for 1d(right). Apcfl/fl) images ofthegrowth of more than100 organoids withoverexpression of test. ( commonly affected genes following treatment with blue stainingand or 14d(middle). Figure 6|PAD2 inhibits the growth ofWnt activated cancer cells. nature CH upon binding of calcium to Ca3–5 binding sites formational transition of PAD2 protein between apo and holo forms ature organoids containing asubpopulationwithoverexpression ofGF c ) Heatmapofrepressed e d c a PAD2 Ctrl RKO SW480 HCT116

E PADI2 MIC

Day 1 CHRNA3 Day 1 Organoids (%)

che 100 DLX4 120 μ A 40 80 60 20 0 m were counted 3dlater.

L BIOLOGY KLRG1 T OD

he colony growth ofSW480, H FLJ11710 RAB11FIP4 Ctrl 590 CPXM1 m nm(right).

Apc PAG1 ical Day

DDX26B PAD2 | Adv ( * V KIAA1274 Day 2 il 2D C ATP12A

re M32 β M11 HCT116 SW480 E a

-catenin direct target genes inSW480 cells overexpressing HUNK R Apcfl/fl)

P nce online public IFI27L1 biolo A D

D LOC157860 ata represent three independentexperiments. Scalebars:200 left, 2 orcontrol vector ( EFNA4 Ctrl organoids withoverexpression of C3orf21 P

D WNT11 ay 3 values in ata show percentage of

MAP3K8 gy IFI27 RASL11B

CT CXCR4 d 2 NT o a 8 in vivo in CDX2 116 andthe tion | . It will be interesting PAD2 a i

IFI27L2 : and Z andoverexpression of

1 Day 4 TNFRSF19 0 . C NLRP11 1 0 www.nature.com/naturechemicalbiology d Day 3 trl) were dissociated to singlecells andseededatequaldensity. is much more LMBR1 3 were determined by atwo-tailed Student

FGF9 8 LEF1 / CTNNB1 n

DEPDC7 c ( h

P C12orf34 in vivo in a A e P ) Representative images ofcolonies ofindicated cells grown agar for insoft 5d(left) ACSS2 m D

-tagged Relative OD Day 5 SORBS2 590 mutantclones(M11andM32)overexpressing 2 spheres compared to control cells intriplicated experiments. ( b 0.4 0.8 0.6 0.2 1.0 P BMP7 1.2 i 0 A -

SW480 o

LGR6 D . 2

2 orcontrol vector. Scanbar, 200 HYAL1 5 * published online 30October 2017 R with Wnt pathway mutations. of lator modu a PAD2as NTZ ofpotential the highlight citrullinationand PAD2 and proteasome the susceptibility. bindingregulatesconformationalNTZ change whether of verify to P HCT116 P

FRAS1 1

A HCT116-M11 A eceived 7July2016; accepted 2October 2017; 0

D CHST13 D In summary, our results present a novelsummary,presenta results Inour * 2 inSW480 cells.

2. VEPH1

HCT116-M32 PAD2 Ctrl TNNC1 O f PPP1R2 β rganoids were grown incomplete andchanged medium(left) to

-catenintreatmentcitrullinationfor the patients ofcancer C6orf97 SP5 P A

ABHD6

D KlAA1199 2. (

R-spondin+ TNIK b

ETV3 133 d

) Quantitationofsphere formation. DOCK11 P P NTZ t Downregulated = 8.56×10 values were calculated usingaFisher’s exact -test; * ZNRF3 μ 111

m; middle,1,000 IL17RD PKIG genes PAD2

TNFRSF1B 544 P –30

<0.01. CXCL 14 μ

m. ( MSX1 TNFRSF11B

f CRYGN ) Representative images of

P FASLG A AXIN2 D μ

2 was quantifiedby C7orf52 O m. (

C20orf118 164 rganoids withdiameters of

ZAP70 NTZ P β R-spondin– b

SLC7A8 = 4.28×10 ) -catenin regulationby-catenin 60 Upregulated

V NKD1 enn diagram shows KCNQ1DN genes article Ctrl PAD2 –2 PAD2 886 e –12 Apc ) Representative Color key 02 ( V il C T re rypan Apc E R Apcfl/fl) ( V il C re

E 7 - R © 2017 Nature America, Inc., part of Springer Nature. All rights reserved. article 30. 29. 28. 27. 26. 25. 24. 23. 22. 21. 20. 19. 18. 17. 16. 15. 14. 13. 12. 11. 10. 9. 8. 7. 6. 5. 4. 3. 2. 1. R o the in available are references, and codes accession Methods, including statements of data availability and any associated Methods 8 f

