DOCSLIB.ORG

Universidad Autónoma De Madrid

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Universidad Autónoma De Madrid Universidad Autónoma de Madrid Departamento de Bioquímica Identification of the substrates of the protease MT1-MMP in TNFα- stimulated endothelial cells by quantitative proteomics. Analysis of their potential use as biomarkers in inflammatory bowel disease. Agnieszka A. Koziol Tesis doctoral Madrid, 2013 2 Departamento de Bioquímica Facultad de Medicina Universidad Autónoma de Madrid Identification of the substrates of the protease MT1-MMP in TNFα- stimulated endothelial cells by quantitative proteomics. Analysis of their potential use as biomarkers in inflammatory bowel disease. Memoria presentada por Agnieszka A. Koziol licenciada en Ciencias Biológicas para optar al grado de Doctor. Directora: Dra Alicia García Arroyo Centro Nacional de Investigaciones Cardiovasculares (CNIC) Madrid, 2013 3 4 ACKNOWLEDGEMENTS - ACKNOWLEDGEMENTS - First and foremost I would like to express my sincere gratitude to my supervisor Dr. Alicia García Arroyo for giving me the great opportunity to study under her direction. Her encouragement, guidance and support from the beginning to the end, enabled me to develop and understand the subject. Her feedback to this manuscript, critical reading and corrections was inappreciable to finish this dissertation. Next, I would like to express my gratitude to those who helped me substantially along the way. To all members of MMPs’ lab, for their interest in the project, teaching me during al these years and valuable contribution at the seminary discussion. Without your help it would have not been possible to do some of those experiments. Thank you all for creating a nice atmosphere at work and for being so good friends in private. I would like to also thank all of the collaborators and technical units for their support and professionalism. Finally, I would like to acknowledge Ministerio de Educación, Cultura y Deporte for providing me the financial support for my research, CNIC and Universidad Autonoma de Madrid for all the economical and technological facilities supporting my thesis work and coursework. 5 6 SUMMARY - SUMMARY - Understanding the molecular mechanism regulating angiogenesis is an essential aspect of pathology of many diseases. Recent evidences implicate membrane-type 1 matrix metalloprotease (MT1-MMP), a potent pericellular enzyme expressed by vascular cells, in inflammation and angiogenesis. This work aimed to explore the MT1-MMP’s contribution to inflammatory-induced angiogenesis, formation of new vessels from preexisting ones. To accomplish this, we applied quantitative proteomic technique named SILAC to TNFα-activated endothelial cells derived from wildtype and MT1-MMP null mice to identify the substrate repertoire of this protease and identify candidates that might affect capillary sprouting within the inflammatory context. We found that TNFα activated endothelial cells and induced expression of several markers characteristic for endothelial tip cells, the main effectors of sprouting angiogenesis. Moreover, MT1-MMP expression was upregulated after TNFα pulse, accompanied by differences in supernatant glycoproteome between wildtype and MT1-MMP null endothelial cells. Glycoproteins identified as putative MT1-MMP substrates include key extracellular matrix, matricellular and secreted proteins such TSP1, NID1, CYR61, SEM3C or SLIT2 as well as cytokines and growth factors like EGFR and CSF1. Bioinformatic analysis revealed a combinatorial MT1-MMP proteolytic program, in which combined rather than single substrate processing would determine biological decisions by activated endothelial cells, including chemotaxis, cell motility and adhesion, and vasculature development. Processing of TSP1, CYR61, NID1 and SEM3C was impaired in MT1-MMP- deficient animals leading to reduce angiogenic response. The relevance of this MT1-MMP-driven proteolytic program was observed in pathology in aberrant angiogenesis related to chronic inflammatory disorders as inflammatory bowel disease (IBD). Using an experimental model of mouse colitis we showed soluble levels of TSP1 and NID1 were increased and positively correlated with MT1-MMP expression. Impaired processing of these substrates was also observed in human serum samples from patients with low/moderate activity of ulcerative colitis or Crohn’s disease. Taken together, these data illustrate that MT1-MMP is an important regulator of inflammatory-induced angiogenic response in endothelial cells and that substrates processed by this protease, such as TSP1 and NID1 might be used as a biomarkers for the diagnosis or prognosis of chronic inflammatory disorders. 