eferences

t (2014). ATP-sensitiveCa depletes intracellular arthritis. rheumatoidfor autoantigen novel design. inhibitor forimplications fashion: proteins. regulation. epigenetic in modifications arginine assay.shift thermal cellular the using tissues Commun. thermophoresis. microscale using liquids biological in assays binding (DARTS).stability ligase. SCFbeta-TrCPubiquitin (2015). 792–797 progression. and development cancer in division models. animal in and culture cell in parvum Cryptosporidium against nitazoxanide of gene. APC the of homolog murine One PLoS cancer.colon and cells stem intestinal in enriched signature target CTNNB1 specification. cell-fate binary mediate embryos dumerilii Platynereis in divisions cell oriented vegetal- (2013). 491–495 embryos. ascidian in layers germ segregates specification USA Sci. Acad.Natl. Proc. mutation. beta-catenin of effects unexpected reveals CTNNB1 of inactivation Biotechnol. editing. genomeCRISPR-Cas9 using lesions genetic combinatorial pathway.signaling inhibitor. GSK-3-specific pharmacological a by Wntsignaling of activation through cells stem embryonic mouse and human in pluripotency ofMaintenance types. cancer (2014). 513–532 mutation of the beta-catenin gene. beta-catenin the of mutation (2005). 843–850 carcinoma. endometrial of characterization genomic medulloblastoma. Hepatology complex. ligase ubiquitin Wntand pathway the in genes cancer and cancer.prostate adenocarcinoma. cancer. rectal and colon human complex. Axin1 intact Ashiru, O., Howe, J.D. & Butters, T.D. Nitazoxanide, an antiviral thiazolide, T.D.antiviral Butters,an Nitazoxanide,J.D.Howe,& O., Ashiru, H. Bang, D.J.Slade, D.M. Lewallen, protein of biology K.W.Clancy,Thompson, Chemical J., & Fuhrmann, P.R. D.Molina, Martinez Protein- S. Duhr,P., & Baaske,D. Rothbauer,C.J.,U., Braun,Wienken, B. Lomenick, Y.Su, asymmetric of subversion symmetry: T.Fearful Reya, & B. Zimdahl, J.,Bajaj, Efficacy S. A. &Tzipori, Fairfield, J.K., Griffiths, D’Onfro, J., C.M., Theodos, L.K. Su, Watanabe,K. B. Bowerman, & S.Q.Schneider, Hudson, C., Kawai, N., Negishi, T. & Yasuo,T.& Negishi,H. N., Kawai, C., Hudson, Kinzler,K.W.Vogelstein,& TargetedB.L.H., T.A., Dang, Wang,Chan, Z., D. Heckl, Wnt the manipulate and probe to vectors Lentiviral R. Nusse, & Fuerer,C. A.H. P.Brivanlou,Greengard, & L., Skaltsounis, Meijer,L., N., Sato, C. Kandoth, pathway? WNT the target safely we Can M. Kahn, N. Harada, cancer.and cells stem in Wnt signalling H. Clevers, T.& Reya, C. Kandoth, D.T.Jones, D.Jia, C.S. Grasso, L. Ding, of characterization Comprehensivemolecular Network.Atlas Genome Cancer V.S.Li, h e

p a et al. et et al. et p et al. et e et al. et et al. et et al. et ACS Chem. Biol. Chem. ACS

r Nat. Med.Nat. et al. et et al. et 1 9

.

APC is essential for targeting phosphorylated targeting for essential is APC 32 et al. et 60 Exome sequencing of hepatoblastoma reveals novel mutationsnovel reveals hepatoblastomaof sequencing Exome , 100 (2010). 100 , et al. et , e92317 (2014). e92317 , Wnt signaling through inhibition of inhibition through Wntsignaling et al. et et al. et et al. et Mutation and citrullination modifies vimentin a to Multiple intestinal neoplasia caused by a mutation in the the in mutation a by caused neoplasia intestinalMultiple Nature Somatic mutations affect key pathways in lung in pathways key affect mutationsSomatic , 941–946 (2014). 941–946 , et al. et et al. et , 1686–1696 (2014). 1686–1696 , Protein arginine deiminase 2 binds calcium in an ordered an in calcium binds 2 deiminase arginine Protein Generation of mouse models of myeloid malignancy with malignancy myeloid of models mouse of Generation et al. et Antimicrob.Chemother.Agents Nature Dissecting the genomic complexity underlying complexitygenomic the Dissecting Intestinal polyposis in mice with a dominant stable dominant a with mice in polyposis Intestinal Cancer Genome Atlas Research Network. IntegratedNetwork. Research Atlas Genome Cancer The mutational landscape of lethal castration-resistant lethal of landscape mutational The Mutational landscape and significance across 12 major 12 across significance and landscapeMutational Nature Nature Target identification using drug affinity responsive target responsive affinity drug Target using identification Integrative ChIP-seq/microarray analysis identifies a identifies analysisChIP-seq/microarrayIntegrative PLoS One PLoS Proc. Natl. Acad. Sci. USA Sci. Acad.Natl. Proc.

10 Chemical proteomic platform to identify citrullinated identify to platformproteomic Chemical 502 et al. et Cell , 55–63 (2004). 55–63 ,

487

, 333–339 (2013). 333–339 ,

455 488

Monitoring drug target engagement in cells and cells in engagement target Monitoringdrug

10

99 149 , 239–243 (2012). 239–243 ,

, 1069–1075 (2008). 1069–1075 , , 2520–2528 (2015). 2520–2528 , , 8265–8270 (2002). 8265–8270 , Dev. CellDev. , 100–105 (2012). 100–105 , 5 , e9370 (2010). e9370 , , 1245–1256 (2012). 1245–1256 , Mol. Cell Mol. Nature β -Catenin asymmetries after all animal/ all after asymmetries -Catenin EMBO J. EMBO Science

2+ 13

487 stores. ACS Chem. Biol. Chem. ACS

Arthritis Rheum. Arthritis , 73–86 (2007). 73–86 , 32

256 , 330–337 (2012). 330–337 , , 652–661 (2008). 652–661 ,

18 Science Chem. Rev. Chem.

106

, 668–670 (1992). 668–670 , 42 , 5931–5942 (1999). 5931–5942 , Cancer Res. Cancer Virology β -Catenin-driven binary fate binary -Catenin-driven , 21984–21989 (2009). 21984–21989 , , 1959–1965 (1998). 1959–1965 , β Nat. Rev. Drug Discov. Drug Rev.Nat. -catenin degradation in an in degradation -catenin

Nature 341

115 , 84–87 (2013). 84–87 ,

462–463 10 56 Curr.Biol. β

, 1043–1053 (2015). 1043–1053 , 75 497 , 2503–2511 (2007). 2503–2511 , -catenin to the the to -catenin , 5413–5461 (2015). 5413–5461 , o , n nature

, 67–73 (2013). 67–73 , Nature l i , 135–148 , n Nat. e

23

v Nat.

e , 434 ch r s e 13 i , o mic N n ,

ature a l

42. 41. 40. 39. 38. 37. 36. 35. 34. 33. 32. 31. 46. 45. 44. 43. to W.Z., K.-H.K.or X.K. institutional affiliations. Correspondence and requests for materials should addressed be Nature remains neutral with regard to claims jurisdictional inpublished maps and available online at available inthe Any supplementary information, chemical compound information and source data are A o The authors declare competing interests: financial details accompany the Competing financialinterests project, the designed interpreted results and wrote manuscript. the microarray profiling; K.A.B. immunohistochemistry performed staining; K.-H.K. and M.P.L. data performed analysis; P.S.H. provided materials; A.M.O. DNA performed formed miceexperiments, LC–Q-TOF–MS analysis and calcium measurement; P. F. C. results and wrote manuscript; the J.R.O. experiments; performed X.Y. and W.Z. per Y.Q. and project, the X.K.designed experiments, performed analyzed data, interpreted A Project SOUND (633974)to P.F.C. for Skin Cancer Research to M.P.L. and the EU Horizon 2020 Collaborative Research Chang Jiang Scholars Program and NSFC (81230090, 81520108030) to W.Z., the Society Vest grants 911778 to Y.Q., 911626 and 912062 to K.H.K., 911747 to X.K., Professor of Tordis and Fritz C. Rieber’s legacy to K.H.K., Bergen Research Foundation to X.K., Helse Greve, Bjarne Rieber, Herman Friele, Trond Mohn, Thorstein Selvik, Kåre Rommetveit, acknowledge funding from Einar Galtung Døsvig, Espen Galtung Døsvig, Jan Einar organoids, and S. Coonrod for the PAD2 expression vector and valuable discussion. We (Cancer Research Institute, UKBeatson Glasgow, UK)for mutant the NusseR. (Stanford University, Stanford, CA) for the Wnt reporter 7TGC, O.J. Sansom Cytometry Core Facility, Department of Clinical Science, University of Bergen. We thank urement, and X. Zu and X. Liu for the LC–Q-TOF–MS analysis. We thank the Flow and for S.M.Leh tochemistry materials. clinical We thank C.Lv for calcium the meas We thank H.M.Hoang for DNA microarray profiling, M.Eidsheim for immunohis A biology f

dditional information uthor contributions cknowledgments t

h J. Cancer J. apoptosis in colorectal tumor cells. tumor colorectal in apoptosis Ther. nitazoxanide. of effect antineoplastic an identifies screening drug cells. cancer colon human in death cell (GSTP1)-dependent Pi transferase 27 Trypanosomacruzi Chemother. tizoxanide. or nitazoxanide to resistance virus C hepatitis resistance. ribavirin. and peginterferon, nitazoxanide, with treated 4 genotype C hepatitis chronic in response cancer. colorectal of treatment for candidate a as nitazoxanide drug anthelmintic the activity.c-myc modulating in MBP-1 and drug. anticancer potential infections. gastrointestinal of treatment activating homeostasis. disease. in involvementand features genes, enzymes: citrullinating of family growing a methylation.DNA controls and (2013). cells. cancer breast in transition GSK3 Brockmann, A. Brockmann, H. Fan-Minogue, Müller,J. Extracellular A. Ferreira,V.P., Ferreira,& Valck,C., N. G., Ramírez, López, forPotential J.S. P., J.F.Glenn, Lui, Rossignol, & M., Elazar, B.E., Korba, Yue,X. virologic Improved E.B. Keeffe, Y.El-Gohary,& J.F.,A., Rossignol, Elfert, W.Senkowski, K.W.Hsu, a as nitazoxanide of perspective functional A J. Ehrisman, & N. Santo, Di the in use its of review M.P.Curran,a V.R. Nitazoxanide:Anderson,& D.J.Huels, Wu,H.Y. Venrooij,PAD,G.J.vanW.J. A.J., Pruijn, Vossenaar, Zendman, & E.R., R. Deplus, S.C. Stadler, e

p , 115–122 (2011). 115–122 , a p

e

12 β che | Adv r activates TGF- activates . Mol. Cancer Ther.Cancer Mol. et al. et , 1896–1905 (2013). 1896–1905 ,

123 et al. et et al. et β o et al. et J. Immunol.J. BioEssays et al. et

et al. et a -catenin mutations.-catenin n 52 et al. et Hepatitis B virus-induced calreticulin protein is involved in IFN in involved is protein calreticulin virus-induced B Hepatitis nce online public l h , 1797–1806 (2008). 1797–1806 , Proc. Natl. Acad. Sci. USA Sci. Acad.Natl. Proc. m i n , 4069–4071 (2008). 4069–4071 , t Structural basis of antizyme-mediated regulation of polyamine of regulationantizyme-mediated of basis Structural Thiazolides inhibit growth and induce glutathione-S- induce and growth inhibit Thiazolides et al. et t The activated The Notch1 receptor cooperates alpha-enolase with e p et al. et Citrullination of DNMT3A by PADI4 regulates its stability its PADI4 regulatesby DNMT3A of Citrullination E-cadherin can limit the transforming properties of properties transforming the limit can E-cadherin

v ical : Dysregulation of PAD4-mediated citrullination of nuclear of PAD4-mediatedcitrullination of Dysregulation / et al. et e / calreticulin in the host-parasite interplay.host-parasite the in calreticulin r w s Three-dimensional cell culture-based screening identifies screening culture-based cell Three-dimensional

i w Structure-function relationship of thiazolide-induced ofrelationship Structure-function 25 o w β

n A c-Myc activation sensor-based high-throughput sensor-based activation c-Myc A 189 , 1106–1118 (2003). 1106–1118 ,

signaling and induces epithelial-to-mesenchymal induces and signaling . o n

f a

14

t Mutat.Res. biolo t , 279–286 (2012). 279–286 , u h , 1504–1516 (2015). 1504–1516 , r e Gastroenterology e

p . c a o EMBO J. EMBO p Nucleic Acids Res. AcidsNucleic Proc. Natl. Acad. Sci. USA Sci. Acad.Natl. Proc. a m e tion | r / . Reprints and permissions information is r ACS Chem. Biol. Chem. ACS e p

gy 768 r i

Drugs n 112 www.nature.com/naturechemicalbiology

t 34 Mol. Cell. Biol. Cell. Mol. s , 16–21 (2014). 16–21 , /

i , 2321–2333 (2015). 2321–2333 , , 11229–11234 (2015). 11229–11234 , d n d

o

136 67 e x i : . , 1947–1967 (2007). 1947–1967 ,

h 1 , 856–862 (2009). 856–862 ,

t 0 42 m

. 1 9 l , 8285–8296 (2014). 8285–8296 , . Publisher’s note: Springer 0 , 1520–1527 (2014). 1520–1527 , 3