7 SUMMARY 8 SUMMARY - RESUMEN - Entender los mecanismos moleculares que regulan la angiogénesis es un aspecto esencial en la patología de numerosas enfermedades. La metaloproteasa de matriz extracelular de membrana tipo 1 (MT1-MMP) es una potente enzima pericelular expresada por las células vasculares. Este trabajo ha explorado la contribución de MT1-MMP en la angiogénesis, formación de nuevos vasos a partir de vasculatura pre-existente, en el contexto inflamatorio. Para ello, se ha aplicado la técnica de proteómica cuantitativa denominada SILAC en células endoteliales derivadas de ratones de genotipo silvestre o deficientes en MT1-MMP; estas células endoteliales se han activado con la citoquina inflamatoria TNFα con objeto de identificar el repertorio de sustratos de MT1-MMP e identificar candidatos que podrían afectar la respuesta angiogénica en inflamación. Hemos demostrado que TNFα activaba las células endoteliales e inducía la expresión de varios marcadores característicos de células endoteliales líder (tip). El tratamiento con TNFα también aumentaba la expresión de la proteasa MT1-MMP en las células endoteliales lo que correlacionaba con diferencias en el glicoproteoma del sobrenadante de cultivo de células endoteliales de genotipo silvestre versus deficientes en MT1-MMP. Las glicoproteínas identificadas como sustratos potenciales de MT1-MMP incluyen proteínas de la matriz extracelular, proteínas matricelulares y proteínas secretadas como TSP1, CYR61, NID1, SEM3C o SLIT2 así como citoquinas y factores de crecimiento como EGFR y CSF1. El análisis bioinformático de los datos proteómicos ha desvelado un programa proteolítico combinatorial, en el cual el procesamiento combinado de varios sustratos por MT1-MMP en vez del procesamiento de sustratos individuales es el que determina las decisiones biológicas de las células endoteliales activadas tales como quimiotaxis, motilidad y adhesión celular, y desarrollo vascular. Hemos confirmado que el procesamiento de TSP1, CYR61, NID1 y SEM3C está disminuido tanto en células como en ratones deficientes en MT1-MMP lo que correlaciona con una reducción de la respuesta angiogénica. Por último, hemos investigado la importancia de este programa proteolítico mediado por MT1-MMP en patologías que cursan con angiogénesis inflamatoria, en concreto en enfermedad inflamatoria intestinal. Utilizando un modelo de colitis experimental en ratón hemos observado que los niveles solubles en suero de los sustratos TSP1 y NID1 aumentan en correlación con la expresión de MT1-MMP a lo largo de la severidad de la colitis. Además, en muestras de suero procedentes de pacientes con colitis ulcerosa o enfermedad de Crohn con actividad baja/moderada también se observa un aumento en los niveles de TSP1 y NID1. En conclusión, nuestros datos demuestran la importancia de MT1-MMP como proteasa reguladora de la angiogénesis inflamatoria en células endoteliales e indican que sustratos procesados por MT1-MMP como TSP1 o NID1 pueden servir como biomarcadores para el diagnóstico o pronóstico de enfermedades inflamatorias crónicas. 9 SUMMARY 10 CONTENTS CONTENTS ACKNOWLEDGEMENTS - .................................................................. 5 SUMMARY - ...................................................................................... 7 RESUMEN - ....................................................................................... 9 NON-STANDARD ABBREVIATIONS AND ACRONYMS - ....................... 15 INTRODUCTION - ............................................................................ 15 - MORPHOGENESIS OF THE VASCULAR SYSTEM - .................................... 17 Principal cellular players in angiogenesis .................................................................... 17 Molecular regulation of angiogenesis .......................................................................... 19 Inflammation-driven angiogenesis .............................................................................. 20 - MMP FAMILY OF PROTEASES - ............................................................. 21 MMPs as multifunctional enzymes ............................................................................ 22 Role of MMPs in inflammation and angiogenesis ....................................................... 22 MMPs in human disease models ................................................................................ 23 Domain structure and classification ............................................................................ 24 MT1-MMP as a paradigm of membrane-tethered MMP ............................................. 26 Regulatory mechanisms controlling MT1-MMP expression ........................................ 26 MT1-MMP subcellular location ................................................................................. 27 Cleavage preferences and targets of MT1-MMP .......................................................... 29 MT1-MMP in physiology and pathology ...................................................................