28 8 / Antimicrob.Agents

, 4829–4842 (2008). 4829–4842 , 110 n Apc c TrendsParasitol. h , 11851–11856 , and o n e Mol. Cancer Mol. l m i n Ctnnb1 b e

i v o e

- r - . s 2 - i o 5

Int. n 1

0

© 2017 Nature America, Inc., part of Springer Nature. All rights reserved. nucleotides were: oligogRNA the of Sequences deleted. be to fragments the flanking designed were 2) and 1 (gRNARNAstechnology.CRISPR–Cas9Two guide using cells HCT116 and SW480 in deleted were PAD2 of region coding protein whole CRISPR–Cas9 genomic DNA deletion. cell sorting (FACS Aria; BD Biosciences). interest for 2 h. GFP expressing cells were purified by fluorescence-activated 0.45- a throughfiltered collected,were cells. 293FT into Culture medium was replaced 5 h later.co-transfected On the were second day viral supernatants pCMVR8.74 and pMD2.G packaging plasmids with together pLenti-GFP or pLenti-PAD2 7TGC, vector tiviral β 2 every d to allow colonies to grow for 8 d, and the expression of FLAG-tagged with 800 orwild-type mutant (39R or 39K) transfection, SW480 cells were with pcDNA3.1 transfected vector containing FLAG-tagged stable For flasks. or wells among transfection of variation the minimize to taken was Care protocol. recommended the to according used lines cell usingall MycoAlert the Mycoplasma Kit Detection (Lonza). cells were purchased from Lonza. Mycoplasma contamination was outruled in Colo320 and DLD1 for Medium 293FT,RPMI-1640 for eagle’smedium fied Dulbecco’sand Eagle’scellsRKO forcells, mediummodi essential minimum HCT116 for medium McCoy’s5A cells, SW480 for medium Leibovitz’sL-15 Technologies.Life from purchased were cells 293FT CAS). (SIBS, Sciences of from the Shanghai Institute of Biochemistry and Cell Biology, Chinese Academy ing to the supplier’s recommendations. DLD1 and Colo320 cells were obtained accord(ATCC)maintainedandType CultureCollection American the from obtainedwere cells RKO(#CRL-2577) and (#CCL-247) HCT116 (#CCL-228) transduction. lentiviral and transfection cell culture, cell lines, Cell PstI digestion. gaagccc-3 gcagatccaggatgaaattgagtttgg-3 Oligonucleotides for mutation of W348 and C647 were 5 to generate enzymatic inactive PAD2 according to the recommended protocol. plasmid shRNA control (#SHC202) were obtained from Sigma. nontargeting and (#TRCN0000051447) plasmid structs were produced and sequencing confirmed by GenScript. PAD2-shRNA USA. FLAG-tagged Mutant (39R/K) University,Cornell at pLenti-PAD2-GFP Coonrod and S.A. from gifts were pIRES2-EGFP FLAG-PAD2-IRES-EGFP, Italy. University, Turin from Novelli, F. gift a was from gift a ENOA-GFPwas and IKZF1-GFP USA; School, W.Medical Harvard Kaelin, FLAG-tagged USA; University, Tech Texas Michel, B. from Institutgift Curie, France; HA-taggeda RNF115 was froma gift Serra-Moreno, R. was pEGFP-CEP89 UK. Bristol, of University the at obtained from Addgene. HA-tagged were (#54023) calreticulin mEmerald-tagged and (#22036), pCMVR8.74 tagged pLenti-PGK-GFP (#19070), FLAG-tagged #12457), pRL-SV40P (#27163), 7× Tcf-eGFP//SV40-mCherry (7TGC; #24304), and 6BIO (#ALX-430-156-M001)was purchased from EnzoLife Sciences. Sigma-Aldrich, from purchased were (#C4859) cycloheximide and (#I3909) purity ≥ (#13693, tizoxanide and Selleckchem, from purchased were (S1208) mitoxantrone99.06%), puritynitazoxanide doxorubicin(#S1627, and (S2485) Chemicals and plasmids. ONLINE doi:10.1038/nchembio.2510 95%) was purchased from Cayman Chemical. MG132 (#M7449), ionomycin(#M7449), MG132 Chemical. Caymanpurchasedfrom was 95%) -catenin was confirmed by immunoblots. For lentiviral transduction, len transduction, lentiviralimmunoblots.For by confirmed was -catenin CTNNB1 CTNNB1 CTNNB1 was Technologies) (Life 3000 Lipofectamine transfection, transient For was used kit (Stratagene) mutagenesis site-directed multiple QuickChange mutant; (TOPFlash FOPFlash 8× Super (#12456), TOPFlash 8× Super PAD2-sgRNA1- F: CACCGCGGGGAGGATGCTGCGCGAG; CTNNB1 β -catenin-4A (#S33A/S37A/T41A/S45A; #24204), pMD2.G (#12259), (#12259), pMD2.G #24204), (#S33A/S37A/T41A/S45A; -catenin-4A μ ′ g/ml g/ml G418(Thermo Fisher Scientific); culture medium was changed , , respectively. The mutations enzyme by were restriction confirmed M -sgRNA2- R: AAACCACCTTCATTCCTAGAGTGAC; -sgRNA2- F: CACCGTCACTCTAGGAATGAAGGTG; -sgRNA1-R: AAACCTGAGCTCGAGTCATTGCATC; -sgRNA1-F: CACCGATGCAATGACTCGAGCTCAG ETHODS The FDA Approved Drug Screening Library (#L1300), ′ and 5 β -catenin, and 2 d later cells were selected selected were cells later d 2 and -catenin, β β ′ -catenin was -catenin a from gift A. Greenhough -ctgggggaagtccctgcaggcaccaacgtccgcag -catenin, PAD1, PAD3 and PAD4 con The ARM repeats of μ m filter and incubated with cells of of cells with incubated and filter m β -catenin- Δ N47 (#19287), FLAG- ′ -cctaaaccgaggcgatct CTNNB1 and the SW480 - - - - -