Load more

Recommended publications
  • Genome-Wide Association Study of Increasing Suicidal Ideation During Antidepressant Treatment in the GENDEP Project
    The Pharmacogenomics Journal (2012) 12, 68–77 & 2012 Macmillan Publishers Limited. All rights reserved 1470-269X/12 www.nature.com/tpj ORIGINAL ARTICLE Genome-wide association study of increasing suicidal ideation during antidepressant treatment in the GENDEP project NPerroud1,2,3,RUher1, Suicidal thoughts during antidepressant treatment have been the focus of 1 2,3,4 several candidate gene association studies. The aim of the present genome- MYM Ng , M Guipponi , wide association study was to identify additional genetic variants involved in 5 6 JHauser, N Henigsberg , increasing suicidal ideation during escitalopram and nortriptyline treatment. WMaier7,OMors8, A total of 706 adult participants of European ancestry, treated for major M Gennarelli9, M Rietschel10, depression with escitalopram or nortriptyline over 12 weeks in the Genome- DSouery11, MZ Dernovsek12, Based Therapeutic Drugs for Depression (GENDEP) study were genotyped 13 14 with Illumina Human 610-Quad Beadchips (Illumina, San Diego, CA, USA). AS Stamp ,MLathrop , A total of 244 subjects experienced an increase in suicidal ideation AFarmer1, G Breen1,KJAitchison1, during follow-up. The genetic marker most significantly associated with CM Lewis1,IWCraig1 increasing suicidality (8.28 Â 10À7) was a single-nucleotide polymorphism and P McGuffin1 (SNP; rs11143230) located 30 kb downstream of a gene encoding guanine deaminase (GDA) on chromosome 9q21.13. Two suggestive drug-specific 1MRC Social, Genetic and Developmental Psychiatry associations within KCNIP4 (Kv channel-interacting protein 4; chromosome Centre, Institute of Psychiatry, King’s College 4p15.31) and near ELP3 (elongation protein 3 homolog; chromosome London, London, UK; 2Department of Psychiatry, 8p21.1) were found in subjects treated with escitalopram.
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • PARSANA-DISSERTATION-2020.Pdf
    DECIPHERING TRANSCRIPTIONAL PATTERNS OF GENE REGULATION: A COMPUTATIONAL APPROACH by Princy Parsana A dissertation submitted to The Johns Hopkins University in conformity with the requirements for the degree of Doctor of Philosophy Baltimore, Maryland July, 2020 © 2020 Princy Parsana All rights reserved Abstract With rapid advancements in sequencing technology, we now have the ability to sequence the entire human genome, and to quantify expression of tens of thousands of genes from hundreds of individuals. This provides an extraordinary opportunity to learn phenotype relevant genomic patterns that can improve our understanding of molecular and cellular processes underlying a trait. The high dimensional nature of genomic data presents a range of computational and statistical challenges. This dissertation presents a compilation of projects that were driven by the motivation to efficiently capture gene regulatory patterns in the human transcriptome, while addressing statistical and computational challenges that accompany this data. We attempt to address two major difficulties in this domain: a) artifacts and noise in transcriptomic data, andb) limited statistical power. First, we present our work on investigating the effect of artifactual variation in gene expression data and its impact on trans-eQTL discovery. Here we performed an in-depth analysis of diverse pre-recorded covariates and latent confounders to understand their contribution to heterogeneity in gene expression measurements. Next, we discovered 673 trans-eQTLs across 16 human tissues using v6 data from the Genotype Tissue Expression (GTEx) project. Finally, we characterized two trait-associated trans-eQTLs; one in Skeletal Muscle and another in Thyroid. Second, we present a principal component based residualization method to correct gene expression measurements prior to reconstruction of co-expression networks.
    [Show full text]
  • Identification of the Binding Partners for Hspb2 and Cryab Reveals
    Brigham Young University BYU ScholarsArchive Theses and Dissertations 2013-12-12 Identification of the Binding arP tners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non- Redundant Roles for Small Heat Shock Proteins Kelsey Murphey Langston Brigham Young University - Provo Follow this and additional works at: https://scholarsarchive.byu.edu/etd Part of the Microbiology Commons BYU ScholarsArchive Citation Langston, Kelsey Murphey, "Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non-Redundant Roles for Small Heat Shock Proteins" (2013). Theses and Dissertations. 3822. https://scholarsarchive.byu.edu/etd/3822 This Thesis is brought to you for free and open access by BYU ScholarsArchive. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of BYU ScholarsArchive. For more information, please contact [email protected], [email protected]. Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non-Redundant Roles for Small Heat Shock Proteins Kelsey Langston A thesis submitted to the faculty of Brigham Young University in partial fulfillment of the requirements for the degree of Master of Science Julianne H. Grose, Chair William R. McCleary Brian Poole Department of Microbiology and Molecular Biology Brigham Young University December 2013 Copyright © 2013 Kelsey Langston All Rights Reserved ABSTRACT Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactors and Non-Redundant Roles for Small Heat Shock Proteins Kelsey Langston Department of Microbiology and Molecular Biology, BYU Master of Science Small Heat Shock Proteins (sHSP) are molecular chaperones that play protective roles in cell survival and have been shown to possess chaperone activity.
    [Show full text]
  • Calumenin-15 Facilitates Filopodia Formation by Promoting TGF-Β Superfamily Cytokine GDF-15 Transcription
    Citation: Cell Death and Disease (2013) 4, e870; doi:10.1038/cddis.2013.403 OPEN & 2013 Macmillan Publishers Limited All rights reserved 2041-4889/13 www.nature.com/cddis Calumenin-15 facilitates filopodia formation by promoting TGF-b superfamily cytokine GDF-15 transcription H Feng1,3, L Chen1,3, Q Wang1,3, B Shen1, L Liu1, P Zheng1,SXu1, X Liu1, J Chen1,2 and J Teng*,1 Filopodia, which are actin-rich finger-like membrane protrusions, have an important role in cell migration and tumor metastasis. Here we identify 13 novel calumenin (Calu) isoforms (Calu 3–15) produced by alternative splicing, and find that Calu-15 promotes filopodia formation and cell migration. Calu-15 shuttles between the nucleus and cytoplasm through interacting with importin a, Ran GTPase, and Crm1. The phosphorylation of the threonine at position 73 (Thr-73) by casein kinase 2 (CK2) is essential for the nuclear import of Calu-15, and either Thr-73 mutation or inhibition of CK2 interrupts its nuclear localization. In the nucleus, Calu-15 increases the transcription of growth differentiation factor-15 (GDF-15), a member of the transforming growth factor-b (TGF-b) superfamily, via binding to its promoter region. Furthermore, Calu-15 induces filopodia formation mediated by GDF-15. Together, we identify that Calu-15, a novel isoform of Calu with phosphorylation-dependent nuclear localization, has a critical role in promoting filopodia formation and cell migration by upregulating the GDF-15 transcription. Cell Death and Disease (2013) 4, e870; doi:10.1038/cddis.2013.403; published
    [Show full text]
  • Datasheet: VMA00439 Product Details
    Datasheet: VMA00439 Description: MOUSE ANTI ACBD3 Specificity: ACBD3 Format: Purified Product Type: PrecisionAb™ Monoclonal Clone: 5F9 Isotype: IgG1 Quantity: 100 µl Product Details Applications This product has been reported to work in the following applications. This information is derived from testing within our laboratories, peer-reviewed publications or personal communications from the originators. Please refer to references indicated for further information. For general protocol recommendations, please visit www.bio-rad-antibodies.com/protocols. Yes No Not Determined Suggested Dilution Western Blotting 1/1000 PrecisionAb antibodies have been extensively validated for the western blot application. The antibody has been validated at the suggested dilution. Where this product has not been tested for use in a particular technique this does not necessarily exclude its use in such procedures. Further optimization may be required dependant on sample type. Target Species Human Species Cross Reacts with: Rat Reactivity N.B. Antibody reactivity and working conditions may vary between species. Product Form Purified IgG - liquid Preparation Mouse monoclonal antibody purified by affinity chromatography from ascites Buffer Solution Phosphate buffered saline Preservative 0.09% Sodium Azide (NaN3) Stabilisers 1% Bovine Serum Albumin 50% Glycerol Immunogen Full length recombinant human ACBD3 (NP_073572) produced in HEK293T cells External Database Links UniProt: Q9H3P7 Related reagents Entrez Gene: 64746 ACBD3 Related reagents Page 1 of 2 Synonyms GCP60, GOCAP1, GOLPH1 Specificity Mouse anti Human ACBD3 antibody recognizes ACBD3, also known as PBR- and PKA-associated protein 7, PKA (RIalpha)-associated protein, acyl-Coenzyme A binding domain containing 3, golgi complex associated protein 1 60kDa, golgi phosphoprotein 1 and peripheral benzodiazepine receptor-associated protein PAP7.