CGCTGGGAAGTGGAA, PAD2 AGTCT internal F: R: GGGCGGACTGATTTCTTGGT), internal PAD2 GGGATGGTGGGTGTAAGAGC, R: internal (Int) region ( each and clone was PCR amplified (Epicenter), using primers detecting external (Ext) and internal Solution Extraction DNA QuickExtract using pared divided were respectively.passaging, and forPCR wells into DNAtwo Genomicpre was plates 96-well in colonies single-cell-derived clones, deletion Toscreen sequencing. DNA for (Invitrogen) vector pC2.1 into cloned were primers external and Polymerase TaqDNA by amplified product PCR fied. ampli PCR be R:TGG to large too is DNA wild-type in fragment the because fied external PAD2 CCCACTGCGAGAGGACTG;CCCAGCTATTTTCAGCA), in which only DNA with deletion can be ampli F: external CTNNB1 ( deleted be to fragment the of region external the target to designed were primers deletion, DNA To detect validation. primer and freezing before d 3 for grown were cells sorted remaining the well; per cell one of density the atplates 96-well in plated were and cells Biotechnology) (Sony Sorter GFP-positive Cell SH800 Sony a 3% using top purified the editing, gene sufficient allow to d 2–3 for 3000 Lipofectamine with cells into transfected and mixed equally were digestion restriction BsmBI using Addgene) (#57818; vector pL-CRISPR.EFS.GFP in cloned were oligonucleotides gRNA housed and fed a standard rodent diet at the Animal Facility of the Second Second the of Facility Animal the at diet rodent standard a fed and housed were Mice China). (Nanjing,University Nanjing of Center Research Animal Apc previously described Lentiviral transduction of organoids organoids/50 was performed according to the 70–100 protocols of density a at plate 24-well the in seeded were Organoids BSA. 0.1% and Invitrogen) (#12587-010; B-27 1% containing Invitrogen) (#12634-028; DMEM/F12 Advanced in cultured and noids were suspended in Growth Factor Reduced described Matrigel (#356231; Corning) previously protocols the to according performed were passaging and culture Organoids UK. Institute, Beatson UK Research tnb culture. Organoid (Bio-Tek Instruments). and quantification of OD Fisher Scientific) for 30 (Thermo min; plates weresolution washed with tap bluewater beforeTrypan imaging 0.4% and min 10 for formaldehyde 4% with fixed were colonies cell and spheres agar soft experiment, of day last the At cells per well, and medium with or without compounds was changed 3 every d. d. For3 clonogenic assay, cells were in every six-well platesseeded at the density of 3,000 replaced was medium and triplicates in plates 96-well in assayed were Cells protocol. recommended the to according BioLabs) Cell CBA-130; (# kit TransformationAssays Cell the using performed was assay.assay formation clonogenic and assay formation colony agar Soft FOPFlash luciferase activity was normalized to Renilla signals. (#E2940; Promega) according to the recommended protocol. The TOPFlash or System Assay Luciferase Dual-Glo using by later h 24 measured was activity 0.1 plasmids, other with fection (10 FDA-approved drugs GSK3 with treated were plates using Lipofectamine 3000. For the screeningdrug assay, 293FT cells in 96-well 0.22 with transfected were cells well, assay.TOPFlash sequencing DNA by confirmed further for were and immunoblotting. °C clones 96 Positive min. were 1 for primers both for steps 5 min, which was followed by 30 cycles temperature of 96 °C for 30 s, 55 °C The for 30 s and 72 °C respectively. PAD2-sgRNA2- R: AAACCCACTTGAAGGTGAAGGGCTC. PAD2-sgRNA2- F: CACCGAGCCCTTCACCTTCAAGTGG; PAD2-sgRNA1- R: AAACCTCGCGCAGCATCCTCCCCGC; lox(ex3)/lox(ex3) min/+ ie study. mice xenl : GCCTAGAACG; PAD2 AGGCCCTTGAGGAAAAACTGA; R: external itsia ognis ee band rm .. asm Cancer Sansom, O.J. from obtained were organoids intestinal ) CTNNB1 CTNNB1 TOPFlash assay was performed in a 96-well plate. For each For plate. 96-well a in performed was assay TOPFlash os mutant Mouse 4 C57BL/6- 7 . internal F: TGGAAGGTCTCCTTGGGACT, external F: ATGTTGTGGTGAAGAAAAGAGAGT;F: external 590 μ using Cytation 5 ImagingCell Multi-Mode Reader M) for 24 h before TOPFlash assay. For co-trans assay.For TOPFlash before h 24 for M) β Apc inhibitor 6BIO (1 6BIO inhibitor μ g additional DNA was used. The luciferase The used. was DNA additional g min/+ Apc μ ie ee band rm h Model the from obtained were mice g TOPFlash and 0.02 and TOPFlash g ( iCeR Apcfl/fl VilCreER 1 4 gN 1 n 2 constructs 2 and 1 gRNA . nature CH ) and μ M) or together with 460 with together or M) μ Ctnnb1 Mtie pr well. per Matrigel l ot gr colony agar Soft 3 E 1 MIC μ Bify orga Briefly, . g pRL-SV40P g ( A VilCre L BIOLOGY CTNNB1 ER Ca - - - - -