    [Show full text]
  • Cdipt Mouse Shrna Plasmid (Locus ID 52858) – TL502924 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TL502924 Cdipt Mouse shRNA Plasmid (Locus ID 52858) Product data: Product Type: shRNA Plasmids Product Name: Cdipt Mouse shRNA Plasmid (Locus ID 52858) Locus ID: 52858 Synonyms: 9530042F15Rik; D7Bwg0575e; Pis; Pis1 Vector: pGFP-C-shLenti (TR30023) Format: Lentiviral plasmids Components: Cdipt - Mouse, 4 unique 29mer shRNA constructs in lentiviral GFP vector(Gene ID = 52858). 5µg purified plasmid DNA per construct Non-effective 29-mer scrambled shRNA cassette in pGFP-C-shLenti Vector, TR30021, included for free. RefSeq: BC021473, BC024413, BC032182, NM_001347656, NM_026638, NM_138754, NM_026638.1, NM_026638.2, NM_026638.3, NM_026638.4 Summary: Catalyzes the biosynthesis of phosphatidylinositol (PtdIns) as well as PtdIns:inositol exchange reaction. May thus act to reduce an excessive cellular PtdIns content. The exchange activity is due to the reverse reaction of PtdIns synthase and is dependent on CMP, which is tightly bound to the enzyme (By similarity).[UniProtKB/Swiss-Prot Function] shRNA Design: These shRNA constructs were designed against multiple splice variants at this gene locus. To be certain that your variant of interest is targeted, please contact [email protected]. If you need a special design or shRNA sequence, please utilize our custom shRNA service. This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 Cdipt Mouse shRNA Plasmid (Locus ID 52858) – TL502924 Performance OriGene guarantees that the sequences in the shRNA expression cassettes are verified to Guaranteed: correspond to the target gene with 100% identity.
    [Show full text]
  • Supplementary Information Integrative Analyses of Splicing in the Aging Brain: Role in Susceptibility to Alzheimer’S Disease
    Supplementary Information Integrative analyses of splicing in the aging brain: role in susceptibility to Alzheimer’s Disease Contents 1. Supplementary Notes 1.1. Religious Orders Study and Memory and Aging Project 1.2. Mount Sinai Brain Bank Alzheimer’s Disease 1.3. CommonMind Consortium 1.4. Data Availability 2. Supplementary Tables 3. Supplementary Figures Note: Supplementary Tables are provided as separate Excel files. 1. Supplementary Notes 1.1. Religious Orders Study and Memory and Aging Project Gene expression data1. Gene expression data were generated using RNA- sequencing from Dorsolateral Prefrontal Cortex (DLPFC) of 540 individuals, at an average sequence depth of 90M reads. Detailed description of data generation and processing was previously described2 (Mostafavi, Gaiteri et al., under review). Samples were submitted to the Broad Institute’s Genomics Platform for transcriptome analysis following the dUTP protocol with Poly(A) selection developed by Levin and colleagues3. All samples were chosen to pass two initial quality filters: RNA integrity (RIN) score >5 and quantity threshold of 5 ug (and were selected from a larger set of 724 samples). Sequencing was performed on the Illumina HiSeq with 101bp paired-end reads and achieved coverage of 150M reads of the first 12 samples. These 12 samples will serve as a deep coverage reference and included 2 males and 2 females of nonimpaired, mild cognitive impaired, and Alzheimer's cases. The remaining samples were sequenced with target coverage of 50M reads; the mean coverage for the samples passing QC is 95 million reads (median 90 million reads). The libraries were constructed and pooled according to the RIN scores such that similar RIN scores would be pooled together.
    [Show full text]
  • Knock-Out of ACBD3 Leads to Dispersed Golgi Structure, but Unaffected Mitochondrial Functions in HEK293 and Hela Cells
    International Journal of Molecular Sciences Article Knock-Out of ACBD3 Leads to Dispersed Golgi Structure, but Unaffected Mitochondrial Functions in HEK293 and HeLa Cells Tereza Da ˇnhelovská 1 , Lucie Zdražilová 1 , Hana Štufková 1, Marie Vanišová 1, Nikol Volfová 1, Jana Kˇrížová 1 , OndˇrejKuda 2 , Jana Sládková 1 and Markéta Tesaˇrová 1,* 1 Department of Paediatrics and Inherited Metabolic Disorders, Charles University, First Faculty of Medicine and General University Hospital in Prague, 128 01 Prague, Czech Republic; [email protected] (T.D.); [email protected] (L.Z.); [email protected] (H.Š.); [email protected] (M.V.); [email protected] (N.V.); [email protected] (J.K.); [email protected] (J.S.) 2 Institute of Physiology, Academy of Sciences of the Czech Republic, 142 00 Prague, Czech Republic; [email protected] * Correspondence: [email protected] Abstract: The Acyl-CoA-binding domain-containing protein (ACBD3) plays multiple roles across the cell. Although generally associated with the Golgi apparatus, it operates also in mitochondria. In steroidogenic cells, ACBD3 is an important part of a multiprotein complex transporting cholesterol into mitochondria. Balance in mitochondrial cholesterol is essential for proper mitochondrial protein biosynthesis, among others. We generated ACBD3 knock-out (ACBD3-KO) HEK293 and HeLa cells and characterized the impact of protein absence on mitochondria, Golgi, and lipid profile. In ACBD3- Citation: Daˇnhelovská,T.; KO cells, cholesterol level and mitochondrial structure and functions are not altered, demonstrating Zdražilová, L.; Štufková, H.; that an alternative pathway of cholesterol transport into mitochondria exists. However, ACBD3- Vanišová, M.; Volfová, N.; Kˇrížová,J.; Kuda, O.; Sládková, J.; Tesaˇrová,M.
    [Show full text]
  • Coordinate Regulation of Long Non-Coding Rnas and Protein-Coding Genes in Germ- Free Mice Joseph Dempsey, Angela Zhang and Julia Yue Cui*
    Dempsey et al. BMC Genomics (2018) 19:834 https://doi.org/10.1186/s12864-018-5235-3 RESEARCHARTICLE Open Access Coordinate regulation of long non-coding RNAs and protein-coding genes in germ- free mice Joseph Dempsey, Angela Zhang and Julia Yue Cui* Abstract Background: Long non-coding RNAs (lncRNAs) are increasingly recognized as regulators of tissue-specific cellular functions and have been shown to regulate transcriptional and translational processes, acting as signals, decoys, guides, and scaffolds. It has been suggested that some lncRNAs act in cis to regulate the expression of neighboring protein-coding genes (PCGs) in a mechanism that fine-tunes gene expression. Gut microbiome is increasingly recognized as a regulator of development, inflammation, host metabolic processes, and xenobiotic metabolism. However, there is little known regarding whether the gut microbiome modulates lncRNA gene expression in various host metabolic organs. The goals of this study were to 1) characterize the tissue-specific expression of lncRNAs and 2) identify and annotate lncRNAs differentially regulated in the absence of gut microbiome. Results: Total RNA was isolated from various tissues (liver, duodenum, jejunum, ileum, colon, brown adipose tissue, white adipose tissue, and skeletal muscle) from adult male conventional and germ-free mice (n = 3 per group). RNA-Seq was conducted and reads were mapped to the mouse reference genome (mm10) using HISAT. Transcript abundance and differential expression was determined with Cufflinks using the reference databases NONCODE 2016 for lncRNAs and UCSC mm10 for PCGs. Although the constitutive expression of lncRNAs was ubiquitous within the enterohepatic (liver and intestine) and the peripheral metabolic tissues (fat and muscle) in conventional mice, differential expression of lncRNAs by lack of gut microbiota was highly tissue specific.