© 2017 Nature America, Inc., part of Springer Nature. All rights reserved. or Ion C.I.% greater than 95 were considered significant. (C.I.%) interval confidence score protein either with Candidates parameters. search the in allowed cleavage missed one with and residues, methionine of isoelectric point, with variable carbamidomethylation of cysteine or and oxidationweight molecular protein constraining without performed were Searches Biotechnology Information nonredundant (NCBInr) or Swiss Protein database.for Center National of database the search to science) (Matrix engine search fragmentation associated MASCOT with the equipped 3.5 version Explorer to GPS were submitted spectra and mass peptide resulting the both search, databaseFor ions). background known other and autolyticpeptides trypsin trum on each of the 5–10 most abundant ions present in each sample (excluding acquired for each sample, averaging 2,000 laser shots per fragmentation spec were spectra fragmentation MS tandem TOF/TOF spectrum. per shots laser 2,000 averaging mode, ion positive reflectron in acquired were spectra mass MS/MS) were performed on a 5800 mass spectrometer (AB Sciex). MALDI-TOF Promega). To identify the peptides, MALDI-TOF (MS) and TOF/TOF (tandem Gold, (Trypsinprotease trypsin porcine modified with in-gel digested and was retained obtained from in-gel DeCyder software analysis. differential protein the of ratio The Healthcare). (GE 6.5 sion subjectedto in-gel analysis and cross-gel analysis using DeCyder software ver and Healthcare) (GE software QuantTL Image by analyzed then were images following the SDS–PAGE using Typhoon TRIO (GE Healthcare). The scanned vided (Amersham BioSciences). Gel image scans were carried out immediately stripholders. andIEF SDS–PAGE were following performed protocol the pro Cy5, respectively. and The labeled Cy3 samples with were mixed labeled well beforewere being NTZ loaded into and DMSO with treated Samples columns. DARTS samples, and the original buffer was replaced using 3 kDa MWCO spin containing8.8, pH urea,thioureaM M 7 2 and CHAPS)4% were to the added trometry. spec mass and (2D–DIGE)electrophoresisTwo-dimensional gel difference was Digestion min. 30 forstopped by adding protease inhibitors, and samples were stored at temperature −80°C. room at pronase Roche,) mg/ml (#10165921001; 4.2 with proteolyzed were samples Incubated respectively. 17 withtemperature room at h 1 incubation for CaCl mM 100 NaCl, mM Tris–HCl500 mM 8.0), (500 buffer(pH TNCcontaining tube10× new a 18,000 at centrifuged were lysates Cell Roche,). (#11836153001; inhibitors protease added freshly containing Pierce) (#78501; buffer M-PER ml 2.4 in lysed were cells SW480 described previously protocol the to according performed assay.(DARTS) stability target responsive affinity Drug DMIRBE microscope. Leica a toattached camera Blue Exi Qimaging a withQcapture Suitesoftware the using captured were images Histologic Abcam). 1:100; (#ab50257;PAD2 were IHC for used dilutions described previously protocols the to according immuno staining. and (IHC) histochemistry (H&E) eosin and hematoxylin (IF), Immunofluorescence gators were blinded counting when intestinal the adenomas. affin using standard procedures. After immunohistochemical staining, investi washed in PBS, fixed in 4% PBS-buffered formaldehyde and in embedded par dissected, wereintestines small treatment.The the of day last the at sacrificed were Mice illness. of signs any for daily monitored and weekly weighed were or Mice weeks. consecutive 5 for 2–3) daily gavage oral by mg/kg 200 atnitazoxanide (pH carboxymethylcellulose/H2O·HCl (0.5% control vehicle with administeredwere Mice weight.average similar with groups two into divided 10 of total a acclimation, of week 1 After Committee. Use and Care Animal the of guidelines tutional insti the with compliance in China) (Shanghai,University Medical Military nature described previously protocol the to according (CETSA). assay shift thermal Cellular The spots of interest were picked up by Ettan Spot Picker (GE Healthcare) ch For 2D-DIGE, 10 volumes of 2-D cell lysis buffer (30 mM Tris–HCl, e mic a l

biology g 2 , n lsts ee qal dvdd ewe to tubes two between divided equally were lysates and ), for 10 min at 4 °C. The supernatant was transferred to transferred supernatantwas The °C. 4 at min 10 for Apc min/+ IF, H&E and IHC staining were performed performed were staining IHC and H&E IF, β male mice (7 weeks of age) were randomly were age) of weeks (7 mice male ctnn #b65; :,0; ba) and Abcam) 1:1,000; (#ab16051; -catenin Intact cell CETSA was performed performed was CETSA cell Intact 2 μ 5 Bify S40 el were cells SW480 Briefly, . 4 l DMSO or NTZ (10 mM), (10 NTZ or DMSO l 8 Piay niois and antibodies Primary . DARTS assay was assay DARTS 2 3 Bify 1 10 × 1 Briefly, . ------7

and 75%,respectively. (NanoTemperTechnologies). MSTpowerandTheexcitation powerwere 20% centration at 25 nM. Fluorescence was analyzed in the Monolith NT.115con device final a PAD2to labeled with mixed and prepared were ligands of series or (NTZ ligand of tration concen the while constant, kept PAD2was labeled NT-647 of concentration sample no and aggregation were confirmed walls before measurement. In the MST capillary experiments the the to sticking No capillaries. glass standard Tween-20. After a short incubation, the samples were loaded into MST NT.115 0.05% and DTT mM NaCl,5 mM 50 CaCl2, mM 10 7.5), (pH HEPES mM 50 containingbuffer in performed were assays The kit. NT647-labeling using by fluorescence with labeled was recombinantSigma) PAD2(#SRP0327,protein (MST). Briefly, thermophoresis after the buffer was microscale exchanged to remove DTT and by glycerol, the human determined was Sigma) (#SRP5172, vitro In immunoblotting analysis. 20,000 at trifuged cen werelysates cell The min). temperatureroom(1 at water in thawing and min) (1 nitrogen liquid in freezing of cycles three by lysed were cells Heated min. 3 temperaturefor room at kept and min 3 temperaturesfor indicated at heated were tube each in Cells tubes. seven between divided equally and tors cells were resuspended in 450 volume of DMSO, 10 respectively,with incubated at and 37 °C flasks for T75 1 2 h. After in trypsination equally and PBS seeded wash, treated recommendedthe protocol. to accordingMillipore) EMD (#17-347B; Kit Detection (Modified) Citrulline Immunoblottingby Protein determined wash. citrullination Anti-usingfor 1 CaCl mM DTT,10 mM 5 7.5), (pH HEPES mM GST-tagged(50 and Sigma) (SRP0327, human PAD2 human purified recombinant spectrometry. mass and assay Citrullination s1) and CTNNB1 human for used assays TaqMan and (#4304437) described previously as performed was (RT-qPCR). PCR quantitative real-time and transcription Reverse non-phospho-(active) β Sigma); 1:1,000; M2; clone (#F1804; FLAG Abcam); 1:200; (#ab50257;PAD2 Abcam), 1:2,000; (#ab2907; CALR Abcam), 1:1,000; #ab9134;1:2,000;Abcam); (#ab290;GFP1:1,000; Abcam), ENOA (#ab155102; Abcam);(HA;hemagglutinin1:20,000; clone EPR16891; (#ab181602;GAPDH Tris–HCl with 2% (w/v) SDS; pH 9) followed by centrifugation at 14,000 × mM (20buffer in h) 2 for°C 80 and min 20for °C 100 min, 5 forice (ontion ethanol (95%, 75%, 50% and 0%). Proteins were extracted by a ofseries incuba of series graded a rehydratedwith and xylene by de-paraffinizedwere tissues from 10 previously described immunoblottingbeen have Immunoblotting. vidual antibodies were examined by immunoblotting. FLAG or Abcam) Ubi-1; (#F1804, cloneclone M2, Sigma). Input controls (#ab7254; and proteins pulled down with ubiquitinindi Abcam), 12F7; clone against antibody primary Sigma), (#I5381; IgG mouse 21 and Dynabeads mg 3 with incubated tubes, 3 between divided equally (#15050-065Gibco). After saving 2% samples for input control, cell lysates were Briefly,werecellsmg SW480 by600 harvested Technologies,).usingEDTA 0.25% trypsin free Life (#14321D; Kit Co-Immunoprecipitation Dynabeads of (Co-IP). Co-immunoprecipitation lowing primary antibodies and dilutions: fol the used we immunoblotting,For pellets. insoluble the remove to min 20 -catenin (Ser33/37/Thr41; #4270; 1:1,000; Cell Signaling Technology).-catenin #4270;1:1,000; Cell (Ser33/37/Thr41; o ietfcto o poen irliain y S cnrl n PAD2 and control MS, by citrullination protein of identification For ACTB1 binding assays. binding β β μ (#Hs00355045_m1), -catenin were resolved in SDS–PAGE gel, proteins were visualized visualized were proteins gel, SDS–PAGE in resolved were -catenin ctnn #R57, im) ee nuae wt rato buffer reaction with incubated were Sigma) (#SRP5172, -catenin m thick formalin-fixed, paraffin-embedded (FFPE) mouse intestines, (#Hs99999903_m1) were obtained from Life technologies. h pooos n raet fr ape rprto and preparation sample for reagents and protocols The g for 20 min at 4 °C. The soluble fractions were isolated for isolated were fractions soluble The °C. 4 at min 20 for The binding affinity of PAD2 to NTZ, and NTZ, PAD2ofto affinity binding The β -catenin) was serially diluted. In total, 16 titration 16 total, In diluted. serially was -catenin) PAD2 μ l PBS containing freshly added protease inhibi (#Hs01042505_m1), oI ws oe olwn te protocol the following done was Co-IP 4 8 β . TaqManMixMaster Universal.PCR -catenin (#ab16051; 1:2,000; Abcam); For 4 8 . To. prepareprotein samples AXIN2 in vitro in doi:10.1038/nchembio.2510 2 , 50 mM NaCl) at 37 °C 37 at NaCl) mM 50 , ASCL2 μ β (#Hs00610344_m1), M NTZ or an equal equal an or NTZ M citrullination assay,citrullination -catenin (#ab22656; -catenin (#Hs00270888_ RT-qPCR β -catenin g for for μ g ------

© 2017 Nature America, Inc., part of Springer Nature. All rights reserved. I) f rti o itrs (o example, (for interest of protein immunoprecipitation of (IP) labeling, protein nascent parts: four includes mainly assay. pulse-chase Nonradioactive in triplicates. level was normalized to the DMSO-treated sample. All samples were measured flow by nm fluorescence the of value mean 525 cytometry.compound-treatedFor the sample, at emission fluorescence the measuring before min 10 for compounds or DMSO with treated were cells loaded Fluo-3 min. 20 for tion 4 the absence of calcium or magnesium. Cells werein incubated with PBS Fluo-3 a.m. atwith times three washed and trypsinized were cells Briefly,protocol. recommended the according Beyotime) (#S1056; a.m. Fluo-3 indicator cium Cytosolic calcium measurement. m/z voltage, 3,900 V; fragmentor voltage, 175 V; skimmer voltage, 65 V; scan range, capillary psig; 30 gas, nebulizer pressureof °C; temperature,325 gas L/min; 5 following parameters were forused the mass detection: ñow rate ofgas, drying 10 was volume injection sample the and ml/min 0.3 was rate flow the °C, 35 to set was temperature column the runs, individual between step equilibration pre-of min 4 a was ThereB. 100–5% min, min, 7–11 B; 100% min, 6–7 0–6 B; 5–100% follows: as programed (acetonitrile), B solvent and v/v) acid, mic for 0.1% contains water (ultrapure A solvent of consisted phase mobile The samples. lysate cell analyze to applied Technologies)was Agilent mm; 100 × (ESI) (1.8 column C18 plus Technologies). ionizationEclipse (Agilent An source electrospray an with equipped spectrometer mass Q-TOF Agilent-6520 an with coupled system LC Agilent-1290 an using analysis MS assay.hydrolysisNTZ Both and metabolismwere by determined LC–Q-TOF– 20,000 at fuged lysateslysates cell werebyof freezing/thawingthe Cell centri for cycles. three preparationbefore once PBS with washed and nitrogen liquid in frozen were 10 or DMSO with treated were cells assay,SW480 metabolism For times. different at water ultrapure in or DMSO in dissolved NTZ hydrolysis and metabolism assays. also allowed in the search parameters. cysteine and oxidation of methionine residues, and with of one missed cleavage carbamidomethylation arginine, of citrullination variable with point, tric isoelec or weight molecular proteinconstraining without performed were database containing the sequences of equippedsearchMASCOT withengine(Matrix tosearch protein a Science) associated fragmentation spectra were submitted to GPS Explorer workstation the and mass peptide resulting the of both search, database For spectrum. fragmentation per shots laser 4,000 averaging ion, each for acquired were spectra MS fragmentation ion tandem TOF/TOF mode. positive in reflectron acquired were spectra Mass SCIEX). (AB System 5800 TOF/TOF SCIEX AB on by MS analysis followed at intervals 20-s were collected Fractions column. separated on an acetonitrile gradient (ranging from 5% to 60%) on a Nano LC respectively. Tryptic peptides were loaded into a A and B were 0.1% TFA in (v/v) water and 0.1% TFA in (v/v) 80% acetonitrile, solvents phase Mobile MA). (Milford, 3000 Ultimate Dionex a using out ried then were digested by Glu-Cproteins (Promega) overnight The at 37 °C. Nano-LC–MS/MS was car temperature. room at min 30 for dark the in temperature. bated room to down cooling by concentration final a to added and Iodoacetamide incu mM then ofwas 15 followed was which min, °C 60 30 at for incubated and mM 10 of concentration final a to added was DTT and cut were Da 120k of weight molecular a with bands Blue, Coomassie by doi:10.1038/nchembio.2510 μ μ M for 30 min at 37 °C followed by PBS wash two incuba times and further 60–1,200. l. The ESI–MS spectra were operated in negative ionization modes. The modes. ionization negative in operated were spectra ESI–MS The l. g for 10 min, and the supernatant was used for the following the for used was supernatant the and min, 10 for Cytosolic calcium was determined using cal h nnaiatv plecae assay pulse-chase nonradioactive The β -catenin (NP_001091679.1). Searches For hydrolysis assay, 10 β -catenin), click-iT reaction of the the of reaction click-iT -catenin), μ -Precolumn Cartridge and Cartridge -Precolumn μ M NTZ for 30 min, cells min, 30 for NTZ M μ μ M NTZ was m; 3.0 mm 3.0 m; ------

probably is not recognized by the normal antibody due to the integration of integration the to due antibody normal the by recognized not is probably number of methionine residues protein, labeled inthe and protein labeled this the bymultiplied Da) (555 TAMRAAzide of weight molecular the be should MW increased the and expected, than larger bit a be shouldprotein detected (#MA1-041; Thermo Fisher Scientific). Of note, the molecular weight (MW) of protein Azide-labeled kit TAMRAagainstantibody TAMRAstandardimmunoblottingby an using detected was buffer The reaction Scientific). Click-iT Fisher the Thermo using (#C10276; HPG and Azide between reaction copper-catalyzed a via Scientific) Fisher Thermo (#T10182; Azide (TAMRA) immunoprecipitated 10056; Thermo Fisher Scientific) following the recommended procedures. The against antibody and Scientific) Fisher Thermo (#10004D; G Protein Dynabeads using performed was experiment IP same The the period. during time IP for used were samples all then and point time final the until ice storedonlysatewas inhibitors. each differenttreatedforwere times, cells When protease with 8.0) pH Tris–HCl, mM in 50 in harvested SDS were (1% buffer cells IP,lysis For treatment. NTZ after and medium normal complete adding before HPG unlabeled the remove to PBS with times three washed were cells later hour One methionine. 35S traditional the of instead analog 40 with incubated further were Cells reserves. methionine RPMI methionine-free with incubated medium (#A1451701;Thermo Fisher at Scientific) 37°Cfor 40minto deplete and PBS, warm were with confluency once 90% washed at cells SW480 labeling, protein nascent For lotting. immunob by interest of protein nascent the of detection and protein, IPed 48. 47. on reasonable request. authorscorresponding the from available are or information)supplementaryits (and paper the within available are study this of findings the supporting ArrayExpress database under accession number E-MTAB-4452. other All data availability. Data differences were considered * when experiments. licated rep the of (s.d.) bars errorand mean represented the arebydata Pooled lists. to analyze the proportions or calculate the probability of overlap genebetween used was Fisher’stestcomparisons. exact pairwise all for difference statistical Student’sreplicates. two-tailed biological A evaluatethe to performed was test three with least at repeated were cells culture using experiments All vations. obser the all of s.d. the is s.d. treatment)and NTZ vs groups(vehicle two the between macroadenomas and microadenomas of means the in difference the is delta The experiments. mouse the repressionin tumor the evaluate to used Statistical analysis. into ArrayExpress the database under accession number E-MTAB-4452. ( ware described previously been has Technologies) Agilent #G4845A, and (#G4112F microarray DNA microarray. DNA TAMRA Azide.

elevation of reactive oxygen species and IL-6/STAT3and signaling. species oxygen reactive of elevation organoids.intestinal of analysis downstream and transduction lentiviral for protocol A J.Heijmans, & G.R. Brink, Vanden 73 Qu, Y.Qu, J.F.,Jeude, Montenegro-Miranda,Vermeulen,P.S.,J.L.,de Van Lidth , 7090–7100 (2013). 7090–7100 , h t L t -homopropargylglycine (HPG; #C10186; Thermo Fisher Scientific) Scientific) Fisher Thermo #C10186; (HPG; -homopropargylglycine p et al. et : / / w w Generation of prostate tumor-initiating cells is associated with associated is tumor-initiatingcells prostate of Generation w . DNA microarray data have been deposited into the the into deposited been have data microarray DNA m eoe ie rncito poiig sn Aiet 44k Agilent using profiling transcription wide Genome Post-hoc power analysis with a minimum power of 0.8 was o 4 β 8 P l . Raw data were imported and analyzed in J-Express soft m -catenin was further labeled with Tetramethylrhodamine values are indicated in figure legends and significant and legends figure in indicated are values i n e . c o m ). DNA microarray data have been deposited been have data microarrayDNA ). P

≤ 0.05and ** J. Vis. Exp.Vis.J. P nature CH

≤ 0.01.

2015 β -catenin (#MA1- -catenin E μ , e52531 (2015). e52531 , MIC methionine M Cancer Res. Cancer A L BIOLOGY

- - - -