    [Show full text]
  • 1 Supporting Information for a Microrna Network Regulates
    Supporting Information for A microRNA Network Regulates Expression and Biosynthesis of CFTR and CFTR-ΔF508 Shyam Ramachandrana,b, Philip H. Karpc, Peng Jiangc, Lynda S. Ostedgaardc, Amy E. Walza, John T. Fishere, Shaf Keshavjeeh, Kim A. Lennoxi, Ashley M. Jacobii, Scott D. Rosei, Mark A. Behlkei, Michael J. Welshb,c,d,g, Yi Xingb,c,f, Paul B. McCray Jr.a,b,c Author Affiliations: Department of Pediatricsa, Interdisciplinary Program in Geneticsb, Departments of Internal Medicinec, Molecular Physiology and Biophysicsd, Anatomy and Cell Biologye, Biomedical Engineeringf, Howard Hughes Medical Instituteg, Carver College of Medicine, University of Iowa, Iowa City, IA-52242 Division of Thoracic Surgeryh, Toronto General Hospital, University Health Network, University of Toronto, Toronto, Canada-M5G 2C4 Integrated DNA Technologiesi, Coralville, IA-52241 To whom correspondence should be addressed: Email: [email protected] (M.J.W.); yi- [email protected] (Y.X.); Email: [email protected] (P.B.M.) This PDF file includes: Materials and Methods References Fig. S1. miR-138 regulates SIN3A in a dose-dependent and site-specific manner. Fig. S2. miR-138 regulates endogenous SIN3A protein expression. Fig. S3. miR-138 regulates endogenous CFTR protein expression in Calu-3 cells. Fig. S4. miR-138 regulates endogenous CFTR protein expression in primary human airway epithelia. Fig. S5. miR-138 regulates CFTR expression in HeLa cells. Fig. S6. miR-138 regulates CFTR expression in HEK293T cells. Fig. S7. HeLa cells exhibit CFTR channel activity. Fig. S8. miR-138 improves CFTR processing. Fig. S9. miR-138 improves CFTR-ΔF508 processing. Fig. S10. SIN3A inhibition yields partial rescue of Cl- transport in CF epithelia.
    [Show full text]
  • Growth and Molecular Profile of Lung Cancer Cells Expressing Ectopic LKB1: Down-Regulation of the Phosphatidylinositol 3؅-Phosphate Kinase/PTEN Pathway1
    [CANCER RESEARCH 63, 1382–1388, March 15, 2003] Growth and Molecular Profile of Lung Cancer Cells Expressing Ectopic LKB1: Down-Regulation of the Phosphatidylinositol 3؅-Phosphate Kinase/PTEN Pathway1 Ana I. Jimenez, Paloma Fernandez, Orlando Dominguez, Ana Dopazo, and Montserrat Sanchez-Cespedes2 Molecular Pathology Program [A. I. J., P. F., M. S-C.], Genomics Unit [O. D.], and Microarray Analysis Unit [A. D.], Spanish National Cancer Center, 28029 Madrid, Spain ABSTRACT the cell cycle in G1 (8, 9). However, the intrinsic mechanism by which LKB1 activity is regulated in cells and how it leads to the suppression Germ-line mutations in LKB1 gene cause the Peutz-Jeghers syndrome of cell growth is still unknown. It has been proposed that growth (PJS), a genetic disease with increased risk of malignancies. Recently, suppression by LKB1 is mediated through p21 in a p53-dependent LKB1-inactivating mutations have been identified in one-third of sporadic lung adenocarcinomas, indicating that LKB1 gene inactivation is critical in mechanism (7). In addition, it has been observed that LKB1 binds to tumors other than those of the PJS syndrome. However, the in vivo brahma-related gene 1 protein (BRG1) and this interaction is required substrates of LKB1 and its role in cancer development have not been for BRG1-induced growth arrest (10). Similar to what happens in the completely elucidated. Here we show that overexpression of wild-type PJS, Lkb1 heterozygous knockout mice show gastrointestinal hamar- LKB1 protein in A549 lung adenocarcinomas cells leads to cell-growth tomatous polyposis and frequent hepatocellular carcinomas (11, 12). suppression. To examine changes in gene expression profiles subsequent to Interestingly, the hamartomas, but not the malignant tumors, arising in exogenous wild-type LKB1 in A549 cells, we used cDNA microarrays.
    [Show full